Major Mouse Testing Program: Longevity

Tamanho: px
Começar a partir da página:

Download "Major Mouse Testing Program: Longevity"


1 Major Mouse Testing Program: Longévité Santé Longevity 10/03/2015 Mapeando efeitos a longo prazo na saúde: Teste em larga escala em camundongos idosos usando terapias promissoras contra o envelhecimento e doenças relacionadas 1

2 Dedicamos esta apresentação a L. Stephen Coles, M.D., Ph.D. (19/01/ /12/2014) pioneiro na área de gerontologia e na pesquisa do envelhecimento. Stephen Coles colocou em contato especialistas americanos em camundongos com o grupo de voluntários desse projeto para terem discussões técnicas e ver o que poderia ser feito. Por anos, Dr. Coles administrou a lista de Gerontology Research Group, que serviu como grande fonte de inspiração para esse projeto. 10/03/2015 Major Mouse Testing Program 2

3 Longevidade: A revolução Revolução ocorreu em nematoides ( C. elegans ) Descoberta revolucionária em 1980: 8 maneiras de aumentar a longevidade [1] 1993: Uma mutação dobra expectativa de vida e confere grande vitalidade [2] 2003: Milhares de testes realizados; ~10% aumenta a longevidade [3] 2008: Uma mutação aumentou a longevidade em quase 10 vezes! PASSADO Vermes e camundongos envelhecem de forma diferente Vermes têm um nº fixo de células: manter a viabilidade celular é a chave Camundongos são mamíferos e a regeneração tecidual é a chave A revolução da longevidade está ocorrendo em camundongos e é promissora para humanos A revolução está chegando em camundongos, mas poucos testes foram feitos Tratamentos conhecidos que aumentam a longevidade de camundongos tiveram efeitos benéficos em humanos (aspirina, metformina, metoprolol, rapamicina) Padrões genéticos de aumento de longevidade em camundongos foram encontrados em famílias humanas longevas (Larron-dwards, Foxo-3A, akt-1) Ajude-nos a realizar múltiplos testes em camundongos, para que possam ser aplicados para humanos futuramente PRESENTE 10/03/ Major Mouse Testing Program

4 Resumo do programa Duração 1ª série de experimentos em animais adultos com duração de 18 meses Na outra série será preciso construir novas linhagens, demorando 38 meses Resultados serão checados 3x para que possam ser testados em humanos. A maior parte dos resultados virá 5 anos após o início do programa. Pessoas envolvidas Contactamos diferentes pesquisadores e identificamos grupos de laboratórios com forte experiência em animais, teste de longevidade e em medicina regenerativa Orçamento Custo estimado para os 1000 diferentes testes é de 20M. Há uma correlação direta entre o financiamento, o nº de testes e o cronograma do projeto. D Benefícios esperados: Resultados esperados De 1000 testes esperamos 100 resultados positivos: -Nematoides:10% de testes positivos (muitos testes já feitos) - Em camundongos, ~10% (difícil de estimar: poucos testes feitos) 1. Mudar pensamento da sociedade em todos seus níveis 2. Resultados devem trazer uma visão global sobro que aumenta a longevidade 3. Esperamos atingir um robusto aumento da longevidade 4. Esperamos que alguns tratamentos sejam aplicáveis em humanos Aplicação em estudos de longevidade em humanos Iniciando o programa esse ano, esperamos resultados robustos em menos de 10 anos. 10/03/2015 Major Mouse Testing Program 4

5 O que testar: Intervenções por origem Resultados parciais Longevity DB: mais de 1000 intervenções Banco de dados lista genes humanos estatisticamente correlacionados com longevidade. Para muitos genes, a causalidade pode ser testada em camundongos: Lifespan Observation Database 3359 intervenções que aumenta longevidade: em roedores (114; alguns indefinidos, mas com resultados promissores), nematoides (2400), outras especies Confirmações futuras precisam ser feitas em camundongos: Outras ideias Grupo no Facebook: PotentialGerontodrugs Atualmente mais de 300 posts Cada post contém uma intervenção em potencial para ser testada em camundongos Outras fontes Outros bancos de dados parecidos foram encontrados. Fóruns e listas de s foram analisados. Circulamos também em conferências da área um trabalho para listarmos ideias.. O número total de intervenções é grande. Análises para determinar prioridades está em andamento 10/03/2015 Major Mouse Testing Program 5

6 O que testar: Intervenções por classe Variações genéticas em humanos Tratamentos com drogas já usadas em humanos Tratamentos já usados em humanos e que acabam favorecendo uma vida saudável. Conceito: Se camundongos viverem mais e melhor com certa droga, é um forte argumento para que esta esteja de forma causal melhorando a saúde de pessoas. Resultados de pesquisas Normalmente resultados in vitro e in vivo de camundongos, ratos, nematoides, ou mosca-da-fruta, precisam de confirmações de aumento robusto da longevidade e saúde para que possam ser extrapoladas para humanos Diversas terapias em camundongos Variações encontradas em populações humanas que acabam favorecendo uma vida saudável, podendo ser testadas através de terapia gênica em camundongos idosos. Conceito: Se camundongos viverem mais e melhor, é um forte argumento para que essa variação melhora a saúde humana de forma causal, e que futuramente terapia gênica pode ser efetiva também. Terapia gênica em camundongos Banco de dados 10/03/2015 Major Mouse Testing Program 6

7 Cronograma geral Fase I 1 ano Formação de times, financimento e investigação de técnicas Número de intervenções testadas depende do financiamento TESTES INICIANDO COM CAMUNDONGOS IDOSOS Fase II 2 meses Fase III 14 meses Fase IV 18 meses Fase V 18 meses Preparação de equipamentos Teste com 40 a 400 terapias Confirmação e otimização de resultados Início de protocolos em humanos TESTES INICIANDO COM NOVA LINHAGEM DE CAMUNDONGO 2 meses 38 meses 18 meses 18 meses Preparação de equipamentos Teste com 60 a 600 terapias Confirmação e otimização de resultados Início de protocolos em humanos O cronograma da Fase III está detalhado no próximo slide 2 m 100 terapias testadas 10 resultados positivos 20 m 1000 terapias testadas 100 resultados positivos A estimativa financeira encontra-se no slide 17. Contém também o número de testes previstos dependendo do financiamento obtido. 10/03/ Major Mouse Testing Program

8 preparação Fase III 6 meses 30 machos 30 fêmeas 18 meses 14 meses? Resultados positivos da Fase III levarão a Fase IV, que é parecida com a Fase IIIb : validação em roedores idosos de outros laboratórios + estudo dos diversos efeitos na saúde Nascimento Fase IIIa: Inicia-se criando linhagens novas. Maioria genética & muitas outras terapias. 18 meses de idade: Início do tratamento Fase IIIb: Teste Real! Drogas, genética, outros 32 meses de idade: Houve aumento da longevidade em relação ao grupo controle? Decisão para próximos passos 10/03/2015 Major Mouse Testing Program 8

9 Organização Geral Doadores Financiamento Resultados Grupo Longévité Santé, ILA Produtores de camundongos Camundongos Instalações/ Facilities 10/03/2015 Major Mouse Testing Program 9

10 Lista: Para-Fazer Escolher intervenções em potencial Em progresso Identificar fontes de financiamento Presente Refinar metodologia Em progresso Laboratórios necessários para realização do projeto e fazer acordos com estes Contactar investidores em potencial Fazer acordos gerais Calcular custos dos experimentos (equipamentos e mão-de-obra) Em progresso Negociações financeiras mais detalhadas Coletar o necessário para começo do programa Futuro 10/03/2015 Major Mouse Testing Program 10

11 Times e laboratórios Laboratórios: 1. Equipados com estrutura de altíssima qualidade para animais (gaiolas com filtros individuais com ventilação) e 2. Especializados em medicina regenerativa, e em áreas relacionadas com o envelhecimento Arlan Richardson 40 anos de experiência em testes de longo prazo com roedores (compostos e terapia gênica) Laboratory USA (Oklahoma) Alexandra Stolzing Medicina regenerativa & células-tronco Translational Centre for Regenerative Medicine Leipzig University (Leipzig) Jean-Marc Lemaitre Medicina regenerativa em camundongos e células humanas (células-tronco e terapia gênica) Inserm na França (Montpellier) 10/03/2015 Major Mouse Testing Program 11

12 Time de voluntários Agradecimento especial ao time de voluntários: Time principal: Edouard Debonneuil, Rached Messaoudi, Valentin Socolov, Martin Dinov, Daniel Krochmal, Maciej Michalak, Nicoleta Reinald Assistência de: Steve Coles (finado), Johnny Adams, Daria Khaltourina, Matthew Scholz, Didier Coeurnelle, Anton Kulaga, Paul Spiegel, Liz Parrish, Alexandru Chircu, Alexandre Blanc, Dmitri Borisoglebsky, Victor Björk, e tantos outros pesquisadores e voluntários da internet. Longévité & Santé: Encontros semanais para organizar o projeto em La Paillasse, Paris. contribuidores de diferentes países em diferentes ocasiões 10/03/2015 Major Mouse Testing Program 12

13 Obrigado por sua atenção! Versões atualizadas dessa apresentação: Caso queira ajudar, Doações via paypal em De outras maneiras através do IBAN: FR Contato para propor ajuda em pontos específicos O que precisamos mais especificamente: Se você tiver experiência em testes de longevidade em camundongos, ou terapia gênica in vivo, ou incorporação de drogas na comida, ou se pude ajudar nos desenhos experimentais do projeto. Se você souber fontes de financiamento em potencial que possam ajudar, ou se você estiver interessando em escrever projetos de financiamento por favor, não hesite em nos contactar Apresentação do projeto em conferências ou tradução dos slides para outras línguas. Contatos para organizações registradas em seu país, sem fins-lucrativos, pró-longevidade com vantagens fiscais para seus doadores, que possam querer financiar o projeto. P.S: Estamos cientes que alguns links e s desse slide não essão homogêneos. Estamos melhorando isso para as futuras versões. Para esclarecimentos, SLS é Sceaux Longévité Santé, e ALA é o American Longevity Alliance, afiliações sem fins-lucrativos da International Longevity Alliance localizada na França e nos EUA, respectivamente. 3/10/2015 Major Mouse Testing Program 13

14 Apêndice Recapitulação em 3 slides Lista de terapias para testar em camundongos Técnicas de terapia gênica Outros 10/03/2015 Major Mouse Testing Program 14

15 Hoje existem menos de 10 estudos de longevidade em camundongos por ano. Objetivo: 1000 testes em menos de 5 anos Em nematoides, 10% dos milhares de testes foram positivos Em camundongos, também 10% [5/67 por Spindler. S e 5/15 por ITP, 1-2 em comum]: Programa de intervenções, EUA: - NDGA (machos, +10%) - Rapamicina (machos, & fêmeas, %) - Acarbose (machos, +22%) - Aspirina (machos, +10%) - α-estradiol (machos, +10%) Aspirina: baixa mortalidade em humanos (80 mg/dia, 5 anos) Everolimo : em teste em idosos(resistência de vacina contra gripe) Metformina: diminui a mortalidade em humanos Outros resultados estão sendo checados em roedores (Fulereno) 10/03/2015 Major Mouse Testing Program 15

16 Resultados esperados Descobertas em camundongos têm grande potencial para avançar saúde humana a longo prazo 1 Alterar a forma que a sociedade pensa A biologia aplicada está emergindo em relação as inúmeras terapias que previnem ou revertem/silenciam o envelhecimento. Podemos então, aumentar a longevidade do camundongo de forma robusta? Quebra de paradigma na ciência da longevidade Guiar pesquisas para o que realmente aumenta a longevidade. Destacar mecanismos envolvidos. Em conjunto com estatísticas em humanos, esperamos que os resultados possam ser aplicáveis em até 5 anos Grande aumento da longevidade Dos muitos resultados, esperamos que alguns aumentem a longevidade de forma drástica Nova área farmacêutica: saúde a longo prazo Aplicação de drogas já existentes para o envelhecimento e doenças relacionadas 10/03/2015 Major Mouse Testing Program 16

17 Financiamento e Orçamento Nota: Custos estão sendo recalculados. De qualquer maneira, o número de testes será ditado pela quantidade de financiamento Fase III Consideremos que 400 terapias serão testadas em camundongos idosos e 600 terapias exijam novas linhagens; sendo que cada terapia precisa de 60 animais (30 machos e 30 fêmeas) e cada um dos dois sistemas (animais envelhecimentos/linhagens novas) precisam de um controle de 1000 camundongos (desenho assimétrico; 50% macho-fêmea). Consideremos que o manuseamento custa ~1.5 por animal/semana (dependendo das condições) e que cada animal viva em média 27 meses. Um cálculo rápido indica que o custo total do manuseamento é de 1.5*(27*(600* )+9*(400* ))*(30.5/7) = 8 M Consideremos que cada animal idoso custa 100 e que cada animal transgênico custa 30 para ser gerado. O custo inicial do camundongo é de (600* )*100+(400* )*30 = 4.5 M Custo total para a Fase III é de 12.5 M Fase IV Consideremos que 10% das terapias testadas na Fase III sigam para a Fase IV, e que em média, cada terapia na Fase IV custará 6 vezes o custo da Fase III (esse aumento de longevidade precisa ser confirmado e refinado). O custo total da Fase IV é de 12.5*10%*6 = 7.5 M Total O custo total das 1000 terapias seria então = 20 M, com os cáculos acima. As principais fontes de gastos foram detalhados acima. 10/03/2015 Major Mouse Testing Program 17

18 Terapias para testar em camundongos Exemplos de terapias extraídas do grupo do Facebook A L T A P R I O R I D A D E M É D I A Controles de aumento da longevidade: aspirina, metformina, rapamicina, estatinas Snell, Ames, mutações de IGF-1 em idade avançada TA-65, ativador de telomerase, e variante humana de telomerase TM5441(Aumenta 4x a longevidade em camundongos; reduz níveis de PAI, marcador de senescência) Centrofenoxino/Meclofenoxato: reduz níveis de lipofuscina e aumenta longevidade de ratos Farmacoperonas (inverte a mutação em GNRHR) Suplementação de Neuraminidase 1 (reduz parcialmente a doença de Alzheimer) Injeções de GDF11 (reduz parcialmente envelhecimento no coração e cérebro de camundongos) D-Glucosamina (mimético da restrição calórica, aumenta longevidade de camundongos idosos) Dimetilaminoetanol (aumenta longevidade; falta testar doses mais baixas) Trealose (induz autofagia; altera via de IGF-1; elimina proteínas neurodegenerativas) Destruição de 7-cetoColesterol com LysoSENS s (Em breve pronta pra testes) Estabilização genética da estrutura da transtiretina... [MUITAS OUTRAS] Bifosfonatos (usados contra osteoporose, mas parece reduzir a longevidade por outras vias) Suplementação de fulereno em ratos (90% de aumento da longevidade) Tafamidis (tratamento de doença familiar de transtiretina) Suplementação de NAD+... [MUITAS OUTRAS] 3/10/2015 Major Mouse Testing Program 18

19 Outras intervenções promissoras 1. Variações genéticas humanas terapia gênica em camundongos. Variações encontradas em populações humanas que acabam favorecendo uma vida saudável, e que podem ser testadas através de terapia gênica em camundongos idosos. Conceito: Se camundongos viverem mais e melhor, é um forte argumento que essa variação melhore a saúde humana de forma causal, e que a terapia gênica possa ser efetiva também. 2. Tratamento com drogas já usadas em humanas tratamento de drogas em camundongos. Tratamentos usados em humanos e que acabam favorecendo uma vida saudável. Conceito: Se camundongos viverem mais e melhor com certa droga, é um forte argumento para que esta melhore de forma causal a saúde de pessoas. 3. Resultados de pesquisas diversas terapias em camundongos. Normalmente resultados in vitro e in vivo de camundongos, ratos, nematoides ou moscas-da-fruta, precisam de confirmações de aumento robusto da longevidade e saúde para que possam ser extrapoladas para humanos 10/03/2015 Major Mouse Testing Program 19

20 Exemplo: transpor rs rs é uma variação genética humana codifica para a proteína tubulina beta4b. A variante corresponde em ter um T no lugar de um C em algum ponto. Foi encontrado no estudo Framingham Heart Study. Cidadões americanos com duas cópias desta variante tiveram menor risco de doenças cardiovasculares, de câncer e de morte prematura de maneira bastante significativa (p_value = 6e-53) Referência: / Camundongos têm o mesmo gene! ("ortólogo") indicando que tem a mesma função. Naturalmente, eles tem um "C", e não um "T". Por isso, queremos dá-los essa mesma variante: parte do gene do camundongo é: "GCCGCATGTCTATGAAGGAGGTGGACGAACAGATGCTTAATGTCCAAAACA«, e o objetivo é transformá-lo em "GCCGCATGTCTATGAAGGAGGTGGATGAACAGATGCTTAATGTCCAAAACA" usando técnicas de CRISPR. Se isso aumentar sua longevidade (melhorar a saúde, etc) é uma confirmação de que funciona em humanos Objetivo é testar rs e também muitos outros candidatos (temos mais de 1400 candidatos!). O que vier de estudos em humanos e for confirmado em camundongos tem grandes chances de funcionar em nós - Depois de 5 anos algumas pessoas (primeiramente talvez pacientes e idosos) começarão a fazer a terapia gênica e serem monitorados quanto sua saúde. - Potencialmente em 10 anos será frequente usar terapia gênica para esses genes para melhora da saúde. 10/03/2015 Major Mouse Testing Program 20

21 Terapia Gênica em animais idosos: técnicas 1. Linhagens sensíveis a drogas Por que usar linhagens específicas e não tratar linhagenes normais? Especialistas nos disseram que técnicas existentes de terapia gênica afetam uma minoria do corpo: mesmo se o gene da longevidade for introduzido, é incerto se terá efeito pronunciado; usando essas técnicas, há o risco de desgastar o programa Eles sugeriram gerar linhagens sensíveis a drogas ( Técnica Passo 1 (6 meses): para cada variante genético a ser testado, uma linhagem será contruída; embriões incorporaram a variação com um promotor ativado por drogas usando a técnica de CRISPR e é implantado em fêmeas. A progenia que tiver a mutação é testada; se estiver OK é cruzada para gerar 30 machos e 30 fêmeas para análise da sobrevida. Passo 2 (18 meses): animais são mantidos e alimentados normalmente. Devem se comportar que nem o controle porque a variação não está expressa. Passo 3 (14 meses): Após 18 meses, são alimentados com a droga que ativa o gene. Curva de sobrevivência é comparada com o controle. P.S: Não abandonamos o tratamento de animais idosos normais: 30 machos 30 fêmeas a) Após esses 38 meses, fase IV: para os casos (10%?) com aumento estatístico da longevidade, a variação é testada em animais idosos usando técnicas diferentes (próximos slides) b) Em paralelo nesses 38 meses, técnicas de terapia gênica (próximos slides) já são testadas para genes estabelecidos de longevidade, sendo uma forma de treinar para a) 3/10/2015 Major Mouse Testing Program 21?

22 Terapia Gênica em animais idosos: técnicas 2. Terapia gênica com 18 meses: Alteração genética mediada por vírus Contexto Muitas técnicas podem alterar genes in vivo. Especialistas sugerem que usemos o Adeno- Associated Virus (AAV). Esses vírus incorporam parte de seu DNA no DNA do hospedeiro infectado. Nas últimas décadas, alguns desses foram selecionados para uso científico para serem aplicados em diferentes órgãos: AAV1,AAV2..AAV9. Ex: usaremos como padrão AAV9, por ter tropismo para tecido neural. Técnica Passo 1 (2 meses): Para cada variação genética a ser testada, o AAV incorpora o gene com a técnica de CRISPR sendo injetado em: 1.animais jovens para testar se espalha-se e 2. em 30 machos e fêmeas de 18 meses Passo 2 (14 meses): Sobrevida dos camundongos envelhecidos é comparada com o grupo controle. Limitantes Baixa eficiência: Uma pequena fração de células recebe AAVs e uma menor ainda tem o constructo no núcleo: a chance de agir de forma suficiente para aumentar a longevidade é baixa. Ainda assim, terapia gênica de telomerase já foi descrita com esse método. Aplicação terapêutica: Frequentemente, adultos são infectados por AAVs durante suas vidas. Para esses, a terapia poderia resultar em uma resposta imune que tornaria a terapia pouco eficaz. Pessoas saudáveis podem hesitar em usar essas terapias. (*) Bernardes de Jesus B. et al. (2002) 30 machos 30 fêmeas /10/2015 Major Mouse Testing Program 22 teste? AAV

23 Terapia Gênica em animais idosos: técnicas 3. Expressão transiente após 18 meses: Minicírculos contendo vetor lipossomal Contexto Minicírculos são círculos de DNA. Em camundongos, eles não afetam necessariamente um nº de células maior que AAVs, mas eles não geram respostas imunes tornando-se uma abordagem translacional mais eficaz. Um problema é que em células em divisão o efeito é transiente, necessitando do uso de constantes tratamentos. Técnica Passo 1 (2 meses): Para cada variação a ser testada minicirculos contendo o gene são produzidos em quantitade suficiente usando bactéria modificadas (um plasmidio é criado em E. coli, suas partes procarioticas são removidas = minicírculo: sem resposta imune); são então incorporados em vetores lipossomais (que tem minicírculos) e injectados em animais jovens para testar sua distribuição. Passo 2 (14 meses): Os minicírculos são injetados em 30 machos e 30 fêmeas, a cada duas semanas, iniciando aos 18 meses de idades. A sobrevida é comparada com a do grupo controle Nota Evoluções: A área está mudando rapidamente. Esses slides são, portanto, indicativos: nós podemos escolher melhores técnicas quando/se essas aparecerem e se tornarem robustas (microcírculos, elementos S/MAR ). teste E. coli 30 machos 30 fêmeas? /10/2015 Major Mouse Testing Program 23

24 Terapia Gênica em animais idosos: técnicas 4. Outros Uma questão de tecido-específico Para a maioria das variações genéticas que queremos testas, não sabemos à priori se afetar algum tecido em específico faria sentido. Ex: uma mutação familiar pode estar associada com aumento longevidade em diferentes população sem saber se esses efeitos são através de certos tecidos. Por isso, os slides anteriores eram sobre técnicas gerais: Ex: que são expressas em todo o corpo. Nesses casos, a não ser que já tenha sido demonstrado que o gene aumenta a longevidade, iniciaremos com a técnica longa #1: gerar a linhagem e esperar por sua longevidade. Para casos específicos que certo órgão deve ser afetado, a terapia gênica pode ser bem mais eficiente. Esse é o caso para célular do sangue e do fígado Uma área que cresce rápido Como dito no último slide, técnicas de terapia gênica estão melhorando Pode acontecer que após 6 meses do início dos experimentos, alguma técnica melhor apareça. Mas, seria muito pior esperar décadas para iniciar os experimentos. Pode acontecer também que a técnica #1 seja uma maneira artifical para modelar uma futura terapia gênica que estará disponível para idosos daqui cinco ou dez anos. Nessa perspectiva, essa técnica seria muito melhor que outras (AAVs, minicírculos, ou outras terapias pouco efetivas) 3/10/2015 Major Mouse Testing Program 24

25 Referências As seguintes referências correspondem ao slide nº3 A revolução da longevidade em C elegans [1] Klass MR (1983). "A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results". MECHANISMS OF AGEING AND DEVELOPMENT 22 (3-4): PMID [2] Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R (1993). "A C. elegans mutant that lives twice as long as wild type". Nature (journal) 366 (6454): PMID [3] Lee SS, Lee RY, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003). A systematic RNAi screen identifies a critical role for mitochondria in C. elegans longevity. NAT GENET. PMID [4] Ayyadevara S, Alla R, Thaden JJ, Shmookler Reis RJ (2008). "Remarkable longevity and stress resistance of nematode PI3K-null mutants". AGING CELL 7 (1): PMID A futura revolução da longevidade em camundongos Bartke A, Brown- Borg H (2004). Life extension in the dwarf mouse. CURR TOP DEV BIOL. 63: PMID Harrison, D. E., Strong, R., Sharp, Z. D., Nelson, J. F., Astle, C. M., Flurkey, K., Nadon, N. L., Wilkinson, J. E., Frenkel, K., Carter, C. S., Pahor, M., Javors, M. A., Fernandez, E. and Miller, R. A. (2009) Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. NATURE 460: PMID Spindler SR, Mote PL, Li R, Dhahbi JM, Yamakawa A, Flegal JM, Jeske DR, Li R, Lublin AL (2013). β1-adrenergic receptor blockade extends the life span of Drosophila and long-lived mice. AGE. PMID Martin-Montalvo A, Mercken EM, Mitchell SJ, Palacios HH, Mote PL, Scheibye-Knudsen M, Gomes AP, Ward TM, Minor RK, Blouin MJ, Schwab M, Pollak M, Zhang Y, Yu Y, Becker KG, Bohr VA, Ingram DK, Sinclair DA, Wolf NS, Spindler SR, Bernier M, de Cabo R (2013). Metformin improves healthspan and lifespan in mice. NAT COMMUN. 4:2192. PMID /03/2015 Major Mouse Testing Program 25

TERAPIA GÊNICA. Brasília DF, Julho de 2010.

TERAPIA GÊNICA. Brasília DF, Julho de 2010. Apresentação desenvolvida pelas graduandas em Ciências Farmacêuticas: Ana Carolina Macedo Lima, Ariane Mugnano Castelo Branco, Caroline Cardoso Mendes Souza, Clarisse Danielli Silva Albergaria, Jéssica

Leia mais

Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais colocam o País na vanguarda da medicina mundial

Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais colocam o País na vanguarda da medicina mundial ISTOÉ - Independente Imprimir Especial BRASIL POTÊNCIA Edição: 2095 30.Dez.09-15:00 Atualizado em 06.Fev.13-12:48 Na Dianteira Do Conhecimento Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais

Leia mais

Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia

Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia Fórum INCA-ASCO sobre Câncer Hereditário Predisposição Genética ao Câncer 21 e 22 de novembro de 2011 Hotel Novo Mundo Flamengo Rio de Janeiro Brasil Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia

Leia mais

CLASSIFICAÇÃO GENÉTICA. Reprodução, Acasalamento, Manutenção e Algumas considerações...

CLASSIFICAÇÃO GENÉTICA. Reprodução, Acasalamento, Manutenção e Algumas considerações... CLASSIFICAÇÃO GENÉTICA Reprodução, Acasalamento, Manutenção e Algumas considerações... Classificação Genética Heterogênicos = outbred Isogênicos = Inbred Acasalamento Aleatório Não-Consangüíneos Acasalamento

Leia mais

Governador Geraldo Alckmin entrega o maior laboratório destinado a pesquisas sobre o câncer da América Latina

Governador Geraldo Alckmin entrega o maior laboratório destinado a pesquisas sobre o câncer da América Latina MATEC ENGENHARIA ENTREGA O MAIOR LABORATORIO PARA PESQUISA DE CÂNCER DA AMÉRICA LATINA Qui, 14/04/11-11h00 SP ganha maior laboratório para pesquisa de câncer da América Latina Instituto do Câncer também

Leia mais

Aula - Terapia Gênica. Unidade Curricular: Cultura de Células Animais. Prof. Me. Leandro Parussolo

Aula - Terapia Gênica. Unidade Curricular: Cultura de Células Animais. Prof. Me. Leandro Parussolo Aula - Terapia Gênica Unidade Curricular: Cultura de Células Animais Prof. Me. Leandro Parussolo O que é? O que não é? O que será? 1990 (EUA) - Primeiro protocolo clínico de Terapia Gênica em humanos 2

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais



Leia mais

A genética do vírus da gripe

A genética do vírus da gripe A genética do vírus da gripe Para uma melhor compreensão das futuras pandemias é necessário entender sobre as pandemias passadas e os fatores que contribuem para a virulência, bem como estabelecer um compromisso

Leia mais


EXERCÍCIOS PARA O 8 ANO (2015) EXERCÍCIOS PARA O 8 ANO (2015) 1- A Fábrica Celular Células de bactérias (procarióticas) e células animais (eucarióticas), apresentam semelhanças e diferenças. a) Qual a estrutura presente em ambas que

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Homeopatia. Copyrights - Movimento Nacional de Valorização e Divulgação da Homeopatia 2

Homeopatia. Copyrights - Movimento Nacional de Valorização e Divulgação da Homeopatia 2 Homeopatia A Homeopatia é um sistema terapêutico baseado no princípio dos semelhantes (princípio parecido com o das vacinas) que cuida e trata de vários tipos de organismos (homem, animais e plantas) usando

Leia mais

Um novo tipo de câncer

Um novo tipo de câncer Um novo tipo de câncer Cirurgias menos invasivas e tratamentos personalizados são algumas das apostas da ciência para o câncer de cabeça e pescoço. Em visita ao Brasil, médico especialista na área apresenta

Leia mais



Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

A patroa quer emagrecer

A patroa quer emagrecer A patroa quer emagrecer A UU L AL A Andando pela rua, você passa em frente a uma farmácia e resolve entrar para conferir seu peso na balança. E aí vem aquela surpresa: uns quilinhos a mais, ou, em outros

Leia mais

Capítulo II Capítulo II

Capítulo II Capítulo II A doença de Alzheimer, a doença de Parkinson e as doenças de expansão de poliglutaminas são doenças neurodegenerativas que se prevê virem a ser a quarta principal causa de custos de saúde em 2030 (World

Leia mais

Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário

Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário Ajudando futuros pais a tomar uma decisão consciente Agência Nacional de Vigilância Sanitária Anvisa O que é sangue de cordão umbilical

Leia mais


BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

Professor: Curso: Disciplina:

Professor: Curso: Disciplina: Professor: Curso: Disciplina: Aula 1 Turma: Esp. Marcos Morais de Sousa Sistemas de informação Engenharia de Software I Dinâmica da disciplina, plano de curso e avaliação 03º semestre Prof. Esp. Marcos

Leia mais

Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa. Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa

Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa. Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa Protocolo nº: (uso da CEUA) Data de Entrega / / (uso da CEUA) Título do Projeto Pesquisador-chefe Departamento Unidade Acadêmica - - - - -

Leia mais


BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS ! Universidade Federal de Pernambuco Centro de Ciências da Saúde Departamento de Patologia Laboratório de Imunopatologia Keizo Asami Prof. Dr. Lucas Brandão BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

Leia mais

Estratégias de redução do uso de animais em estudos pré-clínicos. Carlos Kiffer Larissa Fontes Generoso

Estratégias de redução do uso de animais em estudos pré-clínicos. Carlos Kiffer Larissa Fontes Generoso Estratégias de redução do uso de animais em estudos pré-clínicos Carlos Kiffer Larissa Fontes Generoso Introdução Desenvolvimento de produtos farmacêuticos e biotecnológicos: SEGURO EFICAZ Desenvolvimento

Leia mais

Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança

Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança Florianópolis, Agosto 2004 Células-tronco O que são células-tronco e o que podemos fazer com elas? Qual a relação

Leia mais

Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária.

Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária. Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária. Todos os animais, domésticos, selvagens e de laboratório são beneficiados por substâncias testadas em animais. Graças

Leia mais

As empresas farmacêuticas não se importam com a DH, certo?

As empresas farmacêuticas não se importam com a DH, certo? Notícias científicas sobre a Doença de Huntington. Em linguagem simples. Escrito por cientistas. Para toda a comunidade Huntington. Entrevista: Graeme Bilbe, chefe global de Neurociências na Novartis O

Leia mais

1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3. 2.1. Objetivos... 3. 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5. 3.1. Objetivo...

1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3. 2.1. Objetivos... 3. 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5. 3.1. Objetivo... 1 ÍNDICE ANALÍTICO 1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3 2.1. Objetivos... 3 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5 3.1. Objetivo... 5 3.1.1. Negociação para comercialização e

Leia mais

Vera Lúcia de Castro Jaguariúna, 2006.

Vera Lúcia de Castro Jaguariúna, 2006. Aspectos do biomonitoramento da toxicidade perinatal pelos agroquímicos Vera Lúcia de Castro Jaguariúna, 2006. A contaminação ambiental por agroquímicos pode causar efeitos negativos aos recursos naturais

Leia mais

Aula 01 - Formatações prontas e condicionais. Aula 01 - Formatações prontas e condicionais. Sumário. Formatar como Tabela

Aula 01 - Formatações prontas e condicionais. Aula 01 - Formatações prontas e condicionais. Sumário. Formatar como Tabela Aula 01 - Formatações prontas e Sumário Formatar como Tabela Formatar como Tabela (cont.) Alterando as formatações aplicadas e adicionando novos itens Removendo a formatação de tabela aplicada Formatação

Leia mais

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos.

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos. Questão 1 Você é um imunologista que quer ficar rico e decide deixar o mundo da ciência, conseguindo um emprego como consultor de roteiro em um novo seriado de drama médico. Você avalia o conhecimento

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais



Leia mais

Módulo 4: Gerenciamento dos Riscos, das Aquisições, das Partes Interessadas e da Integração

Módulo 4: Gerenciamento dos Riscos, das Aquisições, das Partes Interessadas e da Integração Diretoria de Desenvolvimento Gerencial Coordenação Geral de Educação a Distância Gerência de Projetos - Teoria e Prática Conteúdo para impressão Módulo 4: Gerenciamento dos Riscos, das Aquisições, das

Leia mais

Construção de Ambientes de Saúde

Construção de Ambientes de Saúde Construção de Ambientes de Saúde Implantamos o que planejamos Se você recebeu este material provavelmente o projeto de seu ambiente de saúde foi feito conosco. Na L+M, é assim. Apostamos tanto em nossos

Leia mais

Microsoft Project 2003

Microsoft Project 2003 Microsoft Project 2003 1 [Módulo 4] Microsoft Project 2003 2 Definindo durações Inter-relacionamentorelacionamento Caminho crítico Microsoft Project 2003 3 1 Duração das Atividades Microsoft Project 2003

Leia mais

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi VIROLOGIA HUMANA Professor: Bruno Aleixo Venturi O que são vírus? A palavra vírus tem origem latina e significa "veneno". Provavelmente esse nome foi dado devido às viroses, que são doenças causadas por

Leia mais

Perspectivas para a indústria farmacêutica brasileira, seus investimentos e suas pesquisas. Ministério da Saúde Brasília, 12 de agosto de 2015

Perspectivas para a indústria farmacêutica brasileira, seus investimentos e suas pesquisas. Ministério da Saúde Brasília, 12 de agosto de 2015 Perspectivas para a indústria farmacêutica brasileira, seus investimentos e suas pesquisas Ministério da Saúde Brasília, 12 de agosto de 2015 POLÍTICA NACIONAL DE ASSISTÊNCIA FARMACÊUTICA Define a assistência

Leia mais

Resumos do 56º Congresso Nacional de Botânica.

Resumos do 56º Congresso Nacional de Botânica. Genômica Florestal: Oportunidades e Desafios DARIO GRATTAPAGLIA - EMBRAPA RECURSOS GENÉTICOS E BIOTECNOLOGIA/UNIVERSIDADE CATÓLICA DE BRASÍLIA Introdução Plantações florestais

Leia mais



Leia mais

O fígado e a deficiência de alfa-1. antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION

O fígado e a deficiência de alfa-1. antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION O fígado e a deficiência de alfa-1 antitripsina (Alfa-1) 1 ALPHA-1 FOUNDATION O que é deficiência de alfa-1 antitripsina? Alfa-1 é uma condição que pode resultar em graves doenças pulmonares em adultos

Leia mais

c) Locus Gênico Local do cromossomo onde se localiza um gene.

c) Locus Gênico Local do cromossomo onde se localiza um gene. Aula Biologia Tio Ton Biologia 1) Conceitos Prévios a) Genética É a ciência que estuda a transmissão de características hereditárias de pais para filhos ao longo das gerações. b) Gene Segmento da molécula

Leia mais


Scrum. Introdução UFRPE-DEINFO BSI-FÁBRICA DE SOFTWARE Scrum Introdução UFRPE-DEINFO BSI-FÁBRICA DE SOFTWARE scrum Ken Schwaber - Jeff Sutherland Scrum Uma forma ágil de gerenciar projetos. Uma abordagem baseada em equipes autoorganizadas.

Leia mais

Você sabia que 56% dos órgãos ofertados não são aproveitados pelas equipes de transplantes?

Você sabia que 56% dos órgãos ofertados não são aproveitados pelas equipes de transplantes? Você sabia que 56% dos órgãos ofertados não são aproveitados pelas equipes de transplantes? O Sistema Nacional de s precisa de nossa ajuda. É chegada a hora de PULSAR VIDA. Através de ações estratégicas,

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Ensinar ciências fazendo ciência com professores e alunos da educação básica

Ensinar ciências fazendo ciência com professores e alunos da educação básica Ensinar ciências fazendo ciência com professores e alunos da educação básica Pavão, Antonio, C.¹, Rocha, Claudiane, F..S.², Silva, Ana, P.³ Espaço Ciência - pavao@ufpe.br¹,

Leia mais

Módulo 3: Gerenciamento da Qualidade, dos Recursos Humanos e das Comunicações

Módulo 3: Gerenciamento da Qualidade, dos Recursos Humanos e das Comunicações ENAP Diretoria de Desenvolvimento Gerencial Coordenação Geral de Educação a Distância Gerência de Projetos - Teoria e Prática Conteúdo para impressão Módulo 3: Gerenciamento da Qualidade, dos Recursos

Leia mais



Leia mais

Fundamentos de manuseio de fibra nas redes da próxima geração

Fundamentos de manuseio de fibra nas redes da próxima geração Documento técnico Fundamentos de manuseio de fibra nas redes da próxima geração Por: Matt Brown Introdução À medida que a demanda por dados continua a aumentar, cresce também a penetração da fibra óptica

Leia mais

O Mito dos Antioxidantes

O Mito dos Antioxidantes A VIDA DE DAVID GEMS VIROU DE CABEÇA PARA BAIXO EM 2006 DEVIDO A UM GRUPO DE vermes que continuou vivendo quando deveria morrer. Corno diretor assistente do Institute of Healthy Aging da University College

Leia mais

Possibilidades Clínicas Atuais para Terapia Gênica e de Células Tronco no Tratamento da Fibrose Cística e Outras Doenças Genéticas

Possibilidades Clínicas Atuais para Terapia Gênica e de Células Tronco no Tratamento da Fibrose Cística e Outras Doenças Genéticas Possibilidades Clínicas Atuais para Terapia Gênica e de Células Tronco no Tratamento da Fibrose Cística e Outras Doenças Genéticas Preparado Por Dace Shugg Professor Bob Williamson AO, FRS Professor de

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais



Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

Desafios regulatórios Até onde vai a liberdade do Pesquisador?

Desafios regulatórios Até onde vai a liberdade do Pesquisador? Desafios regulatórios Até onde vai a liberdade do Pesquisador? Equipe de Identificação de pré-candidatos (internos ou externos) Pré-candidatos selecionados? Criação da Equipe do Projeto - Diretoria Diretória

Leia mais

O que pode a União Europeia fazer pelas pessoas? O Fundo Social Europeu é uma resposta a esta questão

O que pode a União Europeia fazer pelas pessoas? O Fundo Social Europeu é uma resposta a esta questão 1 2 O que pode a União Europeia fazer pelas pessoas? O Fundo Social Europeu é uma resposta a esta questão 3 A origem do Fundo Social Europeu O Fundo Social Europeu foi criado em 1957 pelo Tratado de Roma,

Leia mais


MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS BIOLOGIA MOLECULAR BÁSICA MÓDULO III Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas de animações. Dê uma olhada nas animações

Leia mais

Aplicações da biotecnologia na área animal

Aplicações da biotecnologia na área animal Aplicações da biotecnologia na área animal As aplicações da biotecnologia moderna na área animal são múltiplas e têm um mercado potencial de bilhões de dólares por ano. A competição por tal mercado exige

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

Desenvolvendo Capacidades de PDSA

Desenvolvendo Capacidades de PDSA Desenvolvendo Capacidades de PDSA Karen Martin Como com qualquer habilidade, desenvolver as capacidades do PDSA (planejar fazer estudar agir) tem tudo a ver com a prática. Para conquistar a disciplina

Leia mais

Módulo5. Módulo 5. Planejamento e realização de projeto de mapeamento e modelagem de processos, Responsabilidades, Atividades-chaves, Exercício

Módulo5. Módulo 5. Planejamento e realização de projeto de mapeamento e modelagem de processos, Responsabilidades, Atividades-chaves, Exercício Módulo5 Módulo 5 Planejamento e realização de projeto de mapeamento e modelagem de processos, Responsabilidades, Atividades-chaves, Exercício Todos os direitos de cópia reservados. Não é permitida a distribuição

Leia mais

Diminua seu tempo total de treino e queime mais gordura

Diminua seu tempo total de treino e queime mais gordura Diminua seu tempo total de treino e queime mais gordura Neste artigo vou mostrar o principal tipo de exercício para acelerar a queima de gordura sem se matar durante horas na academia. Vou mostrar e explicar

Leia mais


GUIA BÁSICO DE COMUNICAÇÃO GUIA BÁSICO DE COMUNICAÇÃO CONVERSA DE ELEVADOR Sendo um empreendedor social, você sabe como é importante ser capaz de descrever sua organização, definindo o que diferencia seu trabalho e detalhando o

Leia mais

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa Pesquisa A pesquisa no INCA compreende atividades de produção do conhecimento científico, melhoria dos procedimentos diagnósticos e terapêuticos do câncer e formação de recursos humanos em pesquisa oncológica.

Leia mais

Vigilância do câncer no Canadá

Vigilância do câncer no Canadá 1 Vigilância do câncer no Canadá Apresentado por Howard Morrison, PhD Centro de Prevenção e Controle de Doenças Crônicas Agência de Saúde Pública do Canadá O contexto canadense 2 Indivíduos 4% das mulheres

Leia mais

ERP AIRC. Transição de Ano Económico 2014-2015 (Receita) Apresentado por: AIRC

ERP AIRC. Transição de Ano Económico 2014-2015 (Receita) Apresentado por: AIRC Apresentado por: AIRC Índice 1. INTRODUÇÃO... 3 1.1 ÂMBITO... 3 1.2 OBJETIVOS... 3 1.3 REQUISITOS A OBSERVAR... 3 1.3.1 Versões das aplicações... 3 1.4 RESOLUÇÃO DE PROBLEMAS... 3 2. SCA ENTRADA EM VIGOR

Leia mais

Tudo começou em África

Tudo começou em África Tudo começou em África (Expresso: 25-04-1998) Análises do D A confirmam a origem africana da espécie humana, uma ideia já defendida no século passado por Charles Darwin e Thomas Henry. A nossa árvore genealógica

Leia mais

ISO 14001:2015 Revisão Perguntas Frequentes

ISO 14001:2015 Revisão Perguntas Frequentes Latest update New and revised ISO 14001:2015 Revisão Perguntas Frequentes Introdução A ISO 14001 Sistemas de Gestão Ambiental, a primeira norma ambiental internacional do mundo tem ajudado milhares de

Leia mais

Com Ciência - Células-tronco: a promessa da medicina regenerativa

Com Ciência - Células-tronco: a promessa da medicina regenerativa Página 1 de 5 Editorial A esperança celular Carlos Vogt Reportagens Pesquisa brasileira em CT já apresenta resultados Em meio à discussão ética, a pesquisa avança em todo o mundo Faltam leis, sobra polêmica

Leia mais


II AS OLIMPÍADAS DE BIOTECNOLOGIA II AS OLIMPÍADAS DE BIOTECNOLOGIA FINAL 14 de Maio de 2007 Nas folhas de respostas preencha o cabeçalho com os seus dados e os da escola que representa. A prova tem a duração de 30 minutos. Cada resposta

Leia mais

Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros

Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros Laboratório de Imunovirologia Molecular DBG UFV Prof. Sérgio Oliveira de Paula Tristeza Parasitária Bovina (TPB) Enfermidade hemoparasita

Leia mais

Transgênicos. Aspectos legais, éticos e de biossegurança. Victor Martin Quintana Flores

Transgênicos. Aspectos legais, éticos e de biossegurança. Victor Martin Quintana Flores Transgênicos Aspectos legais, éticos e de biossegurança Victor Martin Quintana Flores Plantas geneticamente transformadas Aspectos relevantes das plantas transgêncas aumento da produtividade das lavouras,

Leia mais

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos Antonio Luiz Gomes Júnior Genotoxicidade Definição: é o setor da genética que estuda os processos que alteram

Leia mais

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA...

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA... Atividade extra Fascículo 4 Biologia Unidade 9 Questão 1 A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA. O processo de divisão celular é composto por cinco etapas:

Leia mais


ATUAÇÃO DO FARMACÊUTICO NA PESQUISA CLÍNICA 2ª Jornada de Ciências Farmacêuticas Centro Universitário Estadual da Zona Oeste UEZO - 2012 ATUAÇÃO DO FARMACÊUTICO NA PESQUISA CLÍNICA Robson Leite de Souza Cruz Instituto de tecnologia em Imunobiológicos

Leia mais


CÂMARA MUNICIPAL DE MANAUS ESTADO DO AMAZONAS GABINETE DO VEREADOR ELIAS EMANUEL PROJETO LEI Nº048/2015. Institui no Calendário Oficial do Município o Dia de Conscientização de Doação ao Transplante de Fígado, a ser celebrado anualmente no dia 27 de setembro, e dá outras providências.

Leia mais

EPIGENÉTICA E NUTRIÇÃO MATERNA. Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas

EPIGENÉTICA E NUTRIÇÃO MATERNA. Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas EPIGENÉTICA E NUTRIÇÃO MATERNA Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas EPIGENÉTICA Estudo da variação herdável que ocorre sem mudança na sequência do DNA Mudanças de longo

Leia mais

Estratégias de Pesquisa

Estratégias de Pesquisa Estratégias de Pesquisa Ricardo de Almeida Falbo Metodologia de Pesquisa Departamento de Informática Universidade Federal do Espírito Santo Agenda Survey Design e Criação Estudo de Caso Pesquisa Ação Experimento

Leia mais



Leia mais

grandes oportunidades

grandes oportunidades Conecte-se a grandes oportunidades Carreiras sem limites Alcance além do que é possível Qualquer que seja o seu caminho, você pode ser parte das mudanças de vida para melhor no mundo todo. Uma carreira

Leia mais

Análise de risco em alimentos, com foco na área de resistência microbiana

Análise de risco em alimentos, com foco na área de resistência microbiana IV CONGRESSO BRASILEIRO DE QUALIDADE DO LEITE Análise de risco em alimentos, com foco na área de resistência microbiana Perigo (hazard): agente biológico, químico ou físico, ou propriedade do alimento

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

TREINO COGNITIVO E ENVELHECIMENTO: na busca da autonomia dos idosos

TREINO COGNITIVO E ENVELHECIMENTO: na busca da autonomia dos idosos TREINO COGNITIVO E ENVELHECIMENTO: na busca da autonomia dos idosos Samara Pereira Cabral - UFPB Monica Dias Palitot - UFPB Joseane da Silva Meireles - UFPB

Leia mais

Guia do Nexus. O Guia Definitivo para o Nexus: O exoesqueleto do desenvolvimento Scrum escalado. Desenvolvido e mantido por Ken Schwaber e Scrum.

Guia do Nexus. O Guia Definitivo para o Nexus: O exoesqueleto do desenvolvimento Scrum escalado. Desenvolvido e mantido por Ken Schwaber e Scrum. Guia do Nexus O Guia Definitivo para o Nexus: O exoesqueleto do desenvolvimento Scrum escalado Desenvolvido e mantido por Ken Schwaber e Tabela de Conteúdo Visão Geral do Nexus... 2 O Propósito

Leia mais



Leia mais

! Pesquisas de votos; ! Serviços de qualidade; ! Pesquisas de opinião pública; ! Em quem você vai votar em Outubro?

! Pesquisas de votos; ! Serviços de qualidade; ! Pesquisas de opinião pública; ! Em quem você vai votar em Outubro? Introdução Tópicos Especiais em E.S.: Surveys Cleidson de Souza LABES - DI - UFPA! Um dos principais exemplos de pesquisa empírica:! Pesquisas de votos;! Serviços de qualidade;! Pesquisas

Leia mais

Transplante de rim. Perguntas frequentes. Avitum

Transplante de rim. Perguntas frequentes. Avitum Transplante de rim Perguntas frequentes Avitum Por que irei precisar de um transplante de rim? Quando o rim de uma pessoa falha há três tratamentos disponíveis: Hemodiálise Diálise Peritoneal Transplante

Leia mais

Otimização através de LIMS e Lean Seis Sigma

Otimização através de LIMS e Lean Seis Sigma Otimização através de LIMS e Lean Seis Sigma Resumo Com uma abordagem prática este trabalho proporcionará uma visão do projeto de implantação de um sistema LIMS com o objetivo de eliminar totalmente o

Leia mais

Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: Ano: Tempo Início: Término: Total: Edição 29 MMXIV O VÍRUS DO PÂNICO

Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: Ano: Tempo Início: Término: Total: Edição 29 MMXIV O VÍRUS DO PÂNICO Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: de Ano: Tempo Início: Término: Total: Edição 29 MMXIV Grupo b O VÍRUS DO PÂNICO VARÍOLA DE CAMUNDONGO [Numeração tâmil (Índia)]

Leia mais

1.- De Mendel a Morgan. Componentes básicos das células

1.- De Mendel a Morgan. Componentes básicos das células 1.- De Mendel a Morgan Componentes básicos das células Conceitos mendelianos de genética QUESTÂO: Existe uma base celular para as características hereditárias? Período 1850-1865: Charles Darwin e Gregor

Leia mais

Rede Nacional de Métodos Alternativos RENAMA. RENAMA: missão e desafios

Rede Nacional de Métodos Alternativos RENAMA. RENAMA: missão e desafios RENAMA: missão e desafios Sumário Primeiros Passos Visão e motivação para a criação da RENAMA Estrutura Institucional Governança Iniciativa de Ensaios Interlaboratoriais Iniciativas Recentes Chamadas Públicas

Leia mais

Monitoramento e Gestão de Risco Sanitário: os desafios do SNVS para o usuário que é sujeito, cidadão e cliente

Monitoramento e Gestão de Risco Sanitário: os desafios do SNVS para o usuário que é sujeito, cidadão e cliente Monitoramento e Gestão de Risco Sanitário: os desafios do SNVS para o usuário que é sujeito, cidadão e cliente Eduardo Hage Carmo Superintendente de Fiscalização, Controle e Monitoramento 15 Encontro da

Leia mais

Algoritmos Genéticos

Algoritmos Genéticos UNIVERSIDADE PRESBITERIANA MACKENZIE Laboratório de Computação Natural LCoN I ESCOLA DE COMPUTAÇÃO NATURAL Algoritmos Genéticos Rafael Xavier e Willyan Abilhoa Outubro/2012

Leia mais

Implementação e avaliação

Implementação e avaliação Seção 3 Implementação e avaliação ESTUDO BÍBLICO Respondendo às mudanças No início de Neemias 4, vemos que algumas pessoas se opuseram ao projeto. Qual foi a resposta de Neemias? (versículo 9) Como Neemias

Leia mais

RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.

RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC. RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.) 1. IDENTIFICAÇÃO DO PROJETO (item a ser preenchido pela

Leia mais

Roteiro para planejamento de cenários na gestão financeira

Roteiro para planejamento de cenários na gestão financeira Roteiro para planejamento de cenários na gestão financeira Planejamento Performance Dashboard Plano de ação Relatórios Indicadores A sua empresa sabe como se preparar para as incertezas do futuro? Conheça

Leia mais