ESCOLA SUPERIOR DE ENFERMAGEM S. JOSÉ DE CLUNY. Frequência de Bioquímica Geral Modalidade Escrita

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "ESCOLA SUPERIOR DE ENFERMAGEM S. JOSÉ DE CLUNY. Frequência de Bioquímica Geral Modalidade Escrita"

Transcrição

1 ESCOLA SUPERIOR DE ENFERMAGEM S. JOSÉ DE CLUNY Frequência de Bioquímica Geral Modalidade Escrita Semestre 1 Prof. Nuno Costa Ano Lectivo 2008/2009 Data 12/ 12/ 2008

2 GRUPO I 1) O constituinte inorgânico mais abundante na matéria viva é: a) A água. b) As proteínas. c) O sal de sódio. d) Os lípidos. e) Os glúcidos. 2) Os valores ph = 2, ph = 7 e ph = 9 são, respectivamente, de soluções: a) Ácidas, básicas e neutras. b) Básicas, ácidas e neutras. c) Neutras, ácidas e básicas. d) Ácidas, neutras e básicas. e) Neutras, ácidas e ácidas. 3) O ph da água pura é: a) zero. b) 7 c) 14 d) 1 e) 10 4) São funções da água, no protoplasma celular: I - actuar como solvente da maioria das substâncias. II - não actuar na manutenção do equilíbrio osmótico dos organismos em relação ao meio ambiente. III - constituir o meio dispersante dos coloides celulares. IV - participar das reacções de hidrólise. V - agir como activador enzimático. A alternativa que contém as funções verdadeiras é: a) I, II, III b) III, IV, V c) I, III, IV d) V, II, III e) III, II, I 5) Em relação ao papel desempenhado pela água nas estruturas celulares dos seres vivos, qual das afirmações não é correcta? a) É o veículo de eliminação das excreções provenientes do metabolismo celular. b) Age como catalisador enzimático de numerosas reacções intracelulares. c) Oferece grandes condições de estabilidade aos coloides protoplasmáticos. d) Tem participação directa nos fenómenos osmóticos entre a célula e o meio extracelular. e) Participa das reacções de hidrólise. 6) O papel principal do ião PO - 4 na célula é: a) Manter o equilíbrio osmótico. b) Formar ligações de alta energia. c) Actuar como oxidante energético. 2

3 d) Regular o equilíbrio ácido-base. e) Actuar como catalisador em reacções metabólicas. 7) Exemplos de polissacarídeo, dissacarídeo, hexose e pentose, respectivamente: a) Celulose, sacarose, ribose e frutose. b) Amido, maltose, glicose e desoxirribose. c) Quitina, lactose, maltose e desoxirribose. d) Amido, celulose, glicogénio e frutose. e) Ácido hialurónico, quitina, frutose e ribose. 8) Glicogénio e celulose têm em comum, na sua composição, moléculas de: a) Aminoácidos. c) Hidratos de carbono. e) Glicerol. b) Ácidos gordos. d) Proteínas. 9) Os glúcidos que podem ser hidrolisados dando outros glúcidos de moléculas menores são chamados: a) Oses. d) Osídos. b) Monossacarídeos. e) Polipeptídeos. c) Esteroídes. 10) Entre as substâncias relacionadas, qual delas representa a principal fonte energética de preferência das células? a) Proteínas. d) Vitaminas. b) Celulose. e) Água. c) Glicose. 11) Os ésteres de ácidos gordos com álcoois são quimicamente classificados como: a) Glúcidos. d) Lípidos. b) Proteínas. e) Ácidos nucleicos. c) Enzimas. 12) Não podemos considerar como lípidos simples: a) Ésteres de ácidos gordos com glicerol apenas. b) Compostos conhecidos como gorduras, óleos e ceras. c) Lípidos formados por C, H e O apenas. d) Ésteres de ácidos gordos com álcoois, acrescidos de radicais contendo N, P ou S. e) Lípidos que contêm glicerol, colesterol ou outros álcoois, sem radicais nitrogenados, fosforilados ou sulfatados. 13) Os lípidos mais usados na nossa alimentação são integrantes do grupo dos: a) Monoglicérídos. b) Esteróis. 3

4 c) Triglicéridos. d) Lípidos complexos. e) Céridos. 14) Obteve-se da hidrólise de uma substância de origem animal: glicina, serina, histidina, lisina, arginina e fenilalanina. A substância hidrolisada era: a) Um polissacarido. b) Uma proteína. c) Um ácido nucleico. d) Uma cetose. e) Um lípido. 15) Considere as seguintes afirmações: I- As proteínas são substâncias de grande importância para os seres vivos: muitas participam da construção da matéria viva. II- As proteínas chamada enzimas facilitam reacções químicas celulares. III- Os anticorpos, que também são proteínas, funcionam como substâncias de defesa. Assinale: a) Se somente I estiver correcta. b) Se somente II estiver correcta. c) Se somente III estiver correcta. d) Se I e II estiverem correctas. e) Se todas estiverem correctas. 16) No esquema seguinte: I - As letras X e Z representam dois aminoácidos quaisquer. II - A letra Y representa uma ligação peptídica. III - A letra W representa uma proteína qualquer. Assinale: a) Se I, II e III forem verdadeiras b) Se I, II e III forem falsas c) Se apenas I e II forem verdadeiras d) Se apenas I e IIl forem falsas e) Se apenas II e III forem verdadeiras 4

5 17) Chama-se aminoácido essencial ao aminoácido que: a) Não é sintetizado no organismo humano. b) É sintetizado em qualquer organismo animal. c) Só existe em determinados vegetais. d) Tem função semelhante à das vitaminas. e) È indispensável ao metabolismo energético. 18) Considerando-se a definição de enzimas, assinale a alternativa correcta: I - São catalisadores orgânicos, de natureza proteica, sensíveis às variações de temperatura. II - São substâncias químicas, de natureza lipídica, sendo consumidas durante o processo químico. III - Apresentam uma região chamada centro activo, à qual se adapta a molécula do substrato. a) Apenas a afirmativa I é correcta. b) Apenas as afirmativas II e III são correctas. c) Apenas as afirmativas I e III são correctas. d) Todas as afirmativas são correctas. e) Nenhuma afirmativa é correcta. 19) Quanto aos enzimas, pode-se dizer que: a) São proteínas com função de catalisadores químicos orgânicos que aumentam a velocidade das reacções químicas viáveis. b) São substâncias altamente específicas que actuam sempre sobre um determinado substrato, como se fosse um sistema chave-fechadura. c) Após a reacção continuam quimicamente intactas. d) A sua actividade depende da temperatura e do ph do meio. e) Todas as frases estão correctas. 20) Assinale o gráfico que melhor representa o efeito da concentração do substrato na velocidade inicial de uma reacção catalisada por um enzima. 21) A diferença entre DNA e RNA, em relação às bases, é: a) DNA tem uracilo e citosina. 5

6 b) RNA tem timina e adenina. c) DNA tem guanina e uracilo. d) DNA tem uracilo e timina. e) RNA tem adenina e uracilo. 22) Fazendo-se uma análise, por hidrólise, de moléculas de ácidos nucleicos, verifica-se o aparecimento de: a) Açúcar, fosfato e bases nitrogenadas. b) Proteínas, fosfato e bases nitrogenadas. c) Aminoácidos, açúcar e fosfato. d) Pentoses, bases nitrogenadas e aminoácidos. e) Pentoses, aminoácidos e fosfato. 23) Sobre o DNA é incorrecto afirmar que: a) É encontrado em todos os pontos da célula. b) Origina o RNA m. c) Reproduz-se por processo semiconservativo. d) É integrante dos genes nos cromossomas. e) Constitui-se de uma dupla cadeia de nucleótidos. 24) Uma cadeia de RNA mensageiro é formada a partir de uma fita de DNA, que apresenta a seguinte sequência de bases nitrogenadas: TAAATGGCG. A sequência das bases da cadeia do RNA mensageiro formada deve ser: a) CGGGCAAUA b) UTTTUCCGC c) UTAAUUUGU d) ACCCAUUGU e) AUUUACCGC 25) Os fenómenos 1,2 e 3 no esquema ao lado são respectivamente: a) Tradução, transcrição, duplicação b) Duplicação, transcrição, tradução c) Duplicação, tradução, transcrição d) Tradução, duplicação, transcrição e) Transcrição, duplicação, tradução 26) Ao ser sintetizada uma proteína pela acção de um gene específico, cada aminoácido é incorporado numa sequência predeterminada pela molécula de DNA. Qual o factor mais importante para que um aminoácido seja colocado na posição correcta durante esta síntese? a) DNA-polimerase. b) RNA-polimerase. c) RNA-mensageiro. 6

7 d) ATP. e) Concentração do aminoácido. 27) Considere um segmento de molécula de DNA com a seguinte sequência de bases: AAT - CAA - AGA - TTT - CCG Quantos aminoácidos poderão ter, no máximo, uma molécula de proteína formada pelo segmento considerado? a) 15 b) 10 c) 5 d) 3 e) 1 28) O esquema apresenta a síntese de um polipeptídeo a partir de uma molécula de DNA. É correcto dizer que o diagrama mostra: a) A tradução do código genético. b) A transcrição do código genético. c) A transcrição e a tradução do código genético. d) A replicação do DNA. e) A replicação do DNA, a transcrição e a tradução do código genético. 29) Em condições anaeróbicas, o músculo executa a glicólise produzindo ATP e ácido láctico. A produção de lactato é necessária devido à existência de uma quantidade limitada de na célula: a) ADP. b) Piruvato. c) Glucose. d) NAD +. e) NADH. 30) O piruvato entra no Ciclo de Krebs depois de ser convertido em: a) Acetaldeído. b) Lactato. c) Etanol. d) Acetil-CoA. 31) Em condições anaeróbicas, as células musculares podem usar para produzir energia: a) Ácidos gordos. b) Alanina. 7

8 c) Glucose. d) Ácidos gordos e glucose. e) Ácidos gordos e alanina. f) Glucose e alanina. g) Ácidos gordos, glucose e alanina. 32) Os corpos cetónicos circulam na corrente sanguínea... a) Como moléculas solúveis em água. b) Associados à superfície de lipoproteínas plasmáticas. c) Ligados não-covalentemente à albumina. d) Esterificados à carnitina. e) Esterificados à coenzima A. 33) Qual das seguintes frases é correcta? a) A respiração aeróbica é provavelmente mais antiga do que a respiração anaeróbica. b) Na ausência de oxigénio, a fermentação ocorre espontaneamente, sem a utilização de enzimas. c) Cada NADH + H + gerado no Ciclo de Krebs contém energia suficiente para produzir quase três moléculas de ATP. d) Ao contrário do piruvato, os ácidos gordos dividem-se em moléculas de 3 carbonos cada uma durante a respiração. e)em cada volta do Ciclo de Krebs formam-se 8 moléculas de dióxido de carbono. Grupo II 1) Escreva a fórmula estrutural do dissacarídeo seguinte: Maltose (α-glicose (1 4) β-glicose) 2) Escreva as fórmulas estruturais dos ácidos gordos abaixo, todos contendo 18C: a) 18 9,12 b) 18 9,12,15 3) A tabela abaixo mostra a sequência de codões e o seu aminoácido correspondente na síntese de proteínas. 8

9 De acordo com esta tabela, escreva a sequência de aminoácidos que correspondente ao RNAm mostrado: 5` AUGGUAGCCCAUAGAUGUUAA 3` 4) Mostre como o ph e temperatura podem influir sobre as reacções catalisadas pelos enzimas. 5) Observe o hidrato de carbono na figura: a) Classifique-o quanto ao número de sacarídeos ligados. b) Qual o tipo de ligação glucosídica entre cada um deles? 6) A partir dos dados abaixo sobre uma reacção enzimática, faça o gráfico da transformação de Lineweaver-Burk e determine o tipo de inibição. 9

10 COTAÇÃO COTAÇÕES GRUPO I 10 Questões 1 a 33 0,3 (cada) 10 Questão 1 1,0 Questão 2 1,0 GRUPO II Questão 3 2,0 Questão 4 1,0 Questão 5 2,0 Questão 6 3,0 TOTAL 20 10

Bioquímica Celular. LIVRO CITOLOGIA Capítulo 02 Itens 1 a 3 págs. 19 a 30. 3ª Série Profª Priscila F Binatto Fev/2013

Bioquímica Celular. LIVRO CITOLOGIA Capítulo 02 Itens 1 a 3 págs. 19 a 30. 3ª Série Profª Priscila F Binatto Fev/2013 Bioquímica Celular LIVRO CITOLOGIA Capítulo 02 Itens 1 a 3 págs. 19 a 30 3ª Série Profª Priscila F Binatto Fev/2013 Constituintes Bioquímicos da Célula Água e Minerais Carboidratos Lipídios Proteínas Ácidos

Leia mais

BIOQUÍMICA - composição química das células

BIOQUÍMICA - composição química das células BIOQUÍMICA - composição química das células I) Substâncias inorgânicas: água e sais minerais II) Substâncias orgânicas: carboidratos, lipídios, proteínas, ácidos nucléicos,... Substâncias mais presentes

Leia mais

Constituintes químicos dos seres vivos

Constituintes químicos dos seres vivos REVISÃO Bioquímica Constituintes químicos dos seres vivos S A I S I N O R G Â N I C O S CARBOIDRATOS São denominados: açúcares, hidratos de carbono, glicídios ou glicosídeos Energia para o trabalho celular

Leia mais

Principais funções dos sais minerais:

Principais funções dos sais minerais: A Química da Vida Água Água mineral é a água que tem origem em fontes naturais ou artificiais e que possui componentes químicos adicionados, como sais, compostos de enxofre e gases que já vêm dissolvidas

Leia mais

A Química da Vida. Gabriela Eckel

A Química da Vida. Gabriela Eckel A Química da Vida Gabriela Eckel Água A água é um composto químico formado por dois átomos de hidrogênio e um de oxigênio. Sua fórmula química é H2O. Porém, um conjunto de outras substâncias como, por

Leia mais

Bioquímica: Componentes orgânicos e inorgânicos necessários à vida. Leandro Pereira Canuto

Bioquímica: Componentes orgânicos e inorgânicos necessários à vida. Leandro Pereira Canuto Bioquímica: orgânicos e inorgânicos necessários à vida Leandro Pereira Canuto Toda matéria viva: C H O N P S inorgânicos orgânicos Água Sais Minerais inorgânicos orgânicos Carboidratos Proteínas Lipídios

Leia mais

Biomoléculas. * Este esquema não está a incluir as Vitaminas que são classificadas no grupo de moléculas orgânicas. Biomoléculas

Biomoléculas. * Este esquema não está a incluir as Vitaminas que são classificadas no grupo de moléculas orgânicas. Biomoléculas Biomoléculas Biomoléculas Inorgânicas Orgânicas Água Sais Minerais Glícidos Lípidos Prótidos Ácidos Nucléicos * Este esquema não está a incluir as Vitaminas que são classificadas no grupo de moléculas

Leia mais

UNIVERSO TERRA SERES VIVOS ORIGEM

UNIVERSO TERRA SERES VIVOS ORIGEM UNIVERSO TERRA SERES VIVOS ORIGEM BIOLOGIA Surgiu da observação, da curiosidade de se compreender a vida e da utilização da natureza em benefício humano Grande salto com Aristóteles Baseada na observação

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA BIOVESTIBA.NET VIRTUAL UFRGS BIOQUÍMICA 1. (Ufrgs 2015) Observe a tira abaixo. Se o filho do Radicci tornar-se vegetariano do tipo que não utiliza produtos derivados de animais, ficará impossibilitado

Leia mais

A função da água e sais minerais dentro da célula

A função da água e sais minerais dentro da célula A QUÍMICA DA VIDA A função da água e sais minerais dentro da célula Eles tem a ver com o metabolismo das mitocôndrias na qual a principal função seria de não parar a que sustenta, vejamos isso entre água

Leia mais

CARBOIDRATOS Classificação: De acordo com o número de moléculas em sua constituição temos: I- MONOSSACARÍDEOS ( CH 2 O) n n= varia de 3 a 7 Frutose Ga

CARBOIDRATOS Classificação: De acordo com o número de moléculas em sua constituição temos: I- MONOSSACARÍDEOS ( CH 2 O) n n= varia de 3 a 7 Frutose Ga CARBOIDRATOS Os carboidratos são as biomoléculas mais abundantes na natureza. Para muitos carboidratos, a fórmula geral é: [C(H2O)]n, daí o nome "carboidrato", ou "hidratos de carbono" -São moléculas que

Leia mais

BIOQUÍMICA CELULAR. Ramo das ciências naturais que estuda a química da vida. Prof. Adaianne L. Teixeira

BIOQUÍMICA CELULAR. Ramo das ciências naturais que estuda a química da vida. Prof. Adaianne L. Teixeira BIOQUÍMICA CELULAR Ramo das ciências naturais que estuda a química da vida Prof. Adaianne L. Teixeira Principais elementos químicos dos seres vivos CARBONO (C) (Essencial) HIDROGÊNIO (H) OXIGÊNIO (O) NITROGÊNIO

Leia mais

Água A superfície da Terra é constituída de três quartos de água, cerca de 70%, a maior parte está concentrada nos oceanos e mares, cerca de 97,5%, o

Água A superfície da Terra é constituída de três quartos de água, cerca de 70%, a maior parte está concentrada nos oceanos e mares, cerca de 97,5%, o A química da Vida Água A superfície da Terra é constituída de três quartos de água, cerca de 70%, a maior parte está concentrada nos oceanos e mares, cerca de 97,5%, o restante 2,5% está concentrado em

Leia mais

Água A água é uma substância química cujas moléculas são formadas por dois átomos de hidrogênio e um de oxigênio (H2O). É abundante no planeta Terra,

Água A água é uma substância química cujas moléculas são formadas por dois átomos de hidrogênio e um de oxigênio (H2O). É abundante no planeta Terra, A Química da Vida Água A água é uma substância química cujas moléculas são formadas por dois átomos de hidrogênio e um de oxigênio (H2O). É abundante no planeta Terra, onde cobre grande parte de sua superfície

Leia mais

Água, Sais e Carboidratos

Água, Sais e Carboidratos Água, Sais e Carboidratos A Bioquímica estuda as reações químicas dos organismos vivos e tem revelado inúmeras substancias presentes nas células e em outras que ela participa. A bioquímica estuda as moléculas

Leia mais

Bioquímica. Sabadão CSP especial Prof. Felipe Fernandes Prof. João Leite

Bioquímica. Sabadão CSP especial Prof. Felipe Fernandes Prof. João Leite Bioquímica Sabadão CSP especial Prof. Felipe Fernandes Prof. João Leite 1. Água 2. Sais Minerais 4. Os sais minerais são essenciais em uma alimentação saudável, pois exercem várias funções reguladoras

Leia mais

BIOQUÍMICA CELULAR, CITOLOGIA e METABOLISMO CELULAR

BIOQUÍMICA CELULAR, CITOLOGIA e METABOLISMO CELULAR BIOQUÍMICA CELULAR, CITOLOGIA e METABOLISMO CELULAR BIOQUÍMICA CELULAR COMPOSTOS INORGÂNICOS Moléculas simples: ÁGUA; SAIS MINERAIS. COMPOSTOS ORGÂNICOS Moléculas complexas: CARBOIDRATOS; LIPÍDIOS; PROTEÍNAS

Leia mais

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL

EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL 1ª série Ens. Médio 1. A figura a seguir refere-se à hereditariedade: a) EXERCÍCIOS DE MONITORIA 2º PERÍODO AGOSTO BIOLOGIA RECUP. PARCIAL b) Explique de que forma a molécula de DNA atua no fenômeno da

Leia mais

Biomoléculas e processos Passivos/Ativos na célula

Biomoléculas e processos Passivos/Ativos na célula Biomoléculas e processos Passivos/Ativos na célula ICB Dep. Mofologia Disciplina: Biologia Celular Bases moleculares e Macromoleculares Substâncias Inorgânicas/Orgânicas Processos Celulares Passivos/Ativos

Leia mais

Composição química. Profª Maristela. da célula

Composição química. Profª Maristela. da célula Composição química Profª Maristela da célula Compostos inorgânicos Água Sais minerais Compostos orgânicos Carboidratos Lipídios Proteínas Ácidos nucleicos Vitaminas Água Solvente universal Atua no transporte

Leia mais

BIOQUÍMICA CELULAR, METABOLISMO CELULAR

BIOQUÍMICA CELULAR, METABOLISMO CELULAR BIOQUÍMICA CELULAR, CITOLOGIA e METABOLISMO CELULAR BIOQUÍMICA CELULAR COMPOSTOS INORGÂNICOS COMPOSTOS ORGÂNICOS Moléculas simples: ÁGUA; SAIS MINERAIS. Moléculas complexas: CARBOIDRATOS; LIPÍDIOS; PROTEÍNAS

Leia mais

Lista de Exercícios (BIO-LEO)

Lista de Exercícios (BIO-LEO) Lista de Exercícios (BIO-LEO) 1. As principais substâncias que compõem o sêmen humano são enzimas, ácido cítrico, íons (cálcio, zinco, e magnésio), frutose, ácido ascórbico e prostaglandinas, essas últimas

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o GRUPO I

10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o GRUPO I E S C O L A S E C U N D Á R I A A N T Ó N I O S É R G I O 10º ANO MÓDULO 2 (dois) F i c h a d e p r e p a r a ç ã o p a r a o t e s t e d o d i a 31 d e M a r ç o 2 7-03- 201 4 GRUPO I 1 1 Os seres vivos

Leia mais

Professor Antônio Ruas

Professor Antônio Ruas Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Componente curricular: BIOLOGIA GERAL Aula 4 Professor Antônio Ruas 1. Temas: Macromoléculas celulares Produção

Leia mais

Todos tem uma grande importância para o organismo.

Todos tem uma grande importância para o organismo. A Química da Vida ÁGUA A água é um composto químico formado por dois átomos de hidrogênio e um de oxigênio. Sua fórmula química é H2O. A água pura não possui cheiro nem cor. Ela pode ser transformada em

Leia mais

Vitaminas As vitaminas são nutrientes essenciais para nos.o organismo humano necessita destas vitaminas em pequenas quantidades para desempenhar

Vitaminas As vitaminas são nutrientes essenciais para nos.o organismo humano necessita destas vitaminas em pequenas quantidades para desempenhar A Química da vida A água A água é a mais abundante de todas as substâncias da célula, representando cerca de 80% da sua massa; funciona como solvente para grande parte das outras substâncias presentes

Leia mais

Composição Química da Célula

Composição Química da Célula Composição Química da Célula Composição Química da Célula Inorgânicos Orgânicos Água Sais Minerais Proteínas Lipídios Carboidratos Àcidos Nucléicos Composição Química da Célula PROTEÍNAS São constituintes

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

COMPONENTES ORGÂNICOS: CARBOIDRATOS. Glicídios ou Açúcares

COMPONENTES ORGÂNICOS: CARBOIDRATOS. Glicídios ou Açúcares COMPONENTES ORGÂNICOS: CARBOIDRATOS Glicídios ou Açúcares COMPOSIÇÃO DOS CARBOIDRATOS Compostos constituídos principalmente de: Carbono, Hidrogênio Oxigênio Principal fonte de energia para os seres vivos.

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Biologia e Geologia 10º ano. Natércia Charruadas 2011

Biologia e Geologia 10º ano. Natércia Charruadas 2011 Biologia e Geologia 10º ano Natércia Charruadas 2011 Todos os seres vivos, logo todas as células, são constituídos por moléculas orgânicas de grandes dimensões macromoléculas. Estas são formadas por um

Leia mais

Professor Antônio Ruas

Professor Antônio Ruas Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Componente curricular: BIOLOGIA GERAL Aula 4 Professor Antônio Ruas 1. Temas: Macromoléculas celulares Produção

Leia mais

Cap. 3: Componentes orgânicos celulares As moléculas energéticas. Equipe de Biologia

Cap. 3: Componentes orgânicos celulares As moléculas energéticas. Equipe de Biologia Cap. 3: Componentes orgânicos celulares As moléculas energéticas Equipe de Biologia De que são formados os seres vivos? Substâncias orgânicas Carboidratos Lipídios Proteínas Vitaminas Ácidos nucleicos

Leia mais

Todos os seres vivos são constituídos por células unidade estrutural.

Todos os seres vivos são constituídos por células unidade estrutural. Prof. Ana Rita Rainho Biomoléculas Todos os seres vivos são constituídos por células unidade estrutural. Para além da unidade estrutural também existe uma unidade bioquímica todos os seres vivos são constituídos

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota www.acasadoconcurseiro.com.br Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

Exercícios de Proteínas

Exercícios de Proteínas Exercícios de Proteínas 1. As são compostos formados por unidos (as) por ligações e as são orgânicos, de natureza sensíveis às variações de temperatura. Os termos que corretamente preenchem as lacunas

Leia mais

23/03/2015. Moléculas orgânicas - Carboidratos

23/03/2015. Moléculas orgânicas - Carboidratos Moléculas orgânicas - Carboidratos São formados por C, H, O. São Conhecidos como: Hidratos de Carbono Glucídios Glicídios Açúcares Sacarídeos Funções: Energética (glicose); Glicogênio : reserva energética

Leia mais

COMPOSIÇÃO QUÍMICA DA CÉLULA

COMPOSIÇÃO QUÍMICA DA CÉLULA Composição Química da Célula COMPOSIÇÃO QUÍMICA DA CÉLULA Inorgânicos Água Sais Minerais Orgânicos Proteínas Lipídios Carboidratos Ácidos Nucléicos Prof. M.Sc. Renata Fontes MICROMOLÉCULAS MACROMOLÉCULAS

Leia mais

As bases bioquímicas da vida

As bases bioquímicas da vida As bases bioquímicas da vida Água, Sais Minerais, Carboidratos, Lipídios, Proteínas e Vitaminas 1º Ano Profª Priscila F Binatto Constituintes Bioquímicos da Célula Água e Minerais Carboidratos Lipídios

Leia mais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais Substâncias Orgânicas - Formadas por átomos de carbono e hidrogênio Inorgânicas - Água e sais minerais - Carboidratos, lipídios, proteínas, ácidos nucleicos e vitaminas QUÍMICA CELULAR Água Funções: Solvente

Leia mais

BIOLOGIA. Os principais carboidratos de reserva nos vegetais e animais são: Chama-se aminoácido essencial ao aminoácido que:

BIOLOGIA. Os principais carboidratos de reserva nos vegetais e animais são: Chama-se aminoácido essencial ao aminoácido que: BIOLOGIA Associe os números das estruturas celulares assinaladas no desenho com os respectivos nomes da coluna abaixo do desenho. A seguir, assinale a opção em que a seqüência coincida com o que foi marcado

Leia mais

Célula animal Célula vegetal

Célula animal Célula vegetal PROF. TOSCANO Célula animal Célula vegetal O que há de comum nas células? No inicio do século XIX, a Química Inorgânica (que estuda as substâncias que compõem objetos não-vivos), já analisava diversas

Leia mais

PRINCIPAIS VIAS METABÓLICAS

PRINCIPAIS VIAS METABÓLICAS PRINCIPAIS VIAS METABÓLICAS DEGRADAÇÃO DO GLIGOGÊNIO GLICÓLISE VIA DAS PENTOSES FOSFATO GLICONEOGÊNESE SÍNTESE DE CORPOS CETÔNICOS DEGRADAÇÃO DE AMINOÁCIDOS E CICLO DA URÉIA CICLO DE KREBS Β-OXIDAÇÃO DE

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS ESCOLA SUPERIOR AGRÁRIA Instituto Politécnico de Coimbra 2014 PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS DATA 05/05/2014 HORA 10.00H - 12.00H

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_2ª Época 4/2/2010. (Duração: 2 h)

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_2ª Época 4/2/2010. (Duração: 2 h) BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2009_2010_2ª Época 4/2/2010 (Duração: 2 h) Nome do Aluno: Nº: Curso: Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

QUÍMICA ENSINO MÉDIO PROF.ª DARLINDA MONTEIRO 3 ANO PROF.ª YARA GRAÇA

QUÍMICA ENSINO MÉDIO PROF.ª DARLINDA MONTEIRO 3 ANO PROF.ª YARA GRAÇA QUÍMICA 3 ANO PROF.ª YARA GRAÇA ENSINO MÉDIO PROF.ª DARLINDA MONTEIRO CONTEÚDOS E HABILIDADES Unidade IV Ser humano e Saúde 2 CONTEÚDOS E HABILIDADES Aula 18.2 Conteúdo Carboidratos 3 CONTEÚDOS E HABILIDADES

Leia mais

Profª Eleonora Slide de aula. Metabolismo de Carboidratos

Profª Eleonora Slide de aula. Metabolismo de Carboidratos Metabolismo de Carboidratos Metabolismo de Carboidratos Profª Eleonora Slide de aula Condições de anaerobiose Glicose 2 Piruvato Ciclo do ácido cítrico Condições de anaerobiose 2 Etanol + 2 CO 2 Condições

Leia mais

Carboidrato. Curso: Farmácia 3º período Prof. Helder Braz Maia

Carboidrato. Curso: Farmácia 3º período Prof. Helder Braz Maia Carboidrato Curso: Farmácia 3º período Prof. Helder Braz Maia Introdução O que são os carboidratos? Conhecidos como hidratos de carbono, sacarídeos ou açúcares; São as biomoléculas mais abundantes na natureza.

Leia mais

PROGRAMA DE DISCIPLINA. Disciplina: BIOQUÍMICA BÁSICA Código da Disciplina: NDC 119

PROGRAMA DE DISCIPLINA. Disciplina: BIOQUÍMICA BÁSICA Código da Disciplina: NDC 119 PROGRAMA DE DISCIPLINA Disciplina: BIOQUÍMICA BÁSICA Código da Disciplina: NDC 119 Curso: Medicina Veterinária Período de oferta da disciplina: 1 p Faculdade responsável: Núcleo de Disciplinas Comuns (NDC)

Leia mais

INTRODUÇÃO À BIOQUÍMICA DA CÉLULA. Bioquímica Celular Prof. Júnior

INTRODUÇÃO À BIOQUÍMICA DA CÉLULA. Bioquímica Celular Prof. Júnior INTRODUÇÃO À BIOQUÍMICA DA CÉLULA Histórico INTRODUÇÃO 1665: Robert Hooke Compartimentos (Células) 1840: Theodor Schwann Teoria Celular 1. Todos os organismos são constituídos de uma ou mais células 2.

Leia mais

A química da vida Samuel Rutsatz

A química da vida Samuel Rutsatz A química da vida Samuel Rutsatz Água na célula As substâncias que constituem os corpos dos seres vivos possuem em sua constituição entre 75-85% de água. Ou seja, cerca de 80% do corpo de um ser vivo é

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

A Química da Vida. As substâncias que constituem os corpos dos seres vivos possuem em sua constituição entre 75-85% de água. Ou seja, cerca de 80% do

A Química da Vida. As substâncias que constituem os corpos dos seres vivos possuem em sua constituição entre 75-85% de água. Ou seja, cerca de 80% do A Química da Vida. A Química da Vida. As substâncias que constituem os corpos dos seres vivos possuem em sua constituição entre 75-85% de água. Ou seja, cerca de 80% do corpo de um ser vivo é composto

Leia mais

Polímeros, Hidratos de Carbono, Lipídios e Proteínas

Polímeros, Hidratos de Carbono, Lipídios e Proteínas Polímeros, Hidratos de Carbono, Lipídios e Proteínas Polímeros, Hidratos de Carbono, Lipídios e Proteínas 1. naturais ou artificiais formados por macromoléculas que, por sua vez, são constituídas por unidades

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

ÓLEOS E GORDURAS (LIPÍDEOS) - TRIGLICERÍDEOS

ÓLEOS E GORDURAS (LIPÍDEOS) - TRIGLICERÍDEOS Moléculas Orgânicas constituintes dos seres vivos (Biomoléculas Orgânicas) Gorduras ou Lipídeos (Triglicerídeos) Derivadas de ácidos graxos e podem se classificar em: Gorduras Saturadas Gorduras insaturadas

Leia mais

Glicólise. Professora Liza Felicori

Glicólise. Professora Liza Felicori Glicólise Professora Liza Felicori Glicose Glicose (combustível metabólico) Fígado: Serve como tampão para manter o nível de glicose no sangue (liberação controlada de glicose) Glicose GLICOGÊNIO Estoque

Leia mais

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente:

1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: 1) (FMSA-SP) Os fenômenos 1, 2 e 3 no esquema ao lado são respectivamente: a) tradução, transcrição, duplicação b) duplicação, transcrição, tradução c) duplicação, tradução, transcrição d) tradução, duplicação,

Leia mais

Metabolismo dos Glicídios

Metabolismo dos Glicídios QUÍMCA E BIOQUÍMICA Curso Técnico em Nutrição e Dietética Metabolismo dos Glicídios Professor: Adriano Silva Os hidratos de carbono são as biomoléculas mais abundantes do nosso planeta 100b de toneladas

Leia mais

Metabolismo de Carboidratos

Metabolismo de Carboidratos Metabolismo de Carboidratos Curso de Bioqímica para Saúde Coletiva- UFRJ Profa. Dra. Mônica Santos de Freitas 1 Carboidratos Três maiores classes de carboidratos Monossacarídeos- são carboidratos não polimerizados;

Leia mais

Ficha de Exercícios A Célula Ano lectivo: 10º ano Turma: Data:

Ficha de Exercícios A Célula Ano lectivo: 10º ano Turma: Data: Ficha de Exercícios A Célula Ano lectivo: 10º ano Turma: Data: 1- A célula é uma importante estrutura do mundo vivo. Todos os seres vivos começam por existir sob a forma de célula. Alguns seres são unicelulares

Leia mais

Introdução ao Metabolismo. Profª Eleonora Slide de aula

Introdução ao Metabolismo. Profª Eleonora Slide de aula Introdução ao Metabolismo Profª Eleonora Slide de aula Metabolismo Profª Eleonora Slide de aula Relacionamento energético entre as vias catabólicas e as vias anabólicas Nutrientes que liberam energia Carboidratos

Leia mais

Água. A água é uma estrutura dipolar formada por dois átomos de hidrogênio ligados a um átomo de oxigênio.

Água. A água é uma estrutura dipolar formada por dois átomos de hidrogênio ligados a um átomo de oxigênio. Química da Vida Água A água compõe a maior parte da massa corporal do ser humano e de todos os seres vivos, logo na composição química celular prevalece à presença de água. Sendo 70% do peso da célula

Leia mais

Glicídios Pro r f o. f. D a D n a i n el M ag a al a hã h e ã s

Glicídios Pro r f o. f. D a D n a i n el M ag a al a hã h e ã s Glicídios Prof. Daniel Magalhães DEFINIÇÃO Os glicídios, também chamados de açúcares, carboidratos ou hidratos de carbono são moléculas orgânicas constituídas fundamentalmente por átomos de carbono, hidrogênio

Leia mais

Monossacarídeos. açúcares simples. Monossacarídeos. Carboidratos formados por C, H, O

Monossacarídeos. açúcares simples. Monossacarídeos. Carboidratos formados por C, H, O Carboidratos formados por C, H, O Bioquímica Profa. Janara Glicídios, glícides, glucídeos, açúcares ou hidratos de carbono; 3grupos: - monossacarídeos - dissacarídeos - polissacarídeos 1 2 Monossacarídeos

Leia mais

2º trimestre Biologia Sala de estudos Data: Agosto/2015 Ensino Médio 1º ano classe: Profª Elisete Nome: nº

2º trimestre Biologia Sala de estudos Data: Agosto/2015 Ensino Médio 1º ano classe: Profª Elisete Nome: nº 2º trimestre Biologia Sala de estudos Data: Agosto/2015 Ensino Médio 1º ano classe: Profª Elisete Nome: nº Valor: 10 Nota:.. Conteúdo: A química da vida 1) A principal substância INORGÂNICA que encontramos

Leia mais

Profª Eleonora Slide de aula. Introdução ao Metabolismo

Profª Eleonora Slide de aula. Introdução ao Metabolismo Introdução ao Metabolismo Nutrientes que liberam energia Carboidratos Gorduras Proteínas Catabolismo Produtos finais pobres em energia CO 2 2 O N 3 Energia química ATP NADP Metabolismo Macromoléculas celulares

Leia mais

COMPOSIÇÃO QUÍMICA DOS SERES VIVOS

COMPOSIÇÃO QUÍMICA DOS SERES VIVOS COMPOSIÇÃO QUÍMICA DOS SERES VIVOS Os seres vivos são constituídos de compostos orgânicos e inorgânicos, diferentes dos seres não vivos, que apenas apresentam 1 ou 2 compostos inorgânicos em sua formação.

Leia mais

Glicídios - Carboidratos. Professor: Paulo Disciplina: Biologia Campus Aquidauana

Glicídios - Carboidratos. Professor: Paulo Disciplina: Biologia Campus Aquidauana Glicídios - Carboidratos Professor: Paulo Disciplina: Biologia Campus Aquidauana GLICÍDIS São formados, basicamente, por carbono, hidrogênio e oxigênio. Sinônimos: Carboidratos, Açúcares, ses, idratos

Leia mais

Bioquímica Celular (parte II) Lipídios Proteínas Vitaminas Ácidos Nucléicos

Bioquímica Celular (parte II) Lipídios Proteínas Vitaminas Ácidos Nucléicos Bioquímica Celular (parte II) Lipídios Proteínas Vitaminas Ácidos Nucléicos Lipídios Possuem função energética e estrutural. 2ª fonte de energia do organismo. Apresentam maior quantidade de energia que

Leia mais

Nome do aluno Nº 10º CTEC

Nome do aluno Nº 10º CTEC A g r u p a m e n t o d e E s c o l a s A n t ó n i o S é r g i o - V. N. G a i a E S C O L A S E C U N D Á R I A A N T Ó N I O S É R G I O TESTE ESCRITO 10º ANO - Biologia e Geologia - MÓDULO 2 (dois)

Leia mais

Universidade de São Paulo Instituto de Física Energia em Sistemas Biológicos Edi Carlos Sousa

Universidade de São Paulo Instituto de Física Energia em Sistemas Biológicos Edi Carlos Sousa Universidade de São Paulo Instituto de Física Energia em Sistemas Biológicos Edi Carlos Sousa edisousa@if.usp.br Metabolismo Celular Cada reação que ocorre em um organismo vivo requer o uso de energia

Leia mais

As bases bioquímicas da vida

As bases bioquímicas da vida As bases bioquímicas da vida Água, Sais Minerais, Carboidratos, Lipídios, Proteínas e Vitaminas Tecnologia em Produção de Grãos Profª Priscila F Binatto Abr/2015 Constituintes Bioquímicos da Célula Água

Leia mais

UEAP ENG. AMB.CARBOIDRATOS / PROFESSORA ANA JULIA SILVEIRA

UEAP ENG. AMB.CARBOIDRATOS / PROFESSORA ANA JULIA SILVEIRA UEAP ENG. AMB.CARBOIDRATOS / PROFESSORA ANA JULIA SILVEIRA UEAP ENG. AMB.CARBOIDRATOS / Carboidratos, também conhecidos como hidratos de carbono, glicídios, glícidos, glucídeos, glúcidos, glúcides, sacarídeos

Leia mais

TRABALHO DE BIOLOGIA QUÍMICA DA VIDA

TRABALHO DE BIOLOGIA QUÍMICA DA VIDA TRABALHO DE BIOLOGIA QUÍMICA DA VIDA Água Sais minerais Vitaminas Carboidratos Lipídios Proteínas Enzimas Ácidos Núcleos Arthur Renan Doebber, Eduardo Grehs Água A água é uma substância química composta

Leia mais

BIOLOGIA MOLECULAR. Água, Sais Minerais, Glicídios e Lipídios. Biologia Frente A Laís Oya

BIOLOGIA MOLECULAR. Água, Sais Minerais, Glicídios e Lipídios. Biologia Frente A Laís Oya BIOLOGIA MOLECULAR Água, Sais Minerais, Glicídios e Lipídios Biologia Frente A Laís Oya E-mail: laisfernandabio@gmail.com Composição dos seres vivos: 99% da massa corporal dos seres vivos é composta por

Leia mais

Oxidação parcial o que acontece com o piruvato?

Oxidação parcial o que acontece com o piruvato? A glicólise ocorre no citosol das células transforma a glicose em duas moléculas de piruvato e é constituída por uma sequência de 10 reações (10 enzimas) divididas em duas fases. Fase preparatória (cinco

Leia mais

5/4/2011. Metabolismo. Vias Metabólicas. Séries de reações consecutivas catalisadas enzimaticamente, que produzem produtos específicos (metabólitos).

5/4/2011. Metabolismo. Vias Metabólicas. Séries de reações consecutivas catalisadas enzimaticamente, que produzem produtos específicos (metabólitos). Metabolismo Vias Metabólicas Séries de reações consecutivas catalisadas enzimaticamente, que produzem produtos específicos (metabólitos). 1 Endergônico Exergônico Catabolismo Durante o catabolismo de carboidratos,

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

As bases bioquímicas da vida

As bases bioquímicas da vida As bases bioquímicas da vida Água, Sais Minerais, Carboidratos, Lipídios, Proteínas, Ácidos Nucleicos e Vitaminas 1º Ano Profª Priscila F Binatto Abril/2016 Constituintes Bioquímicos da Célula Água e Minerais

Leia mais

28/03/2016. Substâncias inorgânicas Substâncias orgânicas. Substâncias inorgânicas : água e sais minerais;

28/03/2016. Substâncias inorgânicas Substâncias orgânicas. Substâncias inorgânicas : água e sais minerais; Substâncias inorgânicas : água e sais minerais; Substâncias inorgânicas Substâncias orgânicas Substâncias orgânicas: lipídios, carboidratos, proteínas, vitaminas e ácidos nucleicos ( DNA e RNA); Propriedades

Leia mais

MINISTÉRIO DA EDUCAÇÃO Universidade Federal de Alfenas. UNIFAL- MG Campus Varginha. Avenida Celina Ferreira Ottoni, 4000

MINISTÉRIO DA EDUCAÇÃO Universidade Federal de Alfenas. UNIFAL- MG Campus Varginha. Avenida Celina Ferreira Ottoni, 4000 MINISTÉRIO DA EDUCAÇÃO Universidade Federal de Alfenas. UNIFAL- MG Campus Varginha Avenida Celina Ferreira Ottoni, 4000 Biologia Turma 1 A organização da célula Os organismos estudados podem ser unicelulares,

Leia mais

CITOQUÍMICA ou MOLECULAR

CITOQUÍMICA ou MOLECULAR CITOQUÍMICA ou BIOLOGIA MOLECULAR Composição química da célula Os principais elementos encontrados nas células são: carbono (C), hidrogênio (H), oxigênio (O), nitrogênio (N), fósforo (P) e enxofre (S)=

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais

Prof André Montillo

Prof André Montillo Prof André Montillo www.montillo.com.br Carboidratos Definição: São compostos orgânicos constituídos por carbono, hidrogênio e oxigênio. Alguns carboidratos apresentam nitrogênio, fósforo ou enxofre. Também

Leia mais

Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2010/2011. Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano

Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2010/2011. Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2010/2011 Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano ENSINO PRÁTICO E TEORICO-PRÁTICO 7ª AULA TEÓRICO-PRÁTICA

Leia mais

FISIOLOGIA VEGETAL 24/10/2012. Respiração. Respiração. Respiração. Substratos para a respiração. Mas o que é respiração?

FISIOLOGIA VEGETAL 24/10/2012. Respiração. Respiração. Respiração. Substratos para a respiração. Mas o que é respiração? Respiração Mas o que é respiração? FISIOLOGIA VEGETAL Respiração É o processo pelo qual compostos orgânicos reduzidos são mobilizados e subsequentemente oxidados de maneira controlada É um processo de

Leia mais

Lipídeos. Carboidratos (Açúcares) Aminoácidos e Proteínas

Lipídeos. Carboidratos (Açúcares) Aminoácidos e Proteínas BIOQUÍMICA Lipídeos Carboidratos (Açúcares) Aminoácidos e Proteínas LIPÍDEOS São ÉSTERES derivados de ácidos graxos superiores. Ex1: São divididos em: Cerídeos Glicerídeos Fosfatídeos Esteroides CERÍDEOS

Leia mais

Introdução ao Metabolismo Microbiano

Introdução ao Metabolismo Microbiano Introdução ao Metabolismo Microbiano METABOLISMO DEFINIÇÃO: Grego: metabole = mudança, transformação; Toda atividade química realizada pelos organismos; São de dois tipos: Envolvem a liberação de energia:

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 1R Ensino Médio Equipe de Biologia Data: Biologia CARBOIDRATOS - Conceitos Gerais : Os carboidratos são as biomoléculas mais abundantes na natureza. São moléculas que

Leia mais

BE066 - Fisiologia do Exercício BE066 Fisiologia do Exercício. Bioenergética. Sergio Gregorio da Silva, PhD

BE066 - Fisiologia do Exercício BE066 Fisiologia do Exercício. Bioenergética. Sergio Gregorio da Silva, PhD BE066 Fisiologia do Exercício Bioenergética Sergio Gregorio da Silva, PhD Objetivos Definir Energia Descrever os 3 Sistemas Energéticos Descrever as diferenças em Produção de Energia Bioenergética Estuda

Leia mais

Nutrição e cultura de micro-organismos

Nutrição e cultura de micro-organismos Nutrição e cultura de micro-organismos As células consistem de água e macromoléculas. A nutrição microbiana corresponde à parte da fisiologia microbiana que envolve o fornecimento de monômeros que as células

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

3ª Série / Vestibular _ TD 08 _ 19 de abril

3ª Série / Vestibular _ TD 08 _ 19 de abril 3ª Série / Vestibular _ TD 08 _ 19 de abril 21. As células caracterizam-se por possuir uma membrana plasmática, separando o meio intracelular do meio extracelular. A manutenção da integridade dessa membrana

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

INSTRUÇÕES PARA A REALIZAÇÃO DA PROVA LEIA COM MUITA ATENÇÃO

INSTRUÇÕES PARA A REALIZAÇÃO DA PROVA LEIA COM MUITA ATENÇÃO 3º EM Biologia A Josa Av. Dissertativa 25/05/16 INSTRUÇÕES PARA A REALIZAÇÃO DA PROVA LEIA COM MUITA ATENÇÃO 1. Verifique, no cabeçalho desta prova, se seu nome, número e turma estão corretos. 2. Esta

Leia mais

Ficha de trabalho. 1. Observa a figura 1 que representa as relações tróficas em dois ecossistemas. Figura 1

Ficha de trabalho. 1. Observa a figura 1 que representa as relações tróficas em dois ecossistemas. Figura 1 Ficha de trabalho 1. Observa a figura 1 que representa as relações tróficas em dois ecossistemas. Figura 1 1.1 Relativamente ao ecossistema terrestre considerado, esquematize uma cadeia alimentar. Bactéria

Leia mais