UNIVERSIDADE ESTADUAL DE SANTA CRUZ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA E BIOLOGIA MOLECULAR

Tamanho: px
Começar a partir da página:

Download "UNIVERSIDADE ESTADUAL DE SANTA CRUZ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA E BIOLOGIA MOLECULAR"

Transcrição

1 UNIVERSIDADE ESTADUAL DE SANTA CRUZ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA E BIOLOGIA MOLECULAR Análise da biodiversidade metagenômica bacteriana de um solo de Mata Atlântica da Bahia e isolamento de DNA de alto peso molecular visando aplicações biotecnológicas Tharcilla Nascimento da Silva ILHÉUS BAHIA BRASIL Abril de 2007

2 THARCILLA NASCIMENTO DA SILVA Análise da biodiversidade metagenômica bacteriana de um solo de Mata Atlântica da Bahia e isolamento de DNA de alto peso molecular visando aplicações biotecnológicas Dissertação apresentada à Universidade Estadual de Santa Cruz, como parte das exigências para obtenção do título de Mestre em Genética e Biologia Molecular. ILHÉUS BAHIA BRASIL Abril de 2007

3 THARCILLA NASCIMENTO DA SILVA Análise da biodiversidade metagenômica bacteriana de um solo de Mata Atlântica da Bahia e isolamento de DNA de alto peso molecular visando aplicações biotecnológicas. Dissertação apresentada à Universidade Estadual de Santa Cruz, como parte das exigências para obtenção do título de Mestre em Genética e Biologia Molecular. APROVADA: Dra. Ana Paula Trovatti Dr. Eduardo Gross Dr. Martin Brendel Uetanabaro (UEFS) (UESC) (UESC) Dr. Júlio Cézar de Mattos Cascardo (UESC Orientador)

4 "Não confunda jamais conhecimento com sabedoria. Um o ajuda a ganhar a vida; o outro a construir uma vida." (Sandra Carey)

5 A Deus por ter me capacitado e me concedido mais uma vitória, sabendo que muito mais ainda está porvir. A Ele todo louvor e glória! DEDICO Aos meus pais, Juracy e Fátima, por todo sacrifício, carinho, apoio, confiança, pelas palavras proferidas nos momentos de tanta dificuldade. Agradeço a eles por tudo que tenho e sou. Às minhas irmãs, Cíntia, Thirza e Vívian por todo incentivo e amor. Ao meu esposo Wagner Macena por tanto amor, compreensão, paciência e incentivo nos momentos mais precisos, até mesmo quando estava distante fisicamente. Com mor OFEREÇO ii

6 AGRADECIMENTOS A Deus, que me deu força e serenidade para persistir diante das dificuldades e para cumprir esta jornada. Ao meu querido orientador, Dr. Júlio Cezar de Mattos Cascardo, pela orientação, confiança neste nosso desafio, e constante disponibilidade, presteza e boa vontade. A Dra Rachel Passos Rezende pela co-orientação, confiança e incentivo. Ao Prof Dr. João Carlos Teixeira Dias pela importante contribuição no desenvolvimento deste trabalho, assim também pelo estímulo e pelos conhecimentos trocados. Ao Mestrado em Genética Biologia Molecular da Universidade Estadual de Santa Cruz e à Fundação de Amparo à Pesquisa do Estado da Bahia (FAPESB), pela oportunidade de realização do curso e pela bolsa concedida. Aos professores do Mestrado em Genética e Biologia Molecular da UESC, pelos ensinamentos. Ao professor Carlos Priminho Pirovani pela amizade, apoio, incentivo, disposição, mesmo em atividades extra-acadêmicas, conselhos, enfim... Se é alguém que desejo deixar bem clara minha gratidão e satisfação pela amizade, é a você Priminho. Aos colegas Ramon Vidal e Cristiano Villela pela grande colaboração nos trabalhos de bioinformática. Aos amigos do laboratório de Genética, Monitoramento Ambiental, Cultura de Tecidos e Marcadores Moleculares pelos auxílios direto ou indireto, e pelos momentos compartilhados. Às amigas e colegas de mestrado, em especial à Carol, Lívia, Brena e Jamilly pelo apoio, incentivo e sincera amizade. Ao Gileno Jr. e ao Jaime Henrique pela união e parceria, todos em busca de um mesmo ideal, a obtenção de muito resultados e o progresso da metagenômica na UESC. Ao Robson pelo Seqüenciamento das placas de 16S e Fosmídeos. iii

7 Também ao Antônio Carlos, o Pelé! Pessoa muito prestativa, que sempre me deu apoio e ajuda nos momentos em que precisei, naqueles de muita atividade laboratorial. Ao meu amorzinho, que por tanto tempo, ficou me acompanhando durante a semana, inclusive sábados, domingos e feriados, onde saíamos da UESC altas horas, muitas vezes, tinha até que me ajudar, para que nós não ficássemos até mesmo nas madrugadas nos laboratórios.os experimentos pareciam que nunca iam acabar, foi muito suor e dedicação minha, e muita paciência e compreensão sua meu amor. A todos que direta ou indiretamente colaboraram na condução deste trabalho. iv

8 ÍNDICE EXTRATO...vii ABSTRACT...ix LISTA DE FIGURAS...xi LISTA DE TABELAS...xiv 1. INTRODUÇÃO REVISÃO BIBLIOGRÁFICA Mata Atlântica Os microrganismos e o solo Organismos vivos e sua diversidade A diversidade microbiana e os métodos moleculares aplicados na sua detecção Marcadores Moleculares no estudo da diversidade A metagenômica e a biotecnologia METODOLOGIA Coleta das amostras de solo da Mata Atlântica Métodos de extração ex situ de DNA utilizados Clonagem do DNA para estudo da biodiversidade do solo em estudo Amplificação do gene 16S rdna Ligação do 16S rdna ao vetor Transformação bacteriana Coleta dos clones transformantes Extração do DNA plasmidial dos clones para sequenciamento Análise de Bioinformática das seqüências obtidas pelo sequenciamento Preparo das seqüências para filtração das seqüências 16S rdna Diagnóstico filogenético Análise Restrição de DNA Ribossomal Amplificado (ARDRA) A análise de filogenia a partir de ARDRA Clonagem do DNA para estudo funcional...24 v

9 Identificação dos clones Coleta dos clones Indução dos clones fosmídeos a um alto número de cópia Extração do DNA plasmidial dos clones para sequenciamento Digestão dos clones para confirmar inserção dos fragmentos Análise de Bioinformática das seqüências RESULTADOS Análise físico-química do solo de Mata Atlântica Extração de DNA Análise da Biodiversidade Construção da biblioteca de 16S rdna Sequenciamento dos clones contendo o inserto de 16S rdna Análise de Bioinformática das seqüências obtidas pelo sequenciamento Análise dos dados obtidos pela análise de ARDRA Confecção da biblioteca de fosmídeo com solo de Mata Atlântica DISCUSSÃO Microrganismos e o solo de Mata Atlântica Biodiversidade bacteriana do solo de Mata Atlântica Confecção de biblioteca fosmídeos CONCLUSÕES REFERÊNCIAS BIBLIOGRÁFICAS APÊNDICES...80 vi

10 EXTRATO SILVA, Tharcilla Nascimento. Universidade Estadual de Santa Cruz, Ilhéus, abril de Análise da biodiversidade metagenômica bacteriana de um solo de Mata Atlântica da Bahia e isolamento de DNA de alto peso molecular visando aplicações biotecnológicas. Orientador: Júlio Cézar de Mattos Cascardo. Coorientadora: Rachel Passos Rezende. Conselheiro: João Carlos Teixeira Dias. A Mata Atlântica é a segunda maior floresta tropical úmida do Brasil, possui uma importância social e ambiental enorme. Encontra-se hoje extremamente reduzida, sendo uma das florestas tropicais mais ameaçadas do globo. Apesar de reduzida a poucos fragmentos, a biodiversidade de seu ecossistema é uma das maiores do planeta. Muito se conhece sobre a diversidade de sua fauna e flora, mas pouco se conhece acerca da sua diversidade bacteriana. Esse trabalho revela as primeiras descrições da diversidade bacteriana do solo de Mata Atlântica através de métodos moleculares independentes de cultivo. O DNA total dessas amostras foi extraído e usado tanto para análise de filogenia como para identificação de possíveis genes com aplicações biotecnológicas. As amostras de solo, foram coletadas da Fazenda Caimbi, distrito de Olivença -Ilhéus/BA. Para o primeiro objetivo, usou-se o DNA total como molde em uma reação de PCR com iniciadores universais para o gene 16S rdna de Bacteria. O produto de PCR amplificado foi clonado no vetor ptz57r/t e a seqüência do gene 16S rdna foi determinada através do sequenciamento. Além do estudo baseado em sequenciamento das amostras, o perfil molecular da comunidade microbiana foi determinado também por ARDRA, utilizando-se as enzimas AluI,HhaI e MspI, para ratificar os dados obtidos e a eficácia de ambas as técnicas. ARDRA se revelou um marcador promissor para vii

11 comparar a comunidade microbiana presente neste solo. Com fim biotecnológico, o DNA total foi fisicamente fragmentado por seringa ficando entre 25-40kb e clonado em vetores fosmídeos, conforme as instruções do fabricante do CopyControl Fosmid Library Production Kit (Epicentre Biotechnologies) as seqüências dos clones foram determinadas através de sequenciamento e comparadas em banco de dados para análise de similaridades com outras seqüências já descrita A comparação das seqüências de 634 clones com o banco de dados de 16S rrna do RDP II indicou que o filo com maior predominância foi o de Proteobacteria nas amostras de solo com 59,9% das seqüências. O segundo filo com maior predominância foi o de Firmicutes com 29,4% das seqüências. Também foram encontrados representantes do filo Planctomycetes. Além disso, aproximadamente 5% das seqüências não apresentaram similaridade com seqüências de 16S rdna de bactérias conhecidas e não foram classificadas. Quanto a identificação de genes com aplicação biotecnológica, foram identificadas duas enzimas de interesse nesta áera. Palavras-chave: Fosmídeos, metagenômica, biotecnologia, diversidade bacteriana, 16S rdna. viii

12 ABSTRACT SILVA, Tharcilla Nascimento. Universidade Estadual de Santa Cruz, Ilhéus, 30 de abril de Metagenomic bacterial biodiversity of an Atlantic Forest soil and high molecular weight DNA isolation aiming biotechnological aplications. Advisor: Júlio Cézar de Mattos Cascardo. Co-advisors: Rachel Passos Rezende. and João Carlos Teixeira Dias. The Atlantic Forest is the second largest tropical humid Brazilian forest, possessing a high social and environmental role. It is currently reduced and is considered one of the most threatened tropical forests of the globe. Despite being reduced to few fragments, its biodiversity is one of the largest of the world. A lot is known about its fauna and flora, but few is known about its soil bacterial diversity. This work reveals one of the first descriptions of Atlantic Forest bacterial soil diversity, independent of cultivation. Total DNA from soil samples was extracted and used for phylogenetic studies and to search for new genes with biotechnological application. Soil samples were collected at Caimbi Farm, district of Olivença, Ilhéus, Bahia. Initially the DNA was used as a template in a PCR, using 16S rdna universal bacterial primers. The PCR product was cloned in a vector (ptz57r/t) and the isolated clones were sequenced. In parallel to the high throughput sequencing, the 16S molecular profile of the microbial diversity was accessed by ARDRA in order to ratify the obtained data and confirm the efficacy of both techniques. ARDRA revealed to be an promising marker to compare the microbial community present in this soil. For biotechnological purposes, soil DNA was physically fragmented to a size ranging from Kbp, and cloned in fosmids (CopyControl Fosmid Library Production Kit (Epicentre Biotechnologies). The sequences of the obtained clones ix

13 were determined by fosmid end-sequencing and compared by BlastX with Gen Bank. The comparison of the 634 valid sequences against the 16S rrna from RDP II indicate that the predominant phylum was that of the Proteobacteria with 59.9 % of the sequences. The second largest phylum was that of the Firmicute, with 29.4% of the sequences. It was also found representatives belong to the phylum Planctomycetes. Furthermore, approximately 5% of the sequences didn t show any similarity with known 16S rdna bacterial sequences and, or were not classified. Despite the difficulties to sequence the fosmid ends, two genes with possible biotechnological applications were already identified. Key words: Fosmids, metagenomics, biotechnology, bacterial diversity, 16S rdna. x

14 LISTA DE FIGURAS Figura 1. Divisão dos 5 reinos segundo a taxonomia Lineana...8 Figura 2. Representação filogenética da diversidade de organismos vivos, evidenciando a abrangência dos principais grupos de microrganismos...9 Figura 3. Modelo da estrutura secundária do 16S E 18S rrna...14 Figura 4. Diagrama da estratégia de busca e descoberta de produtos microbianos através da clonagem e expressão do DNA extraído diretamente da amostra ambiental...17 Figura 5. Descrição esquemática do processo utilizado na análise das distâncias filogenéticas das seqüências 16S...24 Fig. 6. Mapa do vetor pcc1fos...27 Figura. 7. Visão geral da construção de biblioteca de fosmídeo utilizando o sistema CopyControl, e subseqüente indução dos clones à um alto número de cópia...28 Figura 8. Métodos de extração de DNA de solo de Mata Atlântica. Tubo esquerdo: método A; Tubo direito método B...32 Figura 9. Eletroforese em gel de agarose 0,8%. Da esquerda para direita: marcador de Alto Peso Molecular (8-48 kb); DNA extraído pelo método A; DNA extraído pelo método B...32 xi

15 Figura 10. Produto de PCR do 16S rdna obtidos pelo método B e pelas purificações 1 e Figura 11. Eletroforese em gel de agarose 0,8%, mostrando DNA total e DNA total digerido...34 Figura 12. Eletroforese em gel de agarose 1,0 %, mostrando extração de DNA plasmidial (miniprep) de alguns clones da biblioteca de 16S.rDNA...35 Figura 13. Classificação dos filos identificados no domínio Bactéria...36 Figura 14. Distribuição das classes do filo Gammaproteobacteria...37 Figura 15. Distribuição dos gêneros encontrados...38 Figura 16. Dendograma mostrando a distribuição e as distâncias filogenéticas dos microrganismos, os clones estão identificados como PxxNxx, onde Pxx é a identificação da placa e Nxx o identificador do clone na placa...44 Figura 17. PCR 16S rdna da placa 04 (PL04). Mostrando o fragmento de aproximadamente 1500pb...45 Figura 18. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade bacteriana do solo de Mata Atlântica amplificados com os iniciadores 27F e 1525R, e digeridos com: Enzima de restrição AluI - porção baixa do gel, digestão com a enzima HhaI porção intermediária e MspI porção inferior. Nas extremidades ladder de pb...46 Figura 19. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade bacteriana do solo de Mata Atlântica amplificados com os iniciadores 27F e 1525R, e digeridos com: Enzima de restrição AluI - porção baixa do gel, digestão com a enzima HhaI porção intermediária e MspI porção inferior. Nas extremidades ladder de pb...47 xii

16 Figura 20. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade bacteriana do solo de Mata Atlântica amplificados com os iniciadores 27F e 1525R, e digeridos com: Enzima de restrição AluI - porção baixa do gel, digestão com a enzima HhaI porção intermediária e MspI porção inferior. Nas extremidades ladder de pb...47 Figura 21. Dendograma gerado pelo NTSYS, segundo dados obtidos por ARDRA...50 Figura 22. Dendograma gerado pelo DNAMLK, segundo dados obtidos pelo sequeciamento...50 Figura 23. Eletroforese em gel de agarose de 0,8%, mostrando o DNA de alto peso molecular obtido pela metodologia desenvolvida. M marcador, 1-3 extrações independentes de DNA de solo de Mata Atlântica...51 Figura 24. Eletroforese em gel de agarose 1% a 33% por 16h, obtido a partir da fragmentação do DNA de alto peso molecular para posterior clonagem no vetor pcc1fos TM (Epicentre Biotechnologies)...52 Figura 25. Eletroforese em gel de agarose 1% a 50V por 12h. Digestão de alguns clones de fosmídeo com as enzimas de restrição EcoRI e HindIII. Essas enzimas liberam o clone inteiro (aproximadamente 8kb) e, caso ele tenha algum sítio interno para essas enzimas, outros fragmentos conforme mostrado nas canaletas 2, 3, 13 e 14. A seta vermelha indica a liberação do vetor pcc1fos TM (Epicentre Biotechnologies)...52 Figura 26. Resultados de BLAST-X de seqüências de pontas de fosmídeos, indicando que efetivamente foram clonados fragmentos de DNA metagenômico de solo de Mata Atlântica...54 xiii

17 LISTA DE TABELAS Tabela 1. Números de células microbianas associadas a diferentes tipos de solos...7 Tabela 2. Genes funcionais e enzimas derivados de metagenoma recentemente descobertos, com potencial em aplicações industrial e farmacêutica...18 Tabela 3. Composição química e física do solo de Mata Atlântica...31 xiv

18 1. INTRODUÇÃO A Mata Atlântica é considerada uma das grandes prioridades para a conservação de biodiversidade em todo o continente americano, contudo sua cobertura florestal atual encontra-se reduzida a cerca de 7,6% da área original, que ocupava uma extensão de aproximadamente km 2. Sendo um dos 25 centros de biodiversidade reconhecidos no mundo, já perdeu mais de 70% de sua cobertura vegetal original, contudo estes centros de biodiversidade juntos, abrigam mais de 60% de todas as espécies terrestres do planeta (MYERS et al., 2000). Este rico complexo biótico de natureza florestal encontra-se distribuído por mais de 17 estados brasileiros. Apesar da devastação acentuada, este Bioma ainda contém uma parcela significativa da diversidade biológica do Brasil, com altíssimos níveis de endemismo (MARTINI et al., 2007) A porção do Nordeste brasileiro, entre os rios Jequitinhonha e Contas, concentra a parcela mais significativa da diversidade deste Bioma, sendo considerada por alguns ambientalistas como um dos principais centros de endemismo da Mata Atlântica. Seus remanescentes regulam o fluxo dos mananciais hídricos, asseguram a fertilidade do solo, controlam o clima, protegem escarpas e encostas das serras, além de preservar um patrimônio histórico e cultural imenso. Os microrganismos podem existir em uma grande variedade de habitats, incluindo ambientes quentes, abissais, bastante frios e áreas quimicamente contaminadas (WHITMAN et al., 1998). O solo por ser um ambiente muito complexo, é considerado o principal reservatório da diversidade microbiana (BERTRAND et al., 2005). Cerca de um grama de solo deve conter cerca de 10 bilhões de microrganismos individuais, representando milhares de espécies (ROSSELÓ-MORA; AMANN, 2001). A maior parte da diversidade bacteriana na natureza é desconhecida. Estima-se que menos 1

19 de 10% dos microrganismos existentes no planeta tenham sido caracterizados e descritos (STALEY, 1998). Estimativas atuais mostram que o número de espécies de procariotos incultiváveis em um grama de solo é muito mais significativo que o número de espécies de procariotos cultiváveis (TORSVIK et al., 2002), e estes microrganismos incultiváveis, eram até pouco tempo atrás inacessíveis aos pesquisadores. Em meados de 1980, a análise direta de seqüências de gene rrna mostrou que a maioria dos microrganismos não-cultiváveis presentes em um ambiente não são capturados por métodos tradicionais de cultivo (HANDELSMAN, 2004). Já em 1990, com o advento das técnicas de biologia molecular, mais especificamente da PCR (Reação em Cadeia da Polimerase), tornou-se possível o estudo de organismos procariotos de um determinado ambiente que ainda não são possíveis de serem cultivados e, o número de espécies descrito na literatura vem crescendo nos últimos anos. Esta nova metodologia baseada na análise direta do DNA da amostra ambiental, não só fornece informações em nível de filogenia da comunidade microbiana, como oferece a oportunidade de capturar operons ou genes que participam de ciclos que podem dirigir a síntese de moléculas complexas, como antibióticos, e genes responsáveis pelas mais diversas funções, como por exemplo, genes envolvidos em novas vias metabólicas, enzimas, genes com atividades antimicrobianas, dentre outros (ESCALANTE-LOZADA et al., 2006). Diante desta situação, este trabalho objetivou clonar DNA diretamente de amostra ambiental, para fazer um estudo inicial da biodiversidade bacteriana presente em um solo da Mata Atlântica, através da construção de bibliotecas de rdna 16S, assim como também, com DNA de alto peso molecular, identificar novos genes/enzimas, envolvidos na rota de produção de antibióticos e outros compostos, oriundos de microrganismos que habitam este solo, através da construção de bibliotecas genômicas utilizando vetores fosmídeos. 2

20 2. REVISÃO BIBLIOGRÁFICA 2.1 Mata Atlântica Na época do descobrimento do Brasil, a Mata Atlântica brasileira ocupava praticamente toda a costa brasileira, formando um manto de cobertura florestal desde o Rio Grande do Sul até o Rio Grande do Norte, distribuído por mais de 17 estados brasileiros, com amplas extensões para o interior do país, cobrindo cerca de 1,3 milhão de quilômetros quadrados. Considerada um dos 25 centros de biodiversidade reconhecidos no mundo. Sendo estes centros, áreas que perderam pelo menos 70% de sua cobertura vegetal original, mas que, juntas, abrigam mais de 60% de todas as espécies terrestres do planeta (MYERS et al., 2000), é considerado o bioma mais rico em biodiversidade do planeta e declarada pela UNESCO como Reserva da Biosfera, um verdadeiro Patrimônio da Humanidade. O valor da biodiversidade da Mata Atlântica é incalculável pelo potencial que esse manancial possui para o benefício do homem, do meio ambiente e do uso sustentável da agricultura e pecuária nas regiões tropicais. Atualmente restam apenas cerca de 7% da cobertura original da floresta, tendo sido inclusive identificada como a quinta área mais ameaçada e rica em espécies endêmicas do mundo (GALINDO-LEAL; CÂMARA, 2005), e considerada a mais velha floresta do planeta (www.cepf.net/xp/cepf/static/pdfs/final.atlanticforest.ep.pdf). A porção do Nordeste brasileiro que concentra a parcela mais significativa deste Bioma encontra-se entre os rios Jequitinhonha e Contas, sendo esta região considerada por alguns ambientalistas como um dos principais centros de endemismo da Mata Atlântica, bastante rica em biodiversidade, sendo uma das mais importantes para a conservação da biodiversidade global. Além das inúmeras espécies de plantas, a 3

21 Mata Atlântica abriga diversas espécies de microrganismos, animais, peixes, insetos, aracnídeos e crustáceos, dentre outros, de significativa importância para o ecossistema, para a ciência e para a vida humana. As bactérias e archaeas representam dois terços da vida no planeta e, no entanto, menos de 1% das espécies são conhecidas. Grande parte desta diversidade está nas comunidades microbianas do solo que até pouco tempo atrás eram inacessíveis aos pesquisadores. Conservados adequadamente e explorados de maneira sustentável, esses recursos biológicos poderão servir como fonte inesgotável de alimentos, medicamentos, fitoterápicos, celulose, polímeros diversos, enzimas, genes e produtos gênicos. Através das ferramentas modernas da biotecnologia, essa biodiversidade pode ser explorada e utilizada no isolamento e caracterização bioquímica de novos compostos com propriedades físicas, químicas e, ou biológicas, de interesse econômico, como na produção de antibióticos, bioinseticidas, enzimas, ácidos graxos termoestáveis e produtos biotecnológicos diversos. 2.2 Os microrganismos e o solo A biosfera é dominada por microrganismos (WHITMAN et al., 1998; RONDON et al., 2000), muitos deles ainda não estudados (RONDON et al., 2000). A diversidade de microrganismos é tão vasta quanto desconhecida. Os microrganismos vêm evoluindo a aproximadamente 4 bilhões de anos, e até 2 bilhões de anos atrás eram a única forma de vida na Terra (WARD, 1998b). A diversidade bacteriana é inigualável dentro do mundo biológico. Os estudos com microrganismos tiveram início em 1673, com Van Leeuwenhoek, contudo só ganharam impulso em 1857, com os estudos de Louis Pasteur em Suas descobertas forneceram ferramentas para o desenvolvimento da taxonomia e genética bacterianas (KELLER; ZENGLER, 2004). Avanços significativos, no entanto, podem ser notados a partir da segunda metade do século XIX (TORTORA et al., 2000). O solo é um ambiente muito complexo, considerado o principal reservatório da diversidade microbiana (BERTRAND et al., 2005). O solo é um ambiente heterogêneo, composto por fases sólida, líquida e gasosa (SMILES, 1988). A fase 4

22 sólida é formada por substâncias inorgânicas (areia, silte e argila) e materiais orgânicos (ácidos húmicos, ligninas, hemicelulose, celulose, amido, pectina, lignina, lipídeos, etc.). A fase líquida compreende a porção do solo, onde se encontram em suspensão elementos químicos e moléculas solúveis. A fase gasosa, representada pelos gases que circulam entre as partículas do solo, é originária de processos bioquímicos, como a respiração. Um grama de solo pode conter 10 bilhões de microrganismos, representando milhares de espécies (ROSSELÓ-MORA; AMANN, 2001). Segundo CURTIS et al. (2002), a maior parte da diversidade de bactérias na natureza é desconhecida, mas através de comparação, os oceanos foram estimados em apresentar até 2 milhões de espécies, considerando que uma tonelada de solo deve conter 4 milhões de espécies. Estimativas atuais de espécies de procariotos incultiváveis em um grama de solo variam de cem a quase nove ordens de magnitude maior que estimativas baseadas em procariotos cultiváveis (TORSVIK et al., 2002). Com base nesta estimativa, DYKHUYZEN (1998) especulou que devem existir 10 bilhões de espécies de bactérias na Terra. Representando esta, uma proporção significativa de toda a diversidade evolutiva (WOESE, 1987; WOESE et al., 1990). Os solos executam uma gama de funções que, direta ou indiretamente, sustentam a população humana do mundo. Eles possuem uma importância vital na produção de alimentos e como reservatórios de água. No aspecto global os solos atuam, por exemplo, estocando grande parte do carbono do planeta (duas vezes mais o que existe na atmosfera), tamponando e filtrando grande parte dos poluentes e também como os principais mediadores dos ciclos biogeoquímicos (O DONNELL; GÖRRES, 1999). As partículas do solo são organizadas estruturalmente de forma que produz um habitat espacialmente heterogêneo para os microrganismos caracterizados por diferentes substratos, nutrientes, concentração de oxigênio, conteúdo de água e valores de ph (LADD et al., 1996). O solo se distingue de outras formações geológicas justamente por apresentar sua atividade biológica, principalmente devido à diversidade de microrganismos que nele existem (VARGAS; HUNGRIA, 1997). Os microrganismos constituem uma interface biológica com os ambientes físicos e químicos da Terra, seja atuando diretamente em processos como a mineralização da matéria orgânica ou indiretamente, através de simbioses como na fixação de nitrogênio (O DONNELL; GÖRRES, 1999). 5

23 A composição de comunidade microbiana tem demonstrado variar conforme o uso do solo (BORNEMAN; TRIPLETT, 1997; NUSSLEIN; TIEDJE, 1999), espécies de planta (MARSCHNER et al., 2001; KUSKE et al., 2002), prática de crescimento agrícola (MCCAIG et al., 1999; BUCKLEY; SCHMIDT, 2001), temperatura (WARD et al., 1998), quantidade de nutrientes (BROUGHTON; GROSS, 2000), salinidade (NUBEL et al., 2000), contaminação com poluente (MULLER et al., 2001), predação (JURGENS; MATZ, 2002) e outras variáveis ambientais (Tabela 1). A redução da diversidade microbiana no solo pode ser um importante indicador da perda de equilíbrio e, por conseqüência, da qualidade do solo. A abundância de algumas espécies de microrganismos parece não ser tão importante quanto a manutenção da diversidade, uma vez que a abundância reflete de forma mais imediata a flutuação microbiana de curto prazo e a diversidade revela o equilíbrio entre os diversos organismos e os domínios funcionais no solo (KENNEDY, 1999; LAVELLE, 2000). Novas atividades microbianas no solo têm sido descobertas gerando novos conceitos nos ciclos do carbono, nitrogênio, ferro, manganês e permitindo especular a existência de novos ciclos biogeoquímicos como o ciclo do fosfato, por exemplo (KELLER; ZENGLER, 2004). Tabela 1 - Números de células microbianas associadas a diferentes tipos de solos Número de células microbianas por cm 3 em diferentes ambientes. Os dados apresentados são extrapolações de resultados obtidos por microscopia de fluorescência (adaptado de TORSVIK, 2002) 6

24 2.3 Organismos vivos e sua diversidade O sistema de classificação tradicional é conhecido como taxonomia Lineana, que inclui conceitos como a estruturação em níveis e a nomenclatura binomial. Ela é baseada em dados morfológicos e fisiológicos, e todas as formas de vida na Terra podem ser classificadas em 5 reinos: Animalia, Plantae, Fungi, Protista e Monera ( Figura 1). Sendo a vida também dividida em dois tipos fundamentais: aqueles que possuem uma membrana nuclear (eucariotos) e aqueles que não a possuem (procariotos), de modo que a maior diversidade da vida na terra era devida aos Eucariotos. WOESE et al. (1990) propuseram que a classificação dos seres vivos fosse substituída por um esquema baseado em três reinos ou domínios (Bacteria, Archaea e Eukarya) (Figura 2), sendo os dois primeiros exclusivamente microbianos e compostos por células procarióticas. O terceiro domínio (Eukarya) engloba todos os organismos eucariotos, incluindo os fungos, as microalgas e os protozoários. Para esta classificação WOESE et al. (1990) utilizaram as comparações de seqüências de 16S e 18S rrna propondo assim uma nova classificação universal para a grande diversidade de vida na Terra. Os procariotos eram considerados simples, primitivos e relativamente uniformes em suas características (HUGENHOLTZ; PACE, 1996). Pela primeira vez uma proposta completa de classificação foi feita baseada em dados moleculares e não morfológicos. A partir de então muitos pesquisadores vêm descobrindo que o domínino Bacteria possui muito mais filos do que Woese descreveu, em sua proposta inicial (WOESE, 1987) e muitos representantes destes filos, sendo incultiváveis (DELONG; PACE, 2001). Contudo, mais recentemente, RAPPÉ; GIOVANNONI (2003), também utilizando seqüências 16S rdna amplificados de DNA total de diversos ambientes, aumentaram esse número para 52 filos. Estima-se que menos de 10% dos microrganismos existentes no planeta tenham sido caracterizados e descritos (STALEY, 1998). Embora sejam menos estudados, muitos grupos de microrganismos são essenciais para a sobrevivência das formas de vida na Terra (HAMOND, 1995). O número de espécies microbianas cresce a cada ano, sendo descritos mais de fungos, protozoários, algas, bactérias e vírus (WILSON, 1998; ROSSELLÓ-MORA; 7

25 AMMAN, 2001). As bactérias e arqueas representam dois terços da vida no planeta e, no entanto, menos de 1% das espécies são conhecidas. Grande parte desta diversidade está nas comunidades microbianas do solo que até pouco tempo atrás eram inacessíveis aos pesquisadores. Figura 1- Divisão dos 5 reinos seguindo a taxonomia Lineana (Whittaker, 1969) Figura 2 - Representação filogenética da diversidade de organismos vivos, evidenciando a abrangência dos principais grupos de microrganismos. 8

26 Os microrganismos podem existir em uma grande variedade de habitats, incluindo ambientes quentes, abissais, bastante frios e áreas quimicamente contaminadas (WHITMAN et al., 1998). A diversidade microbiana é um componente crucial para o funcionamento dos ecossistemas naturais porque existe a necessidade da manutenção de processos ecológicos como a decomposição da matéria orgânica, alterando a disponibilidade de nutrientes para as plantas, controle de patógenos, além de influenciar as propriedades físicas do solo, como a estabilidade dos agregados (KENNEDY, 1999). Em virtude de sua longa história evolutiva e da necessidade de adaptação aos ambientes mais distintos, os microrganismos acumularam uma impressionante diversidade genética, que excede, em muito, a diversidade dos organismos eucariotos (HUGENHOLTZ et al., 1998a). Os microrganismos que vivem no solo e em plantas promovem transformações que exercem efeitos diretos e indiretos na produtividade e na qualidade dos produtos agrícolas. O conhecimento desses processos e seus efeitos são essenciais para o manejo apropriado do meio ambiente, como fonte para o crescimento e para o uso racional dos recursos naturais. 2.4 A diversidade microbiana e os métodos moleculares aplicados na sua detecção. Em termos moleculares, a diversidade é caracterizada pelo número de diferentes tipos de seqüências de DNA encontradas no ambiente (LIESACK et al., 1997). Estudos filogenéticos baseados em seqüências do 16S rdna mostram, por exemplo, que a distância filogenética entre dois grupos de bactérias halofílicas e espiroquetas é 2,5 vezes maior que a distância entre os animais e as plantas, que são classificados em reinos diferentes (WOESE et al., 1990; HUGENHOLTZ et al., 1998b7y). Sendo assim, os microrganismos representam o repertório mais rico em diversidade química e molecular na natureza, constituindo a base de processos ecológicos, além de manterem relações vitais entre si e com os organismos superiores (HUNTER-CEVERA, 1998). 9

27 Em função do paradigma científico que exigia que os organismos fossem estudados in vitro (LAVELLE, 2000; BULL et al., 2000) até há pouco tempo, a detecção e identificação de microrganismos em amostras ambientais eram realizadas através de seu isolamento em meios de cultura (TORSVIK; OVREAS, 2002). Esta técnica identificava poucos indivíduos porque o meio de cultura é, em maior ou menor grau, seletivo para um ou outro grupo de microrganismo. Por outro lado, as contagens de células por microscopia refletem apenas uma avaliação quantitativa da população microbiana, sendo pouco informativas sobre a diversidade dos organismos em uma amostra (ZAK et al., 1994; ROSADO, 2000). Em 1980, Torsvik publicou o primeiro protocolo de extração de DNA de amostra de solo. Resultados de estudos moleculares de solos, ambientes marinhos e comunidades de ambientes extremos, têm demonstrado que populações de microrganismos isoladas em cultivo a partir de amostras destes habitats não representam necessariamente os organismos dominantes nos ambientes naturais (HUNGENHOLTZ et al., 1998a). Uma das razões para esta discrepância é o fato de que os métodos de cultivo tradicionalmente utilizados em laboratório, não representam as condições encontradas em ambientes naturais e tendem a selecionar microrganismos de crescimento rápido, adaptados ao meio de cultivo utilizado. A maioria dos microrganismos em amostras ambientais não pode ser detectada através da microscopia convencional, pois eles aderem às partículas de solo tornando-se invisíveis. Atualmente os especialistas reconhecem que apenas uma pequena fração dos microrganismos que ocorre na natureza foi até agora isolada e caracterizada (TORVISK et al., 1990). Até o presente momento dependendo do hábitat estudado, menos de 0,1% e no máximo 10% das espécies microbianas têm sido estudadas (ROSSELÓ MORA; AMMAN, 2001). Uma provável explicação é que até pouco tempo atrás, os microrganismos tinham que ser cultivados para serem estudados (PACE, 1985) e, além disso, o seu tamanho microscópico e a freqüência de ocorrência das populações, a sazonalidade, e em muitos casos, a dependência de hospedeiros e/ou substratos específicos para sua sobrevivência e multiplicação eram também limitações importantes (TORSVIK; OVREAS, 2002). Associado a descoberta de que a maioria dos microrganismos presentes no ambiente não são capturados por métodos tradicionais de cultivo (HANDELSMAN, 2004), melhorias nos métodos de isolamento e sequenciamento de DNA ambiental, conduziram a um crescimento no estudo da genética de populações microbiana, e ao 10

28 surgimento do termo metagenômica (HANDELSMAN et al., 1998). O qual se refere a análise direta de amostra ambiental, sem cultivo prévio. A revolução genômica, em 1990, tinha como alvo estudo de genomas individuais de microrganismos, plantas e animais. Enquanto que atualmente, realizase a análise de misturas complexas de microrganismos, incluindo a compreensão da extensão e do papel da diversidade microbiana, sendo o conteúdo de taxonomia de uma determinada amostra normalmente calculado através da comparação com bancos de dados que apresentam sequências conhecidas (HUSON et al., 2007). Com o advento das técnicas de reação em cadeia da polimerase (PCR) (SAIKI et al., 1988) e seqüenciamento de DNA (SANGER et al., 1977), os métodos moleculares, especialmente aqueles baseados no estudo da seqüência do 16S rdna, têm sido muito úteis na descoberta de novos microrganismos. Tornou-se possível o estudo de organismos procariotos de um determinado ambiente que ainda não são possíveis de serem cultivados, e que representam mais do que 99% dos organismos em alguns ambientes (AMANN et al., 1995). Esse acesso edificou-se em avanços recentes da genômica microbiana, na reação em cadeia da polimerase (PCR), e na clonagem de genes conservados, como 16S rrna, nif, reca, diretamente a partir de amostras ambientais (PACE et al., 1985). Para obtenção da análise estrutural e da diversidade microbiana, o fingerprinting desta comunidade é baseado no método de extração de ácidos nucléicos diretamente de amostras ambientais, seguido de amplificação por PCR dos genes 16S rdna, em bactérias, e 18S rdna, para fungos (GOMES, 2003; DUINEVELD et al., 1998; LIU et al., 1997; LEE et al., 1996; MUYZER et al., 1993) e posteriormente é caracterizado através da clonagem e seqüenciamento ou então analisado por eletroforese, por meio das técnicas de Análise de Restrição de DNA Ribossomal Amplificado (ARDRA), Polimorfismo do Tamanho do Fragmento de Restrição Terminal (T-RFLP), RAPD (Amplificação Aleatória de DNA Polimórfico), Análise do Espaço Ribossomal Intergênico (RISA), Eletroforese em Gel com Gradiente Desnaturante (DGGE), Eletroforese em Gel de Gradiente de Temperatura (TGGE) e Polimorfismo Conformacional de Fita Simples (SSCP) (RANJARD et al., 2000; KOZDRÓJ; ELSAS, 2001). 11

29 2.5 Marcadores Moleculares no estudo da diversidade Atualmente, análises comparativas da estrutura primária dos genes de rrna transformaram a taxonomia microbiana de um simples sistema de identificação para um sistema estruturado de sistemática, baseado na história evolutiva dos organismos (OLSEN et al., 1994). Estudos da evolução e ecologia dos microrganismos são centralizados nas seqüências de genes rrnas. Os primeiros autores a sugerirem o uso do gene 16S rdna como um marcador molecular para o estudo de populações microbianas em amostras ambientais, independente do seu cultivo foram PACE et al. (1986). A análise de restrição do DNA ribossomal amplificado (ARDRA) tem sido muito utilizada para estudar as comunidades microbianas em diferentes tipos de solo e também quando se deseja acessar de maneira rápida alterações genotípicas através do tempo ou entre locais diferentes, refletindo diferentes condições ambientais. O método se baseia no princípio de que os sítios de restrições, existentes no operon de rrna, são relativamente conservados e refletem padrões filogenéticos avaliando, diferenças entre grupos filogenéticos dominantes presentes na comunidade, assim são feitas investigações de parte da seqüência do DNA, notadamente o gene 16S rdna, em bactérias, e 18S rdna, para fungos, que é amplificado por PCR e posteriormente caracterizado através de análise de subseqüentes digestões com enzimas de restrição, obtendo-se assim, um perfil da comunidade microbiana (NÜSSLEIN; TIEDJE, 1999; PETERS et al., 2000). Os RNAs ribossômicos e outros genes centrais envolvidos na transferência de informações, aparentemente não sofreram uma extensa transferência lateral, produzindo a mais coerente base para entender e inter-relacionar os principais ramos evolutivos da árvore da vida (OCHMAN et al., 2000). A escolha do 16S rdna decorreu do fato dele apresentar todas as características necessárias a um marcador molecular ideal: possui uma distribuição universal, estrutura e função conservadas entre os taxa e um tamanho suficiente que permita o aparecimento de divergências na seqüência. Além disso, sua estrutura primária possui uma alternância entre regiões mais e menos conservadas permitindo a investigação de um amplo espectro de distâncias filogenéticas (LUDWIG; SCHLEIFER, 1994). 12

30 O gene 16S rrna é uma das moléculas que compõe, juntamente com outras 21 proteínas, a subunidade menor do ribossomo nos domínios Bactéria e Archaea. O 16S rrna possui também 9 regiões variáveis, alternadas com regiões conservadas, denominadas de V1 a V9 (Figura 3). Estas regiões podem, juntamente com as regiões das hélices, serem utilizadas para determinação de filogenia (WOESE et al., 1983; DAMS et al.,1988). Pesquisas demonstraram que os sítios nucleotídicos mais variáveis possuem uma taxa de substituição até sete mil vezes maior do que aqueles com a menor taxa de substituição e também que existem bases em certas posições que são absolutamente conservadas entre diferentes filos bacterianos (VAN DER PEER et al.,1996). Figura 3. Modelo da estrutura secundária do 16S e 18S rrna: As hélices são numeradas de acordo com a ocorrência a partir da extremidade 5 (seta preta). - Hélices caracterizadas apenas por números são características de procariotos e eucariotos. - Hélices cujo número é precedido por P são exclusivas de procariotos. - Hélices que apresentam números hifenados representam bifurcações de uma hélice principal. - As linhas mais escuras representam regiões mais conservadas e as linhas mais finas representam regiões variáveis (V1 a V9). - A seqüência do 16S rrna domínio Archaea segue o mesmo padrão geral de Bacteria com exceção da hélice 35 que não é ramificada. - Procariotos não possuem V4. - Hélices em linha pontilhada são consideradas raras. (Modelo reproduzido a partir de DAMS et al., 1988). 13

31 2.6 A metagenômica e a biotecnologia O dilema da incapacidade para cultivar a vasta maioria dos microrganismos presentes na maioria dos nichos microbianos (AMANN, et al., 1995) forçou cientistas a desenvolverem métodos para explorar os genomas destas bactérias por biotecnologia sem cultivo prévio (WOLFGANG, et al., 2004). As novas técnicas evidenciaram a enorme diversidade genética de bactérias presentes em apenas 1 (um) grama de solo. Este novo e excitante campo da pesquisa é coletivamente denominado Metagenômica e a chave da tecnologia tem sido resumida na publicação de SCHMIDT et al.(1991). Enquanto as amplificações por PCR requerem um conhecimento prévio da seqüência do gene para o desenho dos primers para a amplificação, a extração direta e clonagem de DNA podem teoricamente acessar genes com qualquer seqüência ou função. A clonagem direta oferece a oportunidade de capturar operons ou genes que participam de ciclos que podem dirigir a síntese de moléculas complexas, como antibióticos. Esta nova metodologia não só fornece informações em nível de filogenia da comunidade microbiana, que é importante para o seu entendimento ecológico, mas também possibilita o isolamento de novos genes responsáveis pelas mais diversas funções, como por exemplo, genes envolvidos em novas vias metabólicas, enzimas, genes com atividades antimicrobianas, elementos de regulação gênica, genes responsáveis por patogenicidade e resistência a antibióticos provenientes em sua maioria de microrganismos não cultiváveis (ESCALANTE-LOZADA et al., 2006). A importância da metagenômica para a biotecnologia torna-se óbvia se considerar que em 1 g de solo pode conter mais de diferentes espécies (TORSVIK et al., 2002). Todavia, 98,0 99,0% dos microrganismos presentes neste nicho microbiano não podem ser cultivados com tecnologias disponíveis atualmente (ELLIS et al., 2003). Recentemente estão listadas no National Center for Biotechnology Information (NCBI) 152 sequenciamentos completos de genomas de procariotos (WOLFGAN, 2004). Se um gene coberto consiste de 10 3 pbs, 1 g de solo deve conter mais de 6,1 x pbs, representando cerca de 6,1 x 10 7 genes. Este número excede, por no mínimo, duas ordens de magnitude o número total de genes seqüenciados de genomas bacterianos cerca de 10 anos atrás. Tal cálculo simples 14

32 pode fornecer uma impressão do número total de genes que resta para ser descoberto pela metagenômica. Duas metodologias têm sido utilizadas para obter informações a partir de bibliotecas metagenômicas: uma baseada na função induzida, na qual bibliotecas metagenômicas são inicialmente classificadas avaliando-se uma característica fornecida, e uma outra baseada na seqüência induzida, na qual bibliotecas são classificadas por uma seqüência particular de DNA. Nas últimas décadas é crescente o número de bactérias patogênicas tanto para humanos como para outros animais que apresentam multi-resistência a drogas sendo que, em alguns casos, foi constatada a existência de bactérias resistentes a todas as drogas antimicrobianas hoje disponíveis para o tratamento. Dentro deste grupo de bactérias multi-resistentes pode-se citar Staphylococcus aureus, Enterococcus sp, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterobacter cloacae, Mycobacterium tuberculosis, Salmonella entérica, Shigella spp. entre outros. A aplicação da metagenômica nestes casos se faz bastante útil, já que tem grande possibilidade de encontrar novas proteínas com potencial antimicrobiano. As aplicações da metagenômica são úteis nos mais diversos campos da indústria (Figura 4). Há uma evolução continuada de resistência aos antibióticos em níveis nacional e internacional. Além de tentar limitar a expansão de resistência, existem consensos crescentes que a exigência base é o desenvolvimento de novos antibióticos para ajudar a reparar o dano contra os antibióticos disponíveis. (CHRISTOPHER et al., 2004). Existe, portanto a necessidade urgente da busca de novas drogas antimicrobianas. Antibióticos e enzimas estão entre as recentes descobertas da metagenômica (PATRICK; JO, 2003). Atualmente o refinamento de novos métodos que enriquecem o conhecimento de genes acelera a descoberta de moléculas úteis (UCHIYAMA et al., 2005). O isolamento dos antibióticos turbomicina A e B, a partir de biblioteca metagenômica, construída de DNA oriundo de microrganismos do solo foi demonstrado por GILLESPIE e colaboradores (2002). Os resultados demonstraram o sucesso da expressão heteróloga de DNA extraído diretamente a partir do solo, como um meio de acessar previamente pequenos compostos orgânicos não caracterizados, 15

33 servindo como exemplo de um caminho para a geração/identificação de novas estruturas químicas. Os microrganismos de solo têm sido uma grande fonte de produtos naturais, estabelecendo industrialmente, antibióticos importantes bem como estão sendo utilizados como substâncias biocatalíticas (ROLF, 2004). Em recentes estudos, muitas procuras em metagenômica focalizaram principalmente no isolamento de um grupo bastante pequeno de genes que codificam para biocatalizadores e enzimas envolvidas na produção de antibióticos e de vitaminas. As lipases e esterases estão entre o grupo amplamente usado de biocatalizadores químicos orgânicos, e não requerem co-fatores (JAEGER; EGGERT, 2002). Então, vários estudos têm focalizado no isolamento desta classe de hidrolases. Similarmente, enzimas com polissacarídeos modificados são de interesse considerável à indústria de alimento, por exemplo, a, 1,4-amilases e a glucoamilases (Tabela 2). As oxidoredutases representam outro exemplo de biocatalizadores sendo excelentes enantiômeros. Eles são usados para a síntese de compostos carbonil, hidroxiácidos, aminoácidos e álcoois quirais que são frequentemente difíceis de preparar quimicamente (DAVIS, BOYER, 2001). Em particular, na produção da álcool redutase NAD(P)-dependente, na produção de hidroxiacetona e como ferramentas para análise enzimática de lipídeo sérico (HUMMEL, 1999). Figura 4. Diagrama da estratégia de busca e descoberta de produtos microbianos através da clonagem e expressão do DNA extraído diretamente da amostra ambiental (metagenoma) (adaptado de BRUGGEMAN, 1998). 16

34 Tabela 2. Genes funcionais e enzimas derivados de metagenoma recentemente descobertos, com potencial em aplicações industrial e farmacêutica. Lipases/esterases Enzimas modificadoras de polissacarídeos α-amilases Enzimas de ramificação de α- 1,4 glicano β-agarases Quitinases Celulases Oxidoredutases/desidrogenases Oxidoredutases de álcoois Redutases de di-ceto-d-ácido glicônico Desidrogenases de 4-hidroxibutirato Outras enzimas Proteases Nitilases Biosínteses de vitaminas Biosínteses de biotina Produção em massa de produtos químicos Biosínteses de 1,3-Propanodiol 3. METODOLOGIA Biosínteses de drogas e antibióticos Turbomicina A,B Policetídeo sintases Violaceína N-aciltirosinas de cadeia longa Indirubina Terraginas 17

35 3. METODOLOGIA 3.1 Coleta das amostras de solo da Mata Atlântica As amostras do solo foram coletadas na Fazenda Caimbi, Ilhéus - Bahia, Brasil e foi classificado como um solo argilo arenoso. Foram coletadas 10, ao longo das estações do ano, amostras de solo da camada de superfície da terra até uma profundidade de 10 cm, utilizou-se espátulas estéreis. As amostras foram transferidas para vasos de vidro também estéries. A última coleta do solo foi realizada em pontos traçados em um raio de 3 metros, aproximadamente. Porém, estes pontos foram bem distantes em relação às amostras coletadas anteriormente, durante um ano de coleta. As coordenadas geográficas das amostras foram determinadas com um aparelho GPS, sendo a média dos dados: Latitude (S) 14 48', Longitude (O) 39º 03', altitude 20 metros. Esta região apresenta média histórica de precipitação pluviométrica de 1988 mm/ano, temperatura média de 23,4 +/-1,5 C, umidade relativa média 85,4 +/- 4,0%. A análise físico-química das amostras de solo coletadas foi executada no Laboratório de Solos e Nutrição de plantas da EMBRAPA/CNMF, Cruz das Almas, Bahia. 3.2 Métodos de extração ex situ de DNA Método A para extração ex situ de DNA de solo de Mata Atlântica (Maciel, BM, 2004) Em Erlenmeyer de 250 ml, adicionou-se 4 g de solo a 50 ml de tampão fosfato de sódio (NaH 2 PO 4.H 2 O + Na 2 HPO 4.7 H 2 O) ph 7,4 + Tween 80 a 0,1%, por 180 r.p.m em mesa agitadora por toda a noite. Distribuiu-se o sobrenadante em tubos de centrífuga com fundos cônicos. Centrifugou-se a 5000 r.p.m. (rotações por minuto) 18

36 por 10 minutos e descartou-se o sobrenadante. Fez-se quatro lavagens em Tampão TE 50/50 mm (Tris-HCl + EDTA), ph 8,1, seguindo de centrifugação de três minutos a 5000 r.p.m para cada lavagem, tendo sido descartado o sobrenadante. A lise das células foi feita por maceração do precipitado após congelamento com nitrogênio líquido. Ressuspendeu-se o macerado em 1 ml de TE 50/50 e adicionou-se 1 ml de fenol/clorofórmio/ álcool isoamílico (25:24:1, ph 7,3). Coletou-se a fase superior e precipitou-se com isopropanol absoluto e acetato de sódio 3 M. Lavou-se duas vezes o precipitado em álcool 70%. Ressuspendeu-se em 100 µl de água ultra pura estéril. Purificou-se em coluna de Sephadex G-200 (Amersham). Método B para extração ex situ de DNA de solo de Mata Atlântica (método utilizando glass beads) Em Erlenmeyer de 250 ml, adicionou-se 4g de solo em 50 ml de tampão fosfato de sódio + Tween 80 a 0,1% em mesa agitadora por toda a noite. Distribuiu-se o sobrenadante em tubos de centrífuga com fundos cônicos. Centrifugou-se a 5000 r.p.m. por 10 minutos e descartou-se o sobrenadante. Adicionou-se glass beads (pérolas de vidro) ao precipitado para aumentar o número de células disponíveis na fase de lise e assim, aumentar o rendimento de DNA recuperado. Lavou-se quatro vezes em tampão PBS (Phosphate Buffer Solution) 1X, ph 7,4, com centrifugação de 3 minutos a 5000 r.p.m. cada lavagem. Lavou-se em tampão TE 50/50 mm (Tris-HCl + EDTA), ph 8,1 por quatro vezes, também com centrifugação de três minutos a 5000 r.p.m cada lavagem, descartou-se o sobrenadante e ressuspendeu-se o pellet em 3 ml desse tampão. Incubou-se a temperatura ambiente por 20 minutos. Adicionou-se 200 µl de SDS a 20%. A lise das células foi feita por choque térmico do pellet alternando nitrogênio líquido (1 min) e água em fervura (4 min) em 3 ciclos. Adicionou-se fenol/clorofórmio/ álcool isoamílico (25:24:1, ph 7,3) na proporção de 1:1 v/v. Coletou-se a fase superior e precipitou-se com isopropanol absoluto e acetato de sódio 3 M. Lavou-se o precipitado por duas vezes em álcool 70%. Ressuspendeuse em 100 µl de água ultra-pura (estéril). Purificou-se em coluna de Sephadex G Purificou-se por 1, 2 e 3 vezes passando na coluna de Sefhadex G

37 3.3 Clonagem do DNA para estudo da biodiversidade do solo em estudo Amplificação do gene 16S rdna Para estudo da biodiversidade bacteriana presente neste solo, o gene 16S rdna foi amplificado por PCR (Reação em cadeia da ploimerase) utilizando o conjunto de iniciadores 27F/1525R para o domínio Bactéria. Permitindo a amplificação de um fragmento de DNA de aproximadamente 1500 pares de bases. A PCR foi realizada em termociclador MJC Research PTC200 (Eppendorf). Na reação foram utilizadas as seguintes condições de tempo e temperatura: 1 ciclo 94 C por 5 minutos; 34 ciclos de 94 C por 1 minuto, 59 C por 1 minuto e 72 C por 2 minutos, finalizando com 1 ciclo de 72 C por 10 min utos. A PCR foi amplificada contendo as seguintes proporções de reagentes: 2,5 µl de tampão 10X da reação para a Taq DNA polimerase (100 mm Tris-HCl, ph 8,8 a 25 C, 500 mm KCl, 0,8%) concentração final de 1X; 3,7 mm de cloreto de magnésio, 0,4 pmol/µl de deoxinucleotídeos (datp, dttp, dctp e dgtp), 0,4 pmol/µl de cada iniciador, 0,4 mm de BSA (Albumina Soro Bovina), 3 unidades de enzima Taq DNA polimerase (Fermentas),e água ultra pura estéril para um volume de final de 25 µl. Como molde para a reação foram utilizadas alíquotas de 150 ng do DNA total das amostras de solo diluídas na proporção 1: Ligação do 16S rdna ao vetor A ligação dos produtos de PCR dos genes 16S rdna amplificados das amostras de solo com o vetor ptz57r/t foi realizada utilizando-se o kit comercial InsTAclone PCR Cloning Kit (Fermentas), e seguindo as informações do fabricante, sendo a proporção vetor/inserto e 1:3. A reação de ligação foi incubada de um dia para o outro a -4ºC Transformação bacteriana A transformação se deu via eletroporação, onde foram utilizados 20 µl das células E. coli DH10β eletro competentes (Invitrogen) e 4 µl da reação de ligação. A amostra foi submetida a um choque elétrico de 2,5 kv/4,9 segundos, no eletroporador GenePulser II (BioRad). Às células de E. coli foi adicionado 1 ml de meio SOC e 20

38 incubadas por 1 hora sob agitação a 37ºC. Após este tempo, a amostra foi plaqueada em meio sólido LB contento o antibiótico ampicilina na concentração de 100 µg/ml, e também IPTG (Isopropyl β-d-1-thiogalactopyranoside) e X-gal (5-bromo-4-cloro-3- indolil-β-dgalactopiranosideo) como substrato para a enzima β-galactosidase nas concentrações de 200 µg/ml e 20 µg/ml, respectivamente. Em seguida as placas foram incubadas na estufa a 37 C por 16 horas Coleta dos clones transformantes Os clones transformantes (colônias brancas) foram coletados com o auxílio de dois catadores e organizados em placas de Petri contendo meio sólido LB e ampicilina a 100 µg.ml -1. As placas foram inoculadas a 37ºC em estufa por 14 h, e depois foram colocadas a 4ºC. Dois dias depois, as bactérias foram inoculadas em placas de polietileno de 96 poços preenchidas com 70 µl de meio líquido LB contendo ampicilina a 100 µg.ml -1, utilizou-se mais antibiótico para a bactéria não expulsar o plasmídeo e incubadas sob agitação por 14h a 37ºC. No dia seguinte foram adicionados 70 µl de glicerol estéril a 16% às culturas. As placas foram então seladas com adesivos estéreis e armazenadas em freezer a -80 C, até a data de uso Extração do DNA plasmidial dos clones e sequenciamento A extração do DNA plasmidial dos clones que continham os insertos de interesse foi realizada segundo a mesma metodologia utilizada para o Programa Genoma do Crinipellis perniciosa, assim também a reação de sequenciamento no seqüenciador MegaBACE 1000 (Amersham Bioscience), contudo utilizou-se o iniciador M13F. Foram seqüenciadas nove placas contendo 96 clones de cada. 3.4 Análise de Bioinformática das seqüências obtidas pelo sequenciamento Preparo das seqüências para filtração das seqüências 16S rdna Antes de submeter as seqüências para a análise filogenética foi preciso remover as regiões das seqüências de baixa qualidade. Também foram eliminados clones que não possuem nenhum 16S rdna, assim como as regiões que não fazem 21

39 parte da sua região informativa (possíveis vetores ou adaptatores) utilizando o BLAST contra o banco de dados de seqüências ribossomais: Ribossomal Database Project release 9.43 (RDP) (COLE, 2005). Para o cálculo das distâncias filogenéticas utilizando alinhamento múltiplo, todas as seqüências foram editadas (recortadas) para representarem a mesma parte da região informativa do 16S rdna, por exemplo: se uma seqüência vai da posição 20 até a posição 500 do 16S rdna e uma outra seqüência vai da posição 100 até a posição 600, então somente a intersecção das duas seqüências será utilizada. Recorta-se a primeira seqüência na posição 100 e a segunda até a posição 500. Isso deve ser feito tanto nos clones seqüenciados como nas seqüências do banco de dados que são utilizados em conjunto Diagnóstico filogenético Todos os clones foram analisados utilizando o classificador Bayesiano de seqüências 16S rdna de bactérias (http://rdp.cme.msu.edu). Este método trabalha bem com seqüências parciais, aproximadamente 500 bases em média, e tem uma eficiência maior que 99,2% no diagnóstico do filo, 98,4% na classe, 96,6% na ordem, 93,0% na família e 87,7% no gênero usando um limiar de 80%. As informações geradas por esse classificador foram tratadas com scripts perl para identificação dessas informações no estudo de distâncias filogenéticas. As seqüências com classificação possível foram, então, rotuladas com essas informações sobre sua taxonomia hierárquica. Foi realizado, em seguida, o alinhamento múltiplo global de todas as seqüências, clones e seqüências similares, editados para estarem na mesma região do 16S rdna, utilizando o CLUSTALW (versão 1.83) (THOMPSON, 1994). A partir do alinhamento múltiplo a análise filogenética foi feita com o pacote PHYLIP (versão 3.66) (FELSENSTEIN, 1989) pois os programas são mais adequados para a abordagem da filogenia da biodiversidade. Para estimar a filogenia foi utilizado o DNAMLK que é baseado no método da máxima verossimilhança, esse modelo permite diferentes freqüências previstas para os quatro nucleotídeos (A, T, C ou G), taxas desiguais de transições e transversões, ou seja, a substituição de uma pirimidina por uma purina tem um peso diferente da substituição de uma purina por uma outra purina e também foi usado o modelo Oculto 22

40 de Markov de penalidades, com o programa inferindo as penalidades de cada posição da seqüência. A consistência estatística dos ramos foi avaliada por bootstrap usando SEQBOOT que produz múltiplos conjuntos de dados (100 réplicas nesse caso específico) a partir do alinhamento múltiplo inicial. O DNAMLK é capaz de tratar um arquivo múltiplo gerado pelo SEQBOOT e gerar múltiplos dendogramas que são avaliados pelo programa CONSENSE que mede a consistência estatística de cada ramo existente, o CONSENSE também pode gerar um dendograma consenso. Figura 5. Descrição esquemática do processo utilizado na análise das distâncias filogenéticas das seqüências 16S rdna. 3.5 Análise Restrição de DNA Ribossomal Amplificado (ARDRA) Com o intuito de ratificar os dados obtidos via seqüenciamento e testar a eficiência da técnica de ARDRA, fez-se uma diluição de 1/100 de 96 minipreps de clones (placa 04). Desta diluição utilizou-se 1 µl da diluição para realizar uma PCR nas mesmas condições do item 3.1, para um volume de final de 50 µl. Após eletroforese e confirmação da amplificação, fez-se uma coleta aleatória de 48 amostras amplificadas e, utilizando-se 10 µl de cada, fez-se três reações de digestão com enzimas de corte freqüente (4 pb). Na reação contendo a enzima de restrição AluI, adicionou-se: 10 µl da amostra, 3 µl do tampão Tango 10X, 1 unidade da enzima AluI, completou-se o volume para 30µL com água ultra pura. 23

41 À reação contendo a enzima de restrição HhaI adicionou-se: 10 µl da amostra, 3µL do tampão Tango 10X, 1 unidade da enzima HhaI, completou-se o volume para 30µL com água ultra pura estéril. À reação contendo a enzima de restrição MspI, adicionou-se: 10 µl da amostra, 3 µl do tampão Tango 10X, 1 unidade da enzima MspI, completou-se o volume para 30 µl com água ultra pura. As reações foram incubadas em banho maria a 37ºC por 16h e posteriormente inativadas a 65ºC AluI e MspI e a 80ºC HhaI, todas por 20 minutos. Foi realizada eletroforese em gel de agarose de 2,0 % a 120V por 1h, corado com Brometo de Etídio e os fragmentos visualizados em luz UV A análise de filogenia a partir de ARDRA Critérios utilizados pra análise de similaridade entre os indivíduos O padrão de bandas obtido com ARDRA para cada indivíduo foi analisado com intuito de se obter um coeficiente de similaridade entre os mesmos. Foram consideradas apenas as bandas mais evidentes que foram mensuradas com auxílio do software da KODAK o EDAS 900, com o resultado das mensurações foi possível confeccionar uma matriz binária para o padrão de bandas dos indivíduos, sendo presença de uma determinada banda assinalada com (1) e ausência (0). Foram considerados idênticos os padrões de bandas que apresentaram o mesmo número de fragmentos de idênticos pesos moleculares. O agrupamento das amostras, de acordo com a similaridade nos padrões de bandas, foi realizado empregando-se o método de UPGMA (Unweighted pair-group method with arithmetical averages) e utilizou-se o coeficiente de Jacar. Este coeficiente de similaridade simples obtido por meio do programa NTSYS (Numerical taxonomy system of multivariate programs), foi utilizado para se obter um dendrograma a partir dos dados de similaridade. 3.6 Clonagem do DNA para estudo funcional Após extração do DNA pelo método B, acima citado, a construção da biblioteca se deu utilizando-se fragmentos entre 25 e 40 Kb, uma vez que o vetor utilizado foi o fosmídeo pcc1fos (figura 6) e este recebe com estabilidade fragmentos de DNA 24

42 dessa faixa de tamanho. Para isto, o DNA foi fragmentado por seringa e fez-se eletroforese em gel de agarose 1% para avaliar se o DNA estava com o tamanho desejado, após esta etapa, fez-se o reparo das pontas do DNA utilizando-se a enzima de reparo do CopyControl Fosmid Library Production Kit (Epicentre Biotechnologies), seguindo recomendações do fabricante. Após isto, aplicou-se todo o DNA (~ 0,5 µg) em gel de agarose 1% a 31 V por toda a noite. O DNA do tamanho de interesse foi excisado do gel e fez-se a solubilização da agarose com a enzima gelase também do Kit acima citado. Seguindo-se da inativação da enzima por 70ºC por 10 minutos. Após este passo o DNA foi purificado com 10% de acetato de sódio 3 M, ph 7,0 e etanol absoluto 2,5 vezes o volume. Após a purificação, o DNA foi precipitado e ressuspenso em 40 µl de TE ph 8,0. Fez-se a ligação do DNA ao vetor fosmídeo (pcc1fos) (Figura 6). Todos os constituintes da reação, exceto a água e o DNA, foram fornecidos no kit acima citado. Incubou-se à temperatura ambiente por 2 horas, seguindo da inativação da enzima, em banho-maria a 72ºC por 10 minutos. O empacotamento dos clones foi realizado utilizando-se extratos de fagos lambda e E.coli (EPI300-T1 R ) fornecidos pelo kit. A princípio, inoculou-se 2 µl da EPI300-T1 R em 10 ml de meio líquido LB + 10 mm de MgSO 4, incubou-se em mesa agitadora a 180 r.p.m. a 37ºC por toda a noite. Transferiu-se 5 ml desta cultura para um Erlenmeyer de 250 ml, contendo 50 ml de LB líquido + 10 mm de MgSO 4, incubou-se a 180 r.p.m. em mesa agitadora a 37 ºC, até obter OD 600 = 1,0. Colocouse então 10 µl da reação de ligação em um tubo eppendorf contendo 25 µl do extrato de empacotamento lambda. Incubou-se a 30ºC por 90 minutos, em seguida adicionou-se mais 25 µl do extrato de empacotamento, e foi feita incubação por mais 90 minutos a 30ºC. Após a segunda incubação por 90 minutos, adicionou-se Phage Diluition Buffer completando o volume para 1 ml. A este adicionou-se 25 µl de clorofórmio. Misturou-se e estocou-se na geladeira. Para posterior infecção das células. 25

43 Figura 6. Mapa do vetor pcc1fos Figura. 7. Visão geral da construção de biblioteca de fosmídeo utilizando o sistema CopyControl (Epicentre Biotechnologies), e subseqüente indução dos clones à um alto número de cópia. 26

44 3.6.1 Identificação dos clones Todas as amostras foram plaqueadas em placas contendo meio sólido LB e o antibiótico cloranfenicol na concentração de 12,5 µg/ml. Em seguida, as placas foram incubadas em estufa a 37 C por toda a noite. 0s clones transformantes foram coletados com o auxílio de dois catadores e organizados em placas de Petri contendo meio sólido LB e cloranfenicol a 12,5 µg/ml. As bactérias foram incubadas em estufa por 14h a 37ºC, e depois foram colocadas na geladeira. As bactérias foram inoculadas em placas de 96 poços contendo 70 µl de meio líquido LB contendo cloranfenicol a 12,5 µg/ml, e incubadas sob agitação por 14h a 37 C. No dia seguinte foram adicionados 70 µl de glicerol estéril a 16% às culturas. As placas foram então seladas com adesivos e armazenadas em freezer a -80 C Coleta dos clones Os clones transformantes (colônias brancas) foram coletados com o auxílio de dois catadores e organizados em placas de Petri contendo meio sólido LB e cloranfenicol a 12,5 µg/ml. As culturas ficaram em estufa por 14h a 37ºC, e depois foram colocadas na geladeira. Dois dias depois, as bactérias foram inoculadas em placas do tipo ELISA de 96 poços preenchidas com 70 µl de meio líquido LB contendo cloranfenicol 12,5 µg/ml, e incubadas sob agitação por 14h a 37 C. No d ia seguinte foram adicionados 70 µl de glicerol 16% estéril às culturas. As placas foram então seladas com adesivos e armazenadas em freezer a -80 C Indução dos clones fosmídeos a um alto número de cópia Adicionou-se em placa de 96 poços, 1 ml de meio LB contendo 12,5 µg/ml de cloranfenicol por poço, e tocou-se com replicador automático na placa de 96 poços contendo o estoque dos clones fosmídeos em glicerol. Colocou-se o adesivo para tampar a placa e perfurou o mesmo para aerar o ambiente. Fez-se incubação por 37ºC por 16h a 260 r.p.m. Passado este período, transferiu-se 200 µl das células crescidas, para outra placa de 96 poços contendo 800 µl de LB com 12,5 µg/ml de 27

45 cloranfenicol e 1 µl da induction solution (consta no kit), deixando por 37ºC por 5h a 260 r.p.m Extração do DNA plasmidial dos clones para sequenciamento Após a indução de um alto número de cópia por célula, foi feita a extração do DNA plasmidial dos clones, segundo a mesma metodologia de rotina, utilizada no laboratório de Genômica e Expressão Gênica da UESC/BA, como também a reação de sequenciamento, contudo utilizou-se os iniciadores pcc1 / pepifos Forward e o pcc1 / pepifos Reverse. Foi seqüenciada uma placa contendo 96 clones. Seqüência dos inciadores utilizados: 5' - GGATGTGCTGCAAGGCGATTAAGTTGG - 3' Forward 5' - CTCGTATGTTGTGTGGAATTGTGAGC - 3' Reverse Digestão dos clones para confirmar inserção dos fragmentos Utilizou-se cerca de 20 clones para fazer a digestão utilizando enzimas de corte único no vetor, são elas: EcoRI e HindIII. Utilizou-se cerca de 15 µl do DNA plasmidial e 1 unidade (1µL) de cada enzima, 3 µl de tampão Red 10X, o volume foi completado para 30 µl com água ultra pura estéril, e a reação foi incubada a 37ºC por toda a noite. Fez-se uma eletroforese em gel de agarose 1% e os fragmentos foram corados com Brometo de Etídio e visualizados em luz ultravioleta (UV) Análise de Bioinformática das seqüências As seqüências obtidas através do sequeciamento foram analisadas por bioinformática utilizando-se o programa Basic Local Alignment Search Tool (BLAST), disponível no National Center for Biotechnology Information (NCBI, para comparar a similaridade das seqüências submetidas com as disponíveis no banco de dados. 28

46 4. RESULTADOS 4.1 Análise físico-química do solo de Mata Atlântica As características físico-químicas das amostras de solo também foram determinadas (Tabela 3). As amostras apresentaram ph pouco ácido, em torno de 6,0. Tabela 3. Composição química e física do solo de Mata Atlântica. 4.2 Extração de DNA As extrações de DNA das amostras de solo foram feitas utilizando-se o método A e B anteriormente descritos. A extração obtida pelo método B apresentou-se melhor, quanto a pureza do DNA, uma vez que precisa-se de um DNA o mais isento possível de constituintes, como ácido húmico, para que não afete a atividade das enzimas empregadas na biologia molecular (Figuras 8 e 9). 29

47 Figura. 8. Métodos de extração de DNA de solo de Mata Atlântica. Tubo esquerdo: método A; Tubo direito: método B. Figura. 9. Eletroforese em gel de agarose 0,8%, 80V por 45min. Da esquerda para direita: marcador de Alto Peso Molecular (8-48 kb); DNA extraído pelo método A; DNA extraído pelo método B. Inicialmente os DNAs extraídos por ambos os métodos, foram utilizados como molde para a amplificação em PCR. Uma reação teste com DNA controle proveniente da Salmonella ssp. foi realizada para verificar se estava ocorrendo inibição da enzima Taq DNA polimerase por constituintes presentes na solução de DNA do solo. O teste foi feito adicionando-se 10ng do DNA do solo, obtido por cada metodologia, e a cada tubo de 200 µl para PCR. Adicionando-se também em um outro tubo a mesma quantidade de DNA controle e verificou-se que houve amplificação do gene 16S rdna nos tubos contendo DNA controle e no tubo contendo DNA extraído pelo método B. Só não amplificando o DNA obtido pelo método A. Mesmo a amostra de DNA ambiental estando ainda com um teor considerado de constituintes que pudessem inibir a ação da Taq DNA polimerase (o que é bem menos que a quantidade no método A). Ainda assim, os DNAs extraídos do solo foram diluídos em água ultra pura 30

48 estéril na proporção de 1:200 visando diluir também os inibidores existentes nas amostras. Nenhuma amplificação foi obtida pelo método A. Por outro lado, dos três tipos de purificação do método B, apenas 1 e 2 mostraram-se amplificáveis por PCR (dado não mostrado), embora seus resultados de leitura em espectrofotômetro nas razões 260/230 nm e 260/280 nm tenham mostrado nível aceitável de contaminação para edna (environmental DNA). A forma 3, por apresentar grande perda de DNA durante o processo, não se mostrou amplificável, nem confiável para estudo de biodiversidade. A metodologia B funcionou muito bem para vários solos. 1500pb Figura 10. Produto de PCR do 16S rdna obtidos pelo método B e pelas purificações 1 e 2. Canaleta 1- marcador pb; Canaleta 2 e 3 Raso da Catarina (Cerrado); 4 e 5 Mangue, 6 e 7 Mata Atlântica. Controle negativo (C-); e amostra de DNA de Salmonella ssp.,controle positivo (C+). Com o método B, obteve-se um rendimento de, em média, 596 ng/µl, enquanto com o método A, obteve-se rendimento de, em média, 310 ng/µl. O resultado dessas leituras em espectrofotômetro mostram que o método B tem um rendimento quase duas vezes maior que o do método A. Essa diferença de rendimento também foi observada visualmente pela análise de bandas após eletroforese dos DNAs extraídos pelos métodos A e B (Figura 11). As principais diferenças entre os dois métodos de extração estão na adição de Glass Beads no método B, enquanto no método A isso não acontece, e na etapa de lise, na qual no método B, utiliza-se choque térmico e no método A, maceração. Estas duas diferenças podem ser as principais explicações para o maior rendimento de DNA pelo método B. 31

49 Figura 11. Eletroforese em gel de agarose 0,8%, mostrando DNA total e DNA total depois de digestão: Canaleta 1- marcador de alto peso molecular 8-48 kb. 2- DNA extraído pelo método B, purificado 1 vez e sem digestão. 3- DNA extraído pelo método B purificado 1 vez e digerido por EcoRI. 4- DNA extraído pelo método B purificado 2 vezes e digerido por BamHI. 5- DNA extraído pelo método B purificado 2 vezes e sem digestão. 6- DNA extraído pelo método B purificado 2 vezes e digerido por EcoRI. 7- DNA extraído pelo método B purificado 2 vezes e digerido por BamHI. 8- DNA extraído pelo método A sem digestão. 9- DNA extraído pelo método A parcialmente digerido por EcoRI. 10- DNA extraído pelo método A parcialmente digerido por BamHI. 4.3 Análise da Biodiversidade Construção da biblioteca de 16S rdna Os produtos de PCR foram utilizados para construir bibliotecas de genes 16S rdna, utilizando-se os inciadores 27F/1525R. Foram obtidos 864 clones transformantes que foram divididos em 9 placas de ELISA contendo 96 clones cada. A organização da biblioteca gênica nas placas se deu da seguinte maneira: Identificação da placa por início da monagem (ex: PL 01 PL09). Seguido do nome do solo e região de interesse. (ex. PL01 Mata Atlântica 16S). A nomenclatura dos 96 clones em cada placa foi feita identificando as linhas de A a H e as colunas de 1 a 12. A extração do DNA plasmidial que contém o inserto correspondente ao gene 16S rdna foi feita utilizando-se o suporte tecnológico de rotina do laboratório de Genômica e Expressão Gênica da UESC/BA (Figura 12). 32

50 Figura 12. Eletroforese em gel de agarose 1,0 %, mostrando extração de DNA plasmidial (miniprep) de alguns clones da biblioteca de 16S.rDNA. A construção da biblioteca com os iniciadores 27F e 1525R, foi escolhida, por que estes são considerados universais, ou seja, anelam no 16S rdna de bactérias de praticamente todos os filos conhecidos. Estes iniciadores têm sido amplamente utilizados na análise de comunidades bacterianas de diversos ambientes Sequenciamento dos clones contendo o inserto de 16S rdna Assim como a extração do DNA plasmidial, a reação de seqüenciamento dos 864 clones foi realizada também, utilizando-se o suporte tecnológico de rotina do laboratório de Genômica e Expressão Gênica da UESC/BA. O seqüenciamento dos clones foi feito com os iniciadores M13 F Análise de Bioinformática das seqüências obtidas pelo sequenciamento Para estudo dos dados de bionformática alcançados via seqüenciamento, foram analisadas no total 659 seqüências com tamanho superior a 200 bp, o suficiente para realizar predições de hierarquia taxonômica com alta confiança, as 33

51 demais seqüências foram descartadas, por não apresentarem tamanho suficiente para este tipo de anáise. Desse total, 631 seqüências foram classificadas como bactéria e 28 seqüências não tiveram classificação de domínio. Dos filos do domínio bactéria, 374 são Proteobacterias, 191 são Firmicutes, cinco Planctomycetes e apenas uma Acidobacteria. Assim, 60 seqüências classificadas no domínio Bactéria têm filo desconhecido (Figura 13). Bacteria - Filos Acidobacteria Firmicutes Planctomycetes Proteobacteria Desconhecidas Figura 13. Classificação dos filos identificados no domínio Bacteria Dos 191 organismos do filo Firmicutes, 184 seqüências foram classificadas como Bacilli e uma única seqüência faz parte da classe Clostridia. Todas as três seqüências do filo Planctomycetes pertencem a classe Planctomycetacia. O clone de Acidobacteria pertence a classe Acidobacteria. Dos 374 organismos do filo Proteobacteria, a classe Alphaproteobacteria tem três seqüências representantes, Betaproteobacteria tem 3 seqüências representantes e a maioria, 359, pertencem a classe Gammaproteobacteria. Das classes identificadas, a Gammaproteobacteria é a que tem maior diversidade de ordens, sendo que 50 seqüências são Xanthominadales, 105 são Pseudomonadales e 192 são Enterobacteriales (Figura 14). 34

52 Um total de 245 seqüências obteve qualidade e tamanho suficientes para detecção do gênero, que é o mais específico que a ferramenta de detecção pode chegar. Os resultados mostram uma grande diversidade de gênero, contudo uma maior quantidade de Caryophanon, Bacillus, Flavimonas, Stenotrophomonas e Acinetobacter (Figura 15). Gammaproteobacteria Enterobacteriales Pseudomonadales Xanthomonadales Figura 14. Distribuição das classes do filo Gammaproteobacteria Gêneros Acidobacterium Acinetobacter Afipia Bacillus Burkholderia Caryophanon Citrobacter Enterobacter Flavimonas Hafnia Isosphaera Paenibacillus Phenylobacterium Pseudomonas Figura 15. Distribuição dos gêneros encontrados. 35

53 Para a análise de distância filogenética foram utilizadas, do total, 380 seqüências que estavam todas na região inicial da seqüência ribossomal entre os nucleotídeos 1 500; seqüências que não compartilharam essa mesma região foram descartadas, isso é necessário para realizar o alinhamento global. O dendograma se mostrou coerente com os dados de predição de hierarquia taxonômica, agrupando corretamente as classes (Figura 16). 36

54 37

55 38

56 39

57 40

58 41

59 Figura 16. Dendograma mostrando a distribuição e as distâncias filogenéticas dos microrganismos, os clones estão identificados como PxxNxx, onde Pxx é a identificação da placa e Nxx o identificador do clone na placa. 42

60 4.4 Análise dos dados obtidos pela análise de ARDRA Este passo foi realizado a fim de confirmar a validade dos dados alcançados pelo sequenciamento, e também de corroborar a eficiência de ambas as técnicas, uma vez que por si só, os resultados obtidos via sequenciamento dos clones, seriam suficientes o bastante para gerar dados informativos da diversidade microbiana presente no solo em estudo. Assim, o DNA plasmidial de 48 clones transformantes da placa 04 (placa escolhida aleatoriamente,foi extraído e amplificado com os iniciadores 27F/1525R para confirmar se os clones possuíam ou não o inserto correspondente ao gene 16S rdna (Figura 17). As enzimas AluI, HhaI e MspI foram utilizadas na análise de restrição do rdna amplificado (ARDRA) para avaliar o perfil de restrição dos clones selecionados (Figura 18, 19 e 20). O método para analisar este perfil gerado após eletroforese em gel de agarose 2,0% a 120V por 2 horas, foi o NTSYS (Figura 21). Figura 17. PCR 16S rdna da placa 04 (PL04). Mostrando o fragmento de aproximadamente 1500pb. 43

61 M A1 B1 C1 D1 E1 F1 G1 H1 A2 B2 C2 D2 E2 F2 G2 H2 A3 B3 M Figura 18. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade bacteriana do solo de Mata Atlântica amplificados com os iniciadores 27F e 1525R, e digeridos com: Enzima de restrição AluI - porção acima do gel, digestão com a enzima HhaI porção intermediária e MspI porção inferior. Nas extremidades ladder de pb. 44

62 M C3 D3 F3 G3 H3 A4 B4 C4 D4 E4 D7 E7 F7 G7 H7 E8 F8 G8 M Figura 19. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade bacteriana do solo de Mata Atlântica amplificados com os iniciadores 27F e 1525R, e digeridos com: Enzima de restrição AluI - porção acima do gel, digestão com a enzima HhaI porção intermediária e MspI porção inferior. Nas extremidades ladder de pb. 45

63 M G8 H8 D9 E9 F9 G9 H9 D10 E10 F10 G10 H10 M Figura 20. Eletroforese em gel de agarose 2,0%. Produtos de ARDRA da comunidade bacteriana do solo de Mata Atlântica amplificados com os iniciadores 27F e 1525R, e digeridos com: Enzima de restrição AluI - porção acima do gel, digestão com a enzima HhaI porção intermediária e MspI porção inferior. Nas extremidades ladder de pb. 46

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI.

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. Antonia Cardoso Almeida ( ICV/ UFPI); Francilene Leonel Campos(orientadora, Curso de Licenciatura em Ciências Biológicas/

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

MEIOS DE CULTURA DESENVOLVIMENTO OU PRODUÇÃO DE MEIOS DE CULTURA. Necessidade Bactérias Leveduras

MEIOS DE CULTURA DESENVOLVIMENTO OU PRODUÇÃO DE MEIOS DE CULTURA. Necessidade Bactérias Leveduras MEIOS DE CULTURA Associação equilibrada de agentes químicos (nutrientes, ph, etc.) e físicos (temperatura, viscosidade, atmosfera, etc) que permitem o cultivo de microorganismos fora de seu habitat natural.

Leia mais

Disciplinas. Dinâmica de Potássio no solo e sua utilização nas culturas

Disciplinas. Dinâmica de Potássio no solo e sua utilização nas culturas Disciplinas Solos nos domínios morfoclimáticos do cerrado Ementa: Solos em ambientes de Cerrado. Sistema Brasileiro de Classificação do Solo. Caracterização morfológica das principais classes de solo inseridas

Leia mais

Ubiquidade de microorganismos. Introdução. Materiais Necessários

Ubiquidade de microorganismos. Introdução. Materiais Necessários dução Os microorganismos (fungos, bactérias e vírus) são chamados assim por terem um tamanho bastante reduzido. Eles são tão pequenos que não conseguimos enxergá-los a olho nu, mas apenas utilizando microscópio

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Departamento de Biologia da Universidade do Minho

Departamento de Biologia da Universidade do Minho Departamento de Biologia da Universidade do Minho Mestrado em Genética Molecular Ano lectivo de 2004/2005, edição de 2004-2006 Estudo da regulação do gene STL1 codificando o sistema de simporte H + /glicerol

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

E C O L O G I A. Incluindo todos os organismos e todos os processos funcionais que a tornam habitável

E C O L O G I A. Incluindo todos os organismos e todos os processos funcionais que a tornam habitável E C O L O G I A Deriva do grego oikos, com sentido de casa e logos com sentido de estudo Portanto, trata-se do estudo do ambiente da casa Incluindo todos os organismos e todos os processos funcionais que

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

CLASSIFICAÇÃO DOS MICRORGANISMOS

CLASSIFICAÇÃO DOS MICRORGANISMOS CONSULTAR Disciplina: Microbiologia Geral CLASSIFICAÇÃO DOS MICRORGANISMOS Microbiologia Tortora, G. J.; Funke, B. R.; Case, C. L.. Capítulo 1 Pag. 2-6 Capítulo 2 Pag. 276-284 Classificação dos microrganismos

Leia mais

Formas do fósforo: -Ortofosfatos: PO 4 3-, HPO 4 2-, H 2 PO 4 -, H 3 PO 4

Formas do fósforo: -Ortofosfatos: PO 4 3-, HPO 4 2-, H 2 PO 4 -, H 3 PO 4 CICLO DO FÓSFORO O fósforo é um não-metal multivalente pertencente à série química do nitrogênio (grupo 15 ou 5 A) que se encontra na natureza combinado, formando fosfatos inorgânicos, inclusive nos seres

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹

Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Transformação genética de milho com construções gênicas contendo o gene AtDREB2A visando tolerância à seca¹ Vanessa Diniz Barcelos Vasconcelos 2, Newton Portilho Carneiro 3 1 Trabalho financiado pelo CNPq/Fapemig

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE

BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE Cláudio Martin Jonsson Vera Lúcia Castro Jaguariúna, outubro 2005. O modelo de agricultura utilizado atualmente visa

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Crescimento Microbiano

Crescimento Microbiano Crescimento Microbiano Fatores que influem no crescimento Temperatura ph Oxigênio Agitação Pressão osmótica Temperatura Para todos os microrganismos existem três temperaturas cardeais: Temperatura mínima

Leia mais

CARTÕES DE COLETA DE AMOSTRAS

CARTÕES DE COLETA DE AMOSTRAS CARDS CARTÕES DE COLETA DE AMOSTRAS Os cartões para extração Biopur proporcionam uma coleta simples, confiável e eficiente, garantindo a preservação de ácidos nucleicos a longo prazo. São ideais para o

Leia mais

O USO DA BIODIVERSIDADE COMO PRESERVAÇÃO AMBIENTAL

O USO DA BIODIVERSIDADE COMO PRESERVAÇÃO AMBIENTAL O USO DA BIODIVERSIDADE COMO PRESERVAÇÃO AMBIENTAL Stefani de Souza Patricia de Freitas Co-autor - Prof. MSc. Cristian Coelho Silva cristian_coelho@yahoo.com.br luscheuer@hotmail.com Palavras-chave: sustentabilidade,

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

CICLOS BIOGEOQUÍMICOS

CICLOS BIOGEOQUÍMICOS CICLOS BIOGEOQUÍMICOS O fluxo de energia em um ecossistema é unidirecional e necessita de uma constante renovação de energia, que é garantida pelo Sol. Com a matéria inorgânica que participa dos ecossistemas

Leia mais

Matéria Orgânica do solo (m.o.s)

Matéria Orgânica do solo (m.o.s) Matéria Orgânica do solo (m.o.s) Objetivos Proporcionar conhecimentos básicos sobre a origem e dinâmica da m.o. do solo; Conhecer suas características e propriedades; Discutir como algumas propriedades

Leia mais

Prof. Maria Alice Z. Coelho www.eq.ufrj.br/biose/courses.html

Prof. Maria Alice Z. Coelho www.eq.ufrj.br/biose/courses.html Prof. Maria Alice Z. Coelho www.eq.ufrj.br/biose/courses.html MICRO microscópio de Robert Hooke (1635-1703) microscópios primitivos de uma lente feitos por van Leeuwenhoek (1632-1723) Fatia fina de cortiça,

Leia mais

Histórico da Classificação Biológica

Histórico da Classificação Biológica Texto Base: Aula 9 Histórico da Classificação Biológica Autoras: Suzana Ursi e Sônia Lopes Iniciamos nosso texto propondo que você observe por um instante os organismos representados nas figuras ao lado.

Leia mais

O NÚMERO DE BACTÉRIAS

O NÚMERO DE BACTÉRIAS O NÚMERO DE BACTÉRIAS A CONTAGEM EM PLACAS A contagem em placas é um dos métodos mais utilizados para determinar qual o número de microrganismos viáveis em um meio líquido. Quando a concentração é baixa,

Leia mais

Complete com as principais características de cada bioma: MATA ATLÂNTICA

Complete com as principais características de cada bioma: MATA ATLÂNTICA Atividade de Ciências 5º ano Nome: ATIVIDADES DE ESTUDO Complete com as principais características de cada bioma: MATA ATLÂNTICA FLORESTA AMAZÔNICA FLORESTA ARAUCÁRIA MANGUEZAL PANTANAL CAATINGA CERRADO

Leia mais

Aula 2 Transformações de Carbono e Energia

Aula 2 Transformações de Carbono e Energia 1.018/7.30J Outono 2003 Fundamentos da Ecologia Aula 2 Transformações de Carbono e Energia LEITURAS PARA A PRÓXIMA AULA: Krebs, Capítulo 25: Ecosystem Metabolism I: Primary Productivity Luria. 1975. Overview

Leia mais

UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA

UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA DISCIPLINA BIOQUÍMICA ESTRUTURAL Ministrante: Prof. Dr. Carlos Alberto de Almeida

Leia mais

PROCESSO SELETIVO BIOLOGIA ÁREA: CIÊNCIAS DA NATUREZA, MATEMÁTICA E SUAS TECNOLOGIAS

PROCESSO SELETIVO BIOLOGIA ÁREA: CIÊNCIAS DA NATUREZA, MATEMÁTICA E SUAS TECNOLOGIAS PROCESSO SELETIVO BIOLOGIA ÁREA: CIÊNCIAS DA NATUREZA, MATEMÁTICA E SUAS TECNOLOGIAS Perceber e utilizar os códigos intrínsecos da Biologia. Relacionar o conhecimento das diversas disciplinas para o entendimento

Leia mais

Exercício 2 DNA e Eletroforese

Exercício 2 DNA e Eletroforese Exercício 2 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

Resistência aos antimicrobianos em Salmonella spp.

Resistência aos antimicrobianos em Salmonella spp. Resistência aos antimicrobianos em Salmonella spp. Síntese das investigações desde a descoberta de novos antimicrobianos Final do século XIX: Pasteur efetuou relatos sobre antagonismo entre diferentes

Leia mais

EDITAL N 01/2008/INPA CONCURSO PÚBLICO ANEXO I VAGAS CONFORME AS CARREIRAS E PERFIS CORRESPONDENTES E LISTA DE TEMAS PARA PROVA ESCRITA.

EDITAL N 01/2008/INPA CONCURSO PÚBLICO ANEXO I VAGAS CONFORME AS CARREIRAS E PERFIS CORRESPONDENTES E LISTA DE TEMAS PARA PROVA ESCRITA. EDITAL N 01/2008/INPA CONCURSO PÚBLICO ANEXO I VAGAS CONFORME AS CARREIRAS E PERFIS CORRESPONDENTES E LISTA DE TEMAS PARA PROVA ESCRITA. 1. CARREIRA DE PESQUISA EM CIÊNCIA E TECNOLOGIA CARGO DE PESQUISADOR

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

Abordagens moleculares no estudo da diversidade microbiana

Abordagens moleculares no estudo da diversidade microbiana A vida sem microrganismos não seria possível! Abordagens moleculares no estudo da diversidade microbiana Teresa Lino Neto tlneto@bio.uminho.pt Departamento de Biologia Universidade do Minho 1 Importantes

Leia mais

34 Por que as vacas mastigam o tempo todo?

34 Por que as vacas mastigam o tempo todo? A U A UL LA Por que as vacas mastigam o tempo todo? Nos sítios e fazendas que têm criação de gado, os bois e vacas se espalham pelo pasto e têm hora certa para ir ao cocho receber o trato. O trato pode

Leia mais

BIOLOGIA NO ENEM: CONTEÚDO PROGRAMÁTICO

BIOLOGIA NO ENEM: CONTEÚDO PROGRAMÁTICO BIOLOGIA NO ENEM: CONTEÚDO PROGRAMÁTICO O ENEM, Exame Nacional do Ensino Médio, em sua versão 2012, apresentará uma redação e 180 questões objetivas, divididas nas quatro áreas do conhecimento: - Ciências

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS. ECOLOGIA Conceitos e Sucessão Ecológica

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS. ECOLOGIA Conceitos e Sucessão Ecológica UFRGS ECOLOGIA Conceitos e Sucessão Ecológica 1. (Ufrgs 2014) Considere as seguintes afirmações sobre conceitos utilizados em ecologia. I. Nicho ecológico é a posição biológica ou funcional que um ecossistema

Leia mais

O desmatamento das florestas tropicais responde por 25% das emissões globais de dióxido de carbono, o principal gás de efeito estufa.

O desmatamento das florestas tropicais responde por 25% das emissões globais de dióxido de carbono, o principal gás de efeito estufa. Biodiversidade Introdução Na Estratégia Nacional para a Biodiversidade, desenvolvida pelo Ministério do Meio Ambiente, acordou-se que o Brasil deve dar ênfase para seis questões básicas: conhecimento da

Leia mais

Instituição executora do projeto: Centro de Pesquisas Ambientais do Nordeste (CEPAN) Coordenador Geral: Felipe Pimentel Lopes de Melo Coordenador

Instituição executora do projeto: Centro de Pesquisas Ambientais do Nordeste (CEPAN) Coordenador Geral: Felipe Pimentel Lopes de Melo Coordenador Instituição executora do projeto: Centro de Pesquisas Ambientais do Nordeste (CEPAN) Coordenador Geral: Felipe Pimentel Lopes de Melo Coordenador Técnico: Maria das Dores de V. C. Melo Coordenação Administrativa-Financeira:

Leia mais

UNIVERSIDADE ESTADUAL DE SANTA CRUZ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA E BIOLOGIA MOLECULAR

UNIVERSIDADE ESTADUAL DE SANTA CRUZ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA E BIOLOGIA MOLECULAR UNIVERSIDADE ESTADUAL DE SANTA CRUZ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA E BIOLOGIA MOLECULAR APLICAÇÃO DA METAGENÔMICA DE SOLOS VISANDO À IDENTIFICAÇÃO DE NOVOS

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

Recursos Genéticos brasileiros. Derly José Henriques da Silva Professor do Departamento de Fitotecnia Universidade Federal de Viçosa

Recursos Genéticos brasileiros. Derly José Henriques da Silva Professor do Departamento de Fitotecnia Universidade Federal de Viçosa Recursos Genéticos brasileiros Derly José Henriques da Silva Professor do Departamento de Fitotecnia Universidade Federal de Viçosa Acesso aos recursos genéticos (antes da CDB ECO - RIO 1992) recursos

Leia mais

EXTRAÇÃO DE DNA (2) A EXTRAÇÃO DE DNA A PRÁTICA NO LABORATÓRIO DE ENSINO BIBLIOGRAFIA

EXTRAÇÃO DE DNA (2) A EXTRAÇÃO DE DNA A PRÁTICA NO LABORATÓRIO DE ENSINO BIBLIOGRAFIA EXTRAÇÃO DE DNA (2) A EXTRAÇÃO DE DNA Muitas pesquisas de Biologia Molecular começam com a extração de ácidos nucleicos. A lise celular libera as moléculas em uma fase aquosa que é separada dos restos

Leia mais

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

ECOSSISTEMA INDIVÍDUO

ECOSSISTEMA INDIVÍDUO Biodiversidade O diversidade biológica - descreve a riqueza e a variedade do mundo natural. As plantas, os animais e os microrganismos fornecem alimentos, remédios e boa parte da matéria-prima industrial

Leia mais

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes)

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes) PT Instruções de utilização CYCLER CHECK Kit de teste para a validação da uniformidade da temperatura em termocicladores pronto a usar, pré-aliquotado REF 7104 (10 testes) REF 71044 (4 testes) Índice 1.

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

ORGANELAS CITOPLASMÁTICAS. Prof. Emerson

ORGANELAS CITOPLASMÁTICAS. Prof. Emerson ORGANELAS CITOPLASMÁTICAS Prof. Emerson Algumas considerações importantes: Apesar da diversidade, algumas células compartilham ao menos três características: São dotadas de membrana plasmática; Contêm

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

PROGRAMAÇÃO CURRICULAR DE CIÊNCIAS

PROGRAMAÇÃO CURRICULAR DE CIÊNCIAS PROGRAMAÇÃO CURRICULAR DE CIÊNCIAS 6 ano 1 volume CONTEÚDOS OBJETIVOS 1.Astronomia: estudando o céu Estrelas e constelações Sistema Solar e exploração do Universo - Movimentos da - Terra e da Lua Reconhecer

Leia mais

Create PDF with GO2PDF for free, if you wish to remove this line, click here to buy Virtual PDF Printer

Create PDF with GO2PDF for free, if you wish to remove this line, click here to buy Virtual PDF Printer AGRICULTURA E AQUECIMENTO GLOBAL Carlos Clemente Cerri Centro de Energia Nuclear na Agricultura (CENA/USP) Fone: (19) 34294727 E-mail: cerri@cena.usp.br Carlos Eduardo P. Cerri Escola Superior de Agricultura

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

VÍRUS E BACTÉRIAS. Disciplina: Ciências Série: 6ª série EF - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Vírus e Bactérias

VÍRUS E BACTÉRIAS. Disciplina: Ciências Série: 6ª série EF - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Vírus e Bactérias Disciplina: Ciências Série: 6ª série EF - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Vírus e Bactérias VÍRUS E BACTÉRIAS Vírus e bactérias foram, por muito tempo, juntamente com seres unicelulares

Leia mais

Princ ipa is funç õe s dos mic rorga nis mos na na tureza

Princ ipa is funç õe s dos mic rorga nis mos na na tureza PONTIFÍCIA UNIVERSIDADE CATÓLICA DE GOIÁS DEPARTAMENTO DE BIOLOGIA CURSO DE ENGENHARIA AMBIENTAL MICROBIOLOGIA APLICADA Princ ipa is funç õe s dos mic rorga nis mos na na tureza Profa.Ana Maria Curado

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA Aluno: Módulo I Professor: Leandro Parussolo Unidade Curricular: Biologia Celular ATIVIDADE

Leia mais

ALUNO(a): Observe o esquema a seguir, no qual I e II representam diferentes estruturas citoplasmáticas.

ALUNO(a): Observe o esquema a seguir, no qual I e II representam diferentes estruturas citoplasmáticas. GOIÂNIA, / / 2015 PROFESSOR: DISCIPLINA: SÉRIE: 3º ano ALUNO(a): Lista de Exercícios NOTA: No Anhanguera você é + Enem Questão 01) Observe o esquema a seguir, no qual I e II representam diferentes estruturas

Leia mais

BIOLOGIA-2011. QUESTÕES de 01 a 06. Questão 01. Questão 02

BIOLOGIA-2011. QUESTÕES de 01 a 06. Questão 01. Questão 02 -2011 UFBA UFBA -- 2ª 2ª FASE 2011 QUESTÕES de 01 a 06 Questão 01 Todas as bactérias compartilham um conjunto de genes essenciais evolutivamente conservados, que codificam produtos indispensáveis à sua

Leia mais

Questão 1. Questão 3. Questão 2. Resposta. Resposta

Questão 1. Questão 3. Questão 2. Resposta. Resposta Questão 1 Uma enzima, extraída da secreção de um órgão abdominal de um cão, foi purificada, dissolvida em uma solução fisiológica com ph 8 e distribuída em seis tubos de ensaio. Nos tubos 2, 4 e 6, foi

Leia mais

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Darwin Voltar Filogenia anatômica e fisiológica Filogênia Molecular A teoria da evolução de Darwin gerou o conceito

Leia mais

QUÍMICA CELULAR NUTRIÇÃO TIPOS DE NUTRIENTES NUTRIENTES ENERGÉTICOS 4/3/2011 FUNDAMENTOS QUÍMICOS DA VIDA

QUÍMICA CELULAR NUTRIÇÃO TIPOS DE NUTRIENTES NUTRIENTES ENERGÉTICOS 4/3/2011 FUNDAMENTOS QUÍMICOS DA VIDA NUTRIÇÃO QUÍMICA CELULAR PROFESSOR CLERSON CLERSONC@HOTMAIL.COM CIESC MADRE CLÉLIA CONCEITO CONJUNTO DE PROCESSOS INGESTÃO, DIGESTÃO E ABSORÇÃO SUBSTÂNCIAS ÚTEIS AO ORGANISMO ESPÉCIE HUMANA: DIGESTÃO ONÍVORA

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais