FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE DOUTORADO EM BIOLOGIA EXPERIMENTAL

Tamanho: px
Começar a partir da página:

Download "FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE DOUTORADO EM BIOLOGIA EXPERIMENTAL"

Transcrição

1 FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE DOUTORADO EM BIOLOGIA EXPERIMENTAL ADRIANA CRISTINA DA SILVA NUNES VARIABILIDADE GENÉTICA DE POPULAÇÕES DO ESTADO DE RONDÔNIA ESTIMADA A PARTIR DE MARCADORES DO CROMOSSOMO Y E DO DNA MITOCONDRIAL Porto Velho-RO

2 FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE DOUTORADO EM BIOLOGIA EXPERIMENTAL ADRIANA CRISTINA DA SILVA NUNES VARIABILIDADE GENÉTICA DE POPULAÇÕES DO ESTADO DE RONDÔNIA ESTIMADA A PARTIR DE MARCADORES DO CROMOSSOMO Y E DO DNA MITOCONDRIAL Porto Velho-RO

3 FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE DOUTORADO EM BIOLOGIA EXPERIMENTAL VARIABILIDADE GENÉTICA DE POPULAÇÕES DO ESTADO DE RONDÔNIA ESTIMADA A PARTIR DE MARCADORES DO CROMOSSOMO Y E DO DNA MITOCONDRIAL Tese apresentada ao Programa de Pós- Graduação Doutorado em Biologia Experimental da Universidade Federal de Rondônia, como requisito para obtenção do Título de Doutora em Biologia Experimental. Área de Concentração: Genética. Doutoranda: Adriana Cristina da Silva Nunes Orientadora: Profª. Drª Maria Manuela da Fonseca Moura Co-Orientadora: Profª. Drª Dayse Aparecida da Silva Porto Velho-RO

4 FICHA CATALOGRÁFICA NUNES, Adriana Cristina da Silva Variabilidade Genética de Populações do Estado de Rondônia Estimada a partir de Marcadores do Cromossomo Y e do DNA Mitocondrial Porto Velho, 2010 s.n., 113 páginas. Tese apresentada ao Programa de Pós-Graduação de Biologia Experimental da Universidade Federal de Rondônia-UNIR, Área de Concentração: Genética Orientadora: Profª. Drª Maria Manuela da Fonseca Moura Co-Orientação: Profª. Drª Dayse Aparecida da Silva Palavras chave: Ancestralidade genética, Cromossomo Y e DNAmt, População ribeirinha 20

5 Título da Tese: Variabilidade Genética de Populações do Estado de Rondônia estimada a partir de Marcadores do Cromossomo Y e do DNA Mitocondrial Doutoranda: Adriana Cristina da Silva Nunes Orientadora: Profª. Drª Maria Manuela da Fonseca Moura Co-Orientação: Profª. Drª Dayse Aparecida da Silva Área de concentração: Genética A comissão julgadora dos trabalhos de defesa de Tese de Doutorado, em sessão pública realizada no dia / /, às horas, nas dependências do(a) da Universidade Federal de Rondônia, considerou a defesa da Candidata: ( ) Aprovado ( ) Reprovado Banca Examinadora: Profa. Dra. Mª Manuela da Fonseca Moura Presidente/Orientadora - UNIR Prof(a). Dr(a). Examinadora Prof(a). Dr(a). Examinadora - Prof(a). Dr(a). Examinador Prof(a). Dr(a). Examinadora - Prof(a). Dr(a). Examinadora UNIR (Suplente) 21

6 Aos meus amados Pais: Manoel & Joana Pelo incentivo e a lembrança de que o conhecimento é a maior riqueza a ser conquistada, pela dedicação, carinho e amor que me transmitiram por todos estes anos de vida. Aos meus irmãos Amarildo e Ailson que mesmo longe sempre estiveram presentes comigo em pensamentos. Ao meu filho Gabriel, por entender os inúmeros momentos de minha ausência física. Que a vida me permita conceder ao Gabriel todas as oportunidades que tive. Ao meu marido Dorisvalder Pelas muitas horas de compreensão das ausências no convívio da família, pelos bons momentos e pela superação das dificuldades. Pelo apoio e incentivo Dedico 22

7 Curiosidade, criatividade, disciplina e especialmente paixão são algumas exigências para o desenvolvimento de um trabalho criterioso, baseado no confronto permanente entre o desejo e a realidade. (Mirian Goldenberg) 23

8 AGRADECIMENTOS À Prof a. Dra. Maria Manuela da Fonseca Moura, amiga e orientadora, cujo apoio, ao longo destes 10 anos de convívio, foi fundamental para minha formação; À Dr a. Dayse Aparecida da Silva do Laboratório de Diagnóstico por DNA da UERJ pela coorientação e zelo nos trabalhos experimentais; Ao Prof. Dr. Elizeu Fagundes de Carvalho, coordenador do Laboratório de Diagnóstico por DNA-LDD/UERJ pelo apoio estrutural; Ao Prof. Dr. Luiz Hildebrando Pereira da Silva pelo exemplo de cientista que é; À Dr a. Vera Engracia Gama de Oliveira pelo incentivo; A equipe da Plataforma Genômica - Sequenciamento de DNA- PDTIS/FIOCRUZ e do Laboratório de Genômica Funcional e Bioinformática-IOC, pelo apoio técnico. As professoras membros da banca examinadora, pela disponibilidade e atenção concedida a este trabalho; À Prof a. Dr a Rubiani de C. Pagotto, pelas sugestões da qualificação e pela amizade; À equipe do CIBEBI, pelo apoio e companheirismo na luta diária, em especial a Isabela; À Universidade Federal de Rondônia, por proporcionar condições satisfatórias no desenvolvimento deste trabalho de tese; Ás agências de incentivo à pesquisa: CAPES, CNPq, UNIR e Fundação Rio Madeira. À equipe do Laboratório de Geografia e Planejamento Ambiental, pelo apoio estrutural; Aos Geógrafos Aldina Assunção, Luiz Cleyton e Michel Watanabe pela amizade, pela ajuda na tabulação dos dados e nas viagens de campo; Em especial, às comunidades de Santo Antônio do Guaporé, Porto Velho, São Miguel e Cujubim sem os quais esta tese não seria possível. E a todos que, de alguma forma, contribuíram para o desenvolvimento e realização deste trabalho. Muito obrigada!! INDICE 24

9 Lista de Figuras X Lista de Tabelas XI Lista de abreviaturas e siglas XII Resumo XII Abstract XIV INTRODUÇÃO 17 1 COLONIZAÇÃO BRASILEIRA E OS ESTUDOS GENÉTICOS Aspectos Geral da Colonização Brasileira A Presença Africana no Estado de Rondônia - o caso de Santo Antônio do Guaporé Aspectos Históricos da Formação da População de Porto Velho, São Miguel e Cujubim Populações Miscigenadas e a Genética Classificação Étnica Marcadores Moleculares na Investigação Populacional Marcadores Genéticos Uniparentais Cromossomo Y Descrição dos Microssatélites em Estudo no Cromossomo Y DNA mitocondrial HIPÓTESE 35 3 OBJETIVOS MATERIAL E MÉTODOS O Processo de Coleta das Amostras Comitê de Ética Caracterização dos Grupos Populacionais Santo Antônio do Guaporé Porto Velho Comunidade São Miguel Comunidade de Cujubim Extração de DNA Extração com Brazol Extração com tampão SEB Extração com Método Southern blot Amplificação das 16 regiões de microssatélites do cromossomo Y Reação de PCR Y FILER com tampão platinum Preparação das Amostras para a Eletroforese Amplificação da Região Hipervariável do DNA Mitocondrial (HVI) Purificação das Amostras Amplificadas Reação de Sequenciamento Purificação do Produto Seqüenciado O Processo de Sequenciamento Automático Parâmetro de Análise Estatística dos Dados 51 5 RESULTADOS E DISCUSSÃO Contribuição Uniparental Masculina 53 25

10 5.2 Dendrograma UPGMA Análise e Contribuição Étnica a partir de Haplótipos Análise de Variância Molecular AMOVA Contribuição Uniparental Feminina Cromossomo Y x DNA mitocondrial 78 6 CONCLUSÃO 83 7 REFERENCIAL BIBLIOGRÁFICO 84 Apêndice I - Resultado da tipagem do cromossomo Y pelo Kit Y-Filer 96 Apêndice II - Freqüência Alélica de 16 STRs das 04 populações do presente estudo 101 Apêndice III - Resultado dos polimorfismos da região HVI nas amostras das populações de Porto Velho, Cujubim, São Miguel e Santo Antônio do Guaporé 107 Apêndice IV - Percentual de haplogrupos por localização geográfica das 04populações do presente estudo 112 Apêndice V - Questionário aplicado durante a pesquisa de campo 115 Anexo I - Soluções de análise laboratorial do cromossomo Y e do DNAmt 117 LISTA DE FIGURAS Figura 01: Representação de estrutura de microssatélite com 12 repetições [agat] denominado alelo Figura 02: Estrutura básica do Cromossomo Y com o haplótipos mínimo estendido 27 Figura 03: Mapa do genoma DNA mitocondrial humano. 31 Figura 04: Mapa de localização da área de estudo: Santo Antônio do Guaporé 38 26

11 Figura 05: Mapa de localização da área de estudo: Porto Velho, São Miguel e Cujubim 40 Figura 06: Organograma metodológico 48 Figura 07: Distribuição das freqüências dos alelos referente ao marcador DSY19 em relação a africano, ameríndio e europeu 52 Figura 08: Distribuição das freqüências dos alelos referente ao marcador DSY390 em relação a africano, ameríndio e europeu 53 Figura 09: Distribuição das freqüências dos alelos referente ao marcador DSY391 em relação a africano, ameríndio e europeu 54 Figura 10: Distribuição das freqüências dos alelos referente ao marcador DSY393 em relação a africano, ameríndio e europeu 54 Figura 11: Distribuição das frequências dos alelos referente ao marcador DSY389I 55 Figura 12: Distribuição das frequências dos alelos referente ao marcador DSY Figura 13: Distribuição das frequências dos alelos referente ao marcador DSY39II 56 Figura 14: Distribuição das frequências dos alelos referente ao marcador DSY Figura 15: Distribuição das frequências dos alelos referente ao marcador DSY Figura 16: Distribuição das frequências dos alelos referente ao marcador DSY Figura 17: Dendrograma UPGMA, baseado nos dados de 16 STRs Y - especifico relacionando as quatro populações ribeirinha do Estado do Rondônia. 59 Figura 18: Dendrograma UPGMA, baseado nos dados de 16 STRs com ameríndio, africanos e europeus 60 Figura 19: Dendrograma UPGMA, baseado nos dados de 16 STRs com populações do Brasil e do mundo 61 Figura 20: Percentual de contribuição haplotípica paterna em relação à amostra de Porto Velho 64 Figura 21: Percentual de contribuição haplotípica paterna em relação à amostra de Cujubim 64 Figura 22: Percentual de contribuição haplotípica paterna em relação à amostra de São Miguel 65 Figura 23: Percentual de contribuição haplotípica paterna em relação à amostra de Santo Antônio do Guaporé. 65 Figura 24: Configuração derivada de haplotipos a partir do método de escalonamento multidimensional 67 Figura 25: Configuração derivada de de haplotipos a partir do método de escalonamento multidimensional entre nossas amostra e amostras de Mato Grosso, Uganda e Portugal 68 Figura 26: Região indicando uma mutação de G>A. 70 Figura 27: Região de inserção a partir do nucleotídeo das bases ACGCG 70 Figura 28: Percentual de contribuição etnica uniparental de origem materna em São Miguel 71 Figura 29: Percentual de contribuição etnica uniparental de origem materna em Cujubim 72 Figura 30: Percentual de contribuição etnica uniparental de origem materna em Santo Antônio do Guaporé 73 Figura 31: Percentual de contribuição etnica uniparental de origem materna em Porto Velho 74 LISTA DE TABELAS Tabela 01: Contribuição em percentuais de haplótipos Europeus, Africanos e Ameríndios em relação às populações do presente estudo 63 Tabela 02: Percentual de indivíduos quanto a origem matrilinear utilizando haplogrupos do DNAmt. Região HVI 74 Tabela 03: Média da contribuição paterna e materna na população de Cujubim 77 Tabela 04: Média da contribuição paterna e materna na população de São Miguel 78 27

12 Tabela 05: Média da contribuição paterna e materna na população de Porto Velho 78 Tabela 06: Média da contribuição paterna e materna na população de Santo Antônio do Guaporé 79 Tabela 07: Freqüência Alélica de 16 STRs na população de Porto Velho 100 Tabela 08 : Freqüência Alélica de 16 STRs na população de Cujubim 102 Tabela 09: Freqüência Alélica de 16 STRs na população de São Miguel 103 Tabela 10: Freqüência Alélica de 16 STRs na população de Santo Antônio do Guaporé 104 Tabela 11: Percentual de haplogrupos matrilinear observado em Porto Velho 111 Tabela 12: Percentual de haplogrupos matrilinear observado em Cujubim 112 Tabela 13: Percentual de haplogrupos matrilinear observado em São Miguel 112 Tabela 14: Percentual de haplogrupos matrilinear observado em Santo Antônio do Guaporé 112 LISTA DE QUADROS Quadro 01: Relação de loci do cromossomo Y amplificados pelo multiplex Y-FILER Applied Biosystems 43 Quadro 02: Soluções de Extração de DNA Genômico (anexo I) 115 Quadro 03: Soluções para realização da PCR e sequenciamento (anexo I)

13 LISTA DE ABREVIATURAS E SIGLAS Água MilliQ - Água desprovida de sais e íons. CEP Comitê de Ética em Pesquisa CONEP Comitê Nacional de Ética em Pesquisa ddh 2 O - Água deionizada DNA - ácido desoxirribonucléico DNAmt - DNA mitocondrial EDTA - ácido etilenodiamino tetra-acético EtBr - Brometo de etídio HCl - Ácido clorídrico 29

14 M - Molar ml Mililitro mg - Miligrama mm - milimolar NaCl - Cloreto de Sódio NRY - região não-recombinante do cromossomo Y ng nanograma PAR - Região Pseudoautossômica pb - pares de bases PCR - Reação de Polimerização em Cadeia; do inglês Polymerase Chain Reation RBC - solução lise (10mM KHCO 3, 155mM NH 4 Cl, 0.1mM EDTA); RFLP - Polimorfismo de Comprimento de Fragmentos de Restrição STR - Repetição curta e junta de bases; do inglês Short Repeat Tandem SNP- Polimorfismo de Nucleotídeo Único; do inglês Single Nucleotide Polymorphism Taq DNA polimerase enzima de polimerização proveniente da Termus aquaticus TBE Tampão: Tris EDTA Borato TRIS Hidroximetil-aminometano TEMED - N N N n-tetrametil etileno-diamino VNTR - Número variável de repetições em tandem; do ingles Variable Number Tandem Repeat µl - microlitro µg micrograma Nunes, Adriana C. S. (2010). Variabilidade genética de populações do estado de Rondônia estimada a partir de marcadores do Cromossomo Y e do DNA Mitocondrial. Tese de Doutorado Porto Velho: Universidade Federal de Rondônia, p. RESUMO A investigação de variabilidade genética em populações ribeirinhas do estado de Rondônia é de grande importância do ponto de vista médico e social. O estudo das diferenças étnicas e da farmacogentética, são necessários para a verificação da resistência e ou susceptibilidade a doenças infecciosas quando da associação entre o ambiente, parasito e ao hospedeiro. Marcadores genéticos ligados ao cromossomo Y e ao DNA mitocondrial foram utilizados como ferramentas para a análise da origem étnica das populações humanas. Com os marcadores do cromossomo Y foi possível analisar a linhagem paterna. Com a seqüência HVI do DNA mitocondrial, apos comparação com a seqüência de Anderson, foi possível agrupar indivíduos de acordo com sua origem materna. Os marcadores do tipo STR (Short tandem 30

15 repeats), também chamados microssatélites ou repetições consecutivas curtas são consideravelmente abundantes no genoma e estão presentes tanto em cromossomos autossômicos quanto em cromossomos sexuais. Utilizamos amostras das populações ribeirinhas de Santo Antônio do Guaporé, São Miguel, Cujubim e Porto Velho, Estado de Rondônia Amazônia Ocidental. Estas populações localizam-se à margem direita dos Rios Guaporé e Madeira, com exceção de São Miguel que fica à margem esquerda do rio Madeira. As comunidades em tela apresentaram diferentes origens conforme formação histórica registrada. Neste trabalho foram aplicadas técnicas da biologia molecular. O DNA genômico foi extraído pelo método fenol clorofórmio e Brazol; e para a técnica de PCR (Reação em Cadeia de Polimerase) foi utilizado o Kit Y-FILER da Applied Biosystems que amplifica 16 regiões em eletroforese capilar com seqüenciador automático ABI PRISM No total de 144 amostras analisadas, observou-se que na população de Porto Velho, a contribuição paterna foi de: 84,93% de europeus, 7,93% de africanos, 0,49% de ameríndios, Cujubim apresentou um percentual de 70,51% europeus, 5,92% africanos e 0,064% de ameríndios, em São Miguel a contribuição parental foi de: 83,080% europeus, 16,69% africanos e 0,21% de ameríndios, e finalmente, em Santo Antônio do Guaporé a contribuição foi: 49,95% europeus, 49,93% africanos e 0,07% de ameríndios. Na linhagem materna observou-se uma contribuição de 87,50% de etnia ameríndia e 12,50% de africana, em São Miguel. Cujubim apresentou-se com 68,42% de haplogrupos de característica africana, Santo Antônio do Guaporé apresentou-se com 65% de origem africana, 20% de ameríndia e 15% de européia. Porto Velho apresentou-se com uma contribuição étnica de 54% européia seguido de 25% de ameríndia e 17% de africana. Em suma, as populações aqui averiguadas apresentam alta contribuição, sendo que, cada população apresentou uma média de contribuição étnica diferente, mesmo sendo populações próximas. Com base no exposto acima, entender a diversidade genética de uma população, constitui uma estratégia importante para o diagnóstico de doenças complexas associadas à etnicidade. PALAVRAS CHAVE: Variabilidade genética, Cromossomo Y e DNAmt, População ribeirinha Nunes, Adriana C. S. (2010).Genetic variability of Rondonia s population estimated from markers on the Y chromosome and mitochondrial DNA. Doctoral thesis. Porto Velho: Universidade Federal de Rondonia, p. ABSTRACT The investigation of genetic variability in riverine populations of Rondonia state is of great importance from the standpoint of medical and social. The study of ethnic differences and pharmacogenetics are required to verify and resistance or susceptibility to infectious diseases is the association between the environment, parasite and host. Genetic markers linked to the Y chromosome and mitochondrial DNA were used as tools for analyzing the ethnic origin of human populations. With the markers on the Y chromosome parse paternal lineage. Sequencing of mitochondrial DNA HVI, after comparison with the sequence of Anderson, it was possible to group individuals according to their maternal origin.markers of type STR (short tandem repeats), also called microsatellites or short consecutive repetitions are pretty abundant in the genome and are present in both autosomes and in sex chromosomes. We used samples from the riverside of Santo. Antonio Guaporé, Sao Miguel, Cujubim and Porto Velho, Rondonia State - Western Amazon in Brazil. These populations are located on the 31

16 right bank of the Rivers Guaporé and Madeira, with the exception of Sao Miguel which is on the left bank of the river Madeira. The communities had different origins in the screen as historical formation recorded. In this work we applied the techniques of molecular biology. Genomic DNA was extracted using phenol chloroform and coamings, and for PCR (Polymerase Chain Reaction), using Y-Filer kit from Applied Biosystems to amplify 16 regions by capillary electrophoresis using an automatic sequencer ABI PRISM In total, we analyzed 144 samples. For polymorphisms of the Y chromosome we used the sample of Santo Antonio do Guapore which presented an haplotype European contribution of 52,59 per cent and African contribution of 35,34 per cent ; in Sao Miguel we found 55.14% of European and 30.29% of African contribution; In Cujubim we found 47.12% of European and 36.58% of African contribution. In Porto Velho we found 45.48% of European and 25.93% of African contribution. The Amerindian contribution to the people of Santo Antonio do Guapore, Sao Miguel, Cujubim and Porto Velho was in the percentage of 8.30% 14.31% 15.90% 27.72%, respectively. Summing up, the populations investigated here have a high European and African contribution. Porto Velho showed a European contribution of 54%, followed by Amerindian 25% and African 17%. In short, the populations investigated here show a high contribution, and that each population had an average contribution of different ethnic, even if nearby populations. Based on the above, understanding the genetic diversity of a population is an important strategy for the diagnosis of complex diseases associated with ethnicity. KEY WORKS: Genetic variability, Y chromosome and mtdna, riverine population 32

17 INTRODUÇÃO A interpretação genética no estudo da variabilidade humana, normal ou patológica, recai sobre o princípio fundamental da reprodução sexuada, cujas informações genéticas estão contidas nos cromossomos paterno e materno. A aplicação da variabilidade humana pode incidir na história da espécie humana, onde pequenos grupos migraram a partir da África para a Europa, Ásia e, finalmente continente Americano (há anos atrás) e Oceania. Nesta longa viagem, as populações entravam em contato com agentes ambientais novos. A sua frequência aumentava ou diminuía de uma geração a outra de acordo com os patógenos envolvidos, até que estes dois se adaptassem (co-evolução de parasita e hospedeiro). Isso ocorrendo sucessivamente e em face dessa co-evolução com patógenos novos e antigos, houve a produção de muita variabilidade (polimorfismos) e também grandes mudanças no conjunto dos tipos étnicos da espécie humana (CAMPBELL, et al. 2008). Existem numerosos exemplos que comprovam a variabilidade humana provocada pela adaptação a patógenos e serão explorados apenas alguns: Pesquisas que analisaram a variabilidade do gene para a betaglobina, observaram que algumas variações no gene responsável pela síntese dessa proteína têm sido mantidas em frequências elevadas em algumas populações humanas, apesar de seus efeitos deletérios. Isso ocorre porque eles conferem resistência contra alguns patógenos. O exemplo mais conhecido é da seleção para proteção contra a malária que pode ser considerada um dos principais fatores relacionados com a evolução dos genes humanos, especialmente para aqueles envolvidos na constituição das hemácias (VERRA, et al. 2008). A bactéria causadora da hanseníase originou-se no leste da África e Oriente Médio e só foi introduzida nas Américas há cerca de 500 anos, havendo, portanto, pouca probabilidade de que povos ameríndios tenham criado resistência ao patógeno, já que tiveram um contacto recente ao parasita (WALTER, 1970) Vários estudos têm sido realizados sobre a diversidade genética do Trypanosoma cruzi e as espécies diferentes de triatomíneos capazes de transmitir a doença de Chagas. No entanto, poucas pesquisas analisaram o papel desempenhado pela variabilidade genética do hospedeiro sobre a transmissão e gravidade da doença, visto que existem diferentes formas clínicas da doença se manifestar (TIBAYRENC, 2010). Estudos verificaram que, em populações indígenas da América do Sul, ocorrem alguns tipos de HLA jamais vistos em outras populações. Analisando as novas variantes, os cientistas concluíram que tiveram origem a partir dos tipos HLA trazidos ao continente pelas populações 33

18 ancestrais da Ásia, e foram modificadas (mutação, conversão gênica) pelo contato com outros ambientes e tiveram uma rápida mutação, já que surgiram entre 12 a 50 mil anos (CAMPBELL, et al. 2008). Todos estes exemplos nos mostram que caracteristicas dos hospedeiros e local de proveniencia devem ser levadas em conta, devido ao tempo de existência que essas populações permaneceram convivendo com o parasita, fazendo com que exista a necessidade de uma epidemiologia genética integrada com abordagem genômica populacional que deve analisar esses componentes da cadeia de transmissão em conjunto, bem como suas possíveis interações no fenômenos denominado co-evolução (CAMPBELL, et al. 2008). O motivo de estudo de variações populacionais também deve ser levado em conta quando se estuda a criação de novos fármacos, tendo sido introduzida recentemente uma nova ciência que está tendo cada vez mais impacto que é a farmacogenética. Nesta nova ciência se estudam as variações genéticas que causam respostas variáveis aos medicamentos incluindo diferenças na eficácia, interações droga-droga e o risco relativo de reações adversas. Isso envolve, estudos de mutações e polimorfismos que podem afetar a expressão ou atividade de receptores farmacológicos, proteínas transportadoras, sinalizadoras e de enzimas metabolizadoras em diferentes populações. (INGELMAN-SUNDBERG, 2001) Apesar das diferenças genéticas entre populações originárias dos diferentes continentes não ser acentuada, as diferenças existentes, que são essencialmente de freqüência dos tipos variantes (alelos) dos genes, permitem conhecer melhor as origens de populações. Esse conhecimento é útil para a medicina dos transplantes e a medicina legal. Uma vez que as freqüências dos tipos diferem entre populações, a probabilidade de se encontrar um doador compatível, por exemplo, também depende do grupo étnico (PROBST, et al. 2000). A população brasileira é tri-hibrida e o grau de miscigenação difere de uma região a outra e mesmo entre grupos da mesma região. De acordo com PROBST, et al. (2000) na população da região metropolitana de Curitiba e do Estado do Paraná, observou-se que a população mulata foi formada por Europeus, Africanos e Ameríndios nas proporções de, aproximadamente, 50%, 40% e 10%, respectivamente, e que a contribuição relativa dos mesmos 3 grupos ancestrais na formação da população branca foi de 90%, 6% e 4%. Essas proporções variam de região para região do país dependendo das proporções de mistura de populações que aconteceram ao longo destes 5 séculos. Assim, no Norte o constituinte trihibrido é muito maior, já que a freqüência da população ameríndia é maior. Diante do exposto, optamos em estudar as populações de São Miguel, Cujubim, Santo Antônio do Guaporé e Porto Velho, visto que não existem estudos sobre as freqüências de mistura racial obtidas a partir de marcadores moleculares do cromossomo Y e do DNA 34

19 mitochondrial. Este estudo pode contribuir para pesquisas futuras da relação entre patógenohospedeiro. 35

20 1 COLONIZAÇÃO BRASILEIRA E OS ESTUDOS GENÉTICOS 1.1- Aspectos Gerais da Colonização Brasileira A chegada dos portugueses no ano de 1500 inaugura a fase colonial. cujo objetivo principal foi o de explorar as riquezas das terras Brasileiras. Em 1530 o rei de Portugal organizou a primeira expedição colonizadora que tinha o objetivo de povoar e iniciar o cultivo de cana-de-açúcar. Entre 1500 e 1850, chegaram aproximadamente portugueses e 4 milhões de africanos em terras brasileiras, onde se depararam com cerca de 2,4 milhões de ameríndios (CURTIN, 1969; IBGE, 2000). Estima-se que, entre o século XVI e meados do século XIX, mais de 11 milhões de homens, mulheres e crianças escravos foram transportados para as Américas. Por volta da segunda metade do século XVI, a oferta de escravos indígenas declinou e os escravos africanos começaram a chegar em maior quantidade no intuito de substituí-los (ALBUQUERQUE e FILHO, 2006). Não há registro exato dos primeiros escravos que chegaram à colônia. No entanto, a tese mais aceita hoje em relação à presença de escravos, conforme dados do Instituto Brasileiro Geografia e Estatística-IBGE, seria por intermédio do Jorge Lopes Bixorda em 1538, que teria traficado para a Bahia os primeiros escravos africanos (IBGE, 2000). Do continente africano, Angola, foi o maior fornecedor de escravos para as Américas portuguesa e espanhola. Atividade que vigorou entre o fim do século XVI até à primeira metade do século XVIII. Entre 1575 e 1591 foram embarcados da região de Angola mais de 52 mil escravos para a colônia. No início do século XIX havia uma população de , das quais, era escrava. Em 1872, no município de Campinas, no Estado de São Paulo, a população escrava era de , enquanto a livre era de (ALBUQUERQUE e FILHO, 2006). Cidades litorâneas como Salvador, São Vicente (São Paulo), Rio de Janeiro e Recife foram os primeiros núcleos de povoamento que, posteriormente, avançaram para o interior da colônia, em diversas direções. O comércio de escravos continuou abertamente mesmo depois da lei que determinava o fim da escravidão. Desta forma a entrada de escravos aumentou significativamente nas décadas de 30 e 40 do século XIX (ALBUQUERQUE e FILHO, 2006). O Quilombo dos Palmares, localizado no interior do Estado de Alagoas, na Serra da Barriga, constitui hoje o quilombo mais conhecido no Brasil por sua expressiva resistência no século XIX. Atualmente existem comunidades quilombolas espalhadas por todos os Estados 36

21 do Brasil. De acordo com dados da Fundação Cultural Palmares, cem comunidades remanescentes dos quilombos estão oficialmente regulamentadas. As maiores concentrações destas comunidades estão nos Estados da Bahia e do Maranhão. Estima-se que existam cerca de comunidades quilombolas espalhadas por todas as regiões do país. A população brasileira foi formada basicamente por contribuições de grupos étnicos distintos como os caucasianos, negróides e ameríndios, sendo os caucasianos oriundos de Portugal os negróides de países africanos e, finalmente, os ameríndios habitantes nativos do continente há pelo menos 1500 anos (RIBEIRO, 1995). Com isto, o povo Brasileiro constituise em uma das populações mais heterogêneas do mundo, sua miscigenação é decorrente também de alemães, italianos, sírio-libaneses e japoneses. O ápice do fluxo imigratório destes últimos povos acima citados, ocorreu na primeira metade do século XX entre 1901 e 1930 ultrapassando 25 mil indivíduos (IBGE, 2000). Um dos primeiros estudos sobre a constituição étnica da população Brasileira data de 1872 cujo dado seria de 2 milhões de negros, 6,5 milhões de brancos, 200 mil índios e 6 milhões de indivíduos miscigenados. Tal cenário nos permite afirmar que a população brasileira é uma população tri-híbrida, resultado da mistura étnica fomentada em 5 séculos de história entre Europa, África e América (KRIEGER, et al. 1965; SALZANO e CALLEGARI- JACQUES, 1988; SALZANO, 2004). Para a realização do estudo de linhagem paterna e materna, proposto neste trabalho, optamos em trabalhar com as amostras de Santo Antônio do Guaporé, Porto Velho, São Miguel e Cujubim por apresentarem diferenças fenotípicas, geográficas, culturais, sociais e de migração A Presença Africana no Estado de Rondônia - O Caso de Santo Antônio do Guaporé A história do povoamento do vale do Guaporé, no estado de Rondônia, onde se localiza a comunidade afro-descendente do presente estudo, tem sua trajetória marcada pela política de ingresso de escravos no século XVIII, por ocasião da exploração das fronteiras agrícolas. Escravos provenientes das regiões do Mato Grosso e do Estado do Pará espalharam-se por toda região que, a priori, contribuíram para o alicerce da economia local. A escravidão indígenas nas províncias do Pará e do Maranhão também foram exaustivamente utilizados na lavoura, naquele século. A utilização do trabalho escravo indígena se estendeu até o século XIX. A economia era baseada na coleta de plantas nativas denominadas drogas do sertão, como: cacau, salsaparrilha e baunilha. (TEIXEIRA, 1996; ALBUQUERQUE e FILHO, 2006). 37

22 As cidades do Rio de Janeiro, Salvador, Recife e Fortaleza foram os principais portos importadores e redistribuidores de escravos para a região Norte do país. No século XVIII, Belém e São Luís tornaram-se grandes centros de venda de escravos para toda a Região Amazônica. De Belém marchavam por terra ou eram conduzidos em embarcações para as regiões mais interiores da Amazônia (ALBUQUERQUE e FILHO, 2006). A entrada de escravos para o vale do Guaporé aconteceu entre 1752 a 1761, na ordem de indivíduos por meio do rio Madeira. Após muitas décadas, o Vale do Guaporé passou a ser identificado como território de negros, cujos herdeiros eram quilombolas provenientes de Vila Bela da Santíssima Trindade, Estado do Mato Grosso (TEIXEIRA, 2004). No século XVIII o abastecimento de escravos para as minas e lavouras do Vale do Guaporé passou a ser feito pela rota do rio Madeira por meio da capitania de comércio do Grão Pará e Maranhão, garantindo naquela época, a política de fronteira agrícola (ROCHA POMBO,1935). A caracterização social no vale do Guaporé, século XVIII, se dava pela presença de negros, índios e mestiços. Na primeira metade do século XVIII, os colonizadores avançaram para o Mato Grosso em busca de ouro e levaram com eles escravos africanos. A vila de Cuiabá rapidamente acumulou uma densa população escrava (ALBUQUERQUE e FILHO, 2006). A população de Santo Antônio do Guaporé foi constituída por ocasião da construção do Real Forte Príncipe da Beira no ano de 1783, forte este construído para impedir invasões espanholas. Na ocasião, duas famílias teriam firmado sua identidade étnica e cultural. As famílias Silva e Calazans teriam sido fundadoras do que hoje se conhece como Santo Antônio do Guaporé. Essas duas famílias primavam pela união entre seus membros. (TEIXEIRA, 1996). O confronto entre negros e índios, durante o século XIX, aconteceu em decorrência da desigualdade numérica entre homens e mulheres. Tal cenário desencadeou ações de captura de mulheres do povo indígena Cabixi, o que provocou a morte de muitos quilombolas pelos cabixi. Outro ponto histórico importante é que no século XIX, e nas primeiras décadas do século XX estabeleceu-se no vale do rio Madeira e do rio Mamoré, os barbadianos, de origem caribenha, que também contribuíram para a diversidade genética naquela região (MELLO e SOUZA, 1989). Entender aspectos da genética dessa população significa resgatar a ancestralidade a partir do seu DNA. O contexto histórico-social também constituiu importante ferramenta para entender a dinâmica populacional. Nossa intervenção procurou analisar a notória miscigenação presente a partir da migração de diferentes povos de diferentes continentes, na 38

23 formação da população de Porto Velho, Cujubim, São Miguel e Santo Antônio do Guaporé, radicada no estado de Rondônia Aspectos Históricos da Formação de Porto Velho, São Miguel e Cujubim. A história da construção do município de Porto Velho confunde-se com a história de formação do estado de Rondônia e o desejo de conquista econômica, em meados do século XIX. Por ocasião da grande seca ocorrida neste período no nordeste, e pelo advento do ciclo da borracha no fim do século XIX, cerca de 80 mil retirantes vieram do nordeste para o que hoje é o Estado de Rondônia, espalhando-se pelo vale do Guaporé, rio Madeira e Jí-Paraná. Suas principais atividades eram a pesca e agricultura de subsistência, atividades que caracterizam ainda hoje a população ribeirinha, por viver às margens dos rios Amazônicos. No caso de Porto Velho, às margens do rio Madeira (LISBOA, 1990). No inicio do século XX houve nova imigração motivada pela esperança de trabalho na construção da Estrada de Ferro Madeira-Mamoré, o que também motivou processos migratórios de trabalhadores de diversos lugares do mundo. A Estrada de Ferro foi construída mediante o Tratado de Petrópolis, assinado no ano de 1903, celebrado entre o Brasil e a Bolívia. Tais acontecimentos constituíram fatores importantes no processo de migração (RIBEIRO, 1995). Diante do exposto, optamos em estudar as comunidades de São Miguel e Cujubim, que ficam às margens do rio Madeira e são formadas por migrantes, do estado do Amazonas, Acre e Mato Grosso. Estas comunidades historicamente apresentam características fenotípicas de miscigenação entre índios, negros e caucasianos (NUNES, 2003). Os voluntários das amostras de Porto Velho são pertencentes a região de Porto Velho Populações Miscigenadas e a Genética A genética de populações baseia-se em analisar a variabilidade genética existente em diferentes grupos populacionais por meio da investigação de mecanismos que mantém essa variabilidade. Essa diversidade humana enquanto patrimônio genético procura entender fenômenos genéticos, históricos e sociais, a qual é facilmente identificável por meio de análise genômica, por meio dos polimorfismos que existem em nosso DNA (CAVALLI- SFORZA, 1998). 39

24 Os mecanismos de mutações, seleções e deriva genética associados aos momentos de migrações de povos ao longo da história da humanidade permitem variações alélicas que vão caracterizar a genética de uma determinada população (KIMURA, 1989). É interessante enfatizar que a seleção e a taxa de mutação são específicas para cada locus que está sendo pesquisado em diferentes regiões do genoma e, por outro lado, a deriva genética e fluxo gênico dependem da demografia e história evolucionária das populações. (CARVALHO-SILVA, et al. 1999) Classificação Étnica A grande diversidade étnica no Brasil tem despertado interesse dos pesquisadores no que se refere a sua grande importância social. cultural e histórica. Sendo assim, vários estudos têm sido realizados com marcadores genéticos no intuito de reconstruir a história biológica e a gênese das diferenças humanas (ZAGO, et al. 1996; HARPENDING e ROGERS, 2000; CAYRES-VALLINOTO, et al. 2003; OLIVEIRA, et al. 2003; LAGUARDIA, 2005). A primeira proposta de classificação de grupos populacionais foi influenciada pelo antropólogo alemão Johan Friedrich Blumenbac no século XVIII o qual descreve cinco raças principais: caucasóide, mongolóide, etiópica, americana e malaica. Estas foram pautadas na origem geográfica e em parâmetros morfológicos. O termo caucasóide, por exemplo, proveio dos habitantes da Geórgia, nas montanhas do Cáucaso (GOULD, 1994). Como o Brasil é o resultado de uma população tri-híbrida formada a partir do cruzamento entre brancos, negros e índios, sua rica diversidade possibilitou uma outra forma de classificação, cuja característica heterogênica pode ser descrita como: mamelucos, cafuzos, crioulos e pardos, os quais são muitas vezes entendidas como raças. No entanto, o conceito de raça no contexto geral está sendo gradativamente afastado do círculo médico e biológico, pois não existe diferença consistente entre as diferentes populações ao redor do mundo (RIBEIRO, 1983; PENA, 2005). O conceito de raça não se sustenta se for definido como grupos geneticamente distintos. Esse fato fica mais evidente quando se leva em consideração que raça se define muitas vezes pela aparência física e, principalmente, cor da pele. Em estudos com marcadores uniparentais constatou-se que um indivíduo negro com características africanas pode perfeitamente possuir DNAmt de haplogrupos ameríndios, ou até europeu (ABÉ-SANDES et al. 2004). Sendo assim, é pertinente analisar a base genética para sua origem étnica. De acordo com Rosenberg et al. (2002) os estudos sobre variabilidade humana com polimorfismos de DNA autossômicos de indivíduos em 51 populações foi importante 40

25 para definir a origem geográfica. Os resultados laboratoriais demonstraram que cinco das populações estudadas poderiam ser bem definidas não só geograficamente, mas geneticamente, pois mostraram diferenças polimórficas bastante acentuadas. São elas: África Sub-Saariana; Europa; Ásia; Ameríndios e Oceania Marcadores Moleculares na Investigação Populacional O estudo da variabilidade genética humana, na investigação antropológica, remonta ao início do século XX com o estudo do sistema sanguíneo ABO por Landsteiner em 1901 que posteriormente foi confirmado por Hirszfeld e Hirszfeld (1919) que demonstraram existir diferentes frequências em populações distintas. Os primeiros estudos sobre variabilidade genética limitavam-se a descrever característica fenotípicas como cor da pele, dos olhos e cabelos, assim como investigar as frequências alélicas analisando grupos sanguíneos. Posteriormente, a eletroforese de proteínas foi incorporada aos estudos antropogenéticos, seguido dos marcadores genéticos do DNA mitocondrial. cromossomo Y, SNPs e dos STRs autossômicos. A investigação por meio de marcadores genéticos permite contribuir e referenciar a população no campo antropogenético (HAMMER e, ZEGURA, 2002). A mistura étnica garante a diversidade genética de uma população com característica polimórfica herdada, a qual contribuirá para a investigação da dinâmica dos genes (FUTUYMA,1992; BEIGUELMAN, 1994). O cromossomo Y e o DNA mitocondrial possuem características de herança uniparental cujo loci haplóides não são recombinantes, sendo assim, extremamente importantes para inferir quanto a eventos do passado e as suas origens paterna e materna, respectivamente (SOUZA e CULPI, 1992). Na década de 80 estudos de polimorfismos utilizando ácidos nucléicos desencadearam, por meio de técnicas moleculares, o melhor entendimento da dinâmica gênica. Segundo CAVALLI-SFORZA, et al. (1994) o termo polimorfismo refere-se a presença de um ou mais alelos de um gene em uma população. Um locus é dito polimórfico quando existem vários alelos com frequência superior a 1%. Na maior parte do genoma de eucarioto é possível verificar sequências polimórficas, que são herdadas, de modo estável, de geração em geração (CHARLESWORTH, et al. 1994). No genoma humano ocorre, em média, 1 microssatélite a cada 6 Kilobases (Kb) (BECKMAN e WEBER, 1992; HEARNE, et al. 1992). 41

26 As classes de marcadores moleculares podem ser divididas em RFLP (Restriction Length Fragment Polymorphism) cuja característica é a utilização de enzima de restrição; em VNTRs (Variable Number of Tandem Repeat) que não utiliza enzimas de restrição e caracteriza-se pela repetição consecutiva de uma sequência de nucleotídeos que varia em quantidade de indivíduo para indivíduo em um determinado lócus (NAKAMURA, et al. 1987). Os VNTRs podem ser divididos em três subclasses de acordo com a quantidade de pares de bases: satélite consiste de segmentos repetidos de 100 ou mais pares de bases (pb); minissatélites repetições de 6 a 100 pb ou polimorfismo com repetições in tandem de 11 a 60 pares de bases (pb), e os microssatélites também denominados STRs (Short Tandem Repeat) sequências repetidas de 2 a 6 pb que apresentam-se em bloco de até 500pb (CHAMBERS, et al. 2000; JEFFREYS et al. 1985; EDWARDS, et al. 1991). O polimorfismo genético se deve tanto ao ganho como à perda de unidades de bases sendo que, os números de unidades que se repetem são chamados de alelos o qual conferem sua variabilidade (Fig. 01) (BELL, et al. 1982; SCHLÖTTERER, 1998) gtctg agat agat agat agat agat agat agat agat agat agat agat agat tctg 12 repetições = alelo 12 Figura 01: Representação de uma estrutura de minissatélites com 12 repetições [agat] - denominado alelo 12. A reação em cadeia de polimerase (PCR) tem sido extremamente importante na investigação populacional de mapas genéticos e identificação genética sobre tudo no estudo dos microssatelites. Outra vantagem na verificação de microssatélites é que são facilmente analisados mesmo quando o DNA está parcialmente degradado ou em pouca quantidade (EDWARDS, 1992). Dentro do grupo de VNTR, Kremer et al. (1991) descreveram a síndrome do X Frágil como doença causada pelo excessivo número de repetição in tandem. As pessoas normais apresentam de 5 a 54 repetições GCC, enquanto que os afetados apresentam de 230 a 4000 repetições no gene FMR-1, fenômeno este denominado expansão (ROSENBERG, 1996). Os SNPs (Single Nucleotide Polymorphism) são marcadores que apresentam uma variação polimorficas em uma única base. Estima-se que ocorra, aproximadamente, um SNP a cada mil bases ao longo do genoma humano (NAKAMURA et al. 1987; HOUCK, et al. 1979; NIELSEN, 2000). Os SNPs são, assim como as sequências ALU, classificados como marcadores binários ou bialélicos por apresentarem dois alelos segregando em populações 42

27 humanas: a sequência ancestral ou a derivada. São oriundos de eventos que ocorreram apenas uma vez na história evolutiva de uma determinada espécie, inclusive seres humanos (HAMMER e ZEGURA, 2002). As sequências ALU, também são uma fração de DNA repetitivo, o qual apresenta um sítio de restrição à enzima AluI em cada extremidade. Estão restritos aos primatas e possuem sequências com cerca de 300 pares de base que estão inseridas por todo o genoma (TISHKOFF et al. 2000). Constituem uma ferramenta útil para a análise da reconstrução histórica de populações humanas e dos eventos demográficos, já que nem todos os indivíduos de uma dada população possuem a inserção. Isto, porque a inserção de elementos Alu constitui um tipo de evento mutacional estável, único e unidirecional. Essa característica particular faz do marcador um dos mais seguros quanto ao conhecimento do estado ancestral. principalmente quando é detectada a ausência do elemento Alu na região de interesse. A taxa de inserção de um novo elemento Alu é de aproximadamente 100 a 200 por milhão de anos (BATZER e DEININGER, 1991; SHEN et al. 1991) Marcadores Genéticos Uniparentais Cromossomo Y O genoma humano haplóide é constituído por cerca de 3,2x10 9 pb de DNA. A região polimórfica do DNA tem sido amplamente utilizada para identificação humana, pois permite que sejam feitas as distinções entre indivíduos e populações. O haplótipo do Y mais estudado até hoje nas populações mundiais foi denominado de haplótipo mínimo pelo Consórcio do Cromossomo Y do inglês Y Chromosome Consortium YCC. O YCC foi fundado por pesquisadores da Universidade do Arizona para estudar a variação genética do cromossomo Y humano e possui um excelente poder discriminatório (KAYSE et al. 1997; LESSIG et al. 2003; NASIDGE et al 2003; SCHOSKE et al 2004; PARK et al. 2005).Trata-se de uma colaboração cientifica para a divulgação de novos polimorfismos, assim como, as possíveis mudanças de nomenclatura. O haplótipo mínimo é constituído pelos marcadores DYS19, DYS385, DYS389I/II, DYS390, DYS391, DYS392 e DYS393. No entanto, existem outros marcadores (DYS447, DYS458 e o DYS464) com grande poder informativo que podem ser combinados com o haplótipo mínimo. Com este acréscimo o haplótipo mínimo deixa de ser mínimo e passa a ser denominado de Haplótipo Mínimo Estendido com maior poder de discriminação (BUTLER, 2002 ; SCHOSKE et al. 2004). 43

28 Os cromossomos sexuais humanos são caracterizados morfologicamente como distintos. Enquanto o cromossomo X tem um tamanho médio de 150 Mb, o Y apresenta apenas 60Mb, sendo o menor do genoma humano com morfologia acrocêntrica pertencente ao grupo G ( AFFARA et al. 1994, ALI e HASNAIN, 2002; CRAIG et al. 2004). O cromossomo Y está estruturalmente dividido em 3 partes: (1) porção pseudoautossômica, que é dividida ainda em duas regiões pseudoautossômicas, PAR1 e PAR2; (2) região eucromática e (3) região heterocromática (ROOTSI, 2004). A região de determinação sexual (SRY) está localizada na posição 2,56Mb, enquanto o gene da amelogenina (AMEL Y) está na posição 6,70Mb do braço curto do cromossomo Y. Este gene está presente nos cromossomos X e Y, podendo ser amplificada simultaneamente com diferentes loci de um sistema multiplex, proporcionando a determinação do sexo (Fig. 02). Posição dos LOCI ao Longo do Cromossomo Y Figura 02: Estrutura básica do Cromossomo Y com os marcadores dos haplótipos mínimos mais os marcadores DYS447, DYS458 e DYS464 o qual pode-se denominar de haplótipo estendido. (Modificado de As regiões pseudoautossômicas sofrem permutações tal qual os genes dos cromossomos autossômicos. Em contraste, as porções eucromática e heterocromática não realizam recombinação com o cromossomo X, sendo então chamadas de região nãorecombinante do cromossomo Y (NRY), representa 95%, enquanto que PAR1 e PAR2 representam os 5% restantes (QUINTAMA e FELLOUS, 2001). Estas regiões apresentam 2,6 e 0,34 milhões de pares de bases nos braços curto e longo, respectivamente (VOGT et al. 1997). Dentro da porção NRY, a heterocromatina representa uma valiosa ferramenta para estudos genéticos, já que possui diferenças polimórficas em diferentes populações masculinas (BUTLER, 2002; ROOTSI, 2004). O cromossomo Y apresenta propriedades inerentes a sua 44

29 estrutura que permitem investigar aspectos migratórios e de evolução humana. Isto é possível por intermédio de uma região não-recombinate do cromossomo Y (NRY) que confere uma herança patrilinear (WILDER et al.2004). Os marcadores ligados ao cromossomo Y são transmitidos aos filhos sem mudanças, exceto quando ocorrem mutações que passam pó meio de gerações e representam um registro de seu passado evolutivo que pode ser usado na reconstrução da história de populações (JOBLING e TYLER-SMITH, 2003). O primeiro marcador polimórfico descrito do cromossomo Y foi o Y27H39 hoje conhecido como DYS19 (BUTLER, et al. 2003). Em 1997 a comunidade Européia forense divulgou mais sete marcadores ligados ao cromossomo Y: DYS389I, DYS389II, DYS390, DYS391, DYS392, DYS393 e DYS385. Em 2003 já haviam sido descritos cerca de 200 novos marcadores no genoma (GDB; Neste mesmo ano, o U. S. Scientific Working Group on DNA Analysis Method (SWGDAN) sugeriu a utilização do haplótipo mínimo acrescido de dois marcadores, denominados DYS438 e DYS439 (BUTLER, 2003). No locus DYS385, verifica-se a amplificação de dois fragmentos diferentes, tais fragmentos não podem ser entendidos como dois loci por serem amplificados com um único par de iniciadores (GUSMÃO et al. 2006). Hoje os marcadores estão disponíveis comercialmente para a produção de banco de dados e para pesquisas com Y-STR. Os estudos com o cromossomo Y que possui cerca de 50 STRs (Short Tandem Repeats), favorece, por meio de seus marcadores, a investigação de casos de crimes sexuais, paternidade, migração e evolução. Nos dias atuais os métodos para obtenção dos STRs evoluíram para a eletroforese capilar, com detecção baseada em fluorescência (FERREIRA e GRATTAPAGLIA, 1998; GOLDSTEIN et al. 1999) Descrição dos Microssatélites em Estudo no Cromossomo Y As características dos microssatélites em estudo podem ser observadas no banco de dados do Chemical Science and Technology Laboratory (CSTL) do National Institute of Standards and Technology (NIST) presente no endereço eletrônico como descrito abaixo: O primeiro microssatélite do cromossomo Y a ser descrito foi o DYS19, originalmente denominado DY-27H39 (ROEWER e EPPLEN, 1992). Este marcador também é conhecido como Y-H39 (BUTLER, 2003). Duas sequência estão depositadas no GeneBank com o código de acesso X77751, com 9 repetições; AC com 12 repetições. Tem como motivo a sequência [TAGA] 3 TAGG[TAGA] n e sua localização cromossômica é Yp

30 O microssatélite DYS390 foi descrito por Roewer et al (1996) e é constituído pelas repetições [TCTG] n [TCTA] p [TCTG] q [TCTA] r. O microssatélite pode ser acessado no GeneBank pelo código AC Sua localização cromossômica é Yq As letras subscritas (n, p, q e r ) que aparecem ao lado das unidades repetitivas representam o número variável das repetições de bases. O microssatélite DYS391 está depositado no GeneBank com dois acessos: G09613 com 11 repetições e AC com 11 repetições. A sequência repetitiva é [TCTA] n e está localizado na região Yq11.21 do cromossomo Y. O microssatélite DYS392 está depositado no GeneBank também com dois acesso: G09867 com 16 repetições e AC06152 com 13 repetições. A sequência repetitiva é [TAT] n e está localizado na região Yq do cromossomo Y. O microssatélite DYS393 é constituído pela sequência repetitiva de quatro nucleotídeos [AGAT] n. Sua sequência pode ser encontrada no banco de dados do GeneBank sob os códigos de acesso: G09601 com 13 repetições e AC com 12 repetições. Este microssatélite está localizado na região Yp11.31 do cromossomo Y (ROWER et al. 1996). O microssatélite DYS385I/II tem como motivo a sequência [GAAA] n. No GeneBank está depositada sob o código de acesso é AC com 11 repetições e Z93950 com 10 repetições. Este marcador foi descrito por Schneider et al.(1998). Sua localização cromossomal é Yp O microssatélite DYS389I/II apresenta dois trechos de repetições que tem como motivo as sequências: [TCTG] q [TCTA] r e [TCTG] n [TCTA] p [TCTG] q [TCTA] r para os marcadores DYS389I, DYS389II, respectivamente. O código de acesso no GenBank é AC e AF140635, respectivamente. Este marcador foi originalmente descrito por Roewer et al e está localizado na região Yq11.21 do cromossomo Y. O microssatélite DYS437é constituído por um trechos de repetições que tem como motivo as sequências: [TCTA] n [TCTG] 2 [TCTA] 4 e seu código de acesso é AC com 10 repetições. Sua localização cromossomal é Y. O microssatélite DYS438 é constituído por um trechos de repetições [TTTTC]n com código de acesso no Genebank AC Este marcador apresenta 10 repetições de nucleotídicas e está localizado na região do cromossomo Y. O microssatélite DYS439 está depositado no GeneBank com o código de acesso AC Apresenta 13 sequências repetidas de [GATA]n. Sua localização cromossomal é Yq. O microssatélite DYS448 tem como motivo a sequência [AGAGAT]nN42[AGAGAT]m com 22 repetições e código de acesso AC A localização cromossomal é Y. 46

31 O microssatélite DYS456 está depositado no GeneBank sob o acesso AC Tem como motivo a sequência repetitiva [AGAT] n. Está localizado no cromossomo Y. Os microssatélites DYS458 e DYS635 não apresenta código de acesso no endereço eletrônico Contudo, apresentam as sequências [GAAA]n e [TCTA] 4 (TGTA) 2 [TCTA] 2 (TGTA) 2 [TCTA] 2 (TGTA) 0,2 [TCTA]n, respectivamente. O marcador DYS635 também é conhecido como Y-GATA-C4. A localização do marcador Y- GATA-H4 no GeneBank é G42676 e AC com 11 e 12 repetições, respectivamente para a sequência [TAGA] n ATGGATAGATTA [GATG] p AA [TAGA] q DNA Mitocondrial As mitocôndrias são organelas presentes no citoplasma celular responsáveis pela produção de energia. O DNA mitocondrial é circular, estritamente de herança materna e, assim como o cromossomo Y, não realiza o processo de recombinação gênica. A quantidade de mitocôndrias varia em função de suas necessidades energéticas, sendo que uma única célula pode chegar a possuir mais de cópias dessa organela (JOBIM et al.2006). O DNA mitocondrial (DNAmt) humano possui pares de base com duas fitas de DNA e 37 genes. Este DNA apresenta informações fundamentais para a reconstrução histórica de nossos antepassados incluindo estudos de evolução humana e migração através da origem matrilineal (ANDERSON et al. 1981; VIGILLANT et al.1991; TORRONI, 1993). A primeira sequência do genoma mitocondrial humano foi caracterizada por Anderson e colaboradores em 1981 (ANDERSON et al. 1981) os quais sequênciaram completamente o DNAmt humano na década de 80. Observou-se que era extremamente compacto com apenas 10% de regiões não codificantes, e que possui em seus 37 genes informações que codificam: 2 RNAs ribossômicos, 22 RNAs transportadores e 13 polipeptídios, todos envolvidos no processo de fosforilação oxidativa (READ e DONNAI, 2008) Esta organela possui uma peculiaridade quanto à constituição das bases nitrogenadas, assim, apresenta duas fitas: a fita pesada H (heavy) que é rica em guanosinas, e a fita leve L (light) que é rica em citosinas (STRACHAN et al. 2002). Além disso, uma pequena porção do DNAmt, conhecida como região 7S, possui fita tripla, como resultado de uma dupla replicação. Essa região, com cerca de pares de bases, é a maior porção não codificante dentro do DNAmt, mas possui função reguladora (PAKENDORF e STONEKING, 2005) e é por isso conhecida como região controle, ou ainda região da alça do deslocamento (D-loop). Dos 37 genes não possuidores de íntrons do genoma mitocondrial. 28 são codificados pela fita H e 09 pela fita L (Fig. 03). 47

32 Figura 03: Mapa do genoma mitocondrial humano, indicando o sentido anti-horário: 02 (dois) genes ribosomal RNA (12S e 16S), 03 (três) genes para subunidades do citocromo oxidase (COI COIII), 07 (sete) genes para subunidades do NADH desidrogenase (N1-N6, N4L), 02 (dois) genes para subunidades do F1 ATPase (6 e 8), o gene do citocromo b, 22 genes do RNA transferase, duas origens de replicação (OH (Heavy) e OL (Light)), e a região controle hipervariável não codificante HVI e HVII. Adaptado de para mostrar as regiões de interesse HVI e HVII (Ano 2009). O genoma mitocondrial na maior parte de sua sequência é idêntico entre os diferentes indivíduos. A variabilidade presente no DNAmt mitocondrial se deve ao fato deste não possuir histonas, proteínas cujo papel fundamental é manter estabilidade da molécula. Outro aspecto extremamente importante para a existência de grande variabilidade é a pobre atividade reparadora da enzima exonucleotídica (READ e DONNAI, 2008). A região D-Loop têm sido amplamente investigada por apresentar alta taxa de mutação e por ser extremamente informativa quanto à diversidade dentro e entre as populações. É possível, então, por meio desta organela verificar a diferença polimórfica entre indivíduos através da herança materna (ALVAREZ, 2001; GÓES, 2003). Segundo a literatura, no momento da fecundação, qualquer estrutura do espermatozóide, com exceção de seu pronúcleo, é marcada para destruição no ovócito por ubiquitinação. Esta ubiquitinação consiste num processo celular que permite a marcação por moléculas de ubiquitina, cujo objetivo e o reconhecimento e a degradação por um proteoma. (SUTOVSKY, 2000 ). Neste contexto, o conhecimento acerca de DNAmt em populações humanas tem sido cada vez mais alvo de estudos detalhados. Isso se deve ao fato de o genoma mitocondrial 48

33 possuir propriedades extremamente significativas, como a ausência de recombinação, a alta taxa de mutação, o grande número de cópias por célula e a herança ser exclusivamente materna. A propriedade mitocondrial de ter herança exclusivamente materna, facilita o estudo dos movimentos migratórios e história das populações. Os trabalhos que utilizam DNAmt para mapear a origem de uma população podem ser complementados com dados da herança paterna, por meio da análise do cromossomo Y (SHEN, 1991). A herança materna e ausência de recombinação são as características mais vantajosas do DNAmt, visto que indica o caminho tomado pelos ancestrais por várias gerações (INGMAN e GYLLENSTEN, 2003). Um outro ponto importante ao se estudar o DNAmt é a observação do fenômeno da heteroplasmia, que consiste na ocorrência em um mesmo indivíduo com mais de um genótipo do DNAmt. Este fenômeno pode ocorrer durante a mutação no genoma de uma ou mais mitocôndrias gerando uma grande mistura de moléculas mutantes e normais. Após gerações é possível que prevaleça dentro de uma célula somente células mutantes ou normais (BUTLER e LEVIN 1998; GÓES, 2003). A associação das propriedades do DNAmt fornece informações importantes para a elucidação do itinerário milenar de nossos ancestrais. As mutações que surgem no genoma mitocondrial podem caracterizar um grupo populacional. desde que tal alteração se fixe na população, formando assim as mutações fundadoras, que são definidas por haplogrupos. Essas variações no DNAmt podem ser usadas para rastrear populações (CAVALLI-SFORZA, 1994). As mutações fundadoras possibilitam o cálculo da frequência de determinado haplogrupo na população e a distribuição geográfica dos descendentes. O DNAmt humano possui uma taxa de substituição de nucleotídeos estimada em 0,0017 x 10-6 por sítio por ano, considerando o genoma mitocondrial sem a região controle. A porção não codificadora, por outro lado, apresenta duas regiões denominadas HVI que se inicia no nucleotídeo e a HVII com seu inicio no 73 nucleotídeo, com 341 e 267 pares de bases, respectivamente. No entanto, a regularidade de substituições nas regiões HVI e HVII é motivo de muitas controvérsias (STONEKING, 2000). Mesmo assim, a base de dados hoje existente relativa à taxa de mutação do DNAmt, contribui largamente com os estudos de história das migrações entre populações de diferentes regiões geográficas em função das mutações acumuladas e de suas frequências (CAVALLI-SFORZA et al. 1994). Existe ainda uma região menor denominada região HVIII que se estende da posição 440 até 560 (ÁLVAREZ et al. 2001). De acordo com Alves-Silva et al. (2000), que estudou 99 amostras de indivíduos do sudeste do estado de Minas Gerais, 50 amostras do estado do Rio Grande do Sul (Santa Catarina e Paraná), 48 amostras do estado do Amazonas, Pará, Rondônia e Acre e, finalmente, 49

34 50 amostras do estado de Pernambuco, foi identificado em amostras de homens brancos brasileiros apontaram para um quadro complexo de 170 diferentes haplotipos nos resultados das análises da região HVI do DNAmt. Foi verificado 4 haplogrupos de origem ameríndia (predominância dos haplogrupos A e B), 8 de origem africana (predominância de L3e, L2 e L1c) e 10 de origem européia (predominância de H e U). Ainda segundo o autor a amostra total evidenciou 33% de contribuição ameríndia e 28% de contribuição africana. Com isto pode-se verificar uma elevada contribuição matrilinear de origem ameríndia e africana. Tais informações, sobre herança compartilhada do genoma, segundo o autor, mostraram mais uma vez o indício de um ancestral comum possivelmente na África há milhares de anos. 50

35 2 HIPÓTESE No Brasil, sabe-se que o cruzamento inter-étnico foi assimétrico em relação ao sexo na época da colonização brasileira, onde homens europeus e mulheres africanas e ameríndias contribuíram desproporcionalmente para esse processo (RIBEIRO, 1995; CALLEGARI- JACQUES et al. 2003). Esta pesquisa norteou-se pela hipótese de um perfil espacial de distribuição dos marcadores ligados ao cromossomo Y e aos haplogrupos do mtdna em 04 populações do estado de Rondônia. A população de Santo Antônio do Guaporé de origem africana foi correlacionada com Porto Velho, São Miguel e Cujubim, que historicamente apresentam características distintas e que podem ter sofrido alguma influência genética de outras populações de diferentes regiões do Brasil e populações de origem miscigenada (européia, ameríndia e africana). Analisar a estrutura genética proporciona uma visão geral da história genética das linhagens masculina e feminina entre as comunidades estudadas do estado de Rondônia, dentro dos modelos de migração propostos. Com base na informação de que populações isoladas tendem a desenvolver entre si taxas desiguais de variação genética, ocasionando estoques gênicos; e mediante o histórico peculiar de sua formação populacional. as análises do DNA mitocondrial e do cromossomo Y foram imprescindíveis para confirmação do percentual de contribuição alélica das populações originais (européia, africana e ameríndia). 51

36 3 OBJETIVOS Geral Este trabalho tem por objetivo caracterizar a variabilidade polimórfica utilizando marcadores uniparentais paternos (cromossomo Y) e maternos (DNA mitocondrial) em amostras populacionais de Santo Antônio do Guaporé, Porto Velho, São Miguel e Cujubim no Estado de Rondônia, com o propósito de avaliar e comparar a história de formação genética destas populações com os modelos migratórios conhecidos Específicos Caracterizar a estrutura populacional das amostras em tela. Determinar as frequências alélicas dos microssatélites Y-específico das populações de Porto Velho, Cujubim, São Miguel e Santo Antônio do Guaporé. Com base nas frequências alélicas estimadas, quantificar a contribuição parental africana, européia e ameríndia. Investigar, a partir da história registrada, o processo de migração no estado de Rondônia em relação à variabilidade genética. Identificar os polimorfismos a partir das regiões HVI do DNAmt. Classificar as amostras em seus diferentes haplogrupos do DNAmt. Estimar diversidade intra e interpopulacional Fazer comparação genética entre as populações de estudo e outras populações da literatura, por meio de banco de dados, a partir de parâmetros estatísticos e inferir modelos propostos de migração. 52

37 4 MATERIAL E MÉTODOS Quatro populações foram analisadas com base nos marcadores do cromossomo Y e do DNAmt, cujo objetivo foi o de buscar informações sobre a predominância dos alelos e consequentemente a provável origem geográfica das comunidades. As amostras foram coletadas de famílias que voluntariamente se dispuseram a participar da pesquisa. Para que não ocorresse viés, apenas as amostras masculinas foram investigadas sem que as mesmas apresentassem parentesco consanguíneo direto, totalizando 144 amostras. 4.1 Processo de Coleta das Amostras A coleta do material biológico aconteceu nos postos de saúde das comunidades após o esclarecimento e o aceite das mesmas, conforme descrito abaixo. 1) Foi aplicado o Inquérito de Pesquisa Individual-IPI com os membros das famílias que espontaneamente aceitaram participar da pesquisa. 2) Dos indivíduos de Santo Antônio do Guaporé coletamos as amostras em papel de filtro, cerca de 04 (quatro) gotas de sangue, aproximadamente 30μl. No procedimento foi utilizada lanceta estéril descartável para punção superficial do dedo indicador da mão direita. 3) Dos indivíduos das populações de Porto Velho, São Miguel e Cujubim foram coletadas, em anos anteriores, 03 ml de sangue. 4) Ao término da coleta, todo o material biológico foi devidamente acondicionado em tubos com EDTA e encaminhado ao laboratório de genética da Universidade Federal de Rondônia para o procedimento de congelamento com glicerol 60%. Com as amostras de homens não aparentados foi realizada a amplificação por PCR utilizando o Kit YFiler Applied Biosystems (DYS389I, DYS390, DYS389II, DYS19, DYS385, DYS393, DYS391, DYS392, DYS437, DYS438, DYS439, DYS456, DYS458, DYS635, GATA-H4 e DYS448). Os alelos foram detectados por fluorescência no sequenciador ABI 3100 Avant durante a eletroforese capilar no Laboratório de Diagnóstico por DNA da Universidade do Estado do Rio de Janeiro. Para a determinação dos alelos utilizamos o controle positivo DNA ng/μl para Y e K562-2ng/μl para o DNAmt. Para descartar a possibilidade de contaminação, utilizamos o controle negativo, adicionando água Milliq, ao invés do DNA, em um dos tubos. 53

38 4.2 - Comitê de Ética Todas as amostras da comunidade de Santo Antônio do Guaporé foram coletadas e analisadas, após autorização formal. por meio de um termo de consentimento livre e esclarecido, devidamente assinado. A pesquisa foi autorizada pelo Comitê de Ética em Pesquisa-CEP, sob o número de aprovação 018/CEP/NUSAU/2006 da Universidade Federal de Rondônia. As amostras de Porto Velho, São Miguel e Cujubim foram coletados no ano de 2003 após entrevistas e assinatura do termo de consentimento livre e esclarecido. Todas as amostras foram analisadas após autorização do Comitê de Ética em Pesquisa-CEP, sob o número de aprovação 382/2003 e aprovado posteriormente pelo CONEP. 4.3 Caracterização dos Grupos Populacionais As quatro comunidades foram preliminarmente caracterizadas por meio de entrevista do tipo fechada, a fim de buscar informações sobre a origem dos entrevistados, conforme questionário do Apêndice V. No trabalho de campo adotou-se o procedimento de georeferenciamento da região na qual foi utilizado o GPS (Sistema Global de Posicionamento) Garmin Etrex, para obtenção das coordenadas geográficas das comunidades Santo Antônio do Guaporé A comunidade de Santo Antônio do Guaporé localiza-se dentro Reserva Biológica do Vale do Guaporé REBIO, a sudoeste do Estado de Rondônia, está sob a responsabilidade administrativa do município de São Francisco do Guaporé. Situa-se à margem direita do Rio Guaporé e fica acerca de 140 Km da cidade de Costa Marques; possui as seguintes coordenadas geográficas: Latitude 12º e Longitude (Fig. 04). No início da década de 90 havia por volta de 400 pessoas morando na localidade, na sua grande maioria crianças e idosos. Hoje a comunidade de Santo Antônio do Guaporé, é constituída de 28 famílias totalizando cerca de 80 pessoas. A comunidade vive da pesca e da agricultura. Possui uma escola, um posto de saúde, um centro comunitário e uma igreja (TEIXEIRA, 1996). Para a realização deste estudo foram analisadas 15 amostras desta comunidade cuja característica é de afro-descendentes. 54

39 Figura 04: Mapa de localização da área de estudo Santo Antônio do Guaporé 39

40 Porto Velho O município de Porto Velho capital do Estado de Rondônia está localizado no extremo oeste do Estado de Rondônia fica à margem direita do Rio Madeira. Possui cerca de habitantes. Porto Velho apresenta as seguintes coordenadas: latitude 08, 45, 48 S; longitude: 63, 54, 48 w. Foram utilizados 82 amostras de homens com característica fenotípicas de cafuzo e mameluco, não aparentados pertencentes ao quadro da policia militar do Estado de Rondônia, e de indivíduo com as mesmas características que entraram com pedido de teste de paternidade na vara civil do município de Porto Velho Comunidade de São Miguel O município de São Miguel está localizado à margem esquerda do rio Madeira, a nordeste de Porto Velho. Possui 211 indivíduos de 63 famílias cadastradas pelo Sistema Único de Saúde (DATASUS, 2003). A população vive basicamente da agricultura de subsistência e da pesca. A localidade não possui água encanada, portanto, utiliza-se de água do rio Madeira tratada com hipoclorito. Alguns moradores na localidade de estudo possuem como fonte de energia o gerador. As casas, em sua maioria, são de madeira; apresenta um posto de saúde e uma escola. Sua estrutura é organizada por linhas ou ramais. Desta comunidade miscigenada foram analisadas 19 amostras Comunidade de Cujubim A comunidade de Cujubim localiza-se à margem direita do rio Madeira e está inserida no contexto geográfico do município de Porto Velho (Latitude , Longitude ). Até o final da década de 40, a localidade era denominada Seringal Aliança. A origem do nome Cujubim é proveniente de um pássaro, muito frequente na região. A predominância é de habitações construídas em madeira cobertas de palha, sem instalações sanitárias. A comunidade de Cujubim fica à cerca de 80Km de Porto Velho. Na atualidade, cerca de 75 famílias desenvolvem atividades agroextrativistas, principalmente a pesca artesanal e a agricultura de subsistência, e buscam alternativas de produção para minimizar o impacto sobre a atividade pesqueira. Os principais conflitos existentes na área dizem respeito à questão fundiária e principalmente à utilização dos recursos pesqueiros, que ocorre de forma predatória no Lago do Cujubim. Para a realização deste estudo foram coletadas 28 amostras de indivíduos que 40

41 procuravam o posto de saúde. As comunidades de Porto Velho, São Miguel e Cujubim podem ser observadas na figura

42 CARTOGRAMA II ÁREA DE ESTUDO LOCALIZAÇÃO DAS COLETAS LEGENDA P/ Humaitá-AM Convenções Cartográficas Delimitação Municipal Áreas Institucionais Rodovias, Estradas, Linhas Vicinais Cidades, Vilas, Localidades Estação Ecológica do Cuniã São Carlos RIO MADEIRA Área de Coleta Centro Administrativo Municipal Vila km 45 Floresta Estadual de Rendimento Sustentado Rio Madeira B Ilha Martins km Escala Gráfica BR-319 N COMUNIDADE DO SÃO MIGUEL Lago São Miguel Ilha dos Viados Lago Cujubim COMUNIDADE DO CUJUBIM GRANDE Belém Rio Jamari Vila Tamaduá Vila da Aliança RIO MADEIRA Rio Candeias Rio Jamari Colônia Penal Vila São Sebastião Porto Velho BR-364 Cadeias do Jamari P/ Cuiabá-MT Vila PAMO P/ Rio Branco-AC BR-364 Figura 05: Mapa de localização da área de estudo Porto Velho São Miguel e Cujubim Rio Candeias Base Cartográfica extraída do Banco de Dados IBGE, Mapa Temático elaborado por CIBEBI, 2008, em parceria com LABOGEOPA / UNIR - Laboratório de Geografia e Planejamento Ambiental / Universidade Federal de Rondônia. Desenhista Cartográfico - Luiz Cleyton Holanda Lobato (Geógrafo). 42

43 4.4 - Extração de DNA Após encaminhamento das amostras ao Laboratório de Genética da Universidade Federal de Rondônia, o sangue foi separado por centrifugação em suas partes: plasma, leucócitos e hemácias. Os tubos com soro também foram separados após coagulação. Em seguida, foram acondicionados em tubos de plástico de criopreservação e todos os componentes celulares foram misturados com glicerol a 60%, exceto o plasma e o soro. Ao término de cada um dos procedimentos de extração de DNA foi realizada eletroforese em gel de agarose 0,8% para a verificação por estimativa de quantidade e qualidade do DNA extraído. O gel de agarose foi corado com brometo de etídeo [10mg/ml] na concentração final a 0,5g/ml. As amostras coletadas com papel de filtro foram armazenadas em envelopes e colocadas na geladeira para posterior extração. Para extração do DNA foram utilizados três protocolos alternativos, segundo (CHOMCZYNSKI & SACHI 1987, CHOMCZYNSKI, 1993; BUDOWLE, et al. (2000), SAMBROOK et al. 1992) (quadro 02 do anexo I ) Extração com Brazol O Brazol é um reagente orgânico que demonstrou ser eficaz na purificação de ácidos nucléicos (CHOMCZYNSKI & SACHI, 1987; CHOMCZYNSKI, 1993). Para as amostras de Santo Antônio do Guaporé e de Cujubim foi utilizado este reagente. Alíquotas de sangue e do reagente Brazol foram colocadas em microtubos de 1,5mL, na proporção 1:3 (100μL da amostra e 300μL de Brazol). Os tubos foram agitados por inversão, ou com auxílio de agitador do tipo vôrtex, por 2 minutos e posteriormente, adicionou-se 50μL de clorofórmio gelado; As amostras foram centrifugadas a rpm a 4 C, por 15 minutos, o sobrenadante foi imediatamente transferido para novos tubos contendo 300 ml de isopropanol gelado. Os tubos foram agitados por inversão por 2 minutos para posterior centrifugação a rpm a 4 C, por 20 minutos. Após está etapa o sobrenadante foi desprezado por aspiração, cuidando sempre para não aspirar o pellet. Opcionalmente foi realizada outra lavagem com isopropanol e dissolvido o pellet em tampão TE 1X estéril. 43

44 Extração com Tampão SEB Em um microtubo de polipropileno do tipo eppendorff contendo 100 μl de sangue foi adicionados 500 μl de SEB ( Tris-Hcl 1M ph 7,5; EDTA 0,5M ph 8,0; Nacl 5M; e SDS 10%) e 15 μl de proteinase K (10mg/ml); em seguida foi levado ao vortex. O tubo com a solução foi deixado em banho seco a 56 C por 2 horas no mínimo. Após ter sido retirado do banho o tubo foi submetido a um spin em seguida foi adicionado 500μl de fenol, clorofórmio e álcool isoamílico (24:1:1). A solução foi misturada no vortex e centrifugada por 2 minutos à rpm. Desta solução foi retirado cerca de 400μl do sobrenadante e passado para um tubo novo, a este tubo acrescentou-se 700μl de etanol e 300μl de NaCl 5M. A solução foi homogeneizada e deixada no freezer por 30 minutos. Em seguida, foi centrifugada por 15 minutos e o sobrenadante foi descartado. Após deixar secar por cerca de 15 minutos, o DNA foi ressuspendido em 50μl de água Milliq ou TE autoclavados. (BUDOWLE, et al. 2000) Extração com Método Southern blot Outro método adotado foi de acordo com SAMBROOK et al. (1992). Em tubos de 1,5mL foi adicionado 100μl de papa de leucócitos lavado 3 vezes com tampão de lise I. Em seguida foi acrescentado o tampão de lise II (Tris-HCl 0,01M ph 8,5 KCl 50mM MgCl 2,5mM NP-40 0,45% Tween 20 0,45%) e 16 μl de proteinase K (10mg/ml). As amostras foram incubados a 56 C por 1 hora no mínimo. Após spin dos tubos, 300μl de NaCl 6M foram adicionados para serem submetidos ao vortex por 30 segundos em velocidade máxima visnado homogeneizar a solução. Após a homogeneização centrifugou-se por 30 minutos a velocidade de rpm, em seguida o sobrenadante foi transferido para novos tubos e adicionado igual volume de isopropanol gelado para a precipitação do DNA. O material foi incubado por no mínimo 1hora a -20 C. Em seguida centrifugado por rpm por 10 minutos a 4 C. O sobrenadante foi desprezado e ao tubo foi adicionado 100μl de etanol 70% gelado e novamente foi centrifugado por 10min a 4 C e descartado o sobrenadante. Finalmente, o material foi colocado pra secar no banho seco e em seguida foi adicionado 50 μl de TE Amplificação das 16 Regiões de Microssatélites do Cromossomo Y Quanto maior for a diversidade gênica dos marcadores constituintes de um haplótipo, maior deverá ser sua diversidade haplotípica e, consequentemente, sua capacidade de discriminar linhagens, com isso, realizou-se análises para estimar as frequências alélicas de 44

45 marcadores do cromossomo Y em diferentes populações de Rondônia. A nomenclatura dos haplogrupos do cromossomo Y seguiu a classificação adotada pelo Consórcio do Cromossomo Y (The Y-Chromosome Consortium -YCC, 2002). Para amplificação de regiões polimórficas do cromossomo Y foi utilizado o sistema multiplex Y-FILER da Applied Biosystems que amplifica 16 regiões Y-STR (Quadro 01). Este kit contém o haplótipo mínimo com mais três marcadores, também muito usados na identificação humana. Este acréscimo teve o objetivo de obter maior poder discriminatório Quadro 01 - Relação de loci do cromossomo Y amplificados pelo multiplex Y-FILER Applied Biosystems. Sistema Y FILER Lócus STR Localização Cromossomal Unidade Repetiva Fluoroforo DYS456 Yp [AGAT]n 6-FAM Número de Alelos DYS389I Yq11.21 [TCTG] 3 [TCTA]n 6-FAM 7-13 DYS390 DYS389II Yq Yq11.21 [TCTG]n[TCTA]n[TCTG]n [TCTA]n [TCTG]n[TCTA]n[TCTG] 3 [TCTA]n Acesso ao Banco de Genes AC (R&C) 6-FAM AC FAM DYS458 Yp [GAAA]n VIC DYS19 Yp11.2 [TAGA] 3 TAGG[TAGA]n VIC DYS385 Yq [GAAA]n VIC 9-22 AC (R&C) AC (r&c) AC (R&C) DYS393 Yp11.31 [AGAT]n NED 9-16 AC DYS391 Yq11.21 [TCTA]n NED 8-13 AC DYS439 Yq [GATA]n NED 9-14 AC DYS635 Yq [TCTA] 4 [TGTA] 2 [TCTA]2[ TGTA] 2 [TGTA] 2 [TGTA] 0,2 [TCTA]n NED DYS392 Yq [TAT]n NED 6-16 GATA-H4 Yq [AGAT] 4 CTAT[AGAT] 2 [A GGT] 3 [AGAT]nN 24 [ATAG ] 4 [ATAC]1 [ATAG] 2 PET 8-13 AC (r&c) AC (R&C) DYS437 Yq [TCTA] [TCTG] [TCTA] PET AC DYS438 Yq [TTTTC] PET 6-13 AC DYS448 Yq [AGAGAT]AGAGAGATA G[AGAGAT]N[AGAGAT] Fonte: Butler (2003). Forensic Sci. Review, Vol. 15 Number 2, July 2003 modificado. PET AC Os iniciadores do sistema multiplex utilizados são marcados com fluoróforos para posterior caracterização por tamanho dos produtos amplificados. O trabalho foi realizado no Laboratório de Diagnóstico por DNA da Universidade do Estado do Rio de Janeiro e no Laboratório de Genômica Funcional e Bioinformática da FIOCRUZ. No primeiro momento 45

46 foi realizada uma diluição das amostras na proporção de 1:20, para em seguida realizar a amplificação das regiões de interesse Reação de PCR Y FILER com Tampão Platinum A reação de PCR foi realizada em uma capela estéril por luz ultravioleta, para maior segurança quanto a possíveis contaminantes. Inicialmente foi realizada uma mistura contendo o Tampão Platinum (4x), primers do sistema multiplex Y-FILER da Applied Biosystems que amplifica 16 regiões, Taq platinum 5u/μl e Água Milliq. De um volume final de 6.25 μl foi alíquotado da mistura 5,25μl em tubos para PCR, aos quais eram adicionados 1 μl de DNA que foi anteriormente diluído na proporção 1:20. Para controle positivo foi utilizado o controle DNA007 (estoque) = 0.1ng/μl. A reação foi submetida ao termociclador GeneAmp PCR SYSTEM 9700 Applied Biosystems programado para os seguintes ciclos 95 c 11min; (94 C 1 min, 61 C 1 min, 72 C 1 min - 30x) 60 C 80seg e 4 C indefinidamente Preparação das Amostras para a Eletroforese As amostras amplificadas pelo sistema Y-FILER foram preparadas com uma mistura de 8,8μl de formamida e 0,2μl do marcador interno de tamanho GeneScan-500 Liz (Applied Biosystems) para 2μl de produto de PCR ou da escada alelica. As amostras e a escada foram acondicionadas em placas de 96 poços, em seguida desnaturadas a 95 C por 5mim e logo depois mantida em banho de gelo por 5 minutos para estabilização das moléculas por choque térmico. Em seguida a placa foi levada ao sequenciador automático ABI PRISM 3100-Avant Genetic Analyser (Applied Biosystems) para o início da eletroforese capilar. Foi adicionada a placa de análise o escada alélica para a leitura correta do resultado juntamente com o controle positivo. A análise dos resultados da amplificação foi realizada usando o programa GeneMapper software version 3.5, cujos dados podem ser observados no Apêndice I. 4.6 Amplificação da Região Hipervariável do DNA Mitocondrial (HVI) A metodologia para análise da região hipervariável do DNA mitocondrial utilizada para investigação matrilinear consistiu no preparo da amostra biológica, quanto a extração do DNA, a amplificação por PCR da região controle HVI (A1, B1), o sequenciamento do produto amplificado para comparação com a sequência padrão de Anderson (1981) é analise os produtos de sequenciamento após eletroforese capilar. A reação para amplificação da 46

47 região controle foram preparadas com Tampão Platinum [4x] 3 μl; Taq Platinum [5u/μl] 0,25 μl; Primer (A1, C1) [10mM] 0,25μl cada; BSA [0,5g/μl] 0,25 μl e água Milliq 6,00 μl. Para um volume final de 12 μl foram utilizados 10 μl do mix para 2 μl de DNA. Para o controle positivo K562-2ng/ μl foi utilizado 1 μl. A amplificação das regiões de interesse foram realizadas no termociclador GENEAMP PCR SYSTEM 9700 Applied Biosystems programado em diferentes ciclos: 95 C por 1min, (95 C 10seg; 60 C 30seg e 72 C 30seg - 32x); 4 C indefinidamente. Após a amplificação, alíquotas contendo 3ul da reação de PCR foram submetidas a técnica de eletroforese em gel de agarose 2% para a confirmação da amplificação. No momento da reação de amplificação foi utilizado um controle o negativo para ter certeza que não houve contaminação. Foram misturados 5 l das amostras com 1 l de tampão de carregamento 6X e aplicado no gel de agarose 2%. O gel foi corado em tampão TAE 1X com brometo de etídeo (0,5g/ml) por 15 minutos e visualizado em transluminador de luz ultravioleta (256nm). Para o registro da imagem foi utilizado o leitor de fluorescência FMBIO II. Somente os resultados positivos obtidos do PCR foram utilizados para a próxima etapa de purificação (Cf. Quadro 03 do anexo I). Na amplificação da região HVI foram utilizados os primers L (5 CACCATTAGCACCCAAAGCT3 ) e H (5 GAGGATGGTGGTCAAGGGAC3 ). As duas fitas devem ser sequenciadas com o objetivo de eliminar possíveis diferenças e detectar heretoplasmia. Neste procedimento foi utilizado o BSA cuja função é estabilizar a atividade enzimática visando uma boa amplificação (FERREIRA e GRATTAPAGLIA, 1998) Purificação das Amostras Amplificadas Após amplificação utilizamos a coluna Microspin S-300HR purificação do produto de PCR, visando eliminar possíveis impurezas contidas no DNA. O processo de purificação começa com a centrifugação da coluna a 6500 rpm por 30 segundos por duas vezes, em seguida a coluna de resina foi transferida para outro eppendorf identificado com o número da amostra No segundo momento, o produto da PCR foi adicionado à coluna para posterior centrifugação por 1minuto a 6500 rpm e recuperação do produto da PCR purificado. Este foi submetido à reação de sequenciamento. 47

48 Reação de Sequenciamento Os produtos purificados foram sequenciados por meio do método cíclico de terminação de cadeia, com o Kit BigDye (version 3.0 ABIPRISM). Neste sistema o primer utilizado na reação direciona a síntese de uma nova fita; cada di-desoxi-ribonucleotideo utilizado é responsável pelo término da reação de polimerização e é marcado com corante de fluorescência diferente, por exemplo: di-desoxi-adenina: JOE, di-desoxi-timina: ROX; didesxi-guanina: NED e di-desoxi-citosina: 6-FAM. As reações sequenciamento das regiões controle foram feitas separadamente. Para cada reação foram utilizados 1,5μl do produto de PCR. As condições de reação para um volume final de 5μl foram as seguintes: 1μl de BigDye; 1μl de tampão platinum, 1,5μl de primers na concentração de 1mM de HVI para a primeira reação. O sequenciamento foi realizado no termociclador GeneAmp PCR SYSTEM 9700 APPLIED BIOSYSTEM nas seguintes condições: 96 C por 10seg; (50 C 5seg; 60 C 4min - 25 ciclos) 4 C indefinidamente Purificação do Produto Sequenciado No segundo método de purificação foi utilizado a resina de exclusão o SEPHADEX G-50 (SIGMA-ALDRICH), cuja preparação da coluna se deu com 750μl da solução colocada em uma coluna própria, dentro de um tubo de 1,5ml. Após a centrifugação por 3 minutos a 6500 rpm para o empacotamento da resina o filtro foi para um tubo novo, onde foi possível adicionar os 5μl do produto de sequenciamento. Em seguida, o tubo foi levado ao processo de centrifugação por 3 minutos a 6500 rpm para a captura do purificado. A resina Sephadex tem propriedades equivalentes à da resina da Amershan, cuja função e a purificação do produto sequenciado por exclusão de moléculas maiores O Processo de Sequenciamento Automático Para a corrida no sequenciador automático de fluorescência ABI3130 Applied Biosystems foi adicionado na placa 15ul de formamida e em seguida colocado o DNA purificado, cuja análise foi realizada no Laboratório de Genômica Funcional e Bioinformática-IOC. Plataforma Genômica - Sequenciamento de DNA- PDTIS/FIOCRUZ. Todas as condições de corrida eletroforética e parâmetros de análise ocorreram conforme descrito no manual técnico do aparelho (Applied Biosystems, Co). A análise das variações de bases foram realizadas por meio da leitura dos picos dos eletroferogramas gerados no 48

49 sequenciamento da região HVS-I, comparada com a respectiva região de uma sequência padronizada internacionalmente por Anderson et al. (1981) no programa BioEdit v.3. Todo o trabalho metodológico pode ser visualizado no organograma da Fig

50 Figura 06: Organograma metodológico 50

51 4.7 Parâmetro de Análise Estatística dos Dados A variabilidade genética foi caracterizada pelos índices de diversidade utilizando o programa Genetix version 4.05, a partir do qual calculou-se a frequência dos alelos para a construção do banco de dados. Alguns parâmetros populacionais foram analisados a exemplo das frequências alélicas, diversidade das populações, assim como a comparação com outras populações Estimativa das Frequências dos Alelos A frequência de um alelo expressa o número de vezes que este é observado em relação ao número total de alelos em dado locus cromossomal (NEI, 1987). Fij= nij/nj Onde: Fij= frequência do alelo i na população j nij= número de ocorrência do alelo i na população j nj= número total de alelos encontrados na amostra da população j Diversidade Gênica por Locus Este índice mede o grau de polimorfismo ou discriminação de um determinado locus. O calculo da diversidade gênica é calculado de acordo com a fórmula de NEI, Onde: D= diversidade gênica n= tamanho da amostra pi= frequência alélica D= (n/n-1) (1- pi2) 51

52 4.9 - Distância Genética No cálculo de distâncias genéticas e a construção de dendrogramas UPGMA (Unweighted Pair Group Method with Arithmetic Mean) foram utilizados 4 programas que fazem parte do pacote PHYLIP versão 3.5c: SEQBOOT, GENDIST, NEIGHBOR E CONSENSE (SOKAL e MICHENER, 1958; REYNOLDS et al. 1983; FELSENSTEIN, 1989). Utilizou-se o programa SEQBOOT foi utilizado para construir um banco de dados contendo mil matrizes distintas obtidas a partir do banco de dados original que continha as frequências alélicas, pelo procedimento de bootstrap. Com a utilização do programa GENDIST, foi possível o cálculo das distâncias genéticas entre as populações, para cada uma das matrizes distintas. Para cada uma destas matrizes, construiu-se dendrogramas distintos pelo método UPGMA, proposto por Sokal e Michener nos anos 50. Este método consiste na clusterização em pares de táxons, com o uso do programa NEIGHBOR. Em seguida, os mil dendrogramas obtidos foram analisados pelo programa CONSENSE, obtendose um dendrograma "ótimo", com maior suporte estatístico. Por fim este dendrograma consenso foi visualizado utilizando-se o programa TreeView, versão Win32. O dendrograma é apresentado com o objetivo de analisar a similaridade entre as populações estudadas, visando a obtenção das relações genéticas entre elas. 52

53 5 RESULTADOS E DISCUSSÃO As amostras das 04 populações de Santo Antônio do Guaporé, São Miguel, Cujubim e Porto Velho pertencentes ao Estado de Rondônia, foram investigadas quanto aos marcadores uniparentais situados em regiões específicas no cromossomo Y e no DNA mitocondrial. Para melhor apresentação dividiu-se o resultado em dois eixos: contribuição uniparental masculina, por meio da análise do cromossomo Y e contribuição uniparental feminina, este último por intermédio do DNA mitocondrial. Como já mencionado para o cromossomo Y utilizou-se o haplótipo mínimo estendido para um resultado mais satisfatório do ponto de vista discriminatório. Os resultados das frequências alélicas podem ser observadas nas no apêndice II. O lócus DYS385 teve como característica a amplificação de dois alelos ao mesmo tempo com apenas um par de iniciadores, tal acontecimento se diferencia dos demais marcadores onde observa-se apenas a amplificação de um alelo. Para evitar viés no momento da análise estatística foram selecionados homens não aparentados Contribuição Uniparental Masculina A contribuição uniparental masculina, cujos marcadores estão na região nãorecombinante do cromossomo Y, foi analisada em todas as populações alvo deste estudo: Porto Velho, Cujubim, São Miguel e Santo Antônio do Guaporé. As populações apresentaram características de miscigenação entre europeus, africanos e ameríndios. Desta maneira, o estudo de polimorfismo traz informação sobre a composição genética das populações em tela, o qual permitiu a montagem de um banco de dados científicos e, consequentemente, possibilitou resgatar da origem daqueles povos. O estudo de polimorfismo de microssatélites em populações de origem brasileira pode ser comparado, em princípio, aos dados de populações africanas, ameríndias e européias visto que são consideradas populações ancestrais. As frequências alélicas estudadas por CARVALHO et al. (2003); TROVOADA et al. (2001); WANDERLEY-SANTOS, (2001) em populações africanas, ameríndias e européias, respectivamente, foram utilizadas com a finalidade de comparação com os resultados obtidos na pesquisa. Para tanto, utilizamos alguns marcadores Caracterização Genética Populacional por Lócus As quatro populações do presente estudos caracterizaram-se quanto a sua contribuição uniparental masculina, utilizando marcadores da região não recombinante do cromossomo Y a 53

54 FREQUENCIA partir do Kit Y-Filer. O resultado possibilitou fazer comparação com as etnias africana, ameríndia e européia Marcador DYS19: Nos resultados aqui obtidos foi possível observar que o alelo DYS19*14 1 apresentou uma frequência semelhante entre as nossas populações e a população de Europeus. Destaquese aqui, que Porto Velho historicamente tem uma formação étnica a partir da contribuição de brancos (europeus), o que justifica esta semelhança em relação a este marcador (Fig. 07) (PINTO, 1993 e 1998). O alelo DYS19*14 apresenta-se com uma frequência superior a 60% na população de Santo Antônio do Guaporé e Porto Velho, similar a frequência encontrada por Carvalho et al. (2003). O alelo 13 e o mais freqüente em ameríndios conforme Wanderley-Santos, (2001) sendo portanto um bom marcador. Encontramos um percentual de 20% na amostra de Cujubim deste mesmo alelo 13. Tal fato nos permite inferir que a população de Cujubim apresenta informações indígenas dos antepassados para este marcador. Frequencia Alelica - DYS19 1,2000 1,0000 0,8000 0,6000 0,4000 Santo Antonio do Guapore Sao Miguel Cujubim PortoVelho Africanos Amerindio Europeu 0,2000 0, ALELOS Figura 07: Distribuição das frequências dos alelos referente ao marcador DYS19 de dados produzidos das populações do estado de Rondônia e dados de Africanos, Ameríndio e Europeu de Trovoada et al. (2001), Wanderley-Santos ( 2001) e Carvalho et al. (2003), respectivamente Marcador DYS390 Através da análise do marcador DYS390 observou-se que a população de Santo Antônio do Guaporé apresentou uma frequência de 33% do alelo DYS390*21 e 24 1 DYS19*14 - significa alelo 14 do marcador DYS19 54

55 Frequencia corroborando a frequência encontrada na população negra estudada por RODRIGUEZ - DELFIN et al. (1997) e PEREIRA, (2002), onde foi encontrado 69% e 72%, respectivamente do referido alelo. Entre as populações investigadas, a população de Santo Antônio do Guaporé é a que possui mais características fenotípicas afro-descendentes. O alelo DYS390*21 é 70% mais frequente entre povos Bantus em região africana. O alelo DYS390*24 foi o segundo alelo mais frequente encontrado em estudos populacionais do norte da África, da Europa, Portugal. Itália e Espanha (JIMENEZ et al. 2001; CARVALHO SILVA, 2001; MACEDO-SOUZA, 2003; PICOMEL et al. 2002; KAYSER et al e JIMENEZ, 2001 PONTES, 2007). As populações de Santo Antônio do Guaporé, São Miguel, Cujubim e Porto Velho apresentaram uma alta frequência do alelo DYS390*24 com 33%, 47%, 28% e 55% respectivamente. O alelo DYS390*24 apresentou-se com maior frequência nas populações de Portugal. Porto Velho, São Paulo, Belém e Rio de Janeiro. Tal condição não é similar a população africana que apresenta cerca de 10% do alelo 24. Na população de Porto Velho observou-se uma similaridade entre aquelas populações indicando uma miscigenação entre populações de africanos e ameríndios (Fig. 08). Nas populações de São Miguel e Porto Velho, o alelo DYS390*24 apresenta alta frequência quando comparadas com as amostras de Ameríndios e Europeus. Isto indica similaridade entre populações de Ameríndios e Europeus. (MACEDO-SOUZA, 2003; KAYSER et al. 2001, RODRIGUEZ - DELFIN et al. 1997) Frequencia Alelica - DYS390 0,7 0,6 0,5 0,4 0,3 0,2 Santo Antonio do Guapore Sao Miguel Cujubim PortoVelho Africanos Amerindio Europeu 0, Alelos Figura 08: Distribuição das frequências dos alelos referente ao marcador DYS390 de dados produzidos das populações do estado de Rondônia e dados de Africanos, Ameríndio e Europeu por Carvalho et al. (2003), Trovoada et al. (2001) e Wanderley-Santos (2001), respectivamente. 55

56 Frequencia Frequências Marcador DYS391 No marcador DYS391 observou-se que os alelos DYS391*10 e 11 são mais frequente, em todas as populações destacando-se que em ameríndios só existe praticamente o alelo 10. As populações de Santo Antônio do Guaporé, São Miguel e Cujubim apresentaram uma freqüência de 50% a 60%. Porto Velho apresentou uma frequência de 36% (Fig. 09). O alelo DYS391*11 apresentou-se com 53% na população de Porto Velho e uma oscilação entre 43% e 34% nas demais populações, com exceção da população de ameríndios. Frequencia Alélica - DYS ,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0, Alelos Santo Antonio do Guapore Sao Miguel Cujubim Porto Velho Africanos Amerindio Europeu Figura 09: Distribuição das frequências dos alelos referente ao marcador DYS391 de dados produzidos das populações do estado de Rondônia e dados de Africanos, Ameríndio e Europeu por Carvalho et al. (2003), Trovoada et al. (2001) e Wanderley-Santos (2001), respectivamente Marcador DYS393 A população de São Miguel apresentou uma alta frequência do alelo DYS393*12 diferenciando das demais populações. Observou-se aqui uma alta frequência do alelo 13 em todas as populações com exceção de São Miguel que pode ser explicado pelo baixo N amostral (Fig. 10) Frequencia Alelica - DYS393 0,8 0,7 0,6 0,5 0,4 0,3 0,2 Santo Antonio do Guapore Sao Miguel Cujubim Porto Velho Africanos Amerindio Europeu 0, Alelos Figura 10: Distribuição das frequências dos alelos referente ao marcador DYS393 de dados produzidos das populações do estado de Rondônia e dados de Africanos, Ameríndio e Europeu por Carvalho et al. (2003), Trovoada et al. (2001) e Wanderley-Santos (2001), respectivamente. 56

57 FREQUENCIA Comparação Uniparental Masculina com outras Populações Para este estudo populacional os dados aqui obtidos foram comparados com o banco de dados de frequências alélicas estudados por LECERF, et al.(2007); PONTES (2007); PALHA et al.(2007); GÓIS et al.(2008) e SILVA et al.(2006), em populações da África, Portugal. Belém, São Paulo, Rio de Janeiro, respectivamente Marcador DYS389I Quando comparados os dados genéticos obtidos com outras populações verificou-se que no marcador DYS389I (Fig. 11), o alelo 13 apresentou uma alta frequência em Porto Velho e Santo Antônio do Guaporé, frequência similar à encontrada em populações como Portugal. Belém e Rio de Janeiro. O alelo 12 apresentou alta frequência nas populações de Cujubim, esta frequência só é vista na população da China (BOFENG, 2008). FREQUENCIA ALELICA DO MARCADOR DYS389I 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0, ALELOS SANTO ANTONIO SAO MIGUEL CUJUBIM PORTO VELHO AFRICA PORTUGAL BELEM SAO PAULO RIO DE JANEIRO Figura 11: Distribuição das frequências dos alelos referente ao marcador DYS389I de dados produzidos das populações do estado de Rondônia e dados de Lecerf (2007), Pontes (2007), Palha et al. (2007), Góis (2008) e Silva et al. (2006) Marcador DYS392 Este marcador apresentou um poder discriminatório marcante em populações ameríndias e africanas. O alelo DYS392*11 indicou uma frequência de 90% para a população africana (Fig. 12), mostrando ser um bom marcador para esta população. Este mesmo alelo, além do alelo 13 apresentam-se com um percentual próximo a 50% nas populações de Portugal. Belém, São Paulo, Porto Velho e Santo Antônio do Guaporé. O alelo 14 foi mais frequente na amostra do Rio de Janeiro em comparação com as demais populações. 57

58 FREQUENCIA FREQUENCIA FREQUENCIA ALELICA DO MARCADOR DYS ,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0, ALELOS SANTO ANTONIO SAO MIGUEL CUJUBIM PORTO VELHO AFRICA PORTUGAL BELEM SAO PAULO RIO DE JANEIRO Figura 12: Distribuição das frequências dos alelos referente ao marcador DYS392 de dados produzidos das populações do estado de Rondônia e dados de Lecerf (2007), Pontes (2007), Palha et al.(2007), Góis (2008) e Silva, et al. (2006) Marcador DYS389II Em relação ao marcador DYS389II as populações de Santo Antonio do Guaporé e São Miguel apresentaram uma frequência semelhante as de Portugal e Belém no alelo DYS389II*29 (Fig. 13). O alelo 30 foi o mais frequente no Rio de Janeiro e na África. As demais populações apareceram com baixo percentual. O alelo 31 apresenta-se com uma freqüência semelhante entre a população africana e Santo Antônio do Guaporé. Cujubim se distingue das outras populações pela alta freqüência dos alelos 10 e 27. FREQUENCIA ALELICA DO MARCADOR DYS389II 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0, ALELOS SANTO ANTONIO SAO MIGUEL CUJUBIM PORTO VELHO AFRICA PORTUGAL BELEM SAO PAULO RIO DE JANEIRO Figura 13: Distribuição das frequências dos alelos referente ao marcador DYS389II de dados produzidos das populações do estado de Rondônia e dados de Lecerf (2007), Pontes (2007), Palha et al.(2007), Góis (2008) e Silva et al.(2006). 58

59 FREQUENCIA FREQUENCIA Marcador DYS390 No marcador DYS390 o alelo 24 se apresentou com maior frequência entre a populações de Porto Velho e Portugal conferindo uma contribuição alélica, seguido do Rio de Janeiro e de São Miguel. O alelo 21 é o mais frequente na África. Foi possível encontrar também uma frequência de 33% na comunidade de Santo Antônio do Guaporé, diferente das demais localidades em estudo (Fig. 14). FREQUENCIA ALELICA DO MARCADOR DYS390 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0, ALELOS SANTO ANTONIO SAO MIGUEL CUJUBIM PORTO VELHO AFRICA PORTUGAL BELEM SAO PAULO RIO DE JANEIRO Figura 14: Distribuição das frequências dos alelos referente ao marcador DYS390 de dados produzidos das populações do estado de Rondônia e dados de Lecerf, (2007), Pontes (2007), Palha et al.(2007), Góis (2008) e Silva et al. (2006) Marcador DYS393 Na análise do marcador DYS393 verificou-se que o alelo 12 foi o de maior frequência na população de São Miguel ficando com 68,4% (Fig. 15). Este alelo apresenta-se como o alelo mais frequente na China e o segundo mais frequente no Japão e em Portugal (BOFENG, 2006; MIZUNO, et al e PONTES, 2007). O alelo 13 apresentou-se com alta frequência em todas as populações com exceção de São Miguel. FRQUENCIA ALELICA DO MACADOR DYS393 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0, ALELOS SANTO ANTONIO SAO MIGUEL CUJUBIM PORTO VELHO AFRICA PORTUGAL BELEM SAO PAULO RIO DE JANEIRO Figura 15: Distribuição das frequências dos alelos referente ao marcador DYS393 de dados produzidos das populações do estado de Rondônia e dados de Lecerf (2007), Pontes (2007), Palha et al.(2007), Góis (2008) e Silva, et al. (2006). 59

60 FREQUENCIA Marcador DYS391 Os alelos DYS391*10 e DYS391*11 foram os mais frequentes nas populações estudadas com exceção do alelo DYS391*11 para a população africana que apresentou um percentual de 18% (Fig. 16). FREQUENCIA ALELICA DO MARCADOR DYS391 0,9 0,8 0,7 0,6 0,5 0,4 0,3 0,2 0, ALELOS SANTO ANTONIO SAO MIGUEL CUJUBIM PORTO VELHO AFRICA PORTUGAL BELEM SAO PAULO RIO DE JANEIRO Figura 16: Distribuição das frequências dos alelos referente ao marcador DYS391 de dados produzidos das populações do estado de Rondônia e dados de Lecerf (2007), Pontes (2007), Palha et al.(2007), Góis (2008) e Silva et al.(2006) Mediante o exposto, desenvolver um banco de dados das populações significa estabelecer uma estratificação étnica e geográfica das frequências de haplogrupos do cromossomo Y. Verifica-se, portanto, a diversidade genética de quatro (04) comunidades: Santo Antônio do Guaporé, Porto Velho, São Miguel e Cujubim, sendo a primeira, com características predominantemente quilombola e as três (03) últimas com características miscigenadas de povos oriundos de europeus, ameríndios e africanos (TEIXEIRA, 1996 e 2004). A hipótese de migração via Estreito de Bering indicou um dos possíveis caminhos que os nativos americanos teriam passado entre e anos. Após cruzarem o estreito de Bering nossos antepassados teriam descido pelo corredor denominado Alberta 2 (CRAWFORD, 1998). Outros modelos apontam a Mongólia no sul da Sibéria como a mais provável origem dos povos nativos da America (NEEL et al. 1994). 2 Passagens livres criadas no gelo, que em diferentes momentos climáticos se abria e fechava. Este fenômeno aconteceu entre e anos. Este fenômeno da natureza se abriu completamente no fim do último período glacial há anos 60

61 5.2 - Dendrogramas Os dendrogramas são representações gráficas de similaridade e dissimilaridade entre espécies e populações, cujas relações entre elas indicam afinidade filogenética de ancestralidade comum (AMORIM, 2002). As árvores são compostas por ramos e nós cuja função dos nós são os de indicar o momento da divergência entre espécies ou populações. Na intenção de observar a proximidade entre as populações foi confeccionado um dendrograma baseado em frequências alélicas dos STR-Y. As populações foram comparadas por meio do teste exato de Fisher para verificar a existência de diferenças significativas. O índice Fst consiste num parâmetro utilizado para se estimar a diversidade genética entre duas ou mais populações. Os cálculos foram realizados por meio do programa Genetix Version 4.05 (BELKHIR et al. 2009). A construção das árvores filogenéticas indicou a possibilidade de que dois alelos tomados ao acaso de duas populações sejam idênticos por origem comum. Os nós representam unidades taxonômicas e os galhos definem as relações entre essas unidades em termos de descendência e ancestralidade. Filogeneticamente a árvore abaixo mostra que São Miguel está mais próxima de Cujubim o que está de acordo com a distância geográfica entre as duas regiões que são consideradas ribeirinhas. Porto Velho está mais distante de São Miguel e Cujubim o que está de acordo com a história de migrações recente de populações provenientes das regiões sul e sudestes do pais. Por fim, Santo Antônio do Guaporé aparece num ramo separado caracterizando sua origem africana (Fig. 17). Figura 17: Dendrograma UPGMA, baseado nos dados de 16 STRs Y-específico relacionando as quatro populações ribeirinha do Estado do Rondônia. SM São Miguel, CJ Cujubim, PVH Porto Velho, AS Santo Antônio de Guaporé. O número 97 e 54 entre os nós corresponde aos valores de bootstrap. O método UPGMA é a mais simples construção de árvore filogenética a partir de dados de distância. Ele emprega um algorítmo sequencial de agrupamento, no qual as relações são identificadas em ordem de similaridade, desta forma a árvore é construída passo a passo (BUSO, 2005). 61

62 Ao se construir outros dendrogramas relacionando as quatro populações aqui analisadas com grupos populacionais de ameríndios, africanos e europeus a partir dos dados das frequências alélicas dos 16 marcadores Y-específicos, observou-se que as populações de Cujubim e Santo Antônio do Guaporé compartilharam o mesmo galho. São Miguel e Porto Velho apresentaram-se em ramos diferentes, porém próximos, enquanto que as populações originais estão mais distantes (Fig. 18). Esta organização pode ser explicada pela proximidade geográfica e pela origem semelhante entre elas. Figura 18: Dendrograma UPGMA, baseado nos dados de 16 STRs (Carvalho et al. 2003; Trovoada et al. 2001; Wanderley-Santos, 2001) ligados ao cromossomo Y relacionando as quatro populações ribeirinha do Estado de Rondônia com populações ancestrais (européia, africana e ameríndia). Os números entre os nós correspondem aos valores de bootstrap. Com o objetivo de comparar os resultados aqui obtidos com resultados de banco de dados populacionais optou-se em utilizar dados de frequência alélica de Belém, Portugal. São Paulo, Japão, Guine Bissau, China, Bantus e Rio de Janeiro. A escolha da população Bantu nas análises 62

63 filogenéticas deste estudo justifica-se pelo fato desta população indicar padrões históricos e genéticos quanto à sua ligação parental mais próxima de escravos brasileiros (HAMMER., 1997, RODRIGUES-DEFIN et al. 1997) (Fig. 19). A proximidade entre as populações de São Miguel, Cujubim, Porto Velho e Santo Antônio do Guaporé pode ser explicada pelo processo histórico de formação e pela facilidade de intercâmbio por meio dos rios Guaporé e Madeira visto que todas as populações vivem na margem dos rios. O processo histórico de migração se dava também pelos rios da Região Amazônica (RIBEIRO, 1995; PINTO, 1993). A presença de dados genéticos da Espanha, na confecção da árvore, se deve ao fato de Rondônia fazer fronteira com a Bolívia e o Acre, que durante muito tempo estiveram sob domínio espanhol indicando assim uma possível migração dessas áreas (Bolívia e Acre) para a contribuição genética destas populações em detrimento da contribuição de Portugal. Figura 19: Dendrograma UPGMA, baseado nos dados de 16 STRs do cromossomo Y relacionando dados do presente estudo e dados segundo Rosa (2006), Silva et al.(2006), Pontes (2007), Sánchez et al. (2007), Palha et al.(2007), Lecerf (2007); Mizuno et al. (2008); Góis (2008) e Lima (2009). Os números entre os nós correspondem aos valores de bootstrap. Em Belém, a composição alelica encontrada em 105 homens apenas 3,8% eram de origem ameríndia, demonstrando uma baixa contribuição genética ameríndia masculina. No entanto, a contribuição ameríndia materna (DNAmt) foi estimada em cerca de 50% demonstrando um 63

64 percentagem maior que nos homens (BATISTA DOS SANTOS, et al. 1999). Este padrão de distribuição alélica assemelha-se ao estudo de Alves-Silva et al. (2000) onde se verificou alta contribuição ameríndia (33%) e africana (28%). Tais resultados nos permitem inferir sobre a existência de casamentos entre homens de origem européia e mulheres de origem ameríndias e africanas, o que justificaria a alta frequência de alelos da Europa nas populações masculinas brasileiras. As populações de Porto velho, Barcelona (Espanha), Santo Antônio do Guaporé, Cujubim e São Miguel apresentaram-se num mesmo galho e Portugal num galho diferente, mas próximo ao conjunto daquelas populações, mostrando uma proximidade genética entre elas. Esta disposição nos possibilita inferir ancestralidade comum entre elas Análise e Contribuição Étnica a partir de Haplótipo Foi realizada por meio do banco de dados eletrônico na página (KAYSE et al. 2002) a verificação da origem dos haplótipos em relação a população mundial. Primeiramente foram considerados os haplótipos estendidos iguais, na falta de haplótipos comuns, diminuiu-se a inserção dos alelos o que resultou em um pequenos numero de haplótipos únicos. A contribuição européia, africana, ameríndia e outro, pode ser observada na tabela 01. Quando analisamos por comparação os haplótipos mais comuns observamos que a contribuição parental européia e africana foi mais expressiva que a ameríndia em todas as populações. O percentual de contribuição européia nas quatro populações mostrou-se bastante presente, principalemente em Porto Velho (85%), Cujubim (71%) e São Miguel (83%). Santo Antônio do Guaporé embora seja de origem quilombola observou-se cerca de 50% de origem europeia. Este valor pode ser explicado por meio da origem histórica já que os senhores de escravos se relacionavam com as negras, mas nem sempre reconheciam as crianças como seus filhos. Outra questão, que deve ser levada em conta, na grande contribuição européia em nossas populações, podem ser explicados pelo processo histórico de colonização ao longo do rio Madeira e do Guaporé pelos portugueses a partir da construção do Real Forte Príncipe da Beira no século XVII (TEIXEIRA, 2004, PINTO, 1993, 1998). Como era esperado encontrou-se uma frequencia relaticamente alta de 49,946% de contribuição haplotípica de africanos em Santo Antônio do Guaporé. Deve-se destacar que Cujubim e Santo Antônio do Guaporé apresentaram uma contribuição muito pequena de amerindios (Tab. 01). Verificando a homogeneidade das populações observou-se que quando entravam as quatro populações o valor do qui-quadarado era altamente singnificante p 0,

65 Quando se retirou Santo Antônio Guaporé da analise e se fez apenas com as tres outras populações o qui quadrado passou a ser não significante com o valor de p 0,2976, mostrando assim que a população de Santo Antônio do Guaporé e diferente das demais. As demais populações apresentaram um baixo percentual de contribuição amerindia (Tab. 01). Tabela 01: Contribuição em percentuais de haplótipos Europeus, Africanos e Ameríndios em relação às populações do presente estudo Populações do Presente Estudo Europeus % Africano % Ameríndio % Outros % Não Identificados % Porto Velho 84,930 7,930 0,490 1,730 4,920 Cujubim 70,506 5,925 0,064 5,879 17,626 São Miguel 83,080 16,686 0,208 0, Santo Antônio do Guaporé 49,969 49,946 0,079 0, Fonte: Dados produzidos a partir da identificação dos haplotipos Em geral. as contribuições ameríndias e européias são sub-estimadas em relação a contribuição africana, principalmente na Região Norte e Nordeste do pais. Talvez este fato se deva à grande proporção de indivíduos pardos presentes no Brasil (RIBEIRO, 1995). Para uma melhor visualização são apresentados os resultados obtidos através de gráficos de pizzas de todas as população estudadas (Fig. 20, 21, 22 e 23). Figura 20: Percentual de contribuição haplotípica paterna em relação à amostra de Porto Velho. 65

66 Figura 21: Percentual de contribuição haplotípica paterna em relação à amostra de Cujubim. Figura 22: Percentual de contribuição haplotípica paterna em relação à amostra de São Miguel. 66

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

Diversidade Genética das Populações Amazônicas

Diversidade Genética das Populações Amazônicas PAINEL I Particularidades genéticas das populações amazônicas e suas possíveis implicações Coordenação de Mesa: Wim Degrave. Diversidade Genética das Populações Amazônicas Sidney dos Santos Será apresentado

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

GENÉTICA FORENSE E PATERNIDADE

GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

Tudo começou em África

Tudo começou em África Tudo começou em África (Expresso: 25-04-1998) Análises do D A confirmam a origem africana da espécie humana, uma ideia já defendida no século passado por Charles Darwin e Thomas Henry. A nossa árvore genealógica

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Métodos Estatísticos para análise. de Y-STRs. em Genética Forense

Métodos Estatísticos para análise. de Y-STRs. em Genética Forense UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE ESTATÍSTICA E INVESTIGAÇÃO OPERACIONAL Métodos Estatísticos para análise de Y-STRs em Genética Forense Cláudia Isabel Vieira da Silva Mestrado

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

Genômica. O que chamou mais atenção no filme?

Genômica. O que chamou mais atenção no filme? Genômica O que chamou mais atenção no filme? Tempo para sequenciamento do genoma Predição do fenótipo com base no genótipo Como este conhecimento pode ser usado para gerar novas tecnologias? Sequenciamento

Leia mais

36a43-134-pesquisa-perfilgen 30/3/07 7:58 PM Page 36 > CAPA

36a43-134-pesquisa-perfilgen 30/3/07 7:58 PM Page 36 > CAPA > CAPA GENÉTICA A Africa nos genes do povo brasileiro Análise de DNA revela regiões que mais alimentaram o tráfico de escravos para o país RICARDO ZORZETTO * Durante pouco mais de três séculos de tráfico

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Avaliação molecular da macho-esterilidade citoplasmática em milho

Avaliação molecular da macho-esterilidade citoplasmática em milho Jornal Eletrônico da Embrapa Milho e Sorgo (Sete Lagoas-MG) Ano 04 - Edição 26 - Agosto / Setembro de 2010 Artigo Avaliação molecular da macho-esterilidade citoplasmática em milho por Sílvia Neto Jardim

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Análise Genética da Cannabis sativa

Análise Genética da Cannabis sativa Análise Genética da Cannabis sativa Rodrigo Soares de Moura-Neto Professor Associado Instituto de Biologia/UFRJ 02/09/2014 rodrigomouraneto@ufrj.br Perspectiva Histórica da Tipagem por DNA SNPs 2014 STR

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Nova genética desestabiliza idéia de raça e coloca dilemas políticos

Nova genética desestabiliza idéia de raça e coloca dilemas políticos Nova genética desestabiliza idéia de raça e coloca dilemas políticos Por Carol Cantarino No final de 2005, o site Edge perguntou a 100 cientistas e filósofos do mundo todo: Qual a idéia mais perigosa presente

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade HOME O laboratório Sabin, desde 2002, emprega a biologia molecular no estudo do DNA. Essa tecnologia é conhecida pela alta qualidade nos procedimentos adotados que asseguram os resultados dos exames oferecidos.

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Embrapa Amazônia Oriental Belém, PA 2015 DIVERGÊNCIA GENÉTICA ENTRE MATRIZES DE

Leia mais

Hereditariedade. Leis da hereditariedade GENÉTICA

Hereditariedade. Leis da hereditariedade GENÉTICA Hereditariedade Definição: É a transferência de informações sobre as características próprias de um ser vivo para outro, de geração para geração, por meio dos gametas ou por transferência direta deácidos

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 17 MITOCÔNDRIAS E RESPIRAÇÃO CELULAR

BIOLOGIA - 1 o ANO MÓDULO 17 MITOCÔNDRIAS E RESPIRAÇÃO CELULAR BIOLOGIA - 1 o ANO MÓDULO 17 MITOCÔNDRIAS E RESPIRAÇÃO CELULAR Retículo endoplasmático Invólucro nuclear Núcleo Mitocôndria Procarionte fotossintético Cloroplasto Procarionte ancestral Eucariote ancestral

Leia mais

Biologia: Genética e Mendel

Biologia: Genética e Mendel Biologia: Genética e Mendel Questão 1 A complexa organização social das formigas pode ser explicada pelas relações de parentesco genético entre os indivíduos da colônia. É geneticamente mais vantajoso

Leia mais

É o estudo do processo de produção, distribuição, circulação e consumo dos bens e serviços (riqueza).

É o estudo do processo de produção, distribuição, circulação e consumo dos bens e serviços (riqueza). GEOGRAFIA 7ª Série/Turma 75 Ensino Fundamental Prof. José Gusmão Nome: MATERIAL DE ESTUDOS PARA O EXAME FINAL A GEOGRAFIA DO MUNDO SUBDESENVOLVIDO A diferença entre os países que mais chama a atenção é

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Expedição 1. 7º ANO_ PROFª BRUNA ANDRADE

Expedição 1. 7º ANO_ PROFª BRUNA ANDRADE Expedição 1. 7º ANO_ PROFª BRUNA ANDRADE O Brasil é considerado um país de dimensões CONTINENTAIS, pois sua área de 8.514.876 Km² é quase igual a do Continente Oceânico. Ele é o 5º país em extensão territorial

Leia mais

LUIZ FERNANDO JOBIM LUÍS RENATO DA SILVEIRA COSTA MOACYR DA SILVA

LUIZ FERNANDO JOBIM LUÍS RENATO DA SILVEIRA COSTA MOACYR DA SILVA LUIZ FERNANDO JOBIM LUÍS RENATO DA SILVEIRA COSTA MOACYR DA SILVA IDENTIFICAÇÃO HUMANA Identificação pelo DNA - Identificação Médico-Legal - Perícias Odontológicas VOLUME II Editora Millennium CAMPINAS/SP

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Teoria da EVA mitocondrial e a utilização do DNA mitocondrial em estudos genéticos

Teoria da EVA mitocondrial e a utilização do DNA mitocondrial em estudos genéticos Teoria da EVA mitocondrial e a utilização do DNA mitocondrial em estudos genéticos 1. Diferentes tipos celulares Estudos de microscopia eletrônica demonstraram que existem fundamentalmente duas classes

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Estado da motorização individual no Brasil Relatório 2015. Coordenação: Juciano Martins Rodrigues. Observatório das Metrópoles

Estado da motorização individual no Brasil Relatório 2015. Coordenação: Juciano Martins Rodrigues. Observatório das Metrópoles Estado da motorização individual no Brasil Relatório 2015 Estado da motorização individual no Brasil Relatório 2015 Coordenação: Juciano Martins Rodrigues Observatório das Metrópoles Luiz Cesar de Queiroz

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

Introdução a genética de populações e a origem da variação genética. Aula 1

Introdução a genética de populações e a origem da variação genética. Aula 1 Introdução a genética de populações e a origem da variação genética Aula 1 O Escopo da Genética de populações! Genética mendeliana! A transmissão da informação da informação genética está sujeita as leis

Leia mais

das espécies Chegamos à aula 50! Durante as aulas do Os trabalhos de Charles Darwin

das espécies Chegamos à aula 50! Durante as aulas do Os trabalhos de Charles Darwin A evolução das espécies A UU L AL A Chegamos à aula! Durante as aulas do telecurso, você viu vários temas relacionados com a Biologia: genética, botânica, zoologia, fisiologia, ecologia entre outros. Finalizaremos

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

A COR NEGRA NO MERCADO DE TRABALHO UM ESTUDO COM ALUNOS NEGROS EGRESSOS DO CEFET-CUIABÁ PAULA,

A COR NEGRA NO MERCADO DE TRABALHO UM ESTUDO COM ALUNOS NEGROS EGRESSOS DO CEFET-CUIABÁ PAULA, A COR NEGRA NO MERCADO DE TRABALHO UM ESTUDO COM ALUNOS NEGROS EGRESSOS DO CEFET-CUIABÁ. PAULA, Willian Silva de. UFMT CEFET-Cbá - willdepaula@yahoo.com.br Orientadora: Profª Drª Maria Lúcia R. Muller

Leia mais

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA OS FUNDAMENTOS DA HEREDITARIEDADE EXPERIMENTO Teste de paternidade 1. Resumo Essa aula propõe a simulação de um teste de paternidade por meio da análise de

Leia mais

16.02. A recombinação genética ocorre em todos os pares de cromossomos das células humanas que estão em meiose.

16.02. A recombinação genética ocorre em todos os pares de cromossomos das células humanas que estão em meiose. BIO 6E aula 16 16.01. A pleiotropia ocorre quando um gene influencia mais de uma característica. Em genes que estão localizados no mesmo par de cromossomos porém distante um do outro, a maioria dos gametas

Leia mais

CADERNO DE ATIVIDADES. História

CADERNO DE ATIVIDADES. História COLÉGIO ARNALDO 2015 CADERNO DE ATIVIDADES História Aluno (a): 4º ano: Turma: Professor (a): Valor: 20 pontos Conteúdo de Recuperação O que é História. Identificar a História como ciência. Reconhecer que

Leia mais

COMISSÃO PERMANENTE DE SELEÇÃO COPESE PRÓ-REITORIA DE GRADUAÇÃO PROGRAD VESTIBULAR 2011 PROVA DE BIOLOGIA

COMISSÃO PERMANENTE DE SELEÇÃO COPESE PRÓ-REITORIA DE GRADUAÇÃO PROGRAD VESTIBULAR 2011 PROVA DE BIOLOGIA Questão 1: É sabido que indivíduos homozigotos recessivos para alelos mutados do gene codificador da enzima hexosaminidase desenvolvem uma doença conhecida como Tay-Sachs, e morrem antes do quarto ano

Leia mais

GENÉTICA DA POPULAÇÃO DO ESTADO DE SÃO PAULO: ANÁLISE DE SNPS DO CROMOSSOMA Y

GENÉTICA DA POPULAÇÃO DO ESTADO DE SÃO PAULO: ANÁLISE DE SNPS DO CROMOSSOMA Y GENÉTICA DA POPULAÇÃO DO ESTADO DE SÃO PAULO: ANÁLISE DE SNPS DO CROMOSSOMA Y MARTA PEDROSO MENDES SÃO BENTO GENÉTICA DA POPULAÇÃO DO ESTADO DE SÃO PAULO: ANÁLISE DE SNPS DO CROMOSSOMA Y Dissertação de

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

Seleção de Temas. Questionário - Proficiência Clínica. Área: Imunologia Rodada: Julho/2008. Prezado Participante,

Seleção de Temas. Questionário - Proficiência Clínica. Área: Imunologia Rodada: Julho/2008. Prezado Participante, Seleção de Temas Prezado Participante, Gostaríamos de contar com a sua contribuição para a elaboração dos próximos materiais educativos. Cada questionário desenvolve um assunto (temas) específico dentro

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Epigenética e Memória Celular

Epigenética e Memória Celular Epigenética e Memória Celular Por Marcelo Fantappié Fonte www.revistacarbono.com A epigenética é definida como modificações do genoma que são herdadas pelas próximas gerações, mas que não alteram a sequência

Leia mais

FORMAÇÃO DO TERRITÓRIO BRASILEIRO

FORMAÇÃO DO TERRITÓRIO BRASILEIRO FORMAÇÃO DO TERRITÓRIO BRASILEIRO É claro que o Brasil não brotou do chão como uma planta. O Solo que o Brasil hoje ocupa já existia, o que não existia era o seu território, a porção do espaço sob domínio,

Leia mais

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Biologia Princípios Básicos de Genética A genética é a parte da biologia que trata do estudo dos genes e de suas manifestações,

Leia mais

IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis

IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis IMPLANTAÇÃO DA TÉCNICA DE MIRU (MYCOBACTERIAL INTERSPERSED REPETITIVE UNITS) PARA CARACTERIZAR MOLECULARMENTE Mycobacterium tuberculosis Natália Sanches Xavier (PIBIC/CNPq-FA-UEM), Rosilene Fressatti Cardoso

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

RENDA, POBREZA E DESIGUALDADE NOTA CONJUNTURAL JANEIRO DE 2014 Nº28

RENDA, POBREZA E DESIGUALDADE NOTA CONJUNTURAL JANEIRO DE 2014 Nº28 RENDA, POBREZA E DESIGUALDADE NOTA CONJUNTURAL JANEIRO DE 2014 Nº28 no Estado do Rio de Janeiro NOTA CONJUNTURAL JANEIRO DE 2014 Nº28 PANORAMA GERAL Na última década, o Brasil passou por profundas mudanças

Leia mais

Introdução à genética quantitativa usando os recursos do R

Introdução à genética quantitativa usando os recursos do R Introdução à genética quantitativa usando os recursos do R Marisa R. Cantarino 1 Julia M. P. Soler (orientadora) 2 1 Introdução Um dos principais desafios da pesquisa genética atualmente é estabelecer

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Importância do rigor técnico-científico dos exames de DNA Relato de casos

Importância do rigor técnico-científico dos exames de DNA Relato de casos Importância do rigor técnico-científico dos exames de DNA Relato de casos Autora: Cristiane Lommez de Oliveira Bióloga. Mestre em Bioquímica e Imunologia pela UFMG. Atua desde 1992 nas áreas de Biologia

Leia mais

DNA profiling parte 2

DNA profiling parte 2 Faculdade Milton Campos Curso Lato Sensu em Medicina Legal Disciplina: Bioinformática e Investigação Criminal Professor: Eduardo Campos dos Santos DNA profiling parte 2 Belo Horizonte Outubro/Novembro

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

MATERIAL DE DIVULGAÇÃO DA EDITORA MODERNA

MATERIAL DE DIVULGAÇÃO DA EDITORA MODERNA MATERIAL DE DIVULGAÇÃO DA EDITORA MODERNA Professor, nós, da Editora Moderna, temos como propósito uma educação de qualidade, que respeita as particularidades de todo o país. Desta maneira, o apoio ao

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

d) 23, 46, 26. 23 d) DNA nucleotídeos desoxirribose uracila desoxirribose timina e) DNA ácidos desoxirribonucléicos

d) 23, 46, 26. 23 d) DNA nucleotídeos desoxirribose uracila desoxirribose timina e) DNA ácidos desoxirribonucléicos 01 - (IBMEC RJ) O núcleo celular foi descoberto pelo pesquisador escocês Robert Brown, que o reconheceu como componente fundamental das células. O nome escolhido para essa organela expressa bem essa ideia:

Leia mais

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA RAZÃO DE PROBABILIDADE BAYESIANA COMO EVIDÊNCIA PARA TESTE DE VÍNCULO DE PATERNIDADE Curitiba 2012 I Dianna Lo Wai Yan Maurício Fernandes do Nascimento

Leia mais

Universidade do Porto

Universidade do Porto Universidade do Porto Y-miniSTR: alternativa para a análise de amostras complicadas Estudo da população do Norte de Portugal Teresa Maria Vieira Martins (Licenciada) Dissertação para a obtenção do grau

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO

EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO EDUCAÇÃO NÃO-FORMAL PARA ALUNOS DO ENSINO MÉDIO: MODELO DIDÁTICO PARA COMPREENSÃO DO TESTE DE VÍNCULO GENÉTICO CUNHA, Marielton dos Passos 1 ; OLIVEIRA, Bruno Francesco Rodrigues de 1 ; RESENDE, Isa Murielly

Leia mais

DINÂMICA LOCAL INTERATIVA INTERATIVIDADE FINAL CONTEÚDO E HABILIDADES. AULA 3.2 Conteúdo: Formação Étnico-Cultural da População Brasileira

DINÂMICA LOCAL INTERATIVA INTERATIVIDADE FINAL CONTEÚDO E HABILIDADES. AULA 3.2 Conteúdo: Formação Étnico-Cultural da População Brasileira 3.2 Conteúdo: Formação Étnico-Cultural da População Brasileira 3.2 Habilidades: Verificar as características dos principais grupos étnicos formadores da população brasileira: indígenas, negros e brancos.

Leia mais

LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA

LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA LABORATÓRIO DE BIODIVERSIDADE MOLECULAR E CITOGENÉTICA O O uso uso deste deste material material é é autorizado autorizado desde desde que que sejam sejam atribuídos atribuídos os os direitos direitos

Leia mais