Major Mouse Testing Program: Longevity

Tamanho: px
Começar a partir da página:

Download "Major Mouse Testing Program: Longevity"

Transcrição

1 Major Mouse Testing Program: Longévité Santé Longevity 10/03/2015 Mapeando efeitos a longo prazo na saúde: Teste em larga escala em camundongos idosos usando terapias promissoras contra o envelhecimento e doenças relacionadas 1

2 Dedicamos esta apresentação a L. Stephen Coles, M.D., Ph.D. (19/01/ /12/2014) pioneiro na área de gerontologia e na pesquisa do envelhecimento. Stephen Coles colocou em contato especialistas americanos em camundongos com o grupo de voluntários desse projeto para terem discussões técnicas e ver o que poderia ser feito. Por anos, Dr. Coles administrou a lista de Gerontology Research Group, que serviu como grande fonte de inspiração para esse projeto. 10/03/2015 Major Mouse Testing Program 2

3 Longevidade: A revolução Revolução ocorreu em nematoides ( C. elegans ) Descoberta revolucionária em 1980: 8 maneiras de aumentar a longevidade [1] 1993: Uma mutação dobra expectativa de vida e confere grande vitalidade [2] 2003: Milhares de testes realizados; ~10% aumenta a longevidade [3] 2008: Uma mutação aumentou a longevidade em quase 10 vezes! PASSADO Vermes e camundongos envelhecem de forma diferente Vermes têm um nº fixo de células: manter a viabilidade celular é a chave Camundongos são mamíferos e a regeneração tecidual é a chave A revolução da longevidade está ocorrendo em camundongos e é promissora para humanos A revolução está chegando em camundongos, mas poucos testes foram feitos Tratamentos conhecidos que aumentam a longevidade de camundongos tiveram efeitos benéficos em humanos (aspirina, metformina, metoprolol, rapamicina) Padrões genéticos de aumento de longevidade em camundongos foram encontrados em famílias humanas longevas (Larron-dwards, Foxo-3A, akt-1) Ajude-nos a realizar múltiplos testes em camundongos, para que possam ser aplicados para humanos futuramente PRESENTE 10/03/ Major Mouse Testing Program

4 Resumo do programa Duração 1ª série de experimentos em animais adultos com duração de 18 meses Na outra série será preciso construir novas linhagens, demorando 38 meses Resultados serão checados 3x para que possam ser testados em humanos. A maior parte dos resultados virá 5 anos após o início do programa. Pessoas envolvidas Contactamos diferentes pesquisadores e identificamos grupos de laboratórios com forte experiência em animais, teste de longevidade e em medicina regenerativa Orçamento Custo estimado para os 1000 diferentes testes é de 20M. Há uma correlação direta entre o financiamento, o nº de testes e o cronograma do projeto. D Benefícios esperados: Resultados esperados De 1000 testes esperamos 100 resultados positivos: -Nematoides:10% de testes positivos (muitos testes já feitos) - Em camundongos, ~10% (difícil de estimar: poucos testes feitos) 1. Mudar pensamento da sociedade em todos seus níveis 2. Resultados devem trazer uma visão global sobro que aumenta a longevidade 3. Esperamos atingir um robusto aumento da longevidade 4. Esperamos que alguns tratamentos sejam aplicáveis em humanos Aplicação em estudos de longevidade em humanos Iniciando o programa esse ano, esperamos resultados robustos em menos de 10 anos. 10/03/2015 Major Mouse Testing Program 4

5 O que testar: Intervenções por origem Resultados parciais Longevity DB: mais de 1000 intervenções Banco de dados lista genes humanos estatisticamente correlacionados com longevidade. Para muitos genes, a causalidade pode ser testada em camundongos: Lifespan Observation Database 3359 intervenções que aumenta longevidade: em roedores (114; alguns indefinidos, mas com resultados promissores), nematoides (2400), outras especies Confirmações futuras precisam ser feitas em camundongos: Outras ideias Grupo no Facebook: PotentialGerontodrugs Atualmente mais de 300 posts Cada post contém uma intervenção em potencial para ser testada em camundongos https://www.facebook.com/groups/gerontodrugs Outras fontes Outros bancos de dados parecidos foram encontrados. Fóruns e listas de s foram analisados. Circulamos também em conferências da área um trabalho para listarmos ideias.. O número total de intervenções é grande. Análises para determinar prioridades está em andamento 10/03/2015 Major Mouse Testing Program 5

6 O que testar: Intervenções por classe Variações genéticas em humanos Tratamentos com drogas já usadas em humanos Tratamentos já usados em humanos e que acabam favorecendo uma vida saudável. Conceito: Se camundongos viverem mais e melhor com certa droga, é um forte argumento para que esta esteja de forma causal melhorando a saúde de pessoas. Resultados de pesquisas Normalmente resultados in vitro e in vivo de camundongos, ratos, nematoides, ou mosca-da-fruta, precisam de confirmações de aumento robusto da longevidade e saúde para que possam ser extrapoladas para humanos Diversas terapias em camundongos Variações encontradas em populações humanas que acabam favorecendo uma vida saudável, podendo ser testadas através de terapia gênica em camundongos idosos. Conceito: Se camundongos viverem mais e melhor, é um forte argumento para que essa variação melhora a saúde humana de forma causal, e que futuramente terapia gênica pode ser efetiva também. Terapia gênica em camundongos Banco de dados 10/03/2015 Major Mouse Testing Program 6

7 Cronograma geral Fase I 1 ano Formação de times, financimento e investigação de técnicas Número de intervenções testadas depende do financiamento TESTES INICIANDO COM CAMUNDONGOS IDOSOS Fase II 2 meses Fase III 14 meses Fase IV 18 meses Fase V 18 meses Preparação de equipamentos Teste com 40 a 400 terapias Confirmação e otimização de resultados Início de protocolos em humanos TESTES INICIANDO COM NOVA LINHAGEM DE CAMUNDONGO 2 meses 38 meses 18 meses 18 meses Preparação de equipamentos Teste com 60 a 600 terapias Confirmação e otimização de resultados Início de protocolos em humanos O cronograma da Fase III está detalhado no próximo slide 2 m 100 terapias testadas 10 resultados positivos 20 m 1000 terapias testadas 100 resultados positivos A estimativa financeira encontra-se no slide 17. Contém também o número de testes previstos dependendo do financiamento obtido. 10/03/ Major Mouse Testing Program

8 preparação Fase III 6 meses 30 machos 30 fêmeas 18 meses 14 meses? Resultados positivos da Fase III levarão a Fase IV, que é parecida com a Fase IIIb : validação em roedores idosos de outros laboratórios + estudo dos diversos efeitos na saúde Nascimento Fase IIIa: Inicia-se criando linhagens novas. Maioria genética & muitas outras terapias. 18 meses de idade: Início do tratamento Fase IIIb: Teste Real! Drogas, genética, outros 32 meses de idade: Houve aumento da longevidade em relação ao grupo controle? Decisão para próximos passos 10/03/2015 Major Mouse Testing Program 8

9 Organização Geral Doadores Financiamento Resultados Grupo Longévité Santé, ILA Produtores de camundongos Camundongos Instalações/ Facilities 10/03/2015 Major Mouse Testing Program 9

10 Lista: Para-Fazer Escolher intervenções em potencial Em progresso Identificar fontes de financiamento Presente Refinar metodologia Em progresso Laboratórios necessários para realização do projeto e fazer acordos com estes Contactar investidores em potencial Fazer acordos gerais Calcular custos dos experimentos (equipamentos e mão-de-obra) Em progresso Negociações financeiras mais detalhadas Coletar o necessário para começo do programa Futuro 10/03/2015 Major Mouse Testing Program 10

11 Times e laboratórios Laboratórios: 1. Equipados com estrutura de altíssima qualidade para animais (gaiolas com filtros individuais com ventilação) e 2. Especializados em medicina regenerativa, e em áreas relacionadas com o envelhecimento Arlan Richardson 40 anos de experiência em testes de longo prazo com roedores (compostos e terapia gênica) Laboratory USA (Oklahoma) Alexandra Stolzing Medicina regenerativa & células-tronco Translational Centre for Regenerative Medicine Leipzig University (Leipzig) Jean-Marc Lemaitre Medicina regenerativa em camundongos e células humanas (células-tronco e terapia gênica) Inserm na França (Montpellier) 10/03/2015 Major Mouse Testing Program 11

12 Time de voluntários Agradecimento especial ao time de voluntários: Time principal: Edouard Debonneuil, Rached Messaoudi, Valentin Socolov, Martin Dinov, Daniel Krochmal, Maciej Michalak, Nicoleta Reinald Assistência de: Steve Coles (finado), Johnny Adams, Daria Khaltourina, Matthew Scholz, Didier Coeurnelle, Anton Kulaga, Paul Spiegel, Liz Parrish, Alexandru Chircu, Alexandre Blanc, Dmitri Borisoglebsky, Victor Björk, e tantos outros pesquisadores e voluntários da internet. Longévité & Santé: Encontros semanais para organizar o projeto em La Paillasse, Paris. contribuidores de diferentes países em diferentes ocasiões 10/03/2015 Major Mouse Testing Program 12

13 Obrigado por sua atenção! Versões atualizadas dessa apresentação: Caso queira ajudar, Doações via paypal em De outras maneiras através do IBAN: FR Contato para propor ajuda em pontos específicos O que precisamos mais especificamente: Se você tiver experiência em testes de longevidade em camundongos, ou terapia gênica in vivo, ou incorporação de drogas na comida, ou se pude ajudar nos desenhos experimentais do projeto. Se você souber fontes de financiamento em potencial que possam ajudar, ou se você estiver interessando em escrever projetos de financiamento por favor, não hesite em nos contactar Apresentação do projeto em conferências ou tradução dos slides para outras línguas. Contatos para organizações registradas em seu país, sem fins-lucrativos, pró-longevidade com vantagens fiscais para seus doadores, que possam querer financiar o projeto. P.S: Estamos cientes que alguns links e s desse slide não essão homogêneos. Estamos melhorando isso para as futuras versões. Para esclarecimentos, SLS é Sceaux Longévité Santé, e ALA é o American Longevity Alliance, afiliações sem fins-lucrativos da International Longevity Alliance localizada na França e nos EUA, respectivamente. 3/10/2015 Major Mouse Testing Program 13

14 Apêndice Recapitulação em 3 slides Lista de terapias para testar em camundongos Técnicas de terapia gênica Outros 10/03/2015 Major Mouse Testing Program 14

15 Hoje existem menos de 10 estudos de longevidade em camundongos por ano. Objetivo: 1000 testes em menos de 5 anos Em nematoides, 10% dos milhares de testes foram positivos Em camundongos, também 10% [5/67 por Spindler. S e 5/15 por ITP, 1-2 em comum]: Programa de intervenções, EUA: - NDGA (machos, +10%) - Rapamicina (machos, & fêmeas, %) - Acarbose (machos, +22%) - Aspirina (machos, +10%) - α-estradiol (machos, +10%) Aspirina: baixa mortalidade em humanos (80 mg/dia, 5 anos) Everolimo : em teste em idosos(resistência de vacina contra gripe) Metformina: diminui a mortalidade em humanos Outros resultados estão sendo checados em roedores (Fulereno) 10/03/2015 Major Mouse Testing Program 15

16 Resultados esperados Descobertas em camundongos têm grande potencial para avançar saúde humana a longo prazo 1 Alterar a forma que a sociedade pensa A biologia aplicada está emergindo em relação as inúmeras terapias que previnem ou revertem/silenciam o envelhecimento. Podemos então, aumentar a longevidade do camundongo de forma robusta? Quebra de paradigma na ciência da longevidade Guiar pesquisas para o que realmente aumenta a longevidade. Destacar mecanismos envolvidos. Em conjunto com estatísticas em humanos, esperamos que os resultados possam ser aplicáveis em até 5 anos Grande aumento da longevidade Dos muitos resultados, esperamos que alguns aumentem a longevidade de forma drástica Nova área farmacêutica: saúde a longo prazo Aplicação de drogas já existentes para o envelhecimento e doenças relacionadas 10/03/2015 Major Mouse Testing Program 16

17 Financiamento e Orçamento Nota: Custos estão sendo recalculados. De qualquer maneira, o número de testes será ditado pela quantidade de financiamento Fase III Consideremos que 400 terapias serão testadas em camundongos idosos e 600 terapias exijam novas linhagens; sendo que cada terapia precisa de 60 animais (30 machos e 30 fêmeas) e cada um dos dois sistemas (animais envelhecimentos/linhagens novas) precisam de um controle de 1000 camundongos (desenho assimétrico; 50% macho-fêmea). Consideremos que o manuseamento custa ~1.5 por animal/semana (dependendo das condições) e que cada animal viva em média 27 meses. Um cálculo rápido indica que o custo total do manuseamento é de 1.5*(27*(600* )+9*(400* ))*(30.5/7) = 8 M Consideremos que cada animal idoso custa 100 e que cada animal transgênico custa 30 para ser gerado. O custo inicial do camundongo é de (600* )*100+(400* )*30 = 4.5 M Custo total para a Fase III é de 12.5 M Fase IV Consideremos que 10% das terapias testadas na Fase III sigam para a Fase IV, e que em média, cada terapia na Fase IV custará 6 vezes o custo da Fase III (esse aumento de longevidade precisa ser confirmado e refinado). O custo total da Fase IV é de 12.5*10%*6 = 7.5 M Total O custo total das 1000 terapias seria então = 20 M, com os cáculos acima. As principais fontes de gastos foram detalhados acima. 10/03/2015 Major Mouse Testing Program 17

18 Terapias para testar em camundongos Exemplos de terapias extraídas do grupo do Facebook A L T A P R I O R I D A D E M É D I A Controles de aumento da longevidade: aspirina, metformina, rapamicina, estatinas Snell, Ames, mutações de IGF-1 em idade avançada TA-65, ativador de telomerase, e variante humana de telomerase TM5441(Aumenta 4x a longevidade em camundongos; reduz níveis de PAI, marcador de senescência) Centrofenoxino/Meclofenoxato: reduz níveis de lipofuscina e aumenta longevidade de ratos Farmacoperonas (inverte a mutação em GNRHR) Suplementação de Neuraminidase 1 (reduz parcialmente a doença de Alzheimer) Injeções de GDF11 (reduz parcialmente envelhecimento no coração e cérebro de camundongos) D-Glucosamina (mimético da restrição calórica, aumenta longevidade de camundongos idosos) Dimetilaminoetanol (aumenta longevidade; falta testar doses mais baixas) Trealose (induz autofagia; altera via de IGF-1; elimina proteínas neurodegenerativas) Destruição de 7-cetoColesterol com LysoSENS s (Em breve pronta pra testes) Estabilização genética da estrutura da transtiretina... [MUITAS OUTRAS] Bifosfonatos (usados contra osteoporose, mas parece reduzir a longevidade por outras vias) Suplementação de fulereno em ratos (90% de aumento da longevidade) Tafamidis (tratamento de doença familiar de transtiretina) Suplementação de NAD+... [MUITAS OUTRAS] 3/10/2015 Major Mouse Testing Program 18

19 Outras intervenções promissoras 1. Variações genéticas humanas terapia gênica em camundongos. Variações encontradas em populações humanas que acabam favorecendo uma vida saudável, e que podem ser testadas através de terapia gênica em camundongos idosos. Conceito: Se camundongos viverem mais e melhor, é um forte argumento que essa variação melhore a saúde humana de forma causal, e que a terapia gênica possa ser efetiva também. 2. Tratamento com drogas já usadas em humanas tratamento de drogas em camundongos. Tratamentos usados em humanos e que acabam favorecendo uma vida saudável. Conceito: Se camundongos viverem mais e melhor com certa droga, é um forte argumento para que esta melhore de forma causal a saúde de pessoas. 3. Resultados de pesquisas diversas terapias em camundongos. Normalmente resultados in vitro e in vivo de camundongos, ratos, nematoides ou moscas-da-fruta, precisam de confirmações de aumento robusto da longevidade e saúde para que possam ser extrapoladas para humanos 10/03/2015 Major Mouse Testing Program 19

20 Exemplo: transpor rs rs é uma variação genética humana codifica para a proteína tubulina beta4b. A variante corresponde em ter um T no lugar de um C em algum ponto. Foi encontrado no estudo Framingham Heart Study. Cidadões americanos com duas cópias desta variante tiveram menor risco de doenças cardiovasculares, de câncer e de morte prematura de maneira bastante significativa (p_value = 6e-53) Referência: https://www.ncbi.nlm.nih.gov/pmc/articles/pmc / Camundongos têm o mesmo gene! ("ortólogo") indicando que tem a mesma função. Naturalmente, eles tem um "C", e não um "T". Por isso, queremos dá-los essa mesma variante: parte do gene do camundongo é: "GCCGCATGTCTATGAAGGAGGTGGACGAACAGATGCTTAATGTCCAAAACA«, e o objetivo é transformá-lo em "GCCGCATGTCTATGAAGGAGGTGGATGAACAGATGCTTAATGTCCAAAACA" usando técnicas de CRISPR. Se isso aumentar sua longevidade (melhorar a saúde, etc) é uma confirmação de que funciona em humanos Objetivo é testar rs e também muitos outros candidatos (temos mais de 1400 candidatos!). O que vier de estudos em humanos e for confirmado em camundongos tem grandes chances de funcionar em nós - Depois de 5 anos algumas pessoas (primeiramente talvez pacientes e idosos) começarão a fazer a terapia gênica e serem monitorados quanto sua saúde. - Potencialmente em 10 anos será frequente usar terapia gênica para esses genes para melhora da saúde. 10/03/2015 Major Mouse Testing Program 20

21 Terapia Gênica em animais idosos: técnicas 1. Linhagens sensíveis a drogas Por que usar linhagens específicas e não tratar linhagenes normais? Especialistas nos disseram que técnicas existentes de terapia gênica afetam uma minoria do corpo: mesmo se o gene da longevidade for introduzido, é incerto se terá efeito pronunciado; usando essas técnicas, há o risco de desgastar o programa Eles sugeriram gerar linhagens sensíveis a drogas (http://www.clontech.com/us/products/inducible_systems/protein) Técnica Passo 1 (6 meses): para cada variante genético a ser testado, uma linhagem será contruída; embriões incorporaram a variação com um promotor ativado por drogas usando a técnica de CRISPR e é implantado em fêmeas. A progenia que tiver a mutação é testada; se estiver OK é cruzada para gerar 30 machos e 30 fêmeas para análise da sobrevida. Passo 2 (18 meses): animais são mantidos e alimentados normalmente. Devem se comportar que nem o controle porque a variação não está expressa. Passo 3 (14 meses): Após 18 meses, são alimentados com a droga que ativa o gene. Curva de sobrevivência é comparada com o controle. P.S: Não abandonamos o tratamento de animais idosos normais: 30 machos 30 fêmeas a) Após esses 38 meses, fase IV: para os casos (10%?) com aumento estatístico da longevidade, a variação é testada em animais idosos usando técnicas diferentes (próximos slides) b) Em paralelo nesses 38 meses, técnicas de terapia gênica (próximos slides) já são testadas para genes estabelecidos de longevidade, sendo uma forma de treinar para a) 3/10/2015 Major Mouse Testing Program 21?

22 Terapia Gênica em animais idosos: técnicas 2. Terapia gênica com 18 meses: Alteração genética mediada por vírus Contexto Muitas técnicas podem alterar genes in vivo. Especialistas sugerem que usemos o Adeno- Associated Virus (AAV). Esses vírus incorporam parte de seu DNA no DNA do hospedeiro infectado. Nas últimas décadas, alguns desses foram selecionados para uso científico para serem aplicados em diferentes órgãos: AAV1,AAV2..AAV9. Ex: usaremos como padrão AAV9, por ter tropismo para tecido neural. Técnica Passo 1 (2 meses): Para cada variação genética a ser testada, o AAV incorpora o gene com a técnica de CRISPR sendo injetado em: 1.animais jovens para testar se espalha-se e 2. em 30 machos e fêmeas de 18 meses Passo 2 (14 meses): Sobrevida dos camundongos envelhecidos é comparada com o grupo controle. Limitantes Baixa eficiência: Uma pequena fração de células recebe AAVs e uma menor ainda tem o constructo no núcleo: a chance de agir de forma suficiente para aumentar a longevidade é baixa. Ainda assim, terapia gênica de telomerase já foi descrita com esse método. Aplicação terapêutica: Frequentemente, adultos são infectados por AAVs durante suas vidas. Para esses, a terapia poderia resultar em uma resposta imune que tornaria a terapia pouco eficaz. Pessoas saudáveis podem hesitar em usar essas terapias. (*) Bernardes de Jesus B. et al. (2002) 30 machos 30 fêmeas /10/2015 Major Mouse Testing Program 22 teste? AAV

23 Terapia Gênica em animais idosos: técnicas 3. Expressão transiente após 18 meses: Minicírculos contendo vetor lipossomal Contexto Minicírculos são círculos de DNA. Em camundongos, eles não afetam necessariamente um nº de células maior que AAVs, mas eles não geram respostas imunes tornando-se uma abordagem translacional mais eficaz. Um problema é que em células em divisão o efeito é transiente, necessitando do uso de constantes tratamentos. Técnica Passo 1 (2 meses): Para cada variação a ser testada minicirculos contendo o gene são produzidos em quantitade suficiente usando bactéria modificadas (um plasmidio é criado em E. coli, suas partes procarioticas são removidas = minicírculo: sem resposta imune); são então incorporados em vetores lipossomais (que tem minicírculos) e injectados em animais jovens para testar sua distribuição. Passo 2 (14 meses): Os minicírculos são injetados em 30 machos e 30 fêmeas, a cada duas semanas, iniciando aos 18 meses de idades. A sobrevida é comparada com a do grupo controle Nota Evoluções: A área está mudando rapidamente. Esses slides são, portanto, indicativos: nós podemos escolher melhores técnicas quando/se essas aparecerem e se tornarem robustas (microcírculos, elementos S/MAR ). teste E. coli 30 machos 30 fêmeas? /10/2015 Major Mouse Testing Program 23

24 Terapia Gênica em animais idosos: técnicas 4. Outros Uma questão de tecido-específico Para a maioria das variações genéticas que queremos testas, não sabemos à priori se afetar algum tecido em específico faria sentido. Ex: uma mutação familiar pode estar associada com aumento longevidade em diferentes população sem saber se esses efeitos são através de certos tecidos. Por isso, os slides anteriores eram sobre técnicas gerais: Ex: que são expressas em todo o corpo. Nesses casos, a não ser que já tenha sido demonstrado que o gene aumenta a longevidade, iniciaremos com a técnica longa #1: gerar a linhagem e esperar por sua longevidade. Para casos específicos que certo órgão deve ser afetado, a terapia gênica pode ser bem mais eficiente. Esse é o caso para célular do sangue e do fígado Uma área que cresce rápido Como dito no último slide, técnicas de terapia gênica estão melhorando Pode acontecer que após 6 meses do início dos experimentos, alguma técnica melhor apareça. Mas, seria muito pior esperar décadas para iniciar os experimentos. Pode acontecer também que a técnica #1 seja uma maneira artifical para modelar uma futura terapia gênica que estará disponível para idosos daqui cinco ou dez anos. Nessa perspectiva, essa técnica seria muito melhor que outras (AAVs, minicírculos, ou outras terapias pouco efetivas) 3/10/2015 Major Mouse Testing Program 24

25 Referências As seguintes referências correspondem ao slide nº3 A revolução da longevidade em C elegans [1] Klass MR (1983). "A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results". MECHANISMS OF AGEING AND DEVELOPMENT 22 (3-4): PMID [2] Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R (1993). "A C. elegans mutant that lives twice as long as wild type". Nature (journal) 366 (6454): PMID [3] Lee SS, Lee RY, Fraser AG, Kamath RS, Ahringer J, Ruvkun G (2003). A systematic RNAi screen identifies a critical role for mitochondria in C. elegans longevity. NAT GENET. PMID [4] Ayyadevara S, Alla R, Thaden JJ, Shmookler Reis RJ (2008). "Remarkable longevity and stress resistance of nematode PI3K-null mutants". AGING CELL 7 (1): PMID A futura revolução da longevidade em camundongos Bartke A, Brown- Borg H (2004). Life extension in the dwarf mouse. CURR TOP DEV BIOL. 63: PMID Harrison, D. E., Strong, R., Sharp, Z. D., Nelson, J. F., Astle, C. M., Flurkey, K., Nadon, N. L., Wilkinson, J. E., Frenkel, K., Carter, C. S., Pahor, M., Javors, M. A., Fernandez, E. and Miller, R. A. (2009) Rapamycin fed late in life extends lifespan in genetically heterogeneous mice. NATURE 460: PMID Spindler SR, Mote PL, Li R, Dhahbi JM, Yamakawa A, Flegal JM, Jeske DR, Li R, Lublin AL (2013). β1-adrenergic receptor blockade extends the life span of Drosophila and long-lived mice. AGE. PMID Martin-Montalvo A, Mercken EM, Mitchell SJ, Palacios HH, Mote PL, Scheibye-Knudsen M, Gomes AP, Ward TM, Minor RK, Blouin MJ, Schwab M, Pollak M, Zhang Y, Yu Y, Becker KG, Bohr VA, Ingram DK, Sinclair DA, Wolf NS, Spindler SR, Bernier M, de Cabo R (2013). Metformin improves healthspan and lifespan in mice. NAT COMMUN. 4:2192. PMID /03/2015 Major Mouse Testing Program 25

Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia

Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia Fórum INCA-ASCO sobre Câncer Hereditário Predisposição Genética ao Câncer 21 e 22 de novembro de 2011 Hotel Novo Mundo Flamengo Rio de Janeiro Brasil Rede Nacional de Câncer Familial: Sub-rede de Epidemiologia

Leia mais

TERAPIA GÊNICA. Brasília DF, Julho de 2010.

TERAPIA GÊNICA. Brasília DF, Julho de 2010. Apresentação desenvolvida pelas graduandas em Ciências Farmacêuticas: Ana Carolina Macedo Lima, Ariane Mugnano Castelo Branco, Caroline Cardoso Mendes Souza, Clarisse Danielli Silva Albergaria, Jéssica

Leia mais

Governador Geraldo Alckmin entrega o maior laboratório destinado a pesquisas sobre o câncer da América Latina

Governador Geraldo Alckmin entrega o maior laboratório destinado a pesquisas sobre o câncer da América Latina MATEC ENGENHARIA ENTREGA O MAIOR LABORATORIO PARA PESQUISA DE CÂNCER DA AMÉRICA LATINA Qui, 14/04/11-11h00 SP ganha maior laboratório para pesquisa de câncer da América Latina Instituto do Câncer também

Leia mais

Homeopatia. Copyrights - Movimento Nacional de Valorização e Divulgação da Homeopatia mnvdh@terra.com.br 2

Homeopatia. Copyrights - Movimento Nacional de Valorização e Divulgação da Homeopatia mnvdh@terra.com.br 2 Homeopatia A Homeopatia é um sistema terapêutico baseado no princípio dos semelhantes (princípio parecido com o das vacinas) que cuida e trata de vários tipos de organismos (homem, animais e plantas) usando

Leia mais

CLASSIFICAÇÃO GENÉTICA. Reprodução, Acasalamento, Manutenção e Algumas considerações...

CLASSIFICAÇÃO GENÉTICA. Reprodução, Acasalamento, Manutenção e Algumas considerações... CLASSIFICAÇÃO GENÉTICA Reprodução, Acasalamento, Manutenção e Algumas considerações... Classificação Genética Heterogênicos = outbred Isogênicos = Inbred Acasalamento Aleatório Não-Consangüíneos Acasalamento

Leia mais

Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais colocam o País na vanguarda da medicina mundial

Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais colocam o País na vanguarda da medicina mundial ISTOÉ - Independente Imprimir Especial BRASIL POTÊNCIA Edição: 2095 30.Dez.09-15:00 Atualizado em 06.Fev.13-12:48 Na Dianteira Do Conhecimento Pesquisas brasileiras sobre câncer e doenças cardíacas e cerebrais

Leia mais

EXERCÍCIOS PARA O 8 ANO (2015)

EXERCÍCIOS PARA O 8 ANO (2015) EXERCÍCIOS PARA O 8 ANO (2015) 1- A Fábrica Celular Células de bactérias (procarióticas) e células animais (eucarióticas), apresentam semelhanças e diferenças. a) Qual a estrutura presente em ambas que

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

A patroa quer emagrecer

A patroa quer emagrecer A patroa quer emagrecer A UU L AL A Andando pela rua, você passa em frente a uma farmácia e resolve entrar para conferir seu peso na balança. E aí vem aquela surpresa: uns quilinhos a mais, ou, em outros

Leia mais

Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária.

Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária. Num mundo sem doenças e sem sofrimento, a experimentação animal não seria necessária. Todos os animais, domésticos, selvagens e de laboratório são beneficiados por substâncias testadas em animais. Graças

Leia mais

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

A genética do vírus da gripe

A genética do vírus da gripe A genética do vírus da gripe Para uma melhor compreensão das futuras pandemias é necessário entender sobre as pandemias passadas e os fatores que contribuem para a virulência, bem como estabelecer um compromisso

Leia mais

Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário

Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário Conhecendo os Bancos de Sangue de Cordão Umbilical e Placentário Ajudando futuros pais a tomar uma decisão consciente Agência Nacional de Vigilância Sanitária Anvisa O que é sangue de cordão umbilical

Leia mais

Um novo tipo de câncer

Um novo tipo de câncer Um novo tipo de câncer Cirurgias menos invasivas e tratamentos personalizados são algumas das apostas da ciência para o câncer de cabeça e pescoço. Em visita ao Brasil, médico especialista na área apresenta

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Vera Lúcia de Castro Jaguariúna, 2006.

Vera Lúcia de Castro Jaguariúna, 2006. Aspectos do biomonitoramento da toxicidade perinatal pelos agroquímicos Vera Lúcia de Castro Jaguariúna, 2006. A contaminação ambiental por agroquímicos pode causar efeitos negativos aos recursos naturais

Leia mais

Aula - Terapia Gênica. Unidade Curricular: Cultura de Células Animais. Prof. Me. Leandro Parussolo

Aula - Terapia Gênica. Unidade Curricular: Cultura de Células Animais. Prof. Me. Leandro Parussolo Aula - Terapia Gênica Unidade Curricular: Cultura de Células Animais Prof. Me. Leandro Parussolo O que é? O que não é? O que será? 1990 (EUA) - Primeiro protocolo clínico de Terapia Gênica em humanos 2

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3. 2.1. Objetivos... 3. 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5. 3.1. Objetivo...

1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3. 2.1. Objetivos... 3. 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5. 3.1. Objetivo... 1 ÍNDICE ANALÍTICO 1. INTRODUÇÃO... 3 2. AVALIAÇÃO DE TECNOLOGIAS... 3 2.1. Objetivos... 3 2.2. Escopo... 4 3. VALORAÇÃO DE TECNOLOGIAS... 5 3.1. Objetivo... 5 3.1.1. Negociação para comercialização e

Leia mais

Perspectivas para a indústria farmacêutica brasileira, seus investimentos e suas pesquisas. Ministério da Saúde Brasília, 12 de agosto de 2015

Perspectivas para a indústria farmacêutica brasileira, seus investimentos e suas pesquisas. Ministério da Saúde Brasília, 12 de agosto de 2015 Perspectivas para a indústria farmacêutica brasileira, seus investimentos e suas pesquisas Ministério da Saúde Brasília, 12 de agosto de 2015 POLÍTICA NACIONAL DE ASSISTÊNCIA FARMACÊUTICA Define a assistência

Leia mais

Transplante de rim. Perguntas frequentes. Avitum

Transplante de rim. Perguntas frequentes. Avitum Transplante de rim Perguntas frequentes Avitum Por que irei precisar de um transplante de rim? Quando o rim de uma pessoa falha há três tratamentos disponíveis: Hemodiálise Diálise Peritoneal Transplante

Leia mais

* Substituir o animal vertebrado por um invertebrado ou outra forma de vida inferior, culturas de tecidos/células a simulações em computadores;

* Substituir o animal vertebrado por um invertebrado ou outra forma de vida inferior, culturas de tecidos/células a simulações em computadores; PESQUISAS COM ANIMAIS VERTEBRADOS As regras a seguir foram desenvolvidas baseadas em regulamentações internacionais para ajudar aos alunos pesquisadores a proteger o bem-estar de ambos, o animal pesquisado

Leia mais

Microsoft Project 2003

Microsoft Project 2003 Microsoft Project 2003 1 [Módulo 4] Microsoft Project 2003 2 Definindo durações Inter-relacionamentorelacionamento Caminho crítico Microsoft Project 2003 3 1 Duração das Atividades Microsoft Project 2003

Leia mais

Estruturas das Sessões em TCC

Estruturas das Sessões em TCC Estruturas das Sessões em TCC Eliana Melcher Martins - Mestre em Ciências pelo Depto. de Psicobiologia da UNIFESP - Especialista em Medicina Comportamental pela UNIFESP - Psicóloga Clínica Cognitivo Comportamental

Leia mais

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS ! Universidade Federal de Pernambuco Centro de Ciências da Saúde Departamento de Patologia Laboratório de Imunopatologia Keizo Asami Prof. Dr. Lucas Brandão BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

Leia mais

Estratégias de redução do uso de animais em estudos pré-clínicos. Carlos Kiffer Larissa Fontes Generoso

Estratégias de redução do uso de animais em estudos pré-clínicos. Carlos Kiffer Larissa Fontes Generoso Estratégias de redução do uso de animais em estudos pré-clínicos Carlos Kiffer Larissa Fontes Generoso Introdução Desenvolvimento de produtos farmacêuticos e biotecnológicos: SEGURO EFICAZ Desenvolvimento

Leia mais

Capítulo II Capítulo II

Capítulo II Capítulo II A doença de Alzheimer, a doença de Parkinson e as doenças de expansão de poliglutaminas são doenças neurodegenerativas que se prevê virem a ser a quarta principal causa de custos de saúde em 2030 (World

Leia mais

Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança

Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança Curso de Capacitação em Biossegurança de OGMs Células-tronco Legislação de Biossegurança Florianópolis, Agosto 2004 Células-tronco O que são células-tronco e o que podemos fazer com elas? Qual a relação

Leia mais

Manter se limpo na rua

Manter se limpo na rua Manter se limpo na rua Tradução de literatura aprovada pela Irmandade de NA. Copyright 1993 by Narcotics Anonymous World Services, Inc. Todos os direitos reservados Muitos de nós tiveram o primeiro contato

Leia mais

Projeto Amplitude. Plano de Ação 2015. Conteúdo

Projeto Amplitude. Plano de Ação 2015. Conteúdo Projeto Amplitude Plano de Ação 2015 P r o j e t o A m p l i t u d e R u a C a p i t ã o C a v a l c a n t i, 1 4 7 V i l a M a r i a n a S ã o P a u l o 11 4304-9906 w w w. p r o j e t o a m p l i t u

Leia mais

Fundamentos de manuseio de fibra nas redes da próxima geração

Fundamentos de manuseio de fibra nas redes da próxima geração Documento técnico Fundamentos de manuseio de fibra nas redes da próxima geração Por: Matt Brown Introdução À medida que a demanda por dados continua a aumentar, cresce também a penetração da fibra óptica

Leia mais

O que pode a União Europeia fazer pelas pessoas? O Fundo Social Europeu é uma resposta a esta questão

O que pode a União Europeia fazer pelas pessoas? O Fundo Social Europeu é uma resposta a esta questão 1 2 O que pode a União Europeia fazer pelas pessoas? O Fundo Social Europeu é uma resposta a esta questão 3 A origem do Fundo Social Europeu O Fundo Social Europeu foi criado em 1957 pelo Tratado de Roma,

Leia mais

TREINAMENTO DOS EMBAIXADORES

TREINAMENTO DOS EMBAIXADORES TREINAMENTO DOS EMBAIXADORES LEVANDO O TECHNOVATION À SUA COMUNIDADE Bem-vindo ao treinamento de Embaixadores Regionais! Aqui vai uma visão geral do Technovation para dar um pontapé inicial no seu treinamento.

Leia mais

UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA

UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA Projeto Gene: Ambiente de Apoio à Aprendizagem de Genética Baseado em Tamagotchi

Leia mais

Professor: Curso: Disciplina:

Professor: Curso: Disciplina: Professor: Curso: Disciplina: Aula 1 Turma: Esp. Marcos Morais de Sousa Sistemas de informação Engenharia de Software I Dinâmica da disciplina, plano de curso e avaliação 03º semestre Prof. Esp. Marcos

Leia mais

Ensinar ciências fazendo ciência com professores e alunos da educação básica

Ensinar ciências fazendo ciência com professores e alunos da educação básica Ensinar ciências fazendo ciência com professores e alunos da educação básica Pavão, Antonio, C.¹, Rocha, Claudiane, F..S.², Silva, Ana, P.³ Espaço Ciência - www.espacociencia.pe.gov.br pavao@ufpe.br¹,

Leia mais

Questão - 01. Essência do Excel 2003...

Questão - 01. Essência do Excel 2003... Valdir Questão - 01 Como deve proceder o usuário do Microsoft para que sejam atualizados os cálculos das funções ou fórmulas utilizadas nas planilhas? a) Pressionar a tecla F9 no teclado b) Pressionar

Leia mais

A FORMAÇÃO PROFISSIONAL NA ÁREA DE ECONOMIA E O ENVELHECIMENTO POPULACIONAL BRASILEIRO. Eduardo L.G. Rios-Neto Demógrafo e Economista CEDEPLAR/UFMG

A FORMAÇÃO PROFISSIONAL NA ÁREA DE ECONOMIA E O ENVELHECIMENTO POPULACIONAL BRASILEIRO. Eduardo L.G. Rios-Neto Demógrafo e Economista CEDEPLAR/UFMG A FORMAÇÃO PROFISSIONAL NA ÁREA DE ECONOMIA E O ENVELHECIMENTO POPULACIONAL BRASILEIRO Eduardo L.G. Rios-Neto Demógrafo e Economista /UFMG ENVELHECIMENTO E CURSOS DE ECONOMIA O grande problema de discutir

Leia mais

Aula 01 - Formatações prontas e condicionais. Aula 01 - Formatações prontas e condicionais. Sumário. Formatar como Tabela

Aula 01 - Formatações prontas e condicionais. Aula 01 - Formatações prontas e condicionais. Sumário. Formatar como Tabela Aula 01 - Formatações prontas e Sumário Formatar como Tabela Formatar como Tabela (cont.) Alterando as formatações aplicadas e adicionando novos itens Removendo a formatação de tabela aplicada Formatação

Leia mais

As empresas farmacêuticas não se importam com a DH, certo?

As empresas farmacêuticas não se importam com a DH, certo? Notícias científicas sobre a Doença de Huntington. Em linguagem simples. Escrito por cientistas. Para toda a comunidade Huntington. Entrevista: Graeme Bilbe, chefe global de Neurociências na Novartis O

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

COMISSÃO TEMPORÁRIA SOBRE A GENÉTICA HUMANA E OUTRAS NOVAS TECNOLOGIAS DA MEDICINA MODERNA

COMISSÃO TEMPORÁRIA SOBRE A GENÉTICA HUMANA E OUTRAS NOVAS TECNOLOGIAS DA MEDICINA MODERNA COMISSÃO TEMPORÁRIA SOBRE A GENÉTICA HUMANA E OUTRAS NOVAS TECNOLOGIAS DA MEDICINA MODERNA AUDIÇÃO de 26 de Abril de 2001 Carlos Alonso BEDATE Curriculum académico Licenciado em Filosofia Universidade

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Será que doses elevadas de creatina "atrasam o início clínico" da doença de Huntington? Porquê a creatina?

Será que doses elevadas de creatina atrasam o início clínico da doença de Huntington? Porquê a creatina? Notícias científicas sobre a Doença de Huntington. Em linguagem simples. Escrito por cientistas. Para toda a comunidade Huntington. Será que doses elevadas de creatina "atrasam o início clínico" da doença

Leia mais

Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa. Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa

Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa. Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa Comitê de Ética no Uso de Animais (CEUA) Protocolo de Pesquisa Protocolo nº: (uso da CEUA) Data de Entrega / / (uso da CEUA) Título do Projeto Pesquisador-chefe Departamento Unidade Acadêmica - - - - -

Leia mais

Roteiro para planejamento de cenários na gestão financeira

Roteiro para planejamento de cenários na gestão financeira Roteiro para planejamento de cenários na gestão financeira Planejamento Performance Dashboard Plano de ação Relatórios Indicadores A sua empresa sabe como se preparar para as incertezas do futuro? Conheça

Leia mais

Medindo a Produtividade do Desenvolvimento de Aplicativos

Medindo a Produtividade do Desenvolvimento de Aplicativos Medindo a Produtividade do Desenvolvimento de Aplicativos Por Allan J. Albrecht Proc. Joint SHARE/GUIDE/IBM Application Development Symposium (October, 1979), 83-92 IBM Corporation, White Plains, New York

Leia mais

acebook Analytics Ferramentas e experimentos para conseguir melhores resultados através das métricas adequadas.

acebook Analytics Ferramentas e experimentos para conseguir melhores resultados através das métricas adequadas. acebook Analytics Ferramentas e experimentos para conseguir melhores resultados através das métricas adequadas. 2 INTRODUÇÃO Em um curto espaço de tempo, vimos o Facebook ir do zero ao status de uma das

Leia mais

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi VIROLOGIA HUMANA Professor: Bruno Aleixo Venturi O que são vírus? A palavra vírus tem origem latina e significa "veneno". Provavelmente esse nome foi dado devido às viroses, que são doenças causadas por

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

Desafios regulatórios Até onde vai a liberdade do Pesquisador?

Desafios regulatórios Até onde vai a liberdade do Pesquisador? Desafios regulatórios Até onde vai a liberdade do Pesquisador? Equipe de Identificação de pré-candidatos (internos ou externos) Pré-candidatos selecionados? Criação da Equipe do Projeto - Diretoria Diretória

Leia mais

Como Criar uma Aula? Na página inicial do Portal do Professor, acesse ESPAÇO DA AULA: Ao entrar no ESPAÇO DA AULA, clique no ícone Criar Aula :

Como Criar uma Aula? Na página inicial do Portal do Professor, acesse ESPAÇO DA AULA: Ao entrar no ESPAÇO DA AULA, clique no ícone Criar Aula : Como Criar uma Aula? Para criar uma sugestão de aula é necessário que você já tenha se cadastrado no Portal do Professor. Para se cadastrar clique em Inscreva-se, localizado na primeira página do Portal.

Leia mais

c) Locus Gênico Local do cromossomo onde se localiza um gene.

c) Locus Gênico Local do cromossomo onde se localiza um gene. Aula Biologia Tio Ton Biologia 1) Conceitos Prévios a) Genética É a ciência que estuda a transmissão de características hereditárias de pais para filhos ao longo das gerações. b) Gene Segmento da molécula

Leia mais

GUIa Prático para enfrentar a concorrência no e-commerce

GUIa Prático para enfrentar a concorrência no e-commerce GUIa Prático para enfrentar a concorrência no e-commerce Você é do tipo que quer arrancar os cabelos toda vez que um concorrente diminui o preço? Então você precisa ler este guia rápido agora mesmo. Aqui

Leia mais

GUIA BÁSICO DE COMUNICAÇÃO

GUIA BÁSICO DE COMUNICAÇÃO GUIA BÁSICO DE COMUNICAÇÃO CONVERSA DE ELEVADOR Sendo um empreendedor social, você sabe como é importante ser capaz de descrever sua organização, definindo o que diferencia seu trabalho e detalhando o

Leia mais

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Darwin Voltar Filogenia anatômica e fisiológica Filogênia Molecular A teoria da evolução de Darwin gerou o conceito

Leia mais

AVALIAÇÃO DA EPIDEMIA DE AIDS NO RIO GRANDE DO SUL dezembro de 2007

AVALIAÇÃO DA EPIDEMIA DE AIDS NO RIO GRANDE DO SUL dezembro de 2007 AVALIAÇÃO DA EPIDEMIA DE AIDS NO RIO GRANDE DO SUL dezembro de 2007 Notas importantes: O Banco de dados (BD) do Sistema de Informação Nacional de Agravos de Notificação (SINAN) vem sofrendo nos últimos

Leia mais

O Mito dos Antioxidantes

O Mito dos Antioxidantes A VIDA DE DAVID GEMS VIROU DE CABEÇA PARA BAIXO EM 2006 DEVIDO A UM GRUPO DE vermes que continuou vivendo quando deveria morrer. Corno diretor assistente do Institute of Healthy Aging da University College

Leia mais

Estratégias de Pesquisa

Estratégias de Pesquisa Estratégias de Pesquisa Ricardo de Almeida Falbo Metodologia de Pesquisa Departamento de Informática Universidade Federal do Espírito Santo Agenda Survey Design e Criação Estudo de Caso Pesquisa Ação Experimento

Leia mais

4 Arquitetura básica de um analisador de elementos de redes

4 Arquitetura básica de um analisador de elementos de redes 4 Arquitetura básica de um analisador de elementos de redes Neste capítulo é apresentado o desenvolvimento de um dispositivo analisador de redes e de elementos de redes, utilizando tecnologia FPGA. Conforme

Leia mais

Aula 3 Introdução à Avaliação de Impacto Aula 3

Aula 3 Introdução à Avaliação de Impacto Aula 3 Aula 3 Introdução à Avaliação de Impacto Aula 3 Introdução à Avaliação de Impacto Quando a chuva cai, necessariamente, a rua fica molhada. Se a rua está molhada, pode ter chovido. Mas, não necessariamente!

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.

RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC. RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.) 1. IDENTIFICAÇÃO DO PROJETO (item a ser preenchido pela

Leia mais

Construção de Ambientes de Saúde

Construção de Ambientes de Saúde Construção de Ambientes de Saúde Implantamos o que planejamos Se você recebeu este material provavelmente o projeto de seu ambiente de saúde foi feito conosco. Na L+M, é assim. Apostamos tanto em nossos

Leia mais

ERP AIRC. Transição de Ano Económico 2014-2015 (Receita) Apresentado por: AIRC

ERP AIRC. Transição de Ano Económico 2014-2015 (Receita) Apresentado por: AIRC Apresentado por: AIRC Índice 1. INTRODUÇÃO... 3 1.1 ÂMBITO... 3 1.2 OBJETIVOS... 3 1.3 REQUISITOS A OBSERVAR... 3 1.3.1 Versões das aplicações... 3 1.4 RESOLUÇÃO DE PROBLEMAS... 3 2. SCA ENTRADA EM VIGOR

Leia mais

TRAJECTA NEURO LABS G5

TRAJECTA NEURO LABS G5 Trajecta :: Robôs Investidores TRAJECTA NEURO LABS G5 Guia Rápido de configuração e operação 22/05/2015 Autor: Rogério Figurelli CEO Trajecta Sumário 1) Neuro Labs a Versão Labs do Neuro Robô... 3 2) Módulos

Leia mais

Educação a distância: desafios e descobertas

Educação a distância: desafios e descobertas Educação a distância: desafios e descobertas Educação a distância: Desafios e descobertas Conteudista: Equipe Multidisciplinar Campus Virtual Cruzeiro do Sul Você na EAD Educação a distância: desafios

Leia mais

AVALIAÇÃO DA EPIDEMIA DE AIDS NO RIO GRANDE DO SUL dezembro de 2007

AVALIAÇÃO DA EPIDEMIA DE AIDS NO RIO GRANDE DO SUL dezembro de 2007 AVALIAÇÃO DA EPIDEMIA DE AIDS NO RIO GRANDE DO SUL dezembro de 2007 Notas importantes: O Banco de dados (BD) do Sistema de Informação Nacional de Agravos de Notificação (SINAN) vem sofrendo nos últimos

Leia mais

Rede Nacional de Métodos Alternativos RENAMA. RENAMA: missão e desafios

Rede Nacional de Métodos Alternativos RENAMA. RENAMA: missão e desafios RENAMA: missão e desafios Sumário Primeiros Passos Visão e motivação para a criação da RENAMA Estrutura Institucional Governança Iniciativa de Ensaios Interlaboratoriais Iniciativas Recentes Chamadas Públicas

Leia mais

Aula 5 Técnicas para Estimação do Impacto

Aula 5 Técnicas para Estimação do Impacto Aula 5 Técnicas para Estimação do Impacto A econometria é o laboratório dos economistas, que busca reproduzir o funcionamento do mundo de forma experimental, como se faz nas ciências naturais. Os modelos

Leia mais

TREINO COGNITIVO E ENVELHECIMENTO: na busca da autonomia dos idosos

TREINO COGNITIVO E ENVELHECIMENTO: na busca da autonomia dos idosos TREINO COGNITIVO E ENVELHECIMENTO: na busca da autonomia dos idosos Samara Pereira Cabral - UFPB samarapcj@hotmail.com Monica Dias Palitot - UFPB monicadiaspt@yahoo.com.br Joseane da Silva Meireles - UFPB

Leia mais

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos.

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos. Questão 1 Você é um imunologista que quer ficar rico e decide deixar o mundo da ciência, conseguindo um emprego como consultor de roteiro em um novo seriado de drama médico. Você avalia o conhecimento

Leia mais

Vigilância do câncer no Canadá

Vigilância do câncer no Canadá 1 Vigilância do câncer no Canadá Apresentado por Howard Morrison, PhD Centro de Prevenção e Controle de Doenças Crônicas Agência de Saúde Pública do Canadá O contexto canadense 2 Indivíduos 4% das mulheres

Leia mais

Scrum. Introdução UFRPE-DEINFO BSI-FÁBRICA DE SOFTWARE

Scrum. Introdução UFRPE-DEINFO BSI-FÁBRICA DE SOFTWARE Scrum Introdução UFRPE-DEINFO BSI-FÁBRICA DE SOFTWARE scrum Ken Schwaber - Jeff Sutherland http://www.scrumalliance.org/ Scrum Uma forma ágil de gerenciar projetos. Uma abordagem baseada em equipes autoorganizadas.

Leia mais

Métodos qualitativos:

Métodos qualitativos: Métodos AULA 11 qualitativos: Pesquisa-Ação Quando iniciou-se a pesquisa-ação? Para Susman e Evered (1978), o termo pesquisa-ação foi introduzido por Kurt Lewin em 1946 para denotar uma abordagem pioneira

Leia mais

Lidar com números e estatísticas não é fácil. Reunir esses números numa apresentação pode ser ainda mais complicado.

Lidar com números e estatísticas não é fácil. Reunir esses números numa apresentação pode ser ainda mais complicado. , ()! $ Lidar com números e estatísticas não é fácil. Reunir esses números numa apresentação pode ser ainda mais complicado. Uma estratégia muito utilizada para organizar visualmente informações numéricas

Leia mais

II AS OLIMPÍADAS DE BIOTECNOLOGIA

II AS OLIMPÍADAS DE BIOTECNOLOGIA II AS OLIMPÍADAS DE BIOTECNOLOGIA FINAL 14 de Maio de 2007 Nas folhas de respostas preencha o cabeçalho com os seus dados e os da escola que representa. A prova tem a duração de 30 minutos. Cada resposta

Leia mais

Webnário Ao Vivo. Top Produtor do Hotmart Revela Todos os Segredos Para Atingir o Sucesso Online.

Webnário Ao Vivo. Top Produtor do Hotmart Revela Todos os Segredos Para Atingir o Sucesso Online. Webnário Ao Vivo Top Produtor do Hotmart Revela Todos os Segredos Para Atingir o Sucesso Online. Por que muitos produtores publicam seus produtos no Hotmart mas não conseguem deixa-los entre os mais

Leia mais

A POSIÇÃO DO MUNICÍPIO DE SÃO JOSÉ DOS CAMPOS (SP) EM RELAÇÃO AO ÍNDICE DE DESENVOLVIMENTO HUMANO (IDH) E AO ÍNDICE DE GINI

A POSIÇÃO DO MUNICÍPIO DE SÃO JOSÉ DOS CAMPOS (SP) EM RELAÇÃO AO ÍNDICE DE DESENVOLVIMENTO HUMANO (IDH) E AO ÍNDICE DE GINI A POSIÇÃO DO MUNICÍPIO DE SÃO JOSÉ DOS CAMPOS (SP) EM RELAÇÃO AO ÍNDICE DE DESENVOLVIMENTO HUMANO (IDH) E AO ÍNDICE DE GINI Roland Anton Zottele 1, Friedhilde M. K. Manulescu 2 1, 2 Faculdade de Ciências

Leia mais

BIOLOGIA IACI BELO. Como duas espécies distintas podem evoluir para formas idênticas?

BIOLOGIA IACI BELO. Como duas espécies distintas podem evoluir para formas idênticas? BIOLOGIA IACI BELO www.iaci.com.br ASSUNTO: EVOLUÇÃO CONVERGENTE Série: 3EM Como duas espécies distintas podem evoluir para formas idênticas? por Joshua Clark - traduzido por HowStuffWorks Brasil Há cerca

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Introdução. O que é um survey? Projeto de Surveys. Tópicos Especiais em E.S.: Surveys. Cleidson de Souza. representatividade de amostras;

Introdução. O que é um survey? Projeto de Surveys. Tópicos Especiais em E.S.: Surveys. Cleidson de Souza. representatividade de amostras; Introdução Tópicos Especiais em E.S.: Surveys Cleidson de Souza LABES - DI - UFPA cdesouza@ufpa.br! Um dos principais exemplos de pesquisa empírica:! Pesquisas de votos;! Pesquisas de opinião pública;!

Leia mais

Gorduras, Alimentos de Soja e Saúde do Coração Análise das Evidências

Gorduras, Alimentos de Soja e Saúde do Coração Análise das Evidências Gorduras, Alimentos de Soja e Saúde do Coração Análise das Evidências Documento de posição do Comité Consultivo Científico da ENSA Introdução Há muito que os cientistas reconhecem o papel importante que

Leia mais

ELABORAÇÃO DE PROJETOS

ELABORAÇÃO DE PROJETOS Unidade II ELABORAÇÃO DE PROJETOS DE PESQUISA Profa. Eliane Gomes Rocha Pesquisa em Serviço Social As metodologias qualitativas de pesquisa são utilizadas nas Ciências Sociais e também no Serviço Social,

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

Expectativa de vida do brasileiro cresce mais de três anos na última década

Expectativa de vida do brasileiro cresce mais de três anos na última década 1 FUNDAMENTOS DA EDUCAÇÃO PROFESSOR BAHIA TEXTO DE CULTURA GERAL FONTE: UOL COTIDIANO 24/09/2008 Expectativa de vida do brasileiro cresce mais de três anos na última década Fabiana Uchinaka Do UOL Notícias

Leia mais

Declaração de Helsinque Associação Médica Mundial

Declaração de Helsinque Associação Médica Mundial A. Introdução Declaração de Helsinque Associação Médica Mundial Princípios éticos para as pesquisas médicas em seres humanos Adotado pela 18ª Assembléia Médica Mundial Helsinque, Finlândia, junho do 1964

Leia mais

CAPÍTULO 9 Exercícios Resolvidos

CAPÍTULO 9 Exercícios Resolvidos CAPÍTULO 9 Exercícios Resolvidos R9.1) Diâmetro de esferas de rolamento Os dados a seguir correspondem ao diâmetro, em mm, de 30 esferas de rolamento produzidas por uma máquina. 137 154 159 155 167 159

Leia mais

3 Dicas MATADORAS Para Escrever Emails Que VENDEM Imóveis

3 Dicas MATADORAS Para Escrever Emails Que VENDEM Imóveis 3 Dicas MATADORAS Para Escrever Emails Que VENDEM Imóveis O que é um e- mail bem sucedido? É aquele e- mail que você recebe o contato, envia o e- mail para o cliente e ele te responde. Nós não estamos

Leia mais

RESPOSTA FÍSICA TOTAL

RESPOSTA FÍSICA TOTAL RESPOSTA FÍSICA TOTAL Valdelice Prudêncio Lima UEMS João Fábio Sanches Silva UEMS O método apresentado é baseado na coordenação da fala e da ação, desenvolvido por James Asher, professor de psicologia

Leia mais

Guia de Uso. O Pro-Treino tem uma divisão clara de funções, apresentada a seguir: E três tipos de usuários que executam as funções descritas acima:

Guia de Uso. O Pro-Treino tem uma divisão clara de funções, apresentada a seguir: E três tipos de usuários que executam as funções descritas acima: Sumário 1. Introdução... 2 2. Conceitos básicos... 2 2.1. Fluxo do sistema... 3 2.2. Acesso ao sistema... 4 2.2.1. Login... 4 2.2.2. Logoff... 4 2.2.3. Esqueci minha senha... 5 2.3. Conhecendo o Sistema...

Leia mais

Alunos de 6º ao 9 anos do Ensino Fundamental

Alunos de 6º ao 9 anos do Ensino Fundamental Alunos de 6º ao 9 anos do Ensino Fundamental Resumo Este projeto propõe a discussão da Década de Ações para a Segurança no Trânsito e a relação dessa com o cotidiano dos alunos, considerando como a prática

Leia mais

Desenvolvendo Capacidades de PDSA

Desenvolvendo Capacidades de PDSA Desenvolvendo Capacidades de PDSA Karen Martin Como com qualquer habilidade, desenvolver as capacidades do PDSA (planejar fazer estudar agir) tem tudo a ver com a prática. Para conquistar a disciplina

Leia mais

O IMPACTO DA UTILIZAÇÃO DE UM SOFTWARE DE GERENCIAMENTO ELETRÔNICO DE PROJETOS NAS EMPRESAS

O IMPACTO DA UTILIZAÇÃO DE UM SOFTWARE DE GERENCIAMENTO ELETRÔNICO DE PROJETOS NAS EMPRESAS O IMPACTO DA UTILIZAÇÃO DE UM SOFTWARE DE GERENCIAMENTO ELETRÔNICO DE PROJETOS NAS EMPRESAS Nadia Al-Bdywoui (nadia_alb@hotmail.com) Cássia Ribeiro Sola (cassiaribs@yahoo.com.br) Resumo: Com a constante

Leia mais

! Pesquisas de votos; ! Serviços de qualidade; ! Pesquisas de opinião pública; ! Em quem você vai votar em Outubro?

! Pesquisas de votos; ! Serviços de qualidade; ! Pesquisas de opinião pública; ! Em quem você vai votar em Outubro? Introdução Tópicos Especiais em E.S.: Surveys Cleidson de Souza LABES - DI - UFPA cdesouza@ufpa.br! Um dos principais exemplos de pesquisa empírica:! Pesquisas de votos;! Serviços de qualidade;! Pesquisas

Leia mais

Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: Ano: Tempo Início: Término: Total: Edição 29 MMXIV O VÍRUS DO PÂNICO

Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: Ano: Tempo Início: Término: Total: Edição 29 MMXIV O VÍRUS DO PÂNICO Instituto de Educação Infantil e Juvenil Primavera, 2014. Londrina, Nome: de Ano: Tempo Início: Término: Total: Edição 29 MMXIV Grupo b O VÍRUS DO PÂNICO VARÍOLA DE CAMUNDONGO [Numeração tâmil (Índia)]

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais