Major Mouse Testing Program: Longevity

Tamanho: px
Começar a partir da página:

Download "Major Mouse Testing Program: Longevity"

Transcrição

1 Major Mouse Testing Program: Longévité Santé Longevity 10/03/2015 Mapeando efeitos a longo prazo na saúde: Teste em larga escala em camundongos idosos usando terapias promissoras contra o envelhecimento e doenças relacionadas 1

2 Dedicamos esta apresentação a L. Stephen Coles, M.D., Ph.D. (19/01/ /12/2014) pioneiro na área de gerontologia e na pesquisa do envelhecimento. Stephen Coles colocou em contato especialistas americanos em camundongos com o grupo de voluntários desse projeto para terem discussões técnicas e ver o que poderia ser feito. Por anos, Dr. Coles administrou a lista de Gerontology Research Group, que serviu como grande fonte de inspiração para esse projeto. 10/03/2015 Major Mouse Testing Program 2

3 Longevidade: A revolução Revolução ocorreu em nematoides ( C. elegans ) Descoberta revolucionária em 1980: 8 maneiras de aumentar a longevidade [1] 1993: Uma mutação dobra expectativa de vida e confere grande vitalidade [2] 2003: Milhares de testes realizados; ~10% aumenta a longevidade [3] 2008: Uma mutação aumentou a longevidade em quase 10 vezes! PASSADO Vermes e camundongos envelhecem de forma diferente Vermes têm um nº fixo de células: manter a viabilidade celular é a chave Camundongos são mamíferos e a regeneração tecidual é a chave A revolução da longevidade está ocorrendo em camundongos e é promissora para humanos A revolução está chegando em camundongos, mas poucos testes foram feitos Tratamentos conhecidos que aumentam a longevidade de camundongos tiveram efeitos benéficos em humanos (aspirina, metformina, metoprolol, rapamicina) Padrões genéticos de aumento de longevidade em camundongos foram encontrados em famílias humanas longevas (Larron-dwards, Foxo-3A, akt-1) Ajude-nos a realizar múltiplos testes em camundongos, para que possam ser aplicados para humanos futuramente PRESENTE 10/03/ Major Mouse Testing Program

4 Resumo do programa Duração 1ª série de experimentos em animais adultos com duração de 18 meses Na outra série será preciso construir novas linhagens, demorando 38 meses Resultados serão checados 3x para que possam ser testados em humanos. A maior parte dos resultados virá 5 anos após o início do programa. Pessoas envolvidas Contactamos diferentes pesquisadores e identificamos grupos de laboratórios com forte experiência em animais, teste de longevidade e em medicina regenerativa Orçamento Custo estimado para os 1000 diferentes testes é de 20M. Há uma correlação direta entre o financiamento, o nº de testes e o cronograma do projeto. D Benefícios esperados: Resultados esperados De 1000 testes esperamos 100 resultados positivos: -Nematoides:10% de testes positivos (muitos testes já feitos) - Em camundongos, ~10% (difícil de estimar: poucos testes feitos) 1. Mudar pensamento da sociedade em todos seus níveis 2. Resultados devem trazer uma visão global sobro que aumenta a longevidade 3. Esperamos atingir um robusto aumento da longevidade 4. Esperamos que alguns tratamentos sejam aplicáveis em humanos Aplicação em estudos de longevidade em humanos Iniciando o programa esse ano, esperamos resultados robustos em menos de 10 anos. 10/03/2015 Major Mouse Testing Program 4

5 O que testar: Intervenções por origem Resultados parciais Longevity DB: mais de 1000 intervenções Banco de dados lista genes humanos estatisticamente correlacionados com longevidade. Para muitos genes, a causalidade pode ser testada em camundongos: Lifespan Observation Database 3359 intervenções que aumenta longevidade: em roedores (114; alguns indefinidos, mas com resultados promissores), nematoides (2400), outras especies Confirmações futuras precisam ser feitas em camundongos: Outras ideias Grupo no Facebook: PotentialGerontodrugs Atualmente mais de 300 posts Cada post contém uma intervenção em potencial para ser testada em camundongos https://www.facebook.com/groups/gerontodrugs Outras fontes Outros bancos de dados parecidos foram encontrados. Fóruns e listas de s foram analisados. Circulamos também em conferências da área um trabalho para listarmos ideias.. O número total de intervenções é grande. Análises para determinar prioridades está em andamento 10/03/2015 Major Mouse Testing Program 5

6 O que testar: Intervenções por classe Variações genéticas em humanos Tratamentos com drogas já usadas em humanos Tratamentos já usados em humanos e que acabam favorecendo uma vida saudável. Conceito: Se camundongos viverem mais e melhor com certa droga, é um forte argumento para que esta esteja de forma causal melhorando a saúde de pessoas. Resultados de pesquisas Normalmente resultados in vitro e in vivo de camundongos, ratos, nematoides, ou mosca-da-fruta, precisam de confirmações de aumento robusto da longevidade e saúde para que possam ser extrapoladas para humanos Diversas terapias em camundongos Variações encontradas em populações humanas que acabam favorecendo uma vida saudável, podendo ser testadas através de terapia gênica em camundongos idosos. Conceito: Se camundongos viverem mais e melhor, é um forte argumento para que essa variação melhora a saúde humana de forma causal, e que futuramente terapia gênica pode ser efetiva também. Terapia gênica em camundongos Banco de dados 10/03/2015 Major Mouse Testing Program 6

7 Cronograma geral Fase I 1 ano Formação de times, financimento e investigação de técnicas Número de intervenções testadas depende do financiamento TESTES INICIANDO COM CAMUNDONGOS IDOSOS Fase II 2 meses Fase III 14 meses Fase IV 18 meses Fase V 18 meses Preparação de equipamentos Teste com 40 a 400 terapias Confirmação e otimização de resultados Início de protocolos em humanos TESTES INICIANDO COM NOVA LINHAGEM DE CAMUNDONGO 2 meses 38 meses 18 meses 18 meses Preparação de equipamentos Teste com 60 a 600 terapias Confirmação e otimização de resultados Início de protocolos em humanos O cronograma da Fase III está detalhado no próximo slide 2 m 100 terapias testadas 10 resultados positivos 20 m 1000 terapias testadas 100 resultados positivos A estimativa financeira encontra-se no slide 17. Contém também o número de testes previstos dependendo do financiamento obtido. 10/03/ Major Mouse Testing Program

8 preparação Fase III 6 meses 30 machos 30 fêmeas 18 meses 14 meses? Resultados positivos da Fase III levarão a Fase IV, que é parecida com a Fase IIIb : validação em roedores idosos de outros laboratórios + estudo dos diversos efeitos na saúde Nascimento Fase IIIa: Inicia-se criando linhagens novas. Maioria genética & muitas outras terapias. 18 meses de idade: Início do tratamento Fase IIIb: Teste Real! Drogas, genética, outros 32 meses de idade: Houve aumento da longevidade em relação ao grupo controle? Decisão para próximos passos 10/03/2015 Major Mouse Testing Program 8

9 Organização Geral Doadores Financiamento Resultados Grupo Longévité Santé, ILA Produtores de camundongos Camundongos Instalações/ Facilities 10/03/2015 Major Mouse Testing Program 9

10 Lista: Para-Fazer Escolher intervenções em potencial Em progresso Identificar fontes de financiamento Presente Refinar metodologia Em progresso Laboratórios necessários para realização do projeto e fazer acordos com estes Contactar investidores em potencial Fazer acordos gerais Calcular custos dos experimentos (equipamentos e mão-de-obra) Em progresso Negociações financeiras mais detalhadas Coletar o necessário para começo do programa Futuro 10/03/2015 Major Mouse Testing Program 10

11 Times e laboratórios Laboratórios: 1. Equipados com estrutura de altíssima qualidade para animais (gaiolas com filtros individuais com ventilação) e 2. Especializados em medicina regenerativa, e em áreas relacionadas com o envelhecimento Arlan Richardson 40 anos de experiência em testes de longo prazo com roedores (compostos e terapia gênica) Laboratory USA (Oklahoma) Alexandra Stolzing Medicina regenerativa & células-tronco Translational Centre for Regenerative Medicine Leipzig University (Leipzig) Jean-Marc Lemaitre Medicina regenerativa em camundongos e células humanas (células-tronco e terapia gênica) Inserm na França (Montpellier) 10/03/2015 Major Mouse Testing Program 11

12 Time de voluntários Agradecimento especial ao time de voluntários: Time principal: Edouard Debonneuil, Rached Messaoudi, Valentin Socolov, Martin Dinov, Daniel Krochmal, Maciej Michalak, Nicoleta Reinald Assistência de: Steve Coles (finado), Johnny Adams, Daria Khaltourina, Matthew Scholz, Didier Coeurnelle, Anton Kulaga, Paul Spiegel, Liz Parrish, Alexandru Chircu, Alexandre Blanc, Dmitri Borisoglebsky, Victor Björk, e tantos outros pesquisadores e voluntários da internet. Longévité & Santé: Encontros semanais para organizar o projeto em La Paillasse, Paris. contribuidores de diferentes países em diferentes ocasiões 10/03/2015 Major Mouse Testing Program 12

13 Obrigado por sua atenção! Versões atualizadas dessa apresentação: Caso queira ajudar, Doações via paypal em De outras maneiras através do IBAN: FR Contato para propor ajuda em pontos específicos O que precisamos mais especificamente: Se você tiver experiência em testes de longevidade em camundongos, ou terapia gênica in vivo, ou incorporação de drogas na comida, ou se pude ajudar nos desenhos experimentais do projeto. Se você souber fontes de financiamento em potencial que possam ajudar, ou se você estiver interessando em escrever projetos de financiamento por favor, não hesite em nos contactar Apresentação do projeto em conferências ou tradução dos slides para outras línguas. Contatos para organizações registradas em seu país, sem fins-lucrativos, pró-longevidade com vantagens fiscais para seus doadores, que possam querer financiar o projeto. P.S: Estamos cientes que alguns links e s desse slide não essão homogêneos. Estamos melhorando isso para as futuras versões. Para esclarecimentos, SLS é Sceaux Longévité Santé, e ALA é o American Longevity Alliance, afiliações sem fins-lucrativos da International Longevity Alliance localizada na França e nos EUA, respectivamente. 3/10/2015 Major Mouse Testing Program 13

14 Apêndice Recapitulação em 3 slides Lista de terapias para testar em camundongos Técnicas de terapia gênica Outros 10/03/2015 Major Mouse Testing Program 14

15 Hoje existem menos de 10 estudos de longevidade em camundongos por ano. Objetivo: 1000 testes em menos de 5 anos Em nematoides, 10% dos milhares de testes foram positivos Em camundongos, também 10% [5/67 por Spindler. S e 5/15 por ITP, 1-2 em comum]: Programa de intervenções, EUA: - NDGA (machos, +10%) - Rapamicina (machos, & fêmeas, %) - Acarbose (machos, +22%) - Aspirina (machos, +10%) - α-estradiol (machos, +10%) Aspirina: baixa mortalidade em humanos (80 mg/dia, 5 anos) Everolimo : em teste em idosos(resistência de vacina contra gripe) Metformina: diminui a mortalidade em humanos Outros resultados estão sendo checados em roedores (Fulereno) 10/03/2015 Major Mouse Testing Program 15

16 Resultados esperados Descobertas em camundongos têm grande potencial para avançar saúde humana a longo prazo 1 Alterar a forma que a sociedade pensa A biologia aplicada está emergindo em relação as inúmeras terapias que previnem ou revertem/silenciam o envelhecimento. Podemos então, aumentar a longevidade do camundongo de forma robusta? Quebra de paradigma na ciência da longevidade Guiar pesquisas para o que realmente aumenta a longevidade. Destacar mecanismos envolvidos. Em conjunto com estatísticas em humanos, esperamos que os resultados possam ser aplicáveis em até 5 anos Grande aumento da longevidade Dos muitos resultados, esperamos que alguns aumentem a longevidade de forma drástica Nova área farmacêutica: saúde a longo prazo Aplicação de drogas já existentes para o envelhecimento e doenças relacionadas 10/03/2015 Major Mouse Testing Program 16

17 Financiamento e Orçamento Nota: Custos estão sendo recalculados. De qualquer maneira, o número de testes será ditado pela quantidade de financiamento Fase III Consideremos que 400 terapias serão testadas em camundongos idosos e 600 terapias exijam novas linhagens; sendo que cada terapia precisa de 60 animais (30 machos e 30 fêmeas) e cada um dos dois sistemas (animais envelhecimentos/linhagens novas) precisam de um controle de 1000 camundongos (desenho assimétrico; 50% macho-fêmea). Consideremos que o manuseamento custa ~1.5 por animal/semana (dependendo das condições) e que cada animal viva em média 27 meses. Um cálculo rápido indica que o custo total do manuseamento é de 1.5*(27*(600* )+9*(400* ))*(30.5/7) = 8 M Consideremos que cada animal idoso custa 100 e que cada animal transgênico custa 30 para ser gerado. O custo inicial do camundongo é de (600* )*100+(400* )*30 = 4.5 M Custo total para a Fase III é de 12.5 M Fase IV Consideremos que 10% das terapias testadas na Fase III sigam para a Fase IV, e que em média, cada terapia na Fase IV custará 6 vezes o custo da Fase III (esse aumento de longevidade precisa ser confirmado e refinado). O custo total da Fase IV é de 12.5*10%*6 = 7.5 M Total O custo total das 1000 terapias seria então = 20 M, com os cáculos acima. As principais fontes de gastos foram detalhados acima. 10/03/2015 Major Mouse Testing Program 17

18 Terapias para testar em camundongos Exemplos de terapias extraídas do grupo do Facebook A L T A P R I O R I D A D E M É D I A Controles de aumento da longevidade: aspirina, metformina, rapamicina, estatinas Snell, Ames, mutações de IGF-1 em idade avançada TA-65, ativador de telomerase, e variante humana de telomerase TM5441(Aumenta 4x a longevidade em camundongos; reduz níveis de PAI, marcador de senescência) Centrofenoxino/Meclofenoxato: reduz níveis de lipofuscina e aumenta longevidade de ratos Farmacoperonas (inverte a mutação em GNRHR) Suplementação de Neuraminidase 1 (reduz parcialmente a doença de Alzheimer) Injeções de GDF11 (reduz parcialmente envelhecimento no coração e cérebro de camundongos) D-Glucosamina (mimético da restrição calórica, aumenta longevidade de camundongos idosos) Dimetilaminoetanol (aumenta longevidade; falta testar doses mais baixas) Trealose (induz autofagia; altera via de IGF-1; elimina proteínas neurodegenerativas) Destruição de 7-cetoColesterol com LysoSENS s (Em breve pronta pra testes) Estabilização genética da estrutura da transtiretina... [MUITAS OUTRAS] Bifosfonatos (usados contra osteoporose, mas parece reduzir a longevidade por outras vias) Suplementação de fulereno em ratos (90% de aumento da longevidade) Tafamidis (tratamento de doença familiar de transtiretina) Suplementação de NAD+... [MUITAS OUTRAS] 3/10/2015 Major Mouse Testing Program 18

19 Outras intervenções promissoras 1. Variações genéticas humanas terapia gênica em camundongos. Variações encontradas em populações humanas que acabam favorecendo uma vida saudável, e que podem ser testadas através de terapia gênica em camundongos idosos. Conceito: Se camundongos viverem mais e melhor, é um forte argumento que essa variação melhore a saúde humana de forma causal, e que a terapia gênica possa ser efetiva também. 2. Tratamento com drogas já usadas em humanas tratamento de drogas em camundongos. Tratamentos usados em humanos e que acabam favorecendo uma vida saudável. Conceito: Se camundongos viverem mais e melhor com certa droga, é um forte argumento para que esta melhore de forma causal a saúde de pessoas. 3. Resultados de pesquisas diversas terapias em camundongos. Normalmente resultados in vitro e in vivo de camundongos, ratos, nematoides ou moscas-da-fruta, precisam de confirmações de aumento robusto da longevidade e saúde para que possam ser extrapoladas para humanos 10/03/2015 Major Mouse Testing Program 19

20 Exemplo: transpor rs rs é uma variação genética humana codifica para a proteína tubulina beta4b. A variante corresponde em ter um T no lugar de um C em algum ponto. Foi encontrado no estudo Framingham Heart Study. Cidadões americanos com duas cópias desta variante tiveram menor risco de doenças cardiovasculares, de câncer e de morte prematura de maneira bastante significativa (p_value = 6e-53) Referência: https://www.ncbi.nlm.nih.gov/pmc/articles/pmc / Camundongos têm o mesmo gene! ("ortólogo") indicando que tem a mesma função. Naturalmente, eles tem um "C", e não um "T". Por isso, queremos dá-los essa mesma variante: parte do gene do camundongo é: "GCCGCATGTCTATGAAGGAGGTGGACGAACAGATGCTTAATGTCCAAAACA«, e o objetivo é transformá-lo em "GCCGCATGTCTATGAAGGAGGTGGATGAACAGATGCTTAATGTCCAAAACA" usando técnicas de CRISPR. Se isso aumentar sua longevidade (melhorar a saúde, etc) é uma confirmação de que funciona em humanos Objetivo é testar rs e também muitos outros candidatos (temos mais de 1400 candidatos!). O que vier de estudos em humanos e for confirmado em camundongos tem grandes chances de funcionar em nós - Depois de 5 anos algumas pessoas (primeiramente talvez pacientes e idosos) começarão a fazer a terapia gênica e serem monitorados quanto sua saúde. - Potencialmente em 10 anos será frequente usar terapia gênica para esses genes para melhora da saúde. 10/03/2015 Major Mouse Testing Program 20

21 Terapia Gênica em animais idosos: técnicas 1. Linhagens sensíveis a drogas Por que usar linhagens específicas e não tratar linhagenes normais? Especialistas nos disseram que técnicas existentes de terapia gênica afetam uma minoria do corpo: mesmo se o gene da longevidade for introduzido, é incerto se terá efeito pronunciado; usando essas técnicas, há o risco de desgastar o programa Eles sugeriram gerar linhagens sensíveis a drogas (http://www.clontech.com/us/products/inducible_systems/protein) Técnica Passo 1 (6 meses): para cada variante genético a ser testado, uma linhagem será contruída; embriões incorporaram a variação com um promotor ativado por drogas usando a técnica de CRISPR e é implantado em fêmeas. A progenia que tiver a mutação é testada; se estiver OK é cruzada para gerar 30 machos e 30 fêmeas para análise da sobrevida. Passo 2 (18 meses): animais são mantidos e alimentados normalmente. Devem se comportar que nem o controle porque a variação não está expressa. Passo 3 (14 meses): Após 18 meses, são alimentados com a droga que ativa o gene. Curva de sobrevivência é comparada com o controle. P.S: Não abandonamos o tratamento de animais idosos normais: 30 machos 30 fêmeas a) Após esses 38 meses, fase IV: para os casos (10%?) com aumento estatístico da longevidade, a variação é testada em animais idosos usando técnicas diferentes (próximos slides) b) Em paralelo nesses 38 meses, técnicas de terapia gênica (próximos slides) já são testadas para genes estabelecidos de longevidade, sendo uma forma de treinar para a) 3/10/2015 Major Mouse Testing Program 21?

22 Terapia Gênica em animais idosos: técnicas 2. Terapia gênica com 18 meses: Alteração genética mediada por vírus Contexto Muitas técnicas podem alterar genes in vivo. Especialistas sugerem que usemos o Adeno- Associated Virus (AAV). Esses vírus incorporam parte de seu DNA no DNA do hospedeiro infectado. Nas últimas décadas, alguns desses foram selecionados para uso científico para serem aplicados em diferentes órgãos: AAV1,AAV2..AAV9. Ex: usaremos como padrão AAV9, por ter tropismo para tecido neural. Técnica Passo 1 (2 meses): Para cada variação genética a ser testada, o AAV incorpora o gene com a técnica de CRISPR sendo injetado em: 1.animais jovens para testar se espalha-se e 2. em 30 machos e fêmeas de 18 meses Passo 2 (14 meses): Sobrevida dos camundongos envelhecidos é comparada com o grupo controle. Limitantes Baixa eficiência: Uma pequena fração de células recebe AAVs e uma menor ainda tem o constructo no núcleo: a chance de agir de forma suficiente para aumentar a longevidade é baixa. Ainda assim, terapia gênica de telomerase já foi descrita com esse método. Aplicação terapêutica: Frequentemente, adultos são infectados por AAVs durante suas vidas. Para esses, a terapia poderia resultar em uma resposta imune que tornaria a terapia pouco eficaz. Pessoas saudáveis podem hesitar em usar essas terapias. (*) Bernardes de Jesus B. et al. (2002) 30 machos 30 fêmeas /10/2015 Major Mouse Testing Program 22 teste? AAV

23 Terapia Gênica em animais idosos: técnicas 3. Expressão transiente após 18 meses: Minicírculos contendo vetor lipossomal Contexto Minicírculos são círculos de DNA. Em camundongos, eles não afetam necessariamente um nº de células maior que AAVs, mas eles não geram respostas imunes tornando-se uma abordagem translacional mais eficaz. Um problema é que em células em divisão o efeito é transiente, necessitando do uso de constantes tratamentos. Técnica Passo 1 (2 meses): Para cada variação a ser testada minicirculos contendo o gene são produzidos em quantitade suficiente usando bactéria modificadas (um plasmidio é criado em E. coli, suas partes procarioticas são removidas = minicírculo: sem resposta imune); são então incorporados em vetores lipossomais (que tem minicírculos) e injectados em animais jovens para testar sua distribuição. Passo 2 (14 meses): Os minicírculos são injetados em 30 machos e 30 fêmeas, a cada duas semanas, iniciando aos 18 meses de idades. A sobrevida é comparada com a do grupo controle Nota Evoluções: A área está mudando rapidamente. Esses slides são, portanto, indicativos: nós podemos escolher melhores técnicas quando/se essas aparecerem e se tornarem robustas (microcírculos, elementos S/MAR ). teste E. coli 30 machos 30 fêmeas? /10/2015 Major Mouse Testing Program 23

24 Terapia Gênica em animais idosos: técnicas 4. Outros Uma questão de tecido-específico Para a maioria das variações genéticas que queremos testas, não sabemos à priori se afetar algum tecido em específico faria sentido. Ex: uma mutação familiar pode estar associada com aumento longevidade em diferentes população sem saber se esses efeitos são através de certos tecidos. Por isso, os slides anteriores eram sobre técnicas gerais: Ex: que são expressas em todo o corpo. Nesses casos, a não ser que já tenha sido demonstrado que o gene aumenta a longevidade, iniciaremos com a técnica longa #1: gerar a linhagem e esperar por sua longevidade. Para casos específicos que certo órgão deve ser afetado, a terapia gênica pode ser bem mais eficiente. Esse é o caso para célular do sangue e do fígado Uma área que cresce rápido Como dito no último slide, técnicas de terapia gênica estão melhorando Pode acontecer que após 6 meses do início dos experimentos, alguma técnica melhor apareça. Mas, seria muito pior esperar décadas para iniciar os experimentos. Pode acontecer também que a técnica #1 seja uma maneira artifical para modelar uma futura terapia gênica que estará disponível para idosos daqui cinco ou dez anos. Nessa perspectiva, essa técnica seria muito melhor que outras (AAVs, minicírculos, ou outras terapias pouco efetivas) 3/10/2015 Major Mouse Testing Program 24

25 Referências As seguintes referências correspondem ao slide nº3 A revolução da longevidade em C elegans [1] Klass MR (1983). "A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results". MECHANISMS OF AGEING AND DEVELOPMENT 22 (3-4): PMID [2] Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R (1993). "A C. elegans mutant that lives twice as long as wild type". Nature (journal) 366 (6454): PMID [3] Lee SS, Lee RY, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003). A systematic RNAi screen identifies a critical role for mitochondria in C. elegans longevity. NAT GENET. PMID [4] Ayyadevara S, Alla R, Thaden JJ, Shmookler Reis RJ (2008). "Remarkable longevity and stress resistance of nematode PI3K-null mutants". AGING CELL 7 (1): PMID A futura revolução da longevidade em camundongos Bartke A, Brown- Borg H (2004). Life extension in the dwarf mouse. CURR TOP DEV BIOL. 63: PMID Harrison, D. E., Strong, R., Sharp, Z. D., Nelson, J. F., Astle, C. M., Flurkey, K., Nadon, N. L., Wilkinson, J. E., Frenkel, K., Carter, C. S., Pahor, M., Javors, M. A., Fernandez, E. and Miller, R. A. (2009) Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. NATURE 460: PMID Spindler SR, Mote PL, Li R, Dhahbi JM, Yamakawa A, Flegal JM, Jeske DR, Li R, Lublin AL (2013). β1-adrenergic receptor blockade extends the life span of Drosophila and long-lived mice. AGE. PMID Martin-Montalvo A, Mercken EM, Mitchell SJ, Palacios HH, Mote PL, Scheibye-Knudsen M, Gomes AP, Ward TM, Minor RK, Blouin MJ, Schwab M, Pollak M, Zhang Y, Yu Y, Becker KG, Bohr VA, Ingram DK, Sinclair DA, Wolf NS, Spindler SR, Bernier M, de Cabo R (2013). Metformin improves healthspan and lifespan in mice. NAT COMMUN. 4:2192. PMID /03/2015 Major Mouse Testing Program 25

Aula - Terapia Gênica. Unidade Curricular: Cultura de Células Animais. Prof. Me. Leandro Parussolo

Aula - Terapia Gênica. Unidade Curricular: Cultura de Células Animais. Prof. Me. Leandro Parussolo Aula - Terapia Gênica Unidade Curricular: Cultura de Células Animais Prof. Me. Leandro Parussolo O que é? O que não é? O que será? 1990 (EUA) - Primeiro protocolo clínico de Terapia Gênica em humanos 2

Leia mais

TERAPIA GÊNICA. Brasília DF, Julho de 2010.

TERAPIA GÊNICA. Brasília DF, Julho de 2010. Apresentação desenvolvida pelas graduandas em Ciências Farmacêuticas: Ana Carolina Macedo Lima, Ariane Mugnano Castelo Branco, Caroline Cardoso Mendes Souza, Clarisse Danielli Silva Albergaria, Jéssica

Leia mais

Governador Geraldo Alckmin entrega o maior laboratório destinado a pesquisas sobre o câncer da América Latina

Governador Geraldo Alckmin entrega o maior laboratório destinado a pesquisas sobre o câncer da América Latina MATEC ENGENHARIA ENTREGA O MAIOR LABORATORIO PARA PESQUISA DE CÂNCER DA AMÉRICA LATINA Qui, 14/04/11-11h00 SP ganha maior laboratório para pesquisa de câncer da América Latina Instituto do Câncer também

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais colocam o País na vanguarda da medicina mundial

Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais colocam o País na vanguarda da medicina mundial ISTOÉ - Independente Imprimir Especial BRASIL POTÊNCIA Edição: 2095 30.Dez.09-15:00 Atualizado em 06.Fev.13-12:48 Na Dianteira Do Conhecimento Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

A genética do vírus da gripe

A genética do vírus da gripe A genética do vírus da gripe Para uma melhor compreensão das futuras pandemias é necessário entender sobre as pandemias passadas e os fatores que contribuem para a virulência, bem como estabelecer um compromisso

Leia mais

Estratégias de redução do uso de animais em estudos pré-clínicos. Carlos Kiffer Larissa Fontes Generoso

Estratégias de redução do uso de animais em estudos pré-clínicos. Carlos Kiffer Larissa Fontes Generoso Estratégias de redução do uso de animais em estudos pré-clínicos Carlos Kiffer Larissa Fontes Generoso Introdução Desenvolvimento de produtos farmacêuticos e biotecnológicos: SEGURO EFICAZ Desenvolvimento

Leia mais

PARA VOCÊ, QUAIS SÃO AS PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS? PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS

PARA VOCÊ, QUAIS SÃO AS PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS? PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS PERSPECTIVAS FUTURAS PARA O TRATAMENTO DE DOENÇAS/DEFICIÊNCIAS E O ESPAÇO DA ATIVIDADE FÍSICA PARA VOCÊ, QUAIS SÃO AS PERSPECTIVAS Amar é descobrir que a deficiência do próximo faz parte do perfeito mosaico

Leia mais

Capítulo II Capítulo II

Capítulo II Capítulo II A doença de Alzheimer, a doença de Parkinson e as doenças de expansão de poliglutaminas são doenças neurodegenerativas que se prevê virem a ser a quarta principal causa de custos de saúde em 2030 (World

Leia mais

Homeopatia. Copyrights - Movimento Nacional de Valorização e Divulgação da Homeopatia mnvdh@terra.com.br 2

Homeopatia. Copyrights - Movimento Nacional de Valorização e Divulgação da Homeopatia mnvdh@terra.com.br 2 Homeopatia A Homeopatia é um sistema terapêutico baseado no princípio dos semelhantes (princípio parecido com o das vacinas) que cuida e trata de vários tipos de organismos (homem, animais e plantas) usando

Leia mais

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos.

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos. Questão 1 Você é um imunologista que quer ficar rico e decide deixar o mundo da ciência, conseguindo um emprego como consultor de roteiro em um novo seriado de drama médico. Você avalia o conhecimento

Leia mais

Possibilidades Clínicas Atuais para Terapia Gênica e de Células Tronco no Tratamento da Fibrose Cística e Outras Doenças Genéticas

Possibilidades Clínicas Atuais para Terapia Gênica e de Células Tronco no Tratamento da Fibrose Cística e Outras Doenças Genéticas Possibilidades Clínicas Atuais para Terapia Gênica e de Células Tronco no Tratamento da Fibrose Cística e Outras Doenças Genéticas Preparado Por Dace Shugg Professor Bob Williamson AO, FRS Professor de

Leia mais

A FORMAÇÃO PROFISSIONAL NA ÁREA DE ECONOMIA E O ENVELHECIMENTO POPULACIONAL BRASILEIRO. Eduardo L.G. Rios-Neto Demógrafo e Economista CEDEPLAR/UFMG

A FORMAÇÃO PROFISSIONAL NA ÁREA DE ECONOMIA E O ENVELHECIMENTO POPULACIONAL BRASILEIRO. Eduardo L.G. Rios-Neto Demógrafo e Economista CEDEPLAR/UFMG A FORMAÇÃO PROFISSIONAL NA ÁREA DE ECONOMIA E O ENVELHECIMENTO POPULACIONAL BRASILEIRO Eduardo L.G. Rios-Neto Demógrafo e Economista /UFMG ENVELHECIMENTO E CURSOS DE ECONOMIA O grande problema de discutir

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

CLASSIFICAÇÃO GENÉTICA. Reprodução, Acasalamento, Manutenção e Algumas considerações...

CLASSIFICAÇÃO GENÉTICA. Reprodução, Acasalamento, Manutenção e Algumas considerações... CLASSIFICAÇÃO GENÉTICA Reprodução, Acasalamento, Manutenção e Algumas considerações... Classificação Genética Heterogênicos = outbred Isogênicos = Inbred Acasalamento Aleatório Não-Consangüíneos Acasalamento

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário

Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário Ajudando futuros pais a tomar uma decisão consciente Agência Nacional de Vigilância Sanitária Anvisa O que é sangue de cordão umbilical

Leia mais

Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança

Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança Florianópolis, Agosto 2004 Células-tronco O que são células-tronco e o que podemos fazer com elas? Qual a relação

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

Aplicações da biotecnologia na área animal

Aplicações da biotecnologia na área animal Aplicações da biotecnologia na área animal As aplicações da biotecnologia moderna na área animal são múltiplas e têm um mercado potencial de bilhões de dólares por ano. A competição por tal mercado exige

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Manipulando genes em busca de cura: o futuro da terapia gênica CARLOS FREDERICO MARTINS MENCK ARMANDO MORAIS VENTURA

Manipulando genes em busca de cura: o futuro da terapia gênica CARLOS FREDERICO MARTINS MENCK ARMANDO MORAIS VENTURA Os autores agradecem à Fapesp, ao CNPq e à Capes pelo apoio a seus trabalhos de pesquisa. CARLOS FREDERICO MARTINS MENCK ARMANDO MORAIS VENTURA Manipulando genes em busca de cura: o futuro da terapia gênica

Leia mais

Questão de Vida ou Morte?

Questão de Vida ou Morte? Célula-Tronco: Questão de Vida ou Morte? III Seminário A Filosofia das Origens Fábio Juliano Pacheco, Ph.D. Laboratório de Biologia Celular, Molecular e Auto-Imunidade Centro Universitário Adventista de

Leia mais

Instituto de Biologia Molecular e Celular Instituto de Engenharia Biomédica

Instituto de Biologia Molecular e Celular Instituto de Engenharia Biomédica Instituto de Biologia Molecular e Celular Instituto de Engenharia Biomédica IBMC INEB> O que é? O IBMC INEB é um Laboratório Associado, ou seja, um centro de investigação científica multidisciplinar que

Leia mais

Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa. Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa

Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa. Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa Protocolo nº: (uso da CEUA) Data de Entrega / / (uso da CEUA) Título do Projeto Pesquisador-chefe Departamento Unidade Acadêmica - - - - -

Leia mais

Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia

Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia Fórum INCA-ASCO sobre Câncer Hereditário Predisposição Genética ao Câncer 21 e 22 de novembro de 2011 Hotel Novo Mundo Flamengo Rio de Janeiro Brasil Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia

Leia mais

Um novo tipo de câncer

Um novo tipo de câncer Um novo tipo de câncer Cirurgias menos invasivas e tratamentos personalizados são algumas das apostas da ciência para o câncer de cabeça e pescoço. Em visita ao Brasil, médico especialista na área apresenta

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

O Mito dos Antioxidantes

O Mito dos Antioxidantes A VIDA DE DAVID GEMS VIROU DE CABEÇA PARA BAIXO EM 2006 DEVIDO A UM GRUPO DE vermes que continuou vivendo quando deveria morrer. Corno diretor assistente do Institute of Healthy Aging da University College

Leia mais

Geneticista Mayana Zatz defende mais ousadia nos estudos com células-tronco e revela avanços da área

Geneticista Mayana Zatz defende mais ousadia nos estudos com células-tronco e revela avanços da área Publicada em 23/05/2010 às 07h53m 'O futuro é brilhante' Geneticista Mayana Zatz defende mais ousadia nos estudos com células-tronco e revela avanços da área SÃO PAULO - A notícia de que cientistas do

Leia mais

Idade, ela pesa 07/07/ 2015. Minhavida.com.br

Idade, ela pesa 07/07/ 2015. Minhavida.com.br Todo mundo quer viver muitos anos, não é mesmo? Mas você já se questionou se está somando mais pontos contra do que a favor na busca pela longevidade? Por isso mesmo, um estudo da Universidade da Califórnia,

Leia mais

Biotecnologia e medicina. Denise Machado

Biotecnologia e medicina. Denise Machado Biotecnologia e medicina Denise Machado Biotecnologia 325 milhões de pessoas no mundo fazem uso de 130 drogas ou vacinas produzidas pelas técnicas da biotecnologia. 70% de tais drogas ou vacinas foram

Leia mais

Mentiras por Omissão: O Relatório Completo

Mentiras por Omissão: O Relatório Completo CurasdoCancer.com apresenta Mentiras por Omissão: O Relatório Completo Obrigado por fazer o download do Relatório Completo em PDF. No nosso slideshow tivemos que condensar e compressar a informação para

Leia mais

Seu pé direito nas melhores Faculdades PUC 29/11/2009

Seu pé direito nas melhores Faculdades PUC 29/11/2009 Seu pé direito nas melhores Faculdades PUC 29//2009 5 Biologia 26. Malária (I), febre amarela (II), mal de Chagas (III) e síndrome da imunodeficiência adquirida (IV) são algumas das doenças que ocorrem

Leia mais

A transgenia não é a única estratégia para a transformação genética de plantas

A transgenia não é a única estratégia para a transformação genética de plantas A transgenia não é a única estratégia para a transformação genética de plantas MARIA HELENA BODANESE ZANETTINI - DEPARTAMENTO DE GENÉTICA, INSTITUTO DE BIOCIÊNCIAS, UFRGS maria.zanettini@ufrgs.br A base

Leia mais

34 CIÊNCIA HOJE vol. 29 nº 171

34 CIÊNCIA HOJE vol. 29 nº 171 É sabido que o DNA contém as informações necessárias para o funcionamento dos organismos. Esse manual de instruções, porém, precisa ser interpretado pelas células, através de um mecanismo que envolve diversas

Leia mais

1ª Conferência Internacional Sobre Células-Tronco & Genética da A4M Brasil "Curso Prático Intensivo"

1ª Conferência Internacional Sobre Células-Tronco & Genética da A4M Brasil Curso Prático Intensivo Confira abaixo a programação completa do evento. 1ª Conferência Internacional Sobre Células-Tronco & Genética da A4M Brasil "Curso Prático Intensivo" 09 de Abril de 2010 08:30 às 09:00 Prof. Dr. Paul Ling

Leia mais

Gabarito Caderno de atividades Biologia - Diversidade da Vida Volume 1-2013

Gabarito Caderno de atividades Biologia - Diversidade da Vida Volume 1-2013 Gabarito Caderno de atividades Biologia - Diversidade da Vida Volume 1-2013 1. A origem da vida na Terra 1) A 2) B 3) E 4) E 5) C 6) C 7) C 8) C 9) D 10) C 11) A 12) C 13) C 14) B 15) D 2. A evolução biológica

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 37 BIOTECNOLOGIA

BIOLOGIA - 2 o ANO MÓDULO 37 BIOTECNOLOGIA BIOLOGIA - 2 o ANO MÓDULO 37 BIOTECNOLOGIA Bactéria Plasmídeo Enzima de restrição corta o plasmídeo DNA Célula humana Gene para insulina Gene para insulina combinado ao DNA da bactéria com a DNA-ligase

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária.

Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária. Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária. Todos os animais, domésticos, selvagens e de laboratório são beneficiados por substâncias testadas em animais. Graças

Leia mais

VÍRUS. Fonte: http://rounielo.blogspot.com.br/2011/05/parte-30-foto-em-3-d-do-virus-da-aids.html

VÍRUS. Fonte: http://rounielo.blogspot.com.br/2011/05/parte-30-foto-em-3-d-do-virus-da-aids.html VÍRUS Fonte: http://rounielo.blogspot.com.br/2011/05/parte-30-foto-em-3-d-do-virus-da-aids.html RESUMO -Os vírus não pertencem a nenhum reino específico, são estudados como um caso à parte. -Os vírus são

Leia mais

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS ! Universidade Federal de Pernambuco Centro de Ciências da Saúde Departamento de Patologia Laboratório de Imunopatologia Keizo Asami Prof. Dr. Lucas Brandão BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

Leia mais

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa Pesquisa A pesquisa no INCA compreende atividades de produção do conhecimento científico, melhoria dos procedimentos diagnósticos e terapêuticos do câncer e formação de recursos humanos em pesquisa oncológica.

Leia mais

EPIGENÉTICA E NUTRIÇÃO MATERNA. Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas

EPIGENÉTICA E NUTRIÇÃO MATERNA. Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas EPIGENÉTICA E NUTRIÇÃO MATERNA Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas EPIGENÉTICA Estudo da variação herdável que ocorre sem mudança na sequência do DNA Mudanças de longo

Leia mais

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA...

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA... Atividade extra Fascículo 4 Biologia Unidade 9 Questão 1 A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA. O processo de divisão celular é composto por cinco etapas:

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

6ª LISTA - BIOTECNOLOGIA - 3º ANO - CMCG - PROF. BELAN

6ª LISTA - BIOTECNOLOGIA - 3º ANO - CMCG - PROF. BELAN 6ª LISTA - BIOTECNOLOGIA - 3º ANO - CMCG - PROF. BELAN 1. (CEFET MG 2013) Chegou ao mercado o primeiro medicamento de terapia gênica um marco na história da medicina. A droga é a esperança de uma vida

Leia mais

CLONAGEM E CÉLULAS-TRONCO Mayana Zatz (pesquisadora da USP)

CLONAGEM E CÉLULAS-TRONCO Mayana Zatz (pesquisadora da USP) CLONAGEM E CÉLULAS-TRONCO Mayana Zatz (pesquisadora da USP) O QUE É CLONAGEM? A clonagem é um mecanismo comum de propagação da espécie em plantas ou bactérias. Um clone é definido como uma população de

Leia mais

Entrevista sobre a realidade da Genética com doutor Salmo Raskin

Entrevista sobre a realidade da Genética com doutor Salmo Raskin Entrevista sobre a realidade da Genética com doutor Salmo Raskin É especialista em Genética Clínica pela Sociedade Brasileira de Genética Clínica e em Genética Médica Molecular (DNA) pela Universidade

Leia mais

UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA

UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA Projeto Gene: Ambiente de Apoio à Aprendizagem de Genética Baseado em Tamagotchi

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

M. Sc. Nadia Batoreu Dr Martin Bonamino Dr Etel Gimba. goulart@bio.fiocruz.br. Ana Emília Goulart, Bio-Manguinhos/ Fiocruz

M. Sc. Nadia Batoreu Dr Martin Bonamino Dr Etel Gimba. goulart@bio.fiocruz.br. Ana Emília Goulart, Bio-Manguinhos/ Fiocruz Investigação dos mecanismos moleculares pelos quais o PCA3 modula a sobrevivência de células de câncer de próstata. LATER/ PBIO Bio-manguinhos/ FIOCRUZ goulart@bio.fiocruz.br M. Sc. Nadia Batoreu Dr Martin

Leia mais

O fígado e a deficiência de alfa-1. antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION

O fígado e a deficiência de alfa-1. antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION O fígado e a deficiência de alfa-1 antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION O que é deficiência de alfa-1 antitripsina? Alfa-1 é uma condição que pode resultar em graves doenças pulmonares em adultos

Leia mais

Pode ser velhice ou carência de B12

Pode ser velhice ou carência de B12 Por Jane E. Brodyre, The New York Times News Service/Syndicate Pode ser velhice ou carência de B12 Ilsa Katz tinha 85 anos quando sua filha, Vivian Atkins, começou a notar que ela estava ficando cada vez

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

Manual do Paciente sobre Terapias com Células-Tronco

Manual do Paciente sobre Terapias com Células-Tronco Sociedade Internacional para a Pesquisa com Células-Tronco Manual do Paciente sobre Terapias com Células-Tronco Apêndice I das Diretrizes para a Aplicação Clínica das Células-Tronco Tradução para o Português

Leia mais

c) Locus Gênico Local do cromossomo onde se localiza um gene.

c) Locus Gênico Local do cromossomo onde se localiza um gene. Aula Biologia Tio Ton Biologia 1) Conceitos Prévios a) Genética É a ciência que estuda a transmissão de características hereditárias de pais para filhos ao longo das gerações. b) Gene Segmento da molécula

Leia mais

PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS FARMACÊUTICAS (CiPharma)

PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS FARMACÊUTICAS (CiPharma) PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS FARMACÊUTICAS (CiPharma) EDITAL CIPHARMA 002/2010 DE SELEÇÃO PÚBLICA DE CANDIDATOS A BOLSA DO PROGRAMA NACIONAL DE PÓS-DOUTORADO PNPD DE ACORDO COM O EDITAL Nº001/2010

Leia mais

Nome: Nº: Turma: Células-tronco

Nome: Nº: Turma: Células-tronco Biologia Ficha 9 Avançado Rafael mai/13 Nome: Nº: Turma: Células-tronco 1. (UFRGS) Em março de 2005, foi promulgada a Lei de Biossegurança, que autoriza a pesquisa com células-tronco obtidas a partir de

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

TECNICAS DE AMPLIFICAÇÃO REPRODUTIVA E DE BIOTECNOLOGIA APLICADAS AO MELHORAMENTO ANIMAL

TECNICAS DE AMPLIFICAÇÃO REPRODUTIVA E DE BIOTECNOLOGIA APLICADAS AO MELHORAMENTO ANIMAL MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL TECNICAS DE AMPLIFICAÇÃO REPRODUTIVA E DE BIOTECNOLOGIA APLICADAS

Leia mais

A probabilidade de nascer uma menina afetada do cruzamento de 3 com 11 é: a) 0,00 b) 0,25 c) 0,50 d) 0,75 e) 1,00

A probabilidade de nascer uma menina afetada do cruzamento de 3 com 11 é: a) 0,00 b) 0,25 c) 0,50 d) 0,75 e) 1,00 Genética e Evolução 1. A mosca drosófila, de olho branco, apresenta a constituição genética X W Y e não possui gene para olho vermelho, que impede a manifestação do outro gene, para olho branco. Na frase,

Leia mais

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi VIROLOGIA HUMANA Professor: Bruno Aleixo Venturi O que são vírus? A palavra vírus tem origem latina e significa "veneno". Provavelmente esse nome foi dado devido às viroses, que são doenças causadas por

Leia mais

II AS OLIMPÍADAS DE BIOTECNOLOGIA

II AS OLIMPÍADAS DE BIOTECNOLOGIA II AS OLIMPÍADAS DE BIOTECNOLOGIA FINAL 14 de Maio de 2007 Nas folhas de respostas preencha o cabeçalho com os seus dados e os da escola que representa. A prova tem a duração de 30 minutos. Cada resposta

Leia mais

Imunidade aos microorganismos

Imunidade aos microorganismos Imunidade aos microorganismos Características da resposta do sistema imune a diferentes microorganismos e mecanismos de escape Eventos durante a infecção: entrada do MO, invasão e colonização dos tecidos

Leia mais

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático)

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) VIRUS CONCEITOS E DEFINIÇÕES Características: 1. Não têm estrutura celular, mas multiplicam-se»

Leia mais

1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3. 2.1. Objetivos... 3. 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5. 3.1. Objetivo...

1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3. 2.1. Objetivos... 3. 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5. 3.1. Objetivo... 1 ÍNDICE ANALÍTICO 1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3 2.1. Objetivos... 3 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5 3.1. Objetivo... 5 3.1.1. Negociação para comercialização e

Leia mais

SISTEMAS COMPLEXOS E COMPORTAMENTO GLOBAL DAS REDES DO. 1. Introdução: O cérebro como um sistema complexo

SISTEMAS COMPLEXOS E COMPORTAMENTO GLOBAL DAS REDES DO. 1. Introdução: O cérebro como um sistema complexo SISTEMAS COMPLEXOS E COMPORTAMENTO GLOBAL DAS REDES DO CÉREBRO Dangeles Lima* Departamento de Física, ICEx, Universidade Federal de Minas Gerais, 30123-970 Belo Horizonte, Minas Gerais, Brazil 1. Introdução:

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Término Previsto: ---/---/-----

Término Previsto: ---/---/----- UNIVERSIDADE CAMILO CASTELO BRANCO CEUA COMISSÃO DE ÉTICA NO USO DE ANIMAIS PROTOCOLO N o. (Para uso exclusivo da CEUA) 1. FORMULÁRIO DE ENCAMINHAMENTO PARA PESQUISA ENVOLVENDO ANIMAIS Curso: Campus: Título

Leia mais

A patroa quer emagrecer

A patroa quer emagrecer A patroa quer emagrecer A UU L AL A Andando pela rua, você passa em frente a uma farmácia e resolve entrar para conferir seu peso na balança. E aí vem aquela surpresa: uns quilinhos a mais, ou, em outros

Leia mais

Seleção Artificial. "A seleção feita pelo homem visa apenas seu próprio bem; a da natureza visa, de forma exclusiva, o bem do indivíduo modificado".

Seleção Artificial. A seleção feita pelo homem visa apenas seu próprio bem; a da natureza visa, de forma exclusiva, o bem do indivíduo modificado. Biotecnologia Seleção Artificial Processo conduzido pelo ser humano de cruzamentos seletivos com o objetivo de selecionar características desejáveis em animais, plantas e outros seres vivos. "A seleção

Leia mais

Curso de Metodologia LILACS no âmbito do Projeto BVS Bioética e Diplomacia em Saúde. Indexação de documentos

Curso de Metodologia LILACS no âmbito do Projeto BVS Bioética e Diplomacia em Saúde. Indexação de documentos Curso de Metodologia LILACS no âmbito do Projeto BVS Bioética e Diplomacia em Saúde Indexação de documentos São Paulo, 3-7 de dezembro de 2012 Sueli Mitiko Yano Suga Andrea Akemi Oribe Hayashi Maria Anália

Leia mais

Biologia: Genética e Mendel

Biologia: Genética e Mendel Biologia: Genética e Mendel Questão 1 A complexa organização social das formigas pode ser explicada pelas relações de parentesco genético entre os indivíduos da colônia. É geneticamente mais vantajoso

Leia mais

Colégio Santa Dorotéia

Colégio Santa Dorotéia Colégio Santa Dorotéia Área de Ciências da Natureza Disciplina: Série: 1ª Ensino Médio Professores: Raquel Lara e Cláudio Mendes Atividades para Estudos Autônomos GABARITO Data: 09 / 03 / 2015 Aluno(a):

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128

RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128 123 RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128 RESUMOS DE PROJETOS 124 A GENÉTICA E NEUROFISIOLOGIA DO AUTISMO... 125 PAPEL DO POLIMORFISMO IL17A (RS7747909) NA TUBERCULOSE.... 126 PAPEL

Leia mais

EXERCÍCIOS PARA O 8 ANO (2015)

EXERCÍCIOS PARA O 8 ANO (2015) EXERCÍCIOS PARA O 8 ANO (2015) 1- A Fábrica Celular Células de bactérias (procarióticas) e células animais (eucarióticas), apresentam semelhanças e diferenças. a) Qual a estrutura presente em ambas que

Leia mais

Sanofi e Regeneron anunciam resultados de estudos de Fase II com o anticorpo PCSK9, o primeiro da classe com efeito hipolipemiante

Sanofi e Regeneron anunciam resultados de estudos de Fase II com o anticorpo PCSK9, o primeiro da classe com efeito hipolipemiante COMUNICADO DE IMPRENSA Sanofi e Regeneron anunciam resultados de estudos de Fase II com o anticorpo PCSK9, o primeiro da classe com efeito hipolipemiante Novos dados apresentados no Congresso do American

Leia mais

MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS

MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS BIOLOGIA MOLECULAR BÁSICA MÓDULO III Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas de animações. Dê uma olhada nas animações

Leia mais

Células estaminais criam nova esperança contra leucemia (pág.1)

Células estaminais criam nova esperança contra leucemia (pág.1) Células estaminais criam nova esperança contra leucemia (pág.1) Investigadores portugueses e americanos, no âmbito do programa MIT-Portugal, estão usar clinicamente células estaminais para neutralizar

Leia mais

Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros

Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros Laboratório de Imunovirologia Molecular DBG UFV Prof. Sérgio Oliveira de Paula Tristeza Parasitária Bovina (TPB) Enfermidade hemoparasita

Leia mais

Câncer: mais 500 mil casos

Câncer: mais 500 mil casos Página 1 de 5 Quarta, 18 de Maio de 2011 ENTREVISTA Câncer: mais 500 mil casos O oncologista afirma que o Brasil não tem estrutura física e médica para tratar outro meio milhão de pessoas com câncer em

Leia mais

Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: Ano: Tempo Início: Término: Total: Edição 29 MMXIV O VÍRUS DO PÂNICO

Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: Ano: Tempo Início: Término: Total: Edição 29 MMXIV O VÍRUS DO PÂNICO Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: de Ano: Tempo Início: Término: Total: Edição 29 MMXIV Grupo b O VÍRUS DO PÂNICO VARÍOLA DE CAMUNDONGO [Numeração tâmil (Índia)]

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

EDITORIAL / EDITORIAL CÉLULA-TRONCO. discreta de células-tronco adultas fazem a reposição. laboratório, determinar suas propriedades

EDITORIAL / EDITORIAL CÉLULA-TRONCO. discreta de células-tronco adultas fazem a reposição. laboratório, determinar suas propriedades EDITORIAL / EDITORIAL CÉLULA-TRONCO José Carlos Rossini Iglézias* As células-tronco são importantes para os organismos vivos por várias razões. No embrião, na fase do terceiro ao quinto dia de idade -

Leia mais

I Curso de Verão em Oncologia Experimental Cursos Práticos

I Curso de Verão em Oncologia Experimental Cursos Práticos I Curso de Verão em Oncologia Experimental Cursos Práticos 1. Técnicas Experimentais para o Estudo da Expressão Gênica O curso terá como base o estudo da expressão gênica utilizando um fator de transcrição.

Leia mais