Marcadores de DNA para registro de animais e diagnóstico de maciez de carne

Tamanho: px
Começar a partir da página:

Download "Marcadores de DNA para registro de animais e diagnóstico de maciez de carne"

Transcrição

1 Marcadores de DNA para registro de animais e diagnóstico de maciez de carne Dario rattapaglia ENOMAX Tecnologia enômica Brasília

2 Tópicos Identificação animal baseada non DNA Tipagem no serviço de registro genealógico Tipagem sanguínea x DNA: vantagens e desafios Base genética e validação ISA de marcadores moleculares Aplicações do DNA no gerenciamento genético de rebanhos Testes de DNA para maciez de carne Mapeamento de QTL e mapeamento por associação Base genética e molecular Testes comercias existentes Validação de testes Como, quando e porque adotar testes de DNA no meu rebanho?

3 Serviço de registro genealógico A identificação animal na maior parte das Associações de Criadores adota variações da seguinte rotina: (1) Inseminação artificial ou monta: notificação à Associação da data inseminação/monta e da origem do sêmen pedido de registro RN à Associação comprovado c/ c/ documentação do touro e da vaca avaliação fenotípica do animal em idade adequada concessão do registro RD (PO ou PC) (2) Transferência de embrião notificação à Associação da data coleta de embrião e do cruzamento utilizado pedido de registro RN à Associação comprovado com documentação do touro e da vaca, acompanhado da descrição fenotípica da receptora avaliação fenotípica do animal em idade adequada concessão do registro RD (PO ou PC)

4 Tipagem no serviço de registro genealógico Legislação atual : tipagem para confirmação de parentesco é obrigatória para 100% dos reprodutores inscritos em centrais 100% dos animais de TE e FIV 3% por amostragem doa aniamais de monta natural 3% dos animais de inseminação artificial Algumas associações adotaram 10% a partir de 01/2003 (ex. ABCZ) Nova instrução normativa em fase final de aprovação no MAPA: 100% dos reprodutores inscritos em centrais 100% dos animais de TE e FIV10% % dos animais de inseminação artificial 5% dos animais de monta natural 100% dos animais nascidos de monta com reprodutores múltiplos A partir de 01/01/2006 as Associações deverão exigir o teste de paternidade, em todos os produtos registrados

5 Vantagens Tecnologia estabelecida e rotineira Atende á legislação vigente Bancos de dados existentes Custo barato Desafios Tecnologia rapidamente se tornando obsoleta no resto do mundo Animais importados não vem com tipagem sanguínea Baixa resolução em situações de parentesco Não fornece informações adicionais para gerenciamento genético Necessidade de produção de reagentes in vivo Exige sangue fresco Dificuldade de automação Não permite armazenamento de amostra em larga escala Laboratórios atuais não atendem à demanda crescente Tipagem sanguínea

6 ENOMA: Material genético total de uma célula ou indivíduo cromossomo célula gene DNA

7 Vantagens Tecnologia estabelecida e rotineira no resto do mundo Animais importados vem com DNA Alta resolução mesmo em situações de parentesco: permite qualificação por busca Fornece informações adicionais para gerenciamento genético Automatizável em larga escala Permite comparação eletrônica de perfis genéticos para teste de parentesco Utiliza qualquer amostra biológica (sêmen, pelos, sangue, swab nasal) Permite armazenamento de amostra em larga escala Atende à legislação brasileira vigente Desafios Elevado custo (caindo rapidamente e hoje competitivo com tipagem sanguínea) Necessidade de migração de bancos de dados (pacotes de backlog) Necessidade de instrução normativa e credenciamento de laboratórios (06/2004) Laboratórios atuais não atendem à demanda (vários em montagem) Tipagem do DNA

8 Unicidade : cada indivíduo tem um perfil de DNA único com exceção de gêmeos univitelinos ou clones de uma planta ou microorganismo Variabilidade: : apesar do fato de que a maior parte do genoma é muito conservada entre indivíduos, algumas regiões genômicas específicas são altamente variáveis permitindo uma discriminação altamente precisa, quantificável e reproduzível Immutabilidade : ou melhor, mutabilidade extremamente baixa (da ordem de a /geração; o DNA de um indivíduo é o mesmo em todas as células e este é estável ao longo de sua vida Marcadores de DNA: ferramenta poderosa para resolver questões de identificação individual e parentesco Estabilidade física : moléculas de DNA podem ser recuperadas, purificadas e analisadas de quase qualquer material biológico

9 Como funciona a identificação animal baseada na sequência de DNA? Cada animal possui uma sequência única e exclusiva de DNA Nenhum outro animal vivo (ou morto) possui a mesma sequência (exceção: gêmeos univitelinos,, clones) O DNA contém a informação genética básica responsável pelo desenvolvimento de um organismo Cada bezerro recebe, em cada loco do DNA, um gene do touro e um outro da vaca Alguns destes locos possuem formas gênicas (alelos) que não diferem entre os indivíduos da população No entanto, outros pontos do DNA possuem grande variação, isto é, é, as formas gênicas neles observados são altamente variáveis na população É raro encontrar outro animal com a mesma sequência naquele ponto do DNA. Estes locos são chamados de hipervariáveis.

10 Esquema resumido da determinação de perfil de DNA com base em marcadores microssatélites amostra biológica PCR - amplificação do DNA em locos específicos DNA célula Determinação dos genótipos dos indivíduos através de eletroforese e detecção a laser semiautomatizada em sequenciador

11 Coleta de amostras de sangue em papel especial Papel especial para coleta de sangue para análise de DNA - CARTÃO DE COLETA ENOMAX Método simples, rápido e barato Pode ser realizado por qualquer pessoa, na fazenda mesmo Não requer refrigeração e transporte especial Kit de coleta é fornecido sem custos adicionais Permite um controle automatizado do processamento da amostra Permite armazenamento a longo prazo para contraprovas

12 Base genética de tipagem do DNA: marcadores microssatélites 5 5 Cromossomo 12 IIIIIIIIIIIIIIII...CACACACACA.....CACACACACA......TTTTT ALELO 5 IIIIIIIIIIIIIIII Cromossomo 12 IIIIIIIIIIIIIIII ALELO 7...CACACACACACACA.....TTTTTTT. IIIIIIIIIIIIIIII Cromossomo 12 IIIIIIIIIIIIIIII ALELO 7...CACACACACACACA.....TTTTTTT. IIIIIIIIIIIIIIII Cromossomo 12 IIIIIIIIIIIIIIII ALELO 7...CACACACACACACA.....TTTTTTT. IIIIIIIIIIIIIIII 5 5 Indivíduo HETEROZIOTO Loco 1 enótipo 5/7 Loco 1 Loco 2 Loco 3 Loco 4 Indivíduo HOMOZIOTO Loco 1 enótipo 7/7

13 Princípios básicos do teste de paternidade pelo DNA INCLUSÃO M C SP M C SP EXCLUSÃO O Suposto Pai (touro) possui o alelo paterno obrigatório O suposto Pai é incluído no grupo de indivíduos que poderiam ser o pai biológico do bezerro M C SP M C SP O Suposto Pai (touro) não possui o alelo paterno obrigatório O suposto Pai é excluído do grupo de indivíduos que poderiam ser o pai biológico do bezerro Cálculo de probabilidades Conclusão categórica

14 Análise automatizada de genótipos em teste de paternidade INCLUSÃO EXCLUSÃO Vaca Vaca Bezerra Bezerra Touro Touro Amelogenina - controle de sexo

15 9+2 marcadores microssatélites recomendados pela ISA (International Society of Animal enetics) para tipagem de bovinos LOCO TLA227 BM2113 TLA53 ETH10 SPS115 TLA126 TLA122 INRA23 ETH3 ETH225 BM1824

16 Banco de dados de frequências alélicas para raças bovinas para realização de cálculos estatísticos de identidade e vínculo 0.6 TLA Frequência NELORE SIMENTAL

17 Marcadores de DNA utilizados pela ENOMAX em exames de equinos e bovinos locos recomendados pela ISA ENOMAX membro institucional da ISA desde 2002 Participou com sucesso do exercício ISA de controle de qualidade de tipagem de bovinos, equinos,, caninos, ovinos e caprinos Validou um total de 15 marcadores bovinos Utiliza em rotina um sistema de 11 marcadores ISA + amelogenina Atualmente aguardando I.N. do MAPA para processo de credenciamento ainda 2004 Aliança estratégica com laboratório Hermes Pardini (abrangência e logística em todo o território nacional)

18 Exemplo de um laudo ENOMAX de exclusão (não qualificação) de paternidade pelo DNA

19 Exemplo de um laudo ENOMAX de inclusão (qualificação) de paternidade pelo DNA

20 Coleta e envio de amostras é muito simples e de baixo custo Marcadores abundantes e distribuídos dos pelo genoma Podem ser detectados via PCR (técnica requer pouco DNA) Altamente polimórficos,, alto poder de discriminação Permitem detectar, com máxima precisão, exclusões de paternidade mesmo em situações de parentesco próximo entre progenitores Permitem declarar paternidade com probabilidade acima de 99,999% de certeza Permitem estudos refinados de distância genética, parentesco e mapeamento genético de características importantes Custo acessível e plenamente competitivo com tipagem sanguínea Vantagens da d tipagem de DNA por microssatélites para determinação de identidade e vínculo genético

21 Aplicações de marcadores de DNA no registro e gerenciamento genético de rebanhos Registro de animais elite verificação de parentesco Determinação de paternidade em sistemas de cruzamento em campo (monta) com múltiplos touros ( multisire breeding ) Certificação e controle de qualidade de sêmens Estudos de distância genética para planejamento de cruzamentos Reconstrução de pedigrees e estimativas de parentesco Verificação de pedigrees de animais elite Suporte aos programas de melhoramento para estimativas precisas de valor de melhoramento de animais elite Rastreamento de animais e produtos até depois do abate

22 Análise de distância genética entre animais visando otimizar esquemas de cruzamentos Visualização via dendrograma

23 Implementação imediata de identificação animal baseado em DNA pela ABCRS 1. Animais de interesse, especialmente reprodutores em centrais, e doadoras seriam selecionados para tipagem 2. Coleta de amostras na propriedade, sob supervisão da Associação (pelos,, swab nasal, sangue em papel) 3. Busca ou envio pelo correio em envelopes lacrados para o laboratório de análise 4. Laudos via internet para o criador e Associação em 10 a 20 dias úteis 5. DNA permite a qualificação bem como busca de touros em banco 6. Construção de banco de dados de animais já tipados via sangue 7. Contratos de maior volume a preços competitivos com a tipagem sanguínea

24 Registro genealógico on line de animais na American Simmental Association ASA - EUA

25 enômica na medicina e agropecuária Característica /doença com componente genético monogênica x multifatorial ene mapeado mapas genéticos e físicos ene identificado sequência do genoma Humanos Prevenção Farmacogenômica Terapia gênica Diagnóstico Plantas e animais Seleção assistida Transformação

26 O genoma é como uma lista telefônica LISTA TELEFÔNICA Nomes de pessoas Sobrenomes comuns entre pessoas podem indicar relacionamento, função Endereço, bairro, vizinhança Profissão, função?? Interações com outras pessoas e redes de relacionamento?? SEQUÊNCIA DO ENOMA Nomes de genes Sequências comuns entre genes indicam relacionamento de função Local no genoma, vizinhanças etc. Função?? Interações com outros genes e cadeias metabólicas?? O RANDE DESAFIO PARA O PRÓXIMO SÉCULO É DESVENDAR A FUNÇÃO DOS ENES E SUAS INTERAÇÕES NA DEFINIÇÃO FINAL DA COMPLEXIDADE DO FUNCIONAMENTO DO ORANISMO

27 Teste de DNA para características qualitativas Heranças geneticamente simples Alelos de grande efeito Pouca ou nenhuma influência ambiental Mutações conhecidas e de fácil detecção Tipicamente de baixo impacto econômico Determinação de sexo Cor de pelagem Musculatura dupla - miostatina Chifres Algumas doenças genéticas mendelianas

28

29 Características quantitativas - multifatoriais Características de maior importância econômica Produtividade - carcassa Fertilidade e eficiência reprodutiva Qualidade (maciez, marmoreio etc.) Resistência a doenças Crescimento Produtividade de leite Heranças geneticamente complexas baixa herdabilidade Alelos de pequeno efeito e penetrância variável enes desconhecidos e de difícil detecção Ampla influência ambiental e interação genótipo x ambiente Expressão tardia (ex. mensuração somente em carcassa)

30 CARACTERÍSTICAS QUANTITATIVAS: de fenótipos a genes via mapeamento genético de QTLs e associação com genes candidatos Marcadores e genes mapeados ESTs mapeados ene A Promotor QTL MAPEADOS 5 UTR Codante 3 UTR enes candidatos Simental 2 Simental 1 Nelore 2 Nelore 1 Angus 2 Angus 1 Jersey 2 Jersey 1 MENSURAÇÃO DE FENÓTIPOS Peso Maciez Fertilidade Resistência Mapa genético de marcadores microssatélites Mapa físico de grandes pedaços de DNA (clones de BAC) ancorado no mapa genético Mapa de diversidade alélica (SNPs) funcional intra e interespecífica aos genes candidatos de interesse

31 Mapeamento de genes de interesse em pedigrees estruturados para seleção assistida As duas pistas na esquerda no gel são os dois genitores, seguidos de 46 indivíduos F1. Os dois marcadores nos dois painéis is são totalmente informativos segregando 1:1:1:1 para A1A3:A1A4:A2A3:A2A4. EMBRA QTL EMBRA173 EMBRA51 EMBRA27 EMBRA120 EMBRA358 EMBRA347 EMBRA320 EMBRA288 EMBRA126 EMBRA48 EMBRA56 EMBRA387 EMBRA324 EMBRA69 EMBRA282 EMBRA36 EMBRA403 rupo 1

32 De QTL a gene: desafio da clonagem posicional Informação de QTL é útil para o melhoramento (teste de marcadores ligados) porém não permite a identificação precisa dos genes responsáveis O intervalo de confiança no qual o QTL é mapeado tipicamente envolve dezenas de centimorgans,, i.e, dezenas ou centenas de genes LOD score > 3.0 Posição mais provável do QTL intervalo de 5 % de recombinação 5 cm em Bos pode corresponder a entre 1 e 10 milhões de pares de bases DNA, centenas de genes

33 Desafios no mapeamento de QTLs DETECÇÃO DE QTL Proporção da variância explicada pelo QTL: quanto maior a variância mais fácil a detecção Correlação entre marcador e o loco funcional: depende da extensão do desequilibrio de ligação (DL), quanto maior melhor a detecção Correção para múltiplos testes de hipóteses: quanto maior a estringência estatística menor o poder e maior a amostra LOCALIZAÇÃO DO QTL Alta correlação marcador-gene = alto DL, bom para detecção mas ruim para localização Baixa correlação marcador-gene = baixo DL, ruim para detecção mas bom para localização precisa e potencialmente clonagem do gene

34 Comparação de resolução e tempo necessário de diferentes abordagens para dissecar a variação quantitativa Mapeamento de associação Mapeamento de QTL

35 Desequilíbrio de ligação ASSOCIAÇÃO 1 2 Equilíbrio de ligação NÃO ASSOCIAÇAO 1 2 marcador 1 Marcador 1 Marcador D =1 Marcador D =0 Rafalski, 2001 Current Op. Pl. Biology

36 Mapeamento de associação para maciez de carne Animais com alto WBS Animais com baixo WBS

37 Mapeamento de associação Ocorrência de desequilíbrio de ligação entre um marcador SNP e um QTN (Quantitative Trait Nucleotide). A extensão do DL no genoma que permite a detecção de associações depende de diversos fatores incluíndo: a a história genética da população a frequência de recombinação no segmento genômico analisado SNP SNP A A A A A A A A A A 9 0 QTN T T T T T T T QTN p=0, T 0 7 DESEQUILÍBRIO DE LIAÇÃO SNP SNP A A A A A A A A A A 5 2 QTN T T T T T T T T T QTN p=0,3575 T 4 5 EQUILÍBRIO DE LIAÇÃO

38 Recombinação reduz o desequilíbrio de ligação ALTO DL BAIXO DL enitores tempo Descendentes Haplótipos ancestrais conservados são reduzidos em tamanho pela recombinação

39 Mapeamento de associação VANTAENS Permite Permite o estabelecimento de relações diretas entre a variabilidade de sequência destes genes e a variabilidade fenotípica SNPs são mais frequentes do que SSR e permitem análises a distâncias mais curtas Permite a análise direta de bancos de germoplasma e coleções de animais elite sem necessidade de populações segregantes DESAFIOS Definição de quais genes candidatos devem ser analisados Desconhecimento da extensão do desequilíbrio de ligação em Bos (espécie e/ou população específica) Seleção de populações adequadas para análise Caracterização fenotípica detalhada

40 Desafio: : seleção de genes candidatos Conhecimento de função pelo papel bioquímico de enzimas Inferência de função com base em similaridades em bancos de dados Existência de mutantes em animais modelo com fenótipo relacionado Expressão diferencial do gene entre fenótipos contrastantes Análise de expressão diferencial em nível de proteína ABORDAEM ENÉTICA: co-localização do gene com QTLs mapeados para características Isenta de premissas Baseada em modelo mendeliano Parte de caracterização fenotípica

41 SNPs Single Nucleotide Polymorphisms Polimorfismos de nucleotídeo único SNP: uma posição de base na qual dois nucleotídeos alternativos ocorrem a uma frequência significativa (>1%) na população SNP individualidade genética Nos torna mais ou menos susceptíveis a doenças Podem influenciar o efeito de fármacos TTTTACATC ATC TTTTACTATC ATC Exemplo: TTT TAC C C ATC TTT TAC TC C ATC Phe Tyr Asn Met Phe Tyr Ser Met NORMAL ASSOCIADO COM COLESTEROL ELEVADO

42 SNPs single nucleotide polymorphisms (polimorfismos de nucleotídeo único) Associado com diferença fenotípica?? Animal 1 Animal 2 Animal 3 Animal 4 Animal 5 Animal 6

43 Exemplo clássico em humanos: SNPs para anemia falciforme Detecção via corte com enzima e hibridização de sonda Hemoglobina alterada Mutação bem caracterizada de A para T Detectada com digestão por MstII Enzima reconhece sítio CCTNA Mutação elimina sítio de restrição Normal Anemia falciforme

44 Exemplo clássico em bovinos: gene DAT para gordura no leite Fenótipo QTL gene candidato confirmação funcional da mutação MAPEAMENTO DE QTL CLONAEM POSICIONAL ASSOCIAÇÃO DA MUTAÇÃO COM TEOR DE ORDURA CONFIRMAÇÃO BIOQUÍMICA FUNCIONAL DA MUTAÇÃO Lisina-Alanina posição 232

45 Detecção de SNPs em heterozigose enotipagem Segregação Mapeamento Output:

46 Mãe Detecção de SNPs em heterozigose Pai X A A 1 : 1 A A Filho 1 Filho 2

47 ENOTIPAEM DE SNPs DE TOURO HETEROZIOTO ALELO 1 AACCCTA ALELO 2 AACCTA ½ AACCCTA ½ AACCTA MACIEZ aumentada MACIEZ reduzida

48 Testes de DNA comerciais nos EUA para características quantitativas em gado de corte 1. enestar Marbling Marmoreio - gene da tiroglobulina enetic Solutions/Bovigen 2. enestar Tenderness Maciez - Mutação no gene da calpastatina enetic Solutions/Bovigen 3. enestar Tenderness 2 Maciez - Uma mutação no gene da calpastatina e uma no gene da calpaina enetic Solutions/Bovigen 4. TenderENE Maciez - Maciez Duas mutações no gene da calpaina Frontier Beef Systems/eneSeek 5. IENITY L Marmoreio e apetite - gene do hormônio leptina Merial/Quantum enetics 6. MMI Mu-Calpain Tender - Maciez - Mutações no gene da calpaina Metamorphix Inc. enomics

49 Alelo 2 Teste para MARMOREIO mutações na região 5 UTR do gene TIROLOBULINA duas mutações (SNP) que definem alelos AACTTCCTCTCCTTTTTTTCTACTCCTACAAAAAATACTACATATACTTCTTTTTCTTATCTCATCAA AATCTCTACATTCTTTTAATATCTCCTTTTTTTCCCTCCATATCCTCATCCTAAATATTCTCTTCTCTATCAACTCTAAAAAACATT CTAAAAAAACATATAAAACATTTTTTCTCTCACTCCTAACTTCCCACCAATTTTAACTTT CCTTTACCCCTAAATAATTATAACCACACCCCCATTCTTCCTTTCTCAATTCAAAATCCACCTCAATCAACCTTTT ATCCCTTTAAATCCCCTAAAAATCTACCCACTCCATATTCTCCTAAATCCCATACAAACCTCATC ATCCATTCTCAAATCAATTACTACACTTTCACACACATTCTCCCTTTCTCTCCCCTACACCTCCACAAATTTTCACCCCA CACTCCACATATTCCTCCAAACAACCATAACCTCCTTTACCACAAAAAACATCACTCTTCCCTATC CTTTCTAATACCCACACATCTATAAACTCCTTCCAACCCTAATCACACTTCTAACCCTTCTCCCTAACT CCCAAATCCCTCCCTATTCTTCTCTCTACTTAATCTCTTCATCCCCAACATCTTTTAATTCTACCCTCTCTCAA CATCTTAACCTCTACCAACTCCTTTTACCAACCTCCCCACCATAACATTTTACCTCATTTAATCCTCATTCCC ATCATTATCACTCTTTCCTTTTCAATAAAACAATCTAAATCACAATCATATC Alelo 3 AACTTCCTCTCCTTTTTTTCTACTCCTACAAAAAATACTACATATACTTCTTTTTCTTATCTCATCAA AATCTCTACATTCTTTTAATATCTCCTTTTTTTCCCTCCATATCCTCATCCTAAATATTCTCTTCTCTATCAACTCTAAAAAACATT CTAAAAAAACATATAAAACATTTTTTCTCTCACTCCTAACTTCCCACCAATTTTAACTTT CCTTTACCCCTAAATAATTATAACCACACCCCCATTCTTCCTTTCTCAATTCAAAATCCACCTCAATCAACCTTTT ATCCCTTTAAATTCCCTAAAAATCTACCCACTCCATATTCTCCTAAATCCCATACAAACCTCATC ATCCATTCTCAAATCAATTACTACACTTTCACACACATTCTCCCTTTCTCTCCCCTACACCTCCACAAATTTTCACCCCA CACTCCACATATTCCTCCAAACAACCATAACCTCCTTTACCACAAAAAACATCACTCTTCCCTATC CTTTCTAATACCCACACATCTATAAACTCCTTCCAACCCTAATCACACTTCTAACCCTTCTCCCTAACT CCCAAATCCCTCCCTATTCTTCTCTCTACTTAATCTCTTCATCCCCAACATCTTTTAATTCTACCCTCTCTCAA CATCTTAACCTCTACCAACTCCTTTTACCAACCTCCCCACCATAACATTTTACCTCATTTAATCCTCATTCCC ATCATTATCACTCTTTCCTTTTCAATAAAACAATCTAAATCACAATCATATC Patente US 6,383,751 Assessing lipid metabolism 1997 Primeiro teste comercial para qualidade de carne (07/2000) O teste distingue alelos do gene Tiroglobulina, um hormônio envolvido na via metabólica de criação de células adiposas Associação demonstrada em Angus, Shorthorn e Wagyu Desenvolvido no CSIRO Australia

50 Teste para MARMOREIO Mutações na região 5 UTR do gene TIROLOBULINA Animais homozigotos 33 (2 star) apresentaram em média maior nota de marmoreio (4 e maior) do que animais homozigotos 22 (0 star) ou heterozigotos 23 (1-star)

51 Teste de DNA para MACIEZ DE CARNE: gene CAST CALPASTATINA enestar Tenderness: primeiro teste comercial para maciez de carne (Novembro de 2002) Desenvolvido pelo CSIRO - Australia Calpastatina é uma enzima que inibe o amaciamento post mortem da carne pela ação da enzima calpaina Se baseia na detecção de dois variantes alélicos no gene da calpastatina Animais homozigotos para o alelo favorável: 2 estrelas (2-star) Em um estudo da empresa que comercializa o teste, a diferença entre animais 0 star e 2 star foi de 1,34 Kg em WBS Muito pouca informação pública sobre o teste Os dois variantes alélicos detectados via amplificação de um segmento de 500pb e resolução via SSCP

52 TESTE DE DNA PARA MACIEZ DE CARNE: gene CAPN1 CALPAINA Fenótipo QTL gene candidato mutações associadas Ainda falta a confirmação funcional das mutações: mutações possivelmente em DL e não causais da diferença

53 Teste para o gene CAPN1 Calpaina Duas mutações com efeito aditivo Tender ENE (tambem( enestar Tenderness 2): segunda geração de teste comercial para maciez de carne (Setembro( de 2003) Desenvolvido pelo MARC - EUA Calpaina é uma enzima que estimula o amaciamento post mortem da carne Se baseia na detecção de dois variantes alélicos em dois codons no gene da calpaina Variantes não são funcionais mas apenas associados (desequilíbrio de ligação) Animais para o alelo favorável: 2 estrelas (2-star) em cada mutação Em um estudo da empresa que comercializa o teste, a diferença entre animais 0-star 0 e 2-star 2 foi de 1,34 Kg em WBS

54 Teste de DNA para o gene CAPN1 Calpaina Duas mutações com efeito aditivo códon 316 e códon 530 SNP SNP no códon 316 do exon 9 - C ou glicina(alelo ) x alanina(alelo C) alelo alelo C ((alanina) ) é o alelo favorável para maciez SNP SNP no códon 530 do 13 - A ou Isoleucina (alelo A) x valina(alelo ) Alelo Alelo (Valina) é o alelo favorável para maciez Animais podem ser de nove genótipos distintos (3 x 3) Animal superior é aquele duplo homozigoto CC na posição 316 e na posição 530

55 DNA para maciez: o mito Pedigree Progênie adaptado de Thallman M Fenótipos Testes de DNA Fenótipos Fenótipos Diferenças esperadas na progênie Avaliação fácil, rápida, precoce e altamente precisa do mérito genético Tem sido dito aos melhoristas e produtores, que os testes de DNA para maciez permitiriam avaliar a superioridade genética de um animal diretamente sem necessidade de pedigrees, testes de progênie, fenotipagem etc...

56 Uma visão realista do uso do DNA para maciez adaptado de Thallman M PEDIREE PROÊNIE Fenótipos Teste de DNA Fenótipos Teste de DNA Fenótipos Teste de DNA Avaliação nacional Diferenças observadas em progênies, ajustadas pela teste de DNA Avaliação mais precisa do mérito genético Neste cenário, fenótipos e resultados de testes de DNA dos indivíduos e parentes são combinados através de avaliações nacionais para produzir estimativas mais acuradas sobre as quais são tomadas as decisões de seleção

57 Questões pendentes com os testes para maciez de carne 1 Validações independentes dos testes de DNA ainda precárias QTL team do US National Beef Cattle Evaluation Consortium ainda não os considera validados pois somente utilizou dados e delineamentos das empresas (maio 2004) enes testados explicam apenas uma pequena porção da variância fenotípica na característica Muito pouca informação na literatura: questões de proteção intelectual ectual (patentes) Delineamento experimentiais utilizados para os testes de associação muitas vezes tem efeito confundido de subestruturação populacional o que gera falsos positivos Necessidade de populações adequadas e fenotipadas

58 Questões pendentes com os testes para maciez de carne 2 Testes são bialélicos quando sabemos que estes genes muito provavelmente segregam de forma multialélica nas populações Perda de alelos mais favoráveis existentes na população pode ocorrer se seleção por DNA for implementada Testes são baseados em associação (DL) e não genes funcionais Validação em diferentes raças ainda não existe ou é contraditória a (ex. SNP na posição 530 teve efeito contrário em população de Santa ertrudis Bos indicus (Pollack 2004) Falta avaliação de efeitos ambientais e de manejo sobre a magnitude do efeito de substituição alélica Faltam avaliações comparativas de DNA x testes de progênie: muita a pesquisa em andamento principalmente nos EUA, Canadá e NZ

59 Como, quando e porque adotar testes de DNA para maciez de carne no meu rebanho? Devemos usar testes de DNA? Quais testes usar? Quais características serão mais beneficiadas pelo teste? Quais animais testar? Como utilizar os resultados dos testes? O que as Associações devem fazer a respeito dos testes?

60 Considerações sobre testes de DNA em geral (adaptado de Thallman M. 2004) Benefícios potenciais: acurácia aumentada na seleção especialmente para características de mensuração cara, limitadas pelo sexo ou mensuradas post mortem Usar ou não?: é uma decisão comercial que deve ser tomada de acordo com a posição no mercado e os custos envolvidos Apenas uma ferramenta de marketing? Adoção de novas tecnologias também tem este componente no início, mas geralmente leva ao sucesso Qual teste usar? Buscar informações sobre validação e magnitude do efeito; considerar experimento piloto para estimar frequências alélicas das mutações na sua população Funciona na minha raça? Muitas vezes não tem dados; buscar participar de pesquisas via associações

61 Considerações sobre testes de DNA em geral (adaptado de Thallman M. 2004) Quais animais testar? Reprodutores mais influentes; candidatos de maior potencial; animais mais provavelmente portadores de alelos favoráveis Como usar os resultados? Combinandos com avaliações fenotípicas; ; DNA aumenta a contribuição da informação fenotípica mas não substitui fenótipo O que esperar da minha associação? Estabelecer procedimentos para aquisição direta de resultados; estabelecer políticas para evitar relatos seletivos de resultados; fomento a redes de pesquisa; informação e educação de produtores Testes de DNA para heranças multifatoriais ainda constituem um desafio Testes de DNA vão se tornar melhores e mais baratos com o tempo Testes de DNA não vão simplificar o melhoramento mas torná-lo mais rápido Deverá se tornar rotina no melhoramento bovino e possivelmente na n a produção

62 Telefax

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA. Biotecnologia

BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA. Biotecnologia BIOTECNOLOGIAS EMPREGADAS NA MEDICINA VETERINÁRIA Biotecnologia O que é isso??? É qualquer técnica que utilize organismos vivos ou suas partes, para fazer ou modificar produtos, melhorar plantas ou animais

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

PROGRAMA DE FOMENTO AO CRUZAMENTO ANGUS MANUAL

PROGRAMA DE FOMENTO AO CRUZAMENTO ANGUS MANUAL PROGRAMA DE FOMENTO AO CRUZAMENTO ANGUS MANUAL 1. A RAÇA ABERDEEN ANGUS Originária da Escócia, a raça foi selecionada em função de suas características superiores de precocidade, fertilidade, rusticidade,

Leia mais

Resumos do 56º Congresso Nacional de Botânica.

Resumos do 56º Congresso Nacional de Botânica. Genômica Florestal: Oportunidades e Desafios DARIO GRATTAPAGLIA - EMBRAPA RECURSOS GENÉTICOS E BIOTECNOLOGIA/UNIVERSIDADE CATÓLICA DE BRASÍLIA dario@cenargen.embrapa.br Introdução Plantações florestais

Leia mais

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel 1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel Quadrado de Punnet Segregação fenotípica 3/4 Preto 1/4 marron

Leia mais

Selecionando para Melhorar as Carcaças do Gado de Corte:

Selecionando para Melhorar as Carcaças do Gado de Corte: Selecionando para Melhorar as Carcaças do Gado de Corte: Leonardo Campos 1 e Gabriel Campos 2 O professor e pesquisador norte-americano R.A. Bob Long, colunista da revista Angus Journal e autor do Sistema

Leia mais

CONSANGUINIDADE EM ANIMAIS

CONSANGUINIDADE EM ANIMAIS MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL CONSANGUINIDADE EM ANIMAIS 1. CONSANGUINIDADE A consangüinidade

Leia mais

Introdução a genética de populações e a origem da variação genética. Aula 1

Introdução a genética de populações e a origem da variação genética. Aula 1 Introdução a genética de populações e a origem da variação genética Aula 1 O Escopo da Genética de populações! Genética mendeliana! A transmissão da informação da informação genética está sujeita as leis

Leia mais

TECNICAS DE AMPLIFICAÇÃO REPRODUTIVA E DE BIOTECNOLOGIA APLICADAS AO MELHORAMENTO ANIMAL

TECNICAS DE AMPLIFICAÇÃO REPRODUTIVA E DE BIOTECNOLOGIA APLICADAS AO MELHORAMENTO ANIMAL MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL TECNICAS DE AMPLIFICAÇÃO REPRODUTIVA E DE BIOTECNOLOGIA APLICADAS

Leia mais

GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA

GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA UNIVERSIDADE FEDERAL RURAL DA AMAZÔNIA DISCIPLINA DE GENÉTICA GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA Profa. Dra. Mônica Gusmão Engenheira Agrônoma Profa. Mônica Gusmão PERGUNTAS FUNDAMENTAIS DOS PADRÕES

Leia mais

Princípios da Seleção Genômica

Princípios da Seleção Genômica José Fernando Garcia Princípios da Seleção Genômica 4º Workshop Precocidade Sexual Associação Nacional de Criadores e Pesquisadores - ANCP Laboratório de Bioquímica e Biologia Molecular Animal International

Leia mais

Quanto vale uma prenhez? How much does a pregnancy is worth? Prof. Dr. José Bento Sterman Ferraz

Quanto vale uma prenhez? How much does a pregnancy is worth? Prof. Dr. José Bento Sterman Ferraz Quanto vale uma prenhez? How much does a pregnancy is worth? Prof. Dr. José Bento Sterman Ferraz Faculdade de Zootecnia e Engenharia de Alimentos da USP Núcleo de Apoio à Pesquisa em Melhoramento Animal,

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

GENÉTICA FORENSE E PATERNIDADE

GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

Inseminação Artificial Aplicada ao Melhoramento Genético Animal

Inseminação Artificial Aplicada ao Melhoramento Genético Animal Inseminação Artificial Aplicada ao Melhoramento Genético Animal Equipe de pesquisadores MGA/ CNPGL: Maria Gabriela C.D. Peixoto Rui da Silva Verneque João Cláudio do Carmo Panetto Frank Ângelo Tomita Bruneli

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

USO DE TECNOLOGIAS MOLECULARES

USO DE TECNOLOGIAS MOLECULARES USO DE TECNOLOGIAS MOLECULARES P= G+A VP = VG + VA Uso de marcadores no estudo de características quantitativas Características quantitativas Controladas por vários genes de pequeno efeito Sofrem maior

Leia mais

Melhoramento Genético

Melhoramento Genético Melhoramento Genético Cibele Lima Douglas de Alencar Matheus Paiva Silva Pablo Medeiros Pedro Vierira César Rogério Ayres Alves O melhoramento genetico é uma ciência utilizada para a obtenção de indivíduos

Leia mais

Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal

Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal Genética clássica: mono, di e polihibridismo, alelismo múltiplo. A PRIMEIRA LEI DE MENDEL OU PRINCÍPIO DA

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

INTRODUÇÃO AO ESTUDO DA GENÉTICA

INTRODUÇÃO AO ESTUDO DA GENÉTICA INTRODUÇÃO AO ESTUDO DA GENÉTICA PROFESSORA: SANDRA BIANCHI ASSUNTOS ESTUDADOS NA GENÉTICA ESTUDO DOS GENES E DA HEREDITARIEDADE A GENÉTICA E A MATEMÁTICA ESTUDANDO PROBABILIDADE FÓRMULA GERAL: P(A) =

Leia mais

BOVINOS RAÇAS SINTÉTICAS

BOVINOS RAÇAS SINTÉTICAS UNIVERSIDADE FEDERAL DO CEARÁ CENTRO DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE ZOOTECNIA LABORATÓRIO DE FISIOLOGIA DA REPRODUÇÃO BOVINOS RAÇAS SINTÉTICAS Disciplina: Exterior e raças Prof. Mauricio van Tilburg

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS CURSO DE BACHARELADO EM ZOOTECNIA. Gene Boorola. Edgard G. Malaguez Rafael Assunção

MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS CURSO DE BACHARELADO EM ZOOTECNIA. Gene Boorola. Edgard G. Malaguez Rafael Assunção MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS CURSO DE BACHARELADO EM ZOOTECNIA Gene Boorola Edgard G. Malaguez Rafael Assunção Ovelha Booroola? É uma mutação genética que tem na característica

Leia mais

2. (FATEC) Um casal cujo filho é do grupo sanguíneo A, com fator Rh positivo, pode ter os seguintes genótipos:

2. (FATEC) Um casal cujo filho é do grupo sanguíneo A, com fator Rh positivo, pode ter os seguintes genótipos: Foz do Iguaçu, de de 2015. Nome: nº Professor Ailton Pastro. 1 a série A, B, C e D Nota: LISTA DE QUESTÕES TRABALHO BIMESTRAL 1. (MACK) Um indivíduo de tipo sanguíneo O, Rh-, filho de pais tipo sanguíneo

Leia mais

Padrões de Transmissão

Padrões de Transmissão Padrões de Transmissão Gênica Padrões de Transmissão Gênica DISCIPLINA: GENÉTICA BÁSICA PROFA. ZULMIRA LACAVA E LUZIRLANE BRAUN Heranças Monogênicas ou Mendelianas 1 1ª Lei de Mendel Modelo pressupôs que

Leia mais

Associação de Criadores de Bovinos da Raça Preta

Associação de Criadores de Bovinos da Raça Preta Associação de Criadores de Bovinos da Raça Preta Benavente, 18 de Abril de 2013 1 - Resultados produtivos e reprodutivos 1.1 - Indicadores da evolução do efetivo 1.2 - Indicadores de produtividade 2 -

Leia mais

Lei da Segregação. Experimentos de Mendel

Lei da Segregação. Experimentos de Mendel Lei da Segregação Os trabalhos do monge Agostinho Gregor Mendel, realizados há mais de um século, estabeleceram os princípios básicos da herança, que, até hoje, são aplicados nos estudos da Genética. A

Leia mais

MELHORAMENTO GENÉTICO

MELHORAMENTO GENÉTICO MELHORAMENTO GENÉTICO Mudança do material hereditário do rebanho de forma a capacitá-lo para produzir leite, mais economicamente em um determinado ambiente. Genética é a ciência que estuda a variação e

Leia mais

Atividade extra. Questão 1. Questão 2. Ciências da Natureza e suas Tecnologias Biologia. A diversidade biológica é o fruto da variação genética.

Atividade extra. Questão 1. Questão 2. Ciências da Natureza e suas Tecnologias Biologia. A diversidade biológica é o fruto da variação genética. Atividade extra Questão 1 A diversidade biológica é o fruto da variação genética. Falar em biodiversidade e em tempo significa, necessariamente, falar de: a. Degeneração. b. Conservação. c. Evolução. d.

Leia mais

Introdução à genética quantitativa usando os recursos do R

Introdução à genética quantitativa usando os recursos do R Introdução à genética quantitativa usando os recursos do R Marisa R. Cantarino 1 Julia M. P. Soler (orientadora) 2 1 Introdução Um dos principais desafios da pesquisa genética atualmente é estabelecer

Leia mais

Genética de Populações

Genética de Populações MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL Genética de Populações COMO SE CONSEGUE ATINGIR OS OBJETIVOS DO

Leia mais

Programa Nelore Brasil e seu Impacto Econômico

Programa Nelore Brasil e seu Impacto Econômico Programa Nelore Brasil e seu Impacto Econômico II Congreso Ganadero Nacional CORFOGA 2008 Prof. Dr. Raysildo B. Lôbo ANCP, USP Crescimento da Pecuária de Corte Brasileira: produção de carne e abate 71,0%

Leia mais

Genética Conceitos Básicos

Genética Conceitos Básicos Genética Conceitos Básicos O que é genética? É o estudo dos genes e de sua transmissão para as gerações futuras. É dividida em: Genética Clássica Mendel (1856 1865) Genética Moderna Watson e Crick (1953).

Leia mais

CLASSIFICAÇÃO GENÉTICA. Reprodução, Acasalamento, Manutenção e Algumas considerações...

CLASSIFICAÇÃO GENÉTICA. Reprodução, Acasalamento, Manutenção e Algumas considerações... CLASSIFICAÇÃO GENÉTICA Reprodução, Acasalamento, Manutenção e Algumas considerações... Classificação Genética Heterogênicos = outbred Isogênicos = Inbred Acasalamento Aleatório Não-Consangüíneos Acasalamento

Leia mais

Entendendo a herança genética. Capítulo 5 CSA 2015

Entendendo a herança genética. Capítulo 5 CSA 2015 Entendendo a herança genética Capítulo 5 CSA 2015 Como explicar as semelhanças entre gerações diferentes? Pai e filha Avó e neta Pai e filho Avó, mãe e filha Histórico Acreditava na produção, por todas

Leia mais

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade HOME O laboratório Sabin, desde 2002, emprega a biologia molecular no estudo do DNA. Essa tecnologia é conhecida pela alta qualidade nos procedimentos adotados que asseguram os resultados dos exames oferecidos.

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

Conheça a primeira central de inseminação do mundo.

Conheça a primeira central de inseminação do mundo. Conheça a primeira central de inseminação do mundo. A primeira central de inseminação do mundo nasceu nos Estados Unidos e veste verde e amarelo há mais de 40 anos. A C.R.I. Genética é uma cooperativa

Leia mais

PROGRAMAS DE INSEMINAÇÃO ARTIFICIAL EM REBANHOS BOVINOS: ANÁLISE DOS GANHOS PARA OS PEQUENOS PRODUTORES

PROGRAMAS DE INSEMINAÇÃO ARTIFICIAL EM REBANHOS BOVINOS: ANÁLISE DOS GANHOS PARA OS PEQUENOS PRODUTORES PROGRAMAS DE INSEMINAÇÃO ARTIFICIAL EM REBANHOS BOVINOS: ANÁLISE DOS GANHOS PARA OS PEQUENOS PRODUTORES Rafael Herrera Alvarez Médico Veterinário, Doutor, Pesquisador Científico do Pólo Centro Sul/APTA

Leia mais

Fenótipo é qualquer característica mensurável. Genótipos Mendelianos são sempre discretos, mas fenótipos podem ser discretos ou contínuos.

Fenótipo é qualquer característica mensurável. Genótipos Mendelianos são sempre discretos, mas fenótipos podem ser discretos ou contínuos. Fenótipo é qualquer característica mensurável. Genótipos Mendelianos são sempre discretos, mas fenótipos podem ser discretos ou contínuos. Ambiente Genótipo Caixa Preta Fenótipo Complexidade A grande maioria

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Complexidade. Fenótipo é qualquer característica mensurável.

Complexidade. Fenótipo é qualquer característica mensurável. Fenótipo é qualquer característica mensurável. Genótipos Mendelianos são sempre discretos, mas fenótipos podem ser discretos ou contínuos. Isto se tornou um problema sério para o Mendelismo e para a teoria

Leia mais

José Ferreira Pankowski

José Ferreira Pankowski José Ferreira Pankowski O conselheiro técnico da Associação dos Criadores de Nelore de Mato Grosso, José Ferreira Pankowski, é o entrevistado da semana do site da Nelore MT. Ele fala sobre o desenvolvimento

Leia mais

RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.

RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC. RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.) 1. IDENTIFICAÇÃO DO PROJETO (item a ser preenchido pela

Leia mais

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto Genética Humana Faculdade Anísio Teixeira Prof João Ronaldo Neto Jan/2012 Herança Multifatorial Herança Monogênica Herança Cromossômica Padrões de Herança Distúrbios Monogênicos São determinados por um

Leia mais

Hereditariedade. Leis da hereditariedade GENÉTICA

Hereditariedade. Leis da hereditariedade GENÉTICA Hereditariedade Definição: É a transferência de informações sobre as características próprias de um ser vivo para outro, de geração para geração, por meio dos gametas ou por transferência direta deácidos

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Universidade Federal de Viçosa - UFV Departamento de Biologia Geral

Universidade Federal de Viçosa - UFV Departamento de Biologia Geral Universidade Federal de Viçosa - UFV Departamento de Biologia Geral Genética de Populações Genética Básica - Bio 240 Profa. Karla Yotoko Capítulo 1 Introdução à Genética de Populações Equilíbrio de Hardy-Weinberg

Leia mais

UTILIDADE E APLICAÇÕES DA GENOTIPAGEM ERITROCITÁRIA NA TRANSFUSÃO: A EXPERIÊNCIA DA FUNDAÇÃO HEMOMINAS. Maria Clara Fernandes da Silva Malta

UTILIDADE E APLICAÇÕES DA GENOTIPAGEM ERITROCITÁRIA NA TRANSFUSÃO: A EXPERIÊNCIA DA FUNDAÇÃO HEMOMINAS. Maria Clara Fernandes da Silva Malta UTILIDADE E APLICAÇÕES DA GENOTIPAGEM ERITROCITÁRIA NA TRANSFUSÃO: A EXPERIÊNCIA DA FUNDAÇÃO HEMOMINAS Maria Clara Fernandes da Silva Malta Antígenos de grupos sanguíneos eritrocitários Carboidratos ou

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

estratégias para melhorar seu rebanho

estratégias para melhorar seu rebanho Texto adaptado pela CRI Genética Brasil Fonte: Associação Americana de Angus CRI Genética Brasil estratégias para melhorar seu rebanho O que é Relatório de Avaliação de Touro? A Associação Americana de

Leia mais

MITOS E REALIDADE SOBRE CONSAGÜINIDADE OU ENDOGAMIA

MITOS E REALIDADE SOBRE CONSAGÜINIDADE OU ENDOGAMIA 1 MITOS E REALIDADE SOBRE CONSAGÜINIDADE OU ENDOGAMIA William Koury Filho Consangüinidade e endogamia são palavras que tem o mesmo significado e, atualmente, vem ganhando destaque na mídia especializada

Leia mais

Perspectivas da pecuária no cenário mundial. 16o. Seminário Nacional de Criadores e Pesquisadores

Perspectivas da pecuária no cenário mundial. 16o. Seminário Nacional de Criadores e Pesquisadores Perspectivas da pecuária no cenário mundial 16o. Seminário Nacional de Criadores e Pesquisadores O Cenário Atual As mudanças na agricultura e produção animal. A tecnologia e sua influência no aumento da

Leia mais

GENÉTICA APLICADA AO MELHORAMENTO ANIMAL

GENÉTICA APLICADA AO MELHORAMENTO ANIMAL MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL GENÉTICA APLICADA AO MELHORAMENTO ANIMAL 1. DIVISÃO DO MATERIAL

Leia mais

Stela Adami Vayego - DEST/UFPR 1

Stela Adami Vayego - DEST/UFPR 1 Aula 04 Medidas Descritivas de Variáveis Quantitativas Parte 2 Medidas de Dispersão Stela Adami Vayego - DEST/UFPR 1 São medidas que fornecem informação com relação a dispersão dos dados (heterogeneidade).

Leia mais

QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL. O 2(g) O 2(aq)

QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL. O 2(g) O 2(aq) QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL Questão 01 O agente oxidante mais importante em águas naturais é, sem a menor dúvida, o oxigênio molecular dissolvido, O 2. O equilíbrio entre o oxigênio

Leia mais

Parâmetros Genéticos

Parâmetros Genéticos MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL Parâmetros Genéticos 1. INTRODUÇÃO Os parâmetros genéticos são

Leia mais

Diversidade Genética das Populações Amazônicas

Diversidade Genética das Populações Amazônicas PAINEL I Particularidades genéticas das populações amazônicas e suas possíveis implicações Coordenação de Mesa: Wim Degrave. Diversidade Genética das Populações Amazônicas Sidney dos Santos Será apresentado

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

da AgroZurita, de Ivan Zurita, que comprou, de "porteira fechada",aestampacedrodenelore.

da AgroZurita, de Ivan Zurita, que comprou, de porteira fechada,aestampacedrodenelore. da AgroZurita, de Ivan Zurita, que comprou, de "porteira fechada",aestampacedrodenelore. Os marcadores moleculares são considerados por unanimidade um marco no desenvolvimento da pecuária nacional. José

Leia mais

XIX CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA 27 de setembro a 01 de outubro de 2010

XIX CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA 27 de setembro a 01 de outubro de 2010 DIVERGÊNCIA GENÉTICA DE PROGÊNIES DE MEIOS-IRMÃOS DE AÇAIZEIRO COM BASE EM VALORES GENÉTICOS DE CARACTERES AGRONÔMICOS E DE CACHO DAVI HENRIQUE LIMA TEIXEIRA 1, MARIA DO SOCORRO PADILHA DE OLIVEIRA ; FLÁVIA

Leia mais

INDEX ASBIA MERCADO 2014

INDEX ASBIA MERCADO 2014 INDEX ASBIA MERCADO 2014 INDEX ASBIA Mercado de sêmen 2014. O relatório do INDEX ASBIA 2014 representa aproximadamente 92% do mercado de sêmen no Brasil, incluindo as raças de corte e leite e é composto

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Aplicações da biotecnologia na área animal

Aplicações da biotecnologia na área animal Aplicações da biotecnologia na área animal As aplicações da biotecnologia moderna na área animal são múltiplas e têm um mercado potencial de bilhões de dólares por ano. A competição por tal mercado exige

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário

O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário que a mutação esteja em homozigose (doença autossômica

Leia mais

Genômica. O que chamou mais atenção no filme?

Genômica. O que chamou mais atenção no filme? Genômica O que chamou mais atenção no filme? Tempo para sequenciamento do genoma Predição do fenótipo com base no genótipo Como este conhecimento pode ser usado para gerar novas tecnologias? Sequenciamento

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores.

daltônico. Esta doença traz como consequência problemas nas células denominadas de cones, que ajudam a enxergar cores. BIO V7 CAP 19 19.01 O genótipo do casal III-2 e III-3 é X A X a x X a y. Fazendo o cruzamento os filhos podem ser: X A X a, X A Y, X a X a, X a Y. Como se pode observar qual é o masculino e qual é o feminino,

Leia mais

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal Fepagro em foco Samuel Mazzinghy Alvarenga Histórico recente da Agropecuária Era científica: a partir de ~ 1.700 Rotação de culturas e métodos de cultivo intensivo Drenagem Utilização de arado, máquinas

Leia mais

A probabilidade de nascer uma menina afetada do cruzamento de 3 com 11 é: a) 0,00 b) 0,25 c) 0,50 d) 0,75 e) 1,00

A probabilidade de nascer uma menina afetada do cruzamento de 3 com 11 é: a) 0,00 b) 0,25 c) 0,50 d) 0,75 e) 1,00 Genética e Evolução 1. A mosca drosófila, de olho branco, apresenta a constituição genética X W Y e não possui gene para olho vermelho, que impede a manifestação do outro gene, para olho branco. Na frase,

Leia mais

Implementac a o do Alelo Animal/ Animal GRIN no Brasil. Samuel Rezende Paiva Embrapa Labex EUA Recursos Genéticos

Implementac a o do Alelo Animal/ Animal GRIN no Brasil. Samuel Rezende Paiva Embrapa Labex EUA Recursos Genéticos Implementac a o do Alelo Animal/ Animal GRIN no Brasil Samuel Rezende Paiva Embrapa Labex EUA Recursos Genéticos O Que é o Alelo Animal? PORTAL ALELO, lançamento final 2013: https://www.embrapa.br/alelo

Leia mais

O impacto do touro no rebanho de cria

O impacto do touro no rebanho de cria Algumas contas simples podem constatar que o touro de cria é um fator de produção de extrema relevância A realidade de mercado atual exige do pecuarista competência para se manter no negócio, e visão estratégica

Leia mais

A utilização da vaca F1: visão da EMATER-MG INTRODUÇÃO

A utilização da vaca F1: visão da EMATER-MG INTRODUÇÃO A utilização da vaca F1: visão da EMATER-MG 1Elmer Ferreira Luiz de Almeida; 2José Alberto de Àvila Pires 1 Coordenador Técnico Bovinocultura de Leite da EMATER-MG 2Coordenador Técnico Bovinocultura de

Leia mais

Centro Educacional Juscelino Kubitschek

Centro Educacional Juscelino Kubitschek Centro Educacional Juscelino Kubitschek ALUNO: N.º: DATA: / / ENSINO: ( ) Fundamental (x) Médio SÉRIE: _3ª TURMA: TURNO: DISCIPLINA: _BIOLOGIA PROFESSOR: Silas Miranda 01- A genealogia abaixo apresenta

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

PRINCÍPIOS DE GENÉTICA MÉDICA

PRINCÍPIOS DE GENÉTICA MÉDICA PRINCÍPIOS DE GENÉTICA MÉDICA Conceitos Genética / Genômica Doença genética Hereditariedade Congênito DNA / Gene / Locus / Alelo Homozigoto / Heterozigoto Cromossomos Autossomos Sexuais Dominante / Recessivo

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

O cruzamento do charolês com o zebu (indubrasil, guzerá ou nelore) dá origem ao CANCHIM. Rústico e precoce, produz carne de boa qualidade.

O cruzamento do charolês com o zebu (indubrasil, guzerá ou nelore) dá origem ao CANCHIM. Rústico e precoce, produz carne de boa qualidade. OUTUBRO 2006 Para chegar ao novo animal, os criadores contaram com a ajuda do superintendente do laboratório de inseminação artificial Sersia Brasil, Adriano Rúbio, idealizador da composição genética

Leia mais

BIOLOGIA GENÉTICA PROF ESTEVAM

BIOLOGIA GENÉTICA PROF ESTEVAM BIOLOGIA GENÉTICA PROF ESTEVAM 1) (FUVEST) Dois genes alelos atuam na determinação da cor das sementes de uma planta: A, dominante, determina a cor púrpura e a, recessivo, determina cor amarela. A tabela

Leia mais

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71)

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71) DELIBERAÇÃO Câmara de Pós-Graduação Nº 32/2012 Reestrutura o Programa de Pós-Graduação em Genética e Biologia Molecular, em nível de Mestrado e Doutorado. CONSIDERANDO a solicitação da Comissão Coordenadora

Leia mais

ENSINO MÉDIO. Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC

ENSINO MÉDIO. Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC ENSINO MÉDIO Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC 1- A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante, cuja manifestação ocorre na fase adulta, com uma progressiva

Leia mais

Profa. Rosana Rodrigues (LMGV, P4, Sala 110)

Profa. Rosana Rodrigues (LMGV, P4, Sala 110) Resistência Genética a Doenças em Plantas Profa. Rosana Rodrigues (LMGV, P4, Sala 110) 1807 Prevost doenças: agente causal carvão do trigo - fungo Fins do séc. XIX Smith doenças - bactérias O que é DOENÇA?

Leia mais

MELHORAMENTO GENÉTICO ANIMAL NO BRASIL: UNDAMENTOS, HISTÓRIA E IMPORTÂNCIA. Keppler Euclides (CNPGC-EMBRAPA)

MELHORAMENTO GENÉTICO ANIMAL NO BRASIL: UNDAMENTOS, HISTÓRIA E IMPORTÂNCIA. Keppler Euclides (CNPGC-EMBRAPA) MELHORAMENTO GENÉTICO ANIMAL NO BRASIL: UNDAMENTOS, HISTÓRIA E IMPORTÂNCIA Keppler Euclides (CNPGC-EMBRAPA) 1 - INTRODUÇÃO A utilização de animais domésticos tem precedentes históricos que fazem destes

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

Dúvidas Frequentes 1) O que é o teste de paternidade por DNA?

Dúvidas Frequentes 1) O que é o teste de paternidade por DNA? Dúvidas Frequentes 1) O que é o teste de paternidade por DNA? A análise em DNA é o meio mais preciso disponível atualmente para a determinação de paternidades ou maternidades duvidosas. É a extrema sensibilidade

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Programa de Certificação de Alimentação Humana, Animal e de Produção de Sementes NÃO OGM*

Programa de Certificação de Alimentação Humana, Animal e de Produção de Sementes NÃO OGM* Programa de Certificação de Alimentação Humana, Animal e de Produção de Sementes NÃO OGM* (*organismos geneticamente modificados) 1ª Edição - Novembro 2006 Programa de Certificação de Alimentação Humana,

Leia mais

Estado da tecnologia avançada na gestão dos recursos genéticos animais

Estado da tecnologia avançada na gestão dos recursos genéticos animais PARTE 4 Estado da tecnologia avançada na gestão dos recursos genéticos animais A caracterização de raças e ambientes de produção precisa ser melhorada para fomentar políticas de decisão na gestão dos recursos

Leia mais