UNIVERSIDADE ESTADUAL DO CEARÁ PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS VETERINÁRIAS

Transcrição

1 1 UNIVERSIDADE ESTADUAL DO CEARÁ PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS VETERINÁRIAS ADELINE DE ANDRADE CARVALHO VITRIFICAÇÃO DE TECIDO OVARIANO CAPRINO: EFEITO DE UM NOVO DISPOSITIVO FECHADO E ADIÇÃO DE CATALASE FORTALEZA 2013

2 2 ADELINE DE ANDRADE CARVALHO VITRIFICAÇÃO DE TECIDO OVARIANO CAPRINO: EFEITO DE UM NOVO DISPOSITIVO FECHADO E ADIÇÃO DE CATALASE Tese apresentada ao Programa de Pós-Graduação em Ciências Veterinárias da Faculdade de Veterinária da Universidade Estadual do Ceará, como requisito parcial para obtenção do título de Doutor em Ciências Veterinárias. Área de Concentração: Reprodução e Sanidade Animal. Linha de pesquisa: Reprodução e Sanidade de Pequenos Ruminantes. Orientadora: Profa. Dra. Ana Paula Ribeiro Rodrigues. FORTALEZA 2013

3 3 Dados Internacionais de Catalogação na Publicação Universidade Estadual do Ceará Biblioteca Central Prof. Antônio Martins Filho Bibliotecária Responsável Leila Sátiro CRB-3 / 544 C391v Carvalho, Adeline de Andrade. Vitrificação de tecido ovariano caprino: efeito de um novo dispositivo fechado e adição de catalase/adeline de Andrade Carvalho CD-ROM :190f.il. (algumas color.); 4 ¾ pol. CD-ROM contendo o arquivo no formato PDF do trabalho acadêmico, acondicionado em caixa de DVD Slin (19 x 14 cm x 7 mm). Tese (doutorado) Universidade Estadual do Ceará, Faculdade de Veterinária, Doutorado em Ciências Veterinárias, Fortaleza, Área de Concentração: Reprodução e Sanidade Animal. Orientação: Profª. Drª. Ana Paula Ribeiro Rodrigues. Co-orientação: Prof. Dr. José Ricardo de Figueiredo. 1. Criopreservação. 2. Antioxidante. 3. Folículo pré-antral. 4. Cabra. Título. CDD:

4 4

5 5 À minha família e ao meu namorado pelo apoio eterno e incondicional Dedico

6 6 AGRADECIMENTOS A Deus, por me dar coragem para buscar meus objetivos, força para superar as adversidades e serenidade para desfrutar dos momentos felizes; A todas as instituições de ensino as quais frequentei, bem como aos professores e servidores das mesmas, pois todos têm colaboração na pessoa que hoje sou; À Universidade Federal do Piauí, especialmente aos Professores Rômulo José Vieira e Amilton Paulo Raposo Costa, pelos ensinamentos e por me instigarem a visão crítica e a curiosidade, características tão necessárias a um pesquisador; À Universidade Estadual do Ceará (UECE), ao Programa de Pós-Graduação em Ciências Veterinárias (PPGCV) e ao Laboratório de Manipulação de Oócitos e Folículos Ovarianos Pré-Antrais (LAMOFOPA), pela oportunidade de fazer meu doutorado; Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pela bolsa de doutorado concedida, pois sem esta dificilmente conseguiria concluir meu almejado doutorado; Ao Professor José Ricardo de Figueiredo, por sempre me incentivar e me estimular a crescer e me aperfeiçoar; Aos Professores Cláudio Cabral Campello, Francielli Weber Santos e Vilceu Bordignon, pela valorosa contribuição nas publicações; À Professora Regiane Rodrigues Santos, por sua contribuição tão valorosa e por sempre estar tão próxima ao longo de todo o doutorado; À Professora Ana Paula Ribeiro Rodrigues, pela orientação, confiança e apoio, principalmente nesta etapa final;

7 7 Aos Doutores Carlos Henrique Lobo e Cláudio Afonso Pinho Lopes, pela contribuição científica e amizade; A toda a equipe do LAMOFOPA, incluindo os servidores, alunos que fizeram parte da equipe, os que ainda estão na equipe e os que estão chegando agora, todos agregam novos ensinamentos e novas experiências, tanto profissionais quanto pessoais; À minha equipe de trabalho, Luciana R. Faustino, Cleidson M. G. Silva e Simone V. Castro, pelo apoio, pelas noites de sono e finais de semana perdidos, e, principalmente, por tamanho esforço ser realizado sempre de bom humor; À Simone, pelo companheirismo, nos momentos difíceis e nos momentos alegres, tanto no âmbito profissional quanto pessoal; Ao Cleidson e sua esposa, Liliane, pela amizade, pelo carinho, pelo ombro amigo e por me fazerem sentir como parte da família; À Luciana, por ser amiga, no sentido mais real e completo da palavra. Em você encontrei uma amizade tão espontânea e sincera que acredito que nem mesmo a distância nos afaste; Aos meus padrinhos (Paulo e Mônica), por estarem sempre ao meu lado e não me abandonarem em um dos momentos mais difíceis por que já passei. Um muito obrigado sempre será insuficiente perto da generosidade de vocês; Aos amigos Alencar, Lurdinha, Socorro, Malu, Mário, Priscilla e Polliana, por serem meu porto seguro e pessoas que, apesar da minha ausência, sei que me têm afeto e se preocupam comigo; Aos amigos que fiz durante toda a vida, apesar do cotidiano insistir em nos separar, nosso carinho sempre nos aproxima; Ao meu namorado, Kleverton, por conseguir, mesmo à distância, ser um namorado sempre presente, compreensivo, por me apoiar a cada instante e me ajudar a

8 8 levantar nos momentos árduos. Apesar da distância, você consegue me conquistar cada vez mais, dia após dia; A toda a minha família, incluindo meus avós (in memorian), meus tios e primos. A estrutura familiar que tenho me faz mais forte e serena; Aos meus irmãos, Aline e André, pois a palavra irmão significa um companheirismo eterno e um laço de amor indissolúvel; exatamente a relação que temos; À minha sobrinha, Maria Eduarda, por sempre ser motivo de orgulho e de alegria. Amo tanto e cada dia mais! Aos meus pais, Adelaide e Luiz. Para estes, nem todas as palavras, por mais fortes, mais sinceras e mais verdadeiras, jamais serão suficientes. Sou eternamente grata e amo de forma inexplicável. Muito Obrigada!

9 9 Porque eu sou do tamanho do que vejo, e não do tamanho da minha altura... Alberto Caeiro (heterônimo de Fernando Pessoa)

10 10 RESUMO O desenvolvimento de uma técnica segura e prática para a vitrificação de tecido ovariano caprino que previna o contato direto da amostra com o nitrogênio líquido, bem como a contaminação da amostra biológica é uma necessidade da criopreservação de tecido ovariano. Assim, os objetivos deste estudo foram: 1) desenvolver uma nova técnica de vitrificação em um sistema fechado e avaliar a morfologia e viabilidade folicular após a vitrificação de tecido ovariano em fragmento, hemi e ovário inteiro (Fase 1); 2) avaliar a morfologia e ultraestrutura folicular após vitrificação de tecido ovariano em fragmento, hemi e ovário inteiro e cultivo in vitro de curta duração (Fase 2) e 3) analisar o efeito da adição de catalase na solução de vitrificação e/ou remoção do agente crioprotetor sobre a morfologia e viabilidade folicular bem como sobre os níveis de espécies reativas de oxigênio (Reactive Oxygen Species - ROS) e integridade do DNA (Fase 3). Na Fase 1 não foi observada diferença no percentual de folículos morfologicamente normais e viáveis (P>0,05) após a vitrificação quando comparado ao tecido ovariano fresco, independente da forma do tecido ovariano vitrificado. Na Fase 2, antes do cultivo in vitro, foi observada uma redução (P<0,05) no percentual de folículos morfologicamente normais, em todas as formas vitrificadas (fragmento, hemi e ovário inteiro), quando comparado ao controle fresco. Além disso, foram verificadas grandes alterações ultraestruturais quando o tecido ovariano foi vitrificado em ovário inteiro. Após o cultivo in vitro, a morfologia folicular foi melhor preservada quando o tecido ovariano foi vitrificado em fragmento, comparada à vitrificação em hemi ou ovário inteiro (P<0,05) e a ultraestrutura revelou que a vitrificação de hemi-ovário resultou em maior presença de vacúolos do que a vitrificação de fragmentos. Na Fase 3 observou-se que a vitrificação sem a presença de catalase resultou em maior nível de ROS do que no tecido fresco, contudo, a presença de catalase, independente do momento de adição, manteve os níveis de ROS similares ao controle fresco. Não houve diferença quanto à viabilidade folicular (P>0,05) e proteínas sinalizadoras de dano (γh2ax) e reparo (53BP1) do DNA entre os tratamentos testados. Resultados similares foram observados para a morfologia folicular e fragmentação do DNA quando avaliados os grupos criopreservados. Em conclusão, a técnica de vitrificação Ovarian Tissue Cryossystem (OTC) é eficaz para a criopreservação de tecido ovariano caprino, pois mantém a morfologia, a ultraestrutura e a viabilidade folicular, compatíveis ao tecido fresco, após

11 11 aquecimento. O uso de catalase no protocolo de vitrificação também é necessário para manter os níveis de ROS similar ao observado no tecido ovariano fresco. Palavras-chave: Criopreservação. Antioxidante. Folículo pré-antral. Cabra.

12 12 ABSTRACT The development of a safe and practical technique for the caprine ovarian tissue vitrification that prevents direct contact of the sample with liquid nitrogen, as well as contamination of the biological sample is needed for cryopreservation of ovarian tissue. Then, the objectives of this study were: 1) to develop a new vitrification technique in a closed system and evaluate the follicular morphology and viability after vitrification of ovarian tissue of fragment, hemi and whole ovary (Phase 1), 2) to evaluate the follicular morphology and ultrastructure after vitrification of ovarian tissue of fragment, hemi and whole ovary and after short-term in vitro culture (Phase 2), and 3) to analyze the effect of addition of catalase in the vitrification solution and/or removal of cryoprotectant agent on the follicular morphology and viability, as well as on the levels of reactive oxygen species (ROS) and DNA integrity (Phase 3). In Phase 1, there was no difference in the percentage of morphologically normal and viable follicles (P>0.05) after vitrification when compared to fresh ovarian tissue, regardless of the form of ovarian tissue vitrification. In Phase 2, before in vitro culture, a reduction (P<0.05) in the percentage of morphologically normal follicles was observed in all forms of vitrification (fragment, hemi and whole ovary), when compared to the fresh control. In addition, major ultrastructural changes were observed when the ovarian tissue was vitrified in whole ovary. After culture in vitro, the follicular morphology was better preserved when the ovarian tissue was vitrified as fragment compared to vitrification as hemi or whole ovary (P<0.05) and ultrastructure showed that vitrification of hemi-ovary resulted in increased number of vacuoles compared with fragments. In Phase 3, the vitrification without the presence of catalase resulted in higher levels of ROS than fresh tissue. However, the presence of catalase, regardless of the step of addition, maintained ROS levels similar to control fresh. There was no difference in follicular viability (P>0.05) and proteins DNA damage signaling (γh2ax) and repair (53BP1) between treatments. Similar results were observed for follicular morphology and DNA fragmentation when evaluated cryopreserved groups. In conclusion, the vitrification technique Ovarian Tissue Cryosystem (OTC) is effective for vitrification of goat ovarian tissue, causing little cellular damage when assessed follicular morphology, viability and ultrastructure. Furthermore, the presence of catalase is necessary to maintain ROS levels similar to that found in fresh ovarian tissue.

13 Keywords: Cryopreservation. Antioxidant. Preantral follicle. Goat. 13

14 14 LISTA DE FIGURAS REVISÃO DE LITERATURA Figura 1. Desenho esquemático da morfologia do ovário da maioria dos mamíferos. Observar a região medular, e os folículos em diferentes estágios de desenvolvimento, localizados na região cortical (adaptado de GUYTON; HALL, 2006)...28 Figura 2. Técnicas desenvolvidas para vitrificação de tecido ovariano. (A) vitrificação convencional por palhetas e (B) por criotubos, (C) Cobertura direta, (D) agulhas de acupuntura, (E) Cryosupport e (F) Fibreplug. Imagens obtidas de SAKI; RAHIM; ZERGANI, 2009; WANG et al., 2008; CHEN et al., 2006; HASHIMOTO et al., 2010; BEEBE; NOTTLE, Figura 3. Representação esquemática de um octâmero de histonas consistindo de duas moléculas de H2A, H2B, H3 e H4. Adaptado de ZAIDI et al., Figura 4. Via de checkpoint 53BP1-dependente. A DSB resulta na fosforilação da H2AX próximo ao dano do DNA, culminando com o recrutamento e fosforilação da 53BP1 no foco nuclear. A 53BP1, por sua vez, recruta outros fatores, como a p53, e culmina com a parada do ciclo celular, ativação do checkpoint e reparo do DNA. Adaptado de ABRAHAM, CAPÍTULO 1 Figura 1. Imagem ilustrativa de uma célula eucariótica evidenciando as organelas internas no citoplasma e no núcleo. Imagem concedida por Thibodeau e Patton [103]...56 Figura 2. Fotomicrografias demonstrativas da ultraestrutura de folículos ovarianos e oócitos submetidos a procedimentos de criopreservação. (A) Folículo primordial de

15 15 mulher incluso em ovário inteiro congelado/descongelado evidenciando um oócito (O) com ruptura de membrana nuclear e condensação da cromatina (seta preta) no núcleo do oócito (N). Entre as células foliculares (Fc) percebe-se célula folicular alterada com condensação da cromatina (seta branca). Imagem concedida por Martinez-Madrid [62] e autorizada pela Elsevier. (B) Oócito bovino imaturo congelado/descongelado com gotícula lipídica intacta (1) e com lipólise parcial (2). Observam-se áreas de lipólise (seta branca) e mitocôndrias (m). Aumento de 8000x. Figura adaptada de Isachenko [48] e autorizada por Wiley Job Network. (C) Oócitos equinos maturos vitrificados/aquecidos com enturgecimento de mitocôndrias e redução de elétrondensidade da matriz mitocondrial (setas pretas). Figura concedida por Hochi [46] e autorizada pela Elsevier. (D) Folículo suíno incluso em tecido ovariano congelado/descongelado com mitocôndrias túrgidas (m). (l): gotículas lipídicas, (Nu): núcleo, (CG): células da granulosa e (*): espaços vazios. Figura concedida por Borges [13] e autorizada pela Elsevier. (E) Folículo ovariano humano incluso em tecido vitrificado/aquecido com presença de poros na membrana nuclear (setas pretas) e retículo endoplasmático (ER) e mitocôndrias (M) bem preservados, semelhante ao tecido fresco. Figura concedida por Sheikhi [95] e autorizada pela Oxford Journals...59 Figura 3. Imagens representativas do padrão de citoesqueleto de oócitos felinos imaturos submetidos à criopreservação evidenciando microfilamentos em vermelho e microtúbulos em verde. Microfilamentos difusos no ooplasma com uma concentração ligeiramente maior na zona pelúcida (A), microtúbulos uniformemente distribuídos por todo ooplasma (A ). Microfilamentos e microtúbulos distribuídos de forma irregular no citoplasma (B e B ). Barras representativas de 50µm. Figura concedida por Luciano [59] e autorizada pela Elsevier...62 Figura 4. Padrão de organização do fuso meiótico e de cromossomos em oócitos ovinos maturos submetidos à vitrificação. Fuso normal (A) com cromossomos alinhados na placa metafásica (A ). Fuso assimétrico (B e B ). Coluna da direita: marcação de β- tubulina, coluna da esquerda: marcação do DNA com Hoechst. Figura concedida por Asgari [6] e autorizada pela Elsevier...68

16 16 CAPÍTULO 3 Figure 1. Morphological characteristics and viability of preantral follicles enclosed in different dimensions of goat ovarian tissue. (A1-A2) Photomicrograph of morphologically normal goat preantral follicles in the fresh control (A1) and atretic preantral follicle after the cryopreservation of the whole ovary (A2). Note the measurement of follicular diameter in A1, obtained by performing by 2 transverse measurements. In A2, the follicular degeneration is evidenced by a retraction of the ooplasm (black arrow) and nuclear pyknosis (*) [Bar = 15 µm]. (B1-B2) Photomicrographs of ovarian stroma with normal (fresh control; B1) and reduced (whole ovary; B2) cell density. Observe the marking areas randomly selected for evaluation [Bar= 50 µm]. (C1-C2) Images of preantral follicles unstained, viable follicle (fresh control; C1) and stained, non-viable follicle (hemi-ovary; C2), with trypan blue [Bar = 20 µm]...93 CAPÍTULO 4 Fig. 1. Experimental design to assess the effect of vitrification of different dimensions of ovarian tissue (fragment, hemi-ovary, whole ovary) on the morphology of goat preantral follicles. LM: light microscopy; TEM: transmission electronic microscopy; IVC: in vitro culture Fig. 2. Ovarian Tissue Cryosystem: New stainless steel device developed for the vitrification procedures. (A) OTC opened enabling the visualization of its 3 constituent parts: basis (a), insert (b) cover (c). Note the perforations in the upper portion of the insert to facilitate placement and removal of solutions. (B) Exposure of the tissue (hemiovary) to vitrification solution in the basis of the OTC. (C) Inclusion of the insert in the basis of the OTC allows for observation of aseptic handling of the insert. (D) Closure of the basis, with the insert already enclosed, with the cover of the OTC. (E) Storage of OTC, containing the sample to be vitrified in the liquid nitrogen dewars. Note that this system prevents contact of the vitrified sample with liquid nitrogen...108

17 17 Fig. 3. Photomicrographs of goat ovarian cortical histological sections. (A) Normal primordial follicle. (B) Degenerated follicles with retraction of ooplasm. Nu, nucleus; GC, granulosa cells; arrows, shrunken ooplasm Fig. 4. Electron micrographs of goat preantral follicles from fresh control (A) and after vitrification of fragments (B), hemi-ovary (C), and whole ovary (D). Note in A, B and C the normal follicular ultrastructure with round mitochondria and intact granulosa cells, and a degenerated preantral follicle in D. GC: granulosa cells; O: oocyte; Nu: nucleus; n: nucleolus; m: mitochondria; V: vacuole; arrow: nuclear envelope; *: empty spaces. Scale bars = 5 µm Fig. 5. Electron micrographs of goat preantral follicles of in vitro cultured tissues after vitrification of fragments (A) and hemi-ovary (B). Note in (A), a well-preserved preantral follicle and in (B), a follicle in advanced stage of degeneration. GC: granulosa cells; O: oocyte; m: mitochondria; V: vacuole; *: empty spaces. Scale bars = 5 µm CAPÍTULO 5 Fig. 1. ROS levels expressed as fluorescence intensity in non-vitrified (fresh control) and vitrified ovarian tissues in the presence or absence of catalase in vitrification/washing solutions. A,B indicate statistical difference (P<0.05) between groups Fig. 2. Follicular morphology analysis (A-B), apoptosis detection (C-D) and follicular viability evaluation by trypan blue (E-F) and fluorescent markers (G-H). Morphologically normal (A) and degenerate (B) preantral follicle stained with HE. Note in (B) granulosa cells disorganization and ooplasm shrinkage (asterisk). Positive (C) and negative (C') control for TUNEL assay. Vitrified ovarian tissues were analyzed by TUNEL assay (D). Arrows indicate TUNEL-positive reaction; arrowhead indicates TUNEL-negative reaction. Viable (E) and non-viable (F) follicles unstained and stained by Trypan blue, respectively. Viable follicle (G) and non-viable follicle (H) labeled with calcein-am (green) and ethidium homodimer-1 (red), respectively. GC granulosa cells, O oocyte; Nu nucleus. Scale bars = 30 µm...131

18 18 Fig. 3. Percentage (mean ± SEM) of morphologically normal preantral follicles. Goat ovarian tissues were non-vitrified (fresh control) or vitrified-thawed in the presence or absence of catalase in vitrification/washing solutions. A,B indicate statistical difference (P<0.05) between treatment Fig. 4. Relative Bcl2/Bax mrna expression in non-vitrified (fresh control) and vitrified ovarian tissue in the presence or absence of catalase in vitrification/washing solutions Fig. 5. Immunodetection of 53BP1 protein (green bright fluorescent spots) in goat ovarian tissue from the fresh control and after vitrification. (A) Preantral follicle from a negative control sample showing a follicle without fluorescent signal for 53BP1. (B-D) Goat ovarian follicles positively labeled for 53BP1. Note primordial (B), primary (C) and secondary (D) follicles with granulosa cells labeled and the absence of fluorescence signal in the oocytes. GC granulosa cells; O oocyte. Scale bars = 30 µm...135

19 19 LISTA DE TABELAS CAPÍTULO 3 Table 1. Morphology, viability, follicular diameter, and stromal cell density after ovarian tissue vitrification at different dimensions (fragment, hemi-ovary, and whole ovary). *Five animals were used. For each treatment, two samples: one sample to histological analysis and another one to viability analysis were used for each animal. Ovarian tissues samples were obtained from hemi-ovary and whole ovary after vitrification. A,B,C Different superscripts letters indicate statistically significant differences (P< 0.05)...94 CAPÍTULO 4 Table 1 Percentage of morphologically normal preantral follicles enclosed in fresh ovarian tissue and vitrified into fragments, hemi-ovary or whole ovary, before and after in vitro culture. Data are mean ± SEM. A,B,C Different upper-case letters within a column indicate significant difference (P < 0.05). a,b Different lower-case letters within a row indicate significant difference before and after culture in the same treatment (P < 0.05) CAPÍTULO 5 Table 1. Oligonucleotide primers for GADPH, BCL-2 and BAX used in the gene expression analyses. *S sense; AS antisense. GAPDH: Glyceraldehyde 3-phosphate dehydrogenase Table 2. Stromal cells density and follicular viability (Trypan blue, Calcein AM/ethidium and TUNEL-positive follicles) in non-vitrified (fresh control) and vitrified ovarian tissues in presence or absence of catalase. Different superscripts within columns indicate statistical difference between treatments (P<0.05)...133

20 20 LISTA DE ABREVIATURAS E SIGLAS % - Percentagem ~ - Aproximadamente = - Igual a ± - mais ou menos - Vezes < - Menor que > - Maior que - Maior ou igual C - Graus Celsius µg - Microgramas µl - Microlitros µm - micrômetros 53BP1 - p53 binding protein 1 (Proteína Ligada a p53) ANOVA - Análise de variância ATP - Adenosina trifosfato BRCT - Breast cancer 1 carboxyl-terminal domain BSA - Bovine serum albumin (Albumina sérica bovina) CAD - Caspase-activated DNase (DNase ativada por caspase) CAPES - Coordenação de Aperfeiçoamento do Pessoal de Nível Superior cdna - DNA complementar CG - Células da granulosa cm - Centímetros CNPq - Conselho Nacional de Desenvolvimento Científico e Tecnológico CO 2 - Dióxido de carbono C-terminal - Carboxi-terminal DCHF-DA - 2,7 -dihydrodichlorofluorescein diacetate DMSO - Dimethylsulfoxide (Dimetilsulfóxido) DNA - Deoxyribonucleic acid (Ácido desoxirribonucleico) DSB - Double-strand breaks (Quebra da fita dupla) e.g. - Exempli gratia (Por exemplo) EG - Ethylene glycol (Etilenoglicol) ER - Endoplasmic reticulum (Retículo endoplasmático)

21 21 Fc - Follicular cells (Células foliculares) Fig. - Figura FINEP - Financiadora de Estudos e Projetos G2/M - Fase do ciclo celular entre Gap 2 e Mitose GAPDH - Glyceraldehyde 3-phosphate dehydrogenase (Gliceraldeído-2-fosfato desidrogenase) GC - Granulosa cells (Células da granulosa) H - Histona h - Hour (Hora) H 2 O 2 - Hydrogen peroxide (Peróxido de hidrogênio) HCl - Ácido clorídrico HE - Hematoxylin-eosin (Hematoxilina-eosina) i.e. - Id est (isto é) ITS - Insulin-transferrin-selenium (Insulina-transferrina-selênio) IU - International unit (Unidade internacional) IVC - In vitro culture (Cultivo in vitro) kv - Kilovolt l - Gotículas lipídicas L - Litro LAMOFOPA - Laboratório de Manipulação de Oócitos e Folículos Ovarianos Pré- Antrais LM - Light microscopy (Microscopia de luz) m - Mitochondria (Mitocôndria) M - Mitocôndrias M - Molar MEM - Minimum essential medium (Meio essencial mínimo) mg - Miligramas MII - Metáfase II min - Minutes (minutos) ml - Mililitros mm - Milímetro mm - Milimolar mm 3 - Milímetros cúbicos mmol - Milimol

22 22 MOIFOPA - Manipulação de Oócitos Inclusos em Folículos Ovarianos Pré-antrais MRN - Complex MRE11-RAD50-NBS1 (Complexo MRE11-RAD50-NBS1) mrna - Messenger ribonucleic acid (Ácido ribonucléico mensageiro) n - número n - Nucleolus (Nucléolo) N - Núcleo do oócito ng - Nanogramas nm - nanômetros Nu - Nucleus (Núcleo) O - Oocyte (Oócito) O 2 - Oxigênio molecular O Radical ânion superóxido OH - Hydroxyl radical (Radical hidroxila) OPS - Open pulled straws OTC - Ovarian Tissue Cryosystem P - Probabilidade de erro pág. - Página PBS - Phosphate buffered saline (Tampão fosfato-salino) PCR - Polymerase chain reaction (Reação em cadeia da polimerase) ph - Pressão de hidrogênio PPGCV - Programa de Pós-graduação em Ciências Veterinárias qpcr - Quantitative PCR (PCR quantitativa) rfsh - Recombinant follicle stimulating hormone (Hormônio folículo estimulante recombinante) ROS - Reactive oxygen species (Espécies reativas de oxigênio) RT - Room temperature (Temperatura ambiente) s - Seconds (Segundos) SCID - Severe combined immunodeficient SD - Standard deviation (Desvio padrão) sec - Seconds (Segundos) SEM - Standard error of means (Erro padrão da média) SNK - Student-Newman-Keuls SSB - Single-strand breaks (Quebra da fita simples) TEM - Transmission electronic microscopy (Microscopia eletrônica de transmissão)

23 23 Tm - Transição da fase cristalina líquida para a fase cristalina gel TUNEL - Terminal deoxynucleotidyl transferase-mediated biotinylated deoxyuridine triphosphates nick end-labeling UECE - Universidade Estadual do Ceará V - Vacuole (Vacúolo) VG - Vesícula germinativa (Germinal vesicle) vol - Volume VS - Vitrification solution (Solução de vitrificação) w/v - Weight/Volume (Relação peso/volume) WS - Washing solution (Solução de lavagem) α-mem - Minimum essential medium alpha (Meio essencial mínimo alfa) γ-h2ax - H2AX fosforilada

24 24 SUMÁRIO 1. INTRODUÇÃO REVISÃO DE LITERATURA Estrutura e fisiologia do ovário dos mamíferos Morfologia ovariana Dinâmica folicular Criopreservação na reprodução assistida Importância da criopreservação a preservação da fertilidade para mulheres e animais domésticos Vitrificação de tecido ovariano Crioinjúrias Aumento na produção de espécies reativas de oxigênio (reactive oxygen species - ROS) Danos ao DNA JUSTIFICATIVA HIPÓTESES CIENTÍFICAS OBJETIVOS Objetivo geral Objetivos específicos CAPÍTULO 1 Caracterização dos danos celulares em gametas femininos e embriões após criopreservação CAPÍTULO 2 Desenvolvimento de um novo dispositivo de vitrificação CAPÍTULO 3 A espessura do tecido pode influenciar o resultado da vitrificação de córtex ovariano caprino CAPÍTULO 4 Novo método de grande capacidade inovadora para vitrificação de ovários caprinos: Ovarian Tissue Cryosystem (OTC) CAPÍTULO 5 Adição de catalase às soluções de vitrificação mantém a estabilidade dos folículos préantrais ovarianos CONCLUSÕES PERSPECTIVAS REFERÊNCIAS BIBLIOGRÁFICAS ANEXOS Anexo 1 - Depósito de Patente Anexo 2 - Consulta à base de dados do INPI Anexo 3 - Aprovação do Comitê de Ética Anexo 4 - Publicações de resultados parciais

25 25 1. INTRODUÇÃO O conhecimento e os avanços obtidos nas últimas duas décadas acerca da reprodução assistida têm resultado em grandes conquistas, tanto para a reprodução humana (DONNEZ et al., 2004) quanto animal (DELA PEÑA et al., 2002). Além disso, já foi demonstradoo nascimento de descendentes saudáveis após procedimentos de criopreservação. Especificamente para a reprodução animal, pesquisas em animais domésticos de grande valor zootécnico (BORDES et al., 2005) e animais em risco de extinção (SILVA et al., 2012a) têm representado um avanço extremamente significativo para a agropecuária e preservação de espécies. Dentre as técnicas de reprodução assistida, pode-se destacar a Manipulação de Oócitos Inclusos em Folículos Ovarianos Pré-antrais (MOIFOPA), que envolvea preservação, o crescimento e a maturação de folículos ovarianos em estágios iniciais de desenvolvimento (folículos pré-antrais), antes que tenham seu mecanismo de morte naturalmente acionado (FIGUEIREDO et al., 2008). Com a MOIFOPA é possível criopreservar o tecido ovariano, permitindo a conservação do material genético de fêmeas por longos períodos (RUBINSKY, 2003). O processo de criopreservação, especificamente no que diz respeito ao método de vitrificação, tem sido investigado desde o início da década de 40 (LUYET et al., 1940), e, desde então, várias pesquisas têm sido realizadas com a finalidade de entender e reduzir os danos causados às células pela exposição a baixas temperaturas. A criopreservação de tecido ovariano pode ser realizada tanto por congelação lenta (SALLE et al., 2003) quanto por vitrificação (LORNAGE et al., 2006). Nos últimos anos, a vitrificação tem se destacado como método de escolha para a criopreservação de tecido ovariano por sua praticidade de aplicação e baixo custo de execução, bem como pelos resultados satisfatórios, inclusive com obtenção de nascimentos em espécies domésticas, como os ovinos (BORDES et al., 2005; LORNAGE et al., 2006) e até mesmo em humanos (KAWAMURA et al., 2013). Além disso, a vitrificação possui como grande vantagem a nula ou baixa formação de cristais de gelo (KEROS et al., 2009), extremamente danosa para a célula (LUNARDI et al., 2012). Em função dessa característica, várias técnicas de vitrificação têm sido desenvolvidas (MONIRUZZAMAN et al., 2009; TSANG; CHOW, 2009, RAHIMI et al., 2003) com a finalidade de maximizar os resultados obtidos.

26 26 A vitrificação de tecido ovariano tem obtido valiosos resultados como a preservação da morfologia folicular em humanos (SALEHNIA et al., 2012), bem como o nascimento de crias saudáveis em ovinos (BORDES et al., 2005; LORNAGE et al., 2006). Apesar dos nascimentos relatados, verifica-se baixa repetibilidade dos resultados em animais domésticos, provavelmente por características inerentes ao processo de vitrificação, como as altas concentrações de agentes crioprotetores. Ademais, as técnicas desenvolvidas até então exigem uma excessiva manipulação do material biológico e, em sua maioria, os dispositivos são constituídos de polipropileno (como por exemplo, palhetas e criotubos), material caracterizado por não ser um bom condutor de calor (SANSINENA et al., 2012). Assim, têm sido desenvolvidas técnicas que visam o contato com o nitrogênio líquido na tentativa de acelerar a redução de calor. Contudo, o contato com o nitrogênio líquido pode ocasionar a contaminação do material biológico (BIELANSKI et al., 2000; BIELANSKI; VAJTA, 2009), impossibilitando um posterior transplante ou mesmo a utilização do material para o cultivo in vitro. Os estudos atuais têm visado o aperfeiçoamento da técnica de forma a garantir a perfeita integridade morfológica, molecular e funcional dos gametas criopreservados. Dessa forma, danos como a produção de espécies reativas de oxigênio (Reactive Oxygen Species - ROS) e danos à integridade do DNA tem ganhado amplitude nos estudos sobre a criopreservação aplicada à reprodução assistida (RAHIMI et al., 2003; SALEHNIA et al., 2012). Para melhor evidenciar a contribuição científica e tecnológica desta tese, a revisão de literatura a seguir constitui-se de um levantamento sucinto acerca da estrutura e fisiologia do ovário dos mamíferos, dinâmica folicular, criopreservação na reprodução assistida, vitrificação de tecido ovariano e crioinjúrias, com destaque para a produção de ROS e danos ocasionados ao DNA.

27 27 2. REVISÃO DE LITERATURA 2.1. ESTRUTURA E FISIOLOGIA DO OVÁRIO DOS MAMÍFEROS O ovário é um dos órgãos mais importantes do sistema reprodutor feminino e possui duas funções fundamentais para a manutenção da fertilidade: (i) função gametogênica ou exócrina e (ii) função endócrina (GOUGEON, 2004). Quanto à sua função exócrina, este órgão é responsável por garantir o desenvolvimento dos folículos ovarianos e possibilitar a ovulação de um oócito apto a ser fertilizado (SAUMANDE, 1991). Do ponto de vista endócrino, o ovário possui a capacidade de produzir fatores de crescimento e hormônios responsáveis por dar suporte ao crescimento folicular e preparação do organismo feminino para receber o possível embrião (HIRSHFIELD, 1991) MORFOLOGIA OVARIANA A dimensão do ovário dos mamíferos possui uma variação dependente da espécie e da fase do ciclo ovariano (HAFEZ; HAFEZ, 2004). Porém, de forma geral, esse órgão é ovoide, apresenta uma forma de amêndoa (JUNQUEIRA; CARNEIRO, 2004) e é dividido em duas regiões (Figura 1), uma cortical e uma medular (GARTNER; HIATT, 2007; JUNQUEIRA; CARNEIRO, 2004). Na grande maioria dos mamíferos, a região cortical é localizada externamente (FIGUEIREDO et al., 2008). A região cortical é pouco vscularizada, na qual estão presentes células do estroma e folículos ovarianos em diferentes estágios de desenvolvimento (JUNQUEIRA; CARNEIRO, 2004; HAFEZ; HAFEZ, 2004). Já a região medular, em geral localizada na parte interna do ovário, é responsável pela sustentação, vascularização e inervação do órgão, sendo constituída por numerosos vasos sanguíneos e linfáticos, nervos e tecido conjuntivo frouxo (GARTNER; HIATT, 2007; JUNQUEIRA; CARNEIRO, 2004). A superfície do ovário é revestida por epitélio cúbico simples em sua maior extensão e, sob esse epitélio, o estroma forma uma camada de tecido conjuntivo denso e sem vasos, a albugínea do ovário (JUNQUEIRA; CARNEIRO, 2004).

28 28 Figura 1. Desenho esquemático da morfologia do ovário da maioria dos mamíferos. Notem-se a região medular, e os folículos em diferentes estágios de desenvolvimento, localizados na região cortical (adaptado de GUYTON; HALL, 2006) DINÂMICA FOLICULAR O processo de formação e crescimento folicular é denominado foliculogênese (FIGUEIREDO et al., 2008). O folículo é considerado a unidade morfofuncional do ovário e é caracterizado por um oócito circundado por células somáticas (células da granulosa e da teca) e, com o avançar do desenvolvimento, nota-se nessa estrutura a zona pelúcida e a cavidade antral preenchida por fluido folicular (McGEE; HSUEH, 2000). O folículo é responsável por albergar o oócito, permitindo que o mesmo complete seu desenvolvimento e maturação (CORTVRINDT; SMITZ, 2001). Com o desenvolvimento, o folículo passa por mudanças morfológicas, resultando em diferentes categorias foliculares de acordo com o seu estágio de evolução (HULSHOF et al., 1994). Os folículos ovarianos podem ser classificados em duas grandes categorias: (i) folículos pré-antrais e (ii) folículos antrais. Essa grande classificação diz respeito à presença ou não de uma cavidade antral, sendo que somente os folículos antrais possuem essa cavidade (VARGHESE et al., 2008). Os folículos pré-antrais representam a fase inicial do desenvolvimento folicular e podem ser subdivididos em primordiais, intermediários, primários e secundários (FIGUEIREDO et al., 2008). O folículo primordial encontra-se em estágio de quiescência e representa a reserva oocitária

29 29 ovariana. Os folículos nesse estágio são caracterizados por um oócito localizado centralmente circundado por células da granulosa de formato pavimentoso (JUNQUEIRA; CARNEIRO, 2004). Através de mecanismos ainda completamente não elucidados, alguns folículos são selecionados para deixarem o estágio de quiescência e prosseguirem seu desenvolvimento (FIGUEIREDO et al., 2008). Esse desenvolvimento é marcado pela mudança conformacional das células da granulosa, que passam do formato pavimentoso para uma forma cúbica. Assim, um folículo que possui células da granulosa tanto de formato pavimentoso quanto cúbico é denominado intermediário. Quando o oócito passa a ser circundado somente por células da granulosa de formato cúbico os folículos são então denominados primários. A partir dessa fase, o desenvolvimento é caracterizado pela multiplicação das células da granulosa, passando o folículo a apresentar duas ou mais camadas de células da granulosa cúbicas. Nessa fase, o folículo passa a ser denominado secundário. Na fase subsequente já pode ser observada a cavidade antral e o folículo é então denominado de terciário (fase antral inicial) e, com o aumento do líquido folicular, o oócito fica preso ao folículo por um pedículo constituído por células foliculares e passa a ser denominado folículo préovulatório (JUNQUEIRA; CARNEIRO, 2004; MAGOFFIN et al., 2005; RAJKOVIC et al., 2006). Numericamente, a população folicular, na maioria dos mamíferos, é estabelecida ainda na vida intrauterina (ZUCKERMAN, 1951) e, a partir de então, ocorre uma redução sistemática nesse pool folicular (SHAW; ORANRATNACHAI; TROUNSON, 2000). Somente a minoria dos folículos chega à ovulação (0,1%), enquanto a grande maioria é perdida pelo processo de atresia (FIGUEIREDO et al., 2008). A depleção folicular decorre principalmente da apoptose, processo também conhecido como morte celular programada (KIESS; GALLAHER, 1998). Esse evento acomete tanto folículos pré-antrais quanto folículos antrais (TILLY, 1996; MAGOFFIN et al., 2005) e exerce um papel importante no controle e regulação do número de folículos que serão ovulados (KIESS; GALLAHER, 1998, GLAMOCLIJA et al., 2005). Assim, a depleção folicular, na maioria das espécies permite que apenas um oócito seja ovulado em cada ciclo. Portanto, a grande maioria dos folículos é naturalmente eliminada, representando uma limitação para as técnicas de reprodução assistida. Felizmente, a Manipulação de Oócitos Inclusos em Folículos Ovarianos Pré- Antrais (MOIFOPA) é uma alternativa de grande relevância para a reprodução assistida uma vez que permite a preservação e o desenvolvimento dos folículos pré-antrais em

30 30 um ambiente extraovariano, ausente de fatores que permitam a dominância folicular e apoptose dos folículos subordinados (FIGUEIREDO et al., 2008). Assim, a MOIFOPA, além do isolamento folicular consiste ainda em: (i) criopreservação, que permite salvaguardar o material genético feminino, e (ii) cultivo in vitro, que possibilita o desenvolvimento dos folículos ovarianos pré-antrais (FIGUEIREDO et al., 2007). A criopreservação de folículos pré-antrais inclusos no tecido ovariano caracteriza-se como uma biotécnica de grande importância por permitir preservar milhares de oócitos a partir de um único ovário (FIGUEIREDO et al., 2007). Desta forma, pode contribuir para a manutenção da função ovariana (ARAV et al., 2010), permitindo a retomada da função reprodutiva após a descongelação e transplante CRIOPRESERVAÇÃO NA REPRODUÇÃO ASSISTIDA A criopreservação é uma técnica que visa a preservação celular a temperaturas ultrabaixas, também conhecidas como temperatura criogênicas (RUBINSKY, 2003). Em geral, utiliza-se a temperatura do nitrogênio líquido (-196 C), mas sabe-se que abaixo de -40 C a atividade físico-química das células já se encontra suspensa, podendo, então, essas células serem preservadas por períodos indeterminados (BAKHACH, 2009). Essa preservação celular está diretamente relacionada à capacidade da célula de resistir às etapas do procedimento de criopreservação, que se resumem em cinco: (i) exposição aos agentes crioprotetores; (ii) resfriamento; (iii) armazenamento; (iv) aquecimento, e (v) remoção dos agentes crioprotetores (SANTOS et al., 2008). A primeira etapa é a exposição aos agentes crioprotetores. Nesta fase, o objetivo é garantir que a célula perca água, para reduzir a formação de cristais de gelo intracelular, e que a mesma seja substituída por substâncias que proporcionem uma maior estabilidade às células em baixas temperaturas. A segunda etapa consiste no resfriamento das células. Nesta etapa, a água passa do estágio líquido para o sólido, na qual podem ocorrer danos em virtude da redução da temperatura e formação de cristais de gelo intracelular. Em seguida, o material é armazenado em baixas temperaturas (terceira etapa), podendo permanecer nesta condição por períodos indefinidos. No momento adequado, o material criopreservado é então aquecido, com o intuito de que as células voltem à sua temperatura adequada e retomem seu metabolismo normal. Por

31 31 fim, é realizada a remoção do agente crioprotetor do interior da célula ou tecido, sendo substituído por água, e a célula é, portanto, reidratada (SANTOS et al., 2008). A criopreservação pode ser realizada por dois métodos, a congelação lenta e a vitrificação (congelação ultra-rápida) (RAHIMI et al., 2003; SALLE et al., 2003). Independente do método adotado, a criopreservação tem sido bastante utilizada na reprodução assistida por permitir que o material genético de animais e humanos sejam preservados por longos períodos e possam ser resgatados para, no momento mais oportuno, propiciar o nascimentos de descendentes saudáveis (DELA PEÑA et al., 2002; SALLE et al., 2003; BORDES et al., 2005). A criopreservação tem se mostrado uma técnica segura e satisfatória e tem sido amplamente empregada para a preservação de embriões (TSANG; CHOW, 2009), sêmen (BILODEAU et al., 2000), oócitos (GUPTA et al., 2010) e tecido ovariano (BORDES et al., 2005) IMPORTÂNCIA DA CRIOPRESERVAÇÃO A PRESERVAÇÃO DA FERTILIDADE PARA MULHERES E ANIMAIS DOMÉSTICOS Desde o princípio dos anos 2000, a criopreservação de tecido ovariano tem ganhado grande destaque para aplicação da reprodução assistida no sexo feminino por salvaguardar um grande número de oócitos (DELA PEÑA et al., 2002). Além disso, a criopreservação de tecido ovariano também permite, após o transplante, a revascularização tecidual (ARAV et al., 2010; RAHIMI et al., 2010) bem como a restauração da função reprodutiva. Este fato já foi evidenciado pela retomada da função endócrina (dosagens hormonais), acompanhamento dos ciclos ovarianos após a criopreservação (ARAV et al., 2010; DONNEZ et al., 2011), gestação e obtenção de descendentes em murinos (CHEN et al., 2006; HASEGAWA et al., 2006), ovinos (BORDES et al., 2005; LORNAGE et al., 2006) e humanos (ERNST et al., 2010). Esta biotécnica tem sido bastante indicada para utilização em mulheres com câncer (SALLE et al., 2003), pois as drogas utilizadas nos tratamentos oncológicos atuam interrompendo o ciclo de proliferação celular normal (MALTARIS et al., 2009) atingindo não apenas as células cancerosas, mas também a capacidade reprodutiva, por serem gonadotóxicas (BEN-AHARON et al., 2010). Assim, preservar as células germinativas femininas antes da administração desses medicamentos gonadotóxicos é uma alternativa de grande relevância para mulheres que desejam gerar uma criança após a cura da doença. A criopreservação de tecido ovariano tem ganhado destaque na

32 32 reprodução humana por não necessitar de estimulação hormonal (ZHOU et al., 2010), como ocorre para a criopreservação de oócitos maturos ou embriões. Assim, nos casos emergenciais, não há atrasos no início do tratamento oncológico, bem como evita a estimulação de células cancerosas dependentes de estradiol (ZHOU et al., 2010). Além de não depender da fase do ciclo reprodutivo, a criopreservação de tecido ovariano também pode ser realizada em mulheres muito jovens (SHAW; ORANRATNACHAI; TROUNSON, 2000), sendo, por isso, recomendada para meninas que ainda não tenham atingido a maturidade sexual (VARGHESE et al., 2008). Esta técnica também pode ser realizada em mulheres adultas, contudo, é aconselhável para pacientes até os 38 anos, uma vez que a partir dessa idade ocorre uma abrupta perda dos folículos ovarianos (FADDY, 2000). Somada às vantagens já mencionadas, a criopreservação de tecido ovariano também supera questões éticas, legais e religiosas, especialmente quando realizada em humanos (ZHANG et al., 2009). A criopreservação também tem ganhado destaque por preservar genótipos valiosos e/ou raros (SILVA et al., 2012a). Dessa forma, evidencia-se que sua aplicação também é de grande importância para animais zootecnicamente valiosos, bem como animais em risco de extinção (COZZI; WHITE, 1995; WANDERLEY et al., 2012, SILVA et al., 2012b). Na reprodução animal, a criopreservação de tecido ovariano tem sido utilizada com o intuito de preservar o material genético de animais de alto valor zootécnico que venham a óbito inesperado (SHAW; ORANRATNACHAI; TROUNSON, 2000). Dessa forma, mesmo após sua morte, o animal pode continuar propagando sua genética por meio da reprodução assistida e possibilitar o melhoramento genético de rebanhos em diferentes localizações geográficas. Além disso, a criopreservação de tecido ovariano também tem grande relevância para espécies ameaçadas de extinção (COZZI; WHITE, 1995), viabilizando menor manipulação desses animais, por não necessitar de tratamentos hormonais (ZHOU et al., 2010), permitindo a obtenção do material genético de forma mais rápida e segura. Partindo dessa ideia geral, a criopreservação de tecido ovariano permite a preservação do pool folicular por períodos indeterminados (RUBINSKY, 2003), bem como possibilita a retomada da função endócrina quando associada ao transplante de ovário previamente criopreservado (BORDES et al., 2005). A reserva folicular é constituída principalmente por folículos na fase inicial de desenvolvimento (cerca de 90%), isto é, folículos primordiais (KATSKA-KSIAZKIEWICZ, 2006). Apesar de oferecer riscos à função celular, a criopreservação de folículos nesse estágio de

33 33 desenvolvimento é mais segura, uma vez que os oócitos presentes nesses folículos são mais crioresistentes. Essa resistência é conferida por fatores tais como: (i) o pequeno tamanho do oócito; (ii) a baixa taxa metabólica; (iii) o estágio do ciclo celular (parado em prófase I e, portanto, sem presença do fuso meiótico); (iv) o pequeno número de células de suporte; (v) a ausência de zona pelúcida; (vi) a ausência de grânulos corticais e (vii) a pequena quantidade de lipídios intracitoplasmáticos (SHAW; ORANRATNACHAI; TROUNSON, 2000; KAGAWA; SILBER; KUWAYAMA, 2009) VITRIFICAÇÃO DE TECIDO OVARIANO A congelação lenta tem sido utilizada com sucesso há décadas (GOSDEN et al., 1994; COX; SHAW; JENKIN, 1996; SALLE et al., 2003), contudo, a formação intracelular de cristais de gelo é uma das maiores desvantagens desse método e pode resultar em severos danos celulares (LUNARDI et al., 2012). Ao contrário, a vitrificação tem ganhado destaque por ser um método de criopreservação ultra-rápido que resulta na solidificação sem cristalização, ou seja, sem formação intracelular de cristais de gelo (BAGCHI; WOODS; CRITSER, 2008; KEROS et al., 2009). A etapa crítica da vitrificação é a velocidade de redução da temperatura, que deve ser superior à taxa de resfriamento crítico da solução para permitir a formação do estado vítreo antes da organização dos cristais de gelo (POSILLICO et al., 2010). A água possui uma alta taxa de resfriamento crítico, sendo de extrema dificuldade sua solidificação e, portanto, necessária sua substituição por agentes crioprotetores, que possuem uma menor taxa de resfriamento crítico (KIM et al., 2006). Assim, os crioprotetores são componentes chave para o sucesso da vitrificação e devem possuir uma baixa toxicidade e e alta facilidade de transpor a membrana celular, a fim de permitir a penetração de concentração adequada no interior da célula com menores danos (MUKAIDA; OKA, 2012). As leis da termodinâmica revelam que, se um líquido é resfriado suficientemente rápido, pode-se obter um estado sólido amorfo, conhecido como estado vítreo (RUBINSKY, 2003; BALABAN et al., 2008). Por essa característica, a vitrificação tem sido amplamente adotada na reprodução assistida pela simplicidade e rapidez do procedimento (VAJTA et al., 1998). Este método tem sido aplicado com sucesso para a criopreservação de tecido ovariano (DELA PEÑA et al., 2002; BORDES

34 34 et al., 2005, LORNAGE et al., 2006) e diversas técnicas já foram desenvolvidas para este fim (SUGIMOTO et al., 1999; CHEN et al., 2006; CHOI et al., 2007). As técnicas de vitrificação podem ser subdivididas em três grupos: (i) técnicas sem o contato direto com o nitrogênio líquido, (ii) técnicas com contato direto com o nitrogênio líquido e (iii) técnicas com o contato com o vapor de nitrogênio líquido (Figura 2). As técnicas de vitrificação que não têm contato direto com o nitrogênio líquido possuem como principal vantagem a ausência de contaminação do material biológico por patógenos resistentes à temperatura extrema do nitrogênio líquido (BIELANSKI et al., 2000). Contudo, as técnicas inicialmente desenvolvidas, por serem constituídas principalmente por polímeros sintéticos, apresentam como desvantagem a dificuldade de reduzir a temperatura de forma adequada (SANSINENA et al., 2012). Visando aperfeiçoar essa redução de temperatura, algumas equipes têm investido em dispositivos fechados fabricados em materiais metálicos, por serem melhores condutores de calor. Outras equipes têm mantido pesquisas utilizando dispositivos que mantêm o contato direto do material biológico com o nitrogênio líquido (CHEN et al., 2006; CHOI et al., 2007; KIM et al., 2011) mesmo correndo o risco de contaminação das amostras (BIELANSKI et al., 2000; BIELANSKI; VAJTA, 2009). Visando acelerar a redução de temperatura e reduzir a contaminação do material biológico, têm sido utilizadas técnicas que permitam apenas o contato parcial com o nitrogênio líquido, ou seja, com o vapor de nitrogênio. Contudo, já foi demonstrada a resistência de vírus ao vapor de nitrogênio (GROUT; MORRIS, 2009), indicando que essa alternativa pode não apresentar adequada biossegurança.

35 35 Figura 2. Técnicas desenvolvidas para vitrificação de tecido ovariano. (A) vitrificação convencional por palhetas e (B) por criotubos, (C) Cobertura direta, (D) agulhas de acupuntura, (E) Cryosupport e (F) Fiberplug. Imagens obtidas de SAKI; RAHIM; ZERGANI, 2009; WANG et al., 2008; CHEN et al., 2006; HASHIMOTO et al., 2010; BEEBE; NOTTLE, Dentre as técnicas de vitrificação de tecido ovariano que não permitem o contato direto com o nitrogênio líquido, podemos destacar a vitrificação convencional (Figura 2A e B). Esta técnica é amplamente utilizada e consiste da utilização de dispositivos comumente empregados na congelação lenta (palhetas, criotubos ou macrotubos) imersos diretamente no nitrogênio líquido (BORDES et al., 2005; CARVALHO et al., 2011) ou expostos ao vapor de nitrogênio (MAZOOCHI et al., 2008; SALEHNIA et al., 2012). Em 2008, Kader et al. (2008) desenvolveram a técnica de vitrificação Ohio-Cryo que mantém os fragmentos ovarianos em um dispositivo que permite uma rápida substituição dos meios de vitrificação e comprime as amostras no interior deste recipiente buscando acelerar a redução de temperatura por redução do espaço no qual estão os fragmentos ovarianos. Para também acelerar a redução de

36 36 temperatura, foi recentemente desenvolvida a técnica de dispositivo de metal fechado, que consiste em sobrepor o material biológico em uma folha de alumínio que é, então, fechada e sobreposta em nitrogênio líquido. Em seguida, essa folha é inserida em criotubos para o armazenamento da amostra (BOS-MIKICH et al., 2012). As técnicas que possuem o propósito de acelerar a redução de temperatura por contato direto com o nitrogênio líquido são variadas (CHEN et al., 2006; KEROS et al., 2009; KIM et al., 2011). Visando reduzir a quantidade de solução crioprotetora e facilitar a redução de temperatura, foi desenvolvido o método de hemi-palheta, no qual uma palheta de 0,25 ml tem uma extremidade cortada na forma de bisel (constituindo uma hemi-palheta) e uma gota contendo o material a ser vitrificado é então colocada nessa superfície e imediatamente posta em contato com o nitrogênio líquido. Após a vitrificação a hemi-palheta é armazenada no interior de uma palheta maior (0,5 ml) e estocada em botijões criogênicos (KEROS et al., 2009). Para acelerar ainda mais a redução de temperatura, foi desenvolvida a técnica de cobertura direta (Figura 2C), na qual um criotubo, contendo o tecido ovariano, é preenchido por nitrogênio líquido (CHEN et al., 2006; ZHOU et al., 2010). Além desta técnica, também tem sido utilizada a imersão direta do tecido ovariano no nitrogênio líquido sendo estes fragmentos manipulados com pinças (COURBIERE et al., 2006; ISACHENKO et al., 2003) ou perfurados com agulhas de acupuntura (Figura 2D) (WANG et al., 2008; XIAO et al., 2010), ou, ainda, em um Cryosupport (Figura 2E), que consiste em agulhas acopladas a um criotubo, as quais perfuram o tecido ovariano permitindo maior facilidade no manuseio e imersão no nitrogênio (HASHIMOTO et al., 2010). Utilizando o mesmo princípio, a vitrificação por grades de microscopia eletrônica é uma alternativa para maximizar a redução de temperatura, uma vez que essas grades são constituídas de metal e apresentam perfurações que possibilitam o contato direto com o nitrogênio líquido (CHOI et al., 2007; KIM et al., 2011). A utilização do contato da amostra com o vapor de nitrogênio também tem sido amplamente empregada. A vitrificação de tecido ovariano por superfície sólida consiste na imersão parcial de uma superfície metálica em nitrogênio líquido e a sobreposição do tecido ovariano nesta superfície, sendo a vitrificação realizada através da boa condutibilidade de calor, própria do metal (HUANG et al., 2008; CARVALHO et al., 2011; AMORIM et al., 2012). Similarmente, a técnica de Fiberplug (Figura 2F) consiste de uma haste com a extremidade em forma de gancho na qual é colocada a solução de vitrificação e o tecido ovariano a ser criopreservado. Em seguida, o

37 37 Fibreplug é colocado em contato com um bloco de metal imerso em nitrogênio líquido (WANG et al., 2011). Apesar das inúmeras estratégias utilizadas por diferentes equipes para minimizar as crioinjúrias celulares decorrentes da criopreservação, a vitrificação, assim como a congelação lenta, ainda acarreta danos celulares que podem ser letais às células, evidenciando a necessidade de estudos visando encontrar estratégias para solucionar tais problemas CRIOINJÚRIAS Embora a criobiologia tenha evoluído e resultado no nascimento de crias saudáveis tanto por congelação lenta (GOSDEN et al., 1994; SALLE et al., 2003) quanto por vitrificação (BORDES et al., 2005, LORNAGE et al., 2006, KAWAMURA et al., 2013), os processos de exposição aos crioprotetores, redução de temperatura e posterior aquecimento do material criopreservado resultam em danos celulares tanto do ponto de vista estrutural, quanto metabólico (ELLIOTT, 2010; TATONE et al., 2010). Os danos estruturais estão descritos em maiores detalhes no Capítulo 1 desta tese. Portanto, nesta revisão, dentre os danos metabólicos, serão abordados o aumento das ROS e os mecanismos moleculares de identificação de dano e reparo do DNA, os quais estão envolvidos com a perda da viabilidade celular AUMENTO NA PRODUÇÃO DE ESPÉCIES REATIVAS DE OXIGÊNIO (Reactive Oxygen Species - ROS) Os processos biológicos de forma geral resultam na produção de ROS (TATONE et al., 2010), além de serem produzidas também durante o metabolismo anaeróbico (RAHIMI et al., 2003). As ROS são compostos formados durante etapas intermediárias da redução do oxigênio molecular (O 2 ) e são exemplificadas, principalmente pelo radical ânion superóxido ( O - 2 ), o peróxido de hidrogênio (H 2 O 2 ), e o radical hidroxila (OH ), que correspondem às etapas de redução por um, dois ou três elétrons, respectivamente (KOWALTOWSKI; VERCESI, 1999). O H 2 O 2, por ser uma molécula apolar, possui a capacidade de atravessar a membrana celular (VEAL; DAY; MORGAN, 2007) e pode ser convertido em OH (YAN; CHEN; HUA, 2009). Esses radicais possuem uma valência livre e por esta característica são altamente reativos.

38 38 Essa reatividade implica em sequestro de moléculas e início de várias reações de oxidação e redução (TATONE et al., 2010) que podem resultar em alterações nas células, sobretudo com danos nas membranas celulares (DINARA et al., 2001; LANE et al., 2002). O balanço entre moléculas oxidadas e reduzidas no citoplasma da célula (estado redox) é um dos fatores que pode influenciar a sobrevivência celular após a criopreservação. O dano oxidativo à célula já foi descrito durante a criopreservação de tecidos (WHITELEY; FULLER; HOBBS, 1992; LUZ et al., 2012). O processo de criopreservação (resfriamento e aquecimento) aumenta a produção de ROS e causa alterações no metabolismo oxidativo (DOWLING; SIMMONS, 2009). Por essa razão, o estresse oxidativo é um importante fator a ser avaliado com relação às crioinjúrias (TATONE et al., 2010). O aumento das ROS está relacionado com o estresse osmótico em várias células somáticas, assim como em gametas, e pode funcionar como um mecanismo responsável pela resposta adaptativa das células (HALLIWELL; GUTTERIDGE, 1999; BALL; 2008). Além disso, também acredita-se que o reparo das estruturas celulares danificadas pela criopreservação requer geração de energia e subsequente aumento de ROS (ODANI et al., 2003). Após a criopreservação tem sido observada perda da integridade e da viabilidade de espermatozoides (BAIARDI et al, 1997), oócitos (GUPTA et al., 2010) e embriões (LANE et al., 2002). Essas alterações estão, por vezes, associadas à peroxidação lipídica (DINARA et al., 2001; LANE et al., 2002). Em espermatozoides criopreservados foi observada uma redução de 50% dos níveis de antioxidantes dessas células (BILODEAU et al., 2000), o que pode resultar em alteração das propriedades da membrana, interferindo no transporte celular e regulação do ph, em virtude da peroxidação lipídica (LANE et al., 2002). Durante a criopreservação, o estresse oxidativo pode ser gerado através de diferentes mecanismos, como o estresse osmótico e o aumento do metabolismo oxidativo (TATONE et al., 2010). Análises de microarranjo revelaram que células eucarióticas submetidas à criopreservação tem um aumento na expressão de genes associados ao metabolismo energético e à defesa antioxidante (ODANI et al., 2003). A criopreservação pode aumentar as taxas de peroxidação lipídica por aumentar os níveis de ROS (LANE et al., 2002) que degradam os ácidos graxos polinsaturados da membrana plasmática (BAUMBER et al., 2003). O processo de criopreservação altera as condições físico-químicas da célula (STEPONKUS; LYNCH,

39 ; FERNÁNDEZ-SANTOS et al., 2008) e as concentrações elevadas de crioprotetores permeáveis e não permeáveis resultam em estresse osmótico e toxicidade que podem ser responsáveis por crioinjúrias durante a vitrificação de células e tecidos (FAHY et al., 1984). A sensibilidade exacerbada (GUERIN; EL MOUATASSIM; MENEZO, 2001) das células às ROS durante o processo de criopreservação é decorrente do próprio aumento na produção desses compostos (SOMFAI et al., 2007; AHN et al., 2002) ou alteração do potencial antioxidante, resultando em danos a enzimas antioxidantes que protegem as células da peroxidação lipídica (DINARA et al., 2001). Os efeitos de ROS são dose-dependentes e, em níveis elevados, estas moléculas altamente reativas promovem profundas mudanças na célula (TATONE et al., 2010), inclusive, induzindo a expressão de genes envolvidos com a defesa e a regulação do ambiente celular e metabolismo energético (ODANI et al., 2003). Os níveis de ROS parecem aumentar principalmente após o aquecimento celular, uma vez que há a reintrodução do oxigênio nas células criopreservadas bem como a retomada das reações de oxidação-redução, culminando com a produção de ROS como subprodutos dessas reações (EL-WAHSH, 2003; STOREY, 2004, TATONE et al., 2010), evidenciando a necessidade do aumento das defesas antioxidantes após o aquecimento celular. As ROS são originadas tanto intracelularmente, por decorrência do metabolismo celular, quanto extracelularmente, devido a fatores estressantes e agressivos. Seus principais alvos incluem DNA, lipídeos, proteínas e açúcares, sendo que a ordem de preferência de ataque depende de muitos fatores, como o local onde a espécie reativa é gerada, a habilidade relativa de uma biomolécula ser oxidada e a disponibilidade de íons metálicos associados a essa biomolécula (EVANS; DIZDAROGLU; COOKE, 2004). No entanto, enquanto lipídeos, proteínas e açúcares podem ser removidos via degradação, o mesmo não ocorre com o DNA, uma vez que é a molécula responsável por todas as informações genéticas de todas as células de um organismo vivo (BERRA; MENCK, 2006). Desta forma, o dano ao DNA se mostra mais severo e letal às células DANOS AO DNA O molde de DNA para a propagação da informação genética no núcleo de células eucariotas é a cromatina, um polímero dinâmico que serve como uma plataforma

40 40 de controle central para todos os processos intracelulares como replicação e reparo do DNA (KHORASANIZADEH, 2004; WOODCOCK; DIMITROV, 2001). A unidade fundamental da cromatina é o nucleossoma, que consiste de 147 pares de base de DNA envolvendo um octâmero de histona (Figura 3). Esse octâmero é formado por um heterotetrâmero central de histonas H4 e H3, circundado por dois heterodímeros das histonas H2A e H2B (BEDNAR et al., 1995; LUGER et al., 1997). O nucleossoma é uma estrutura dinâmica regulada por inúmeras modificações pós-traducionais das histonas, como, por exemplo, no processo de reparo do DNA. Após o dano ao DNA, a cromatina é modificada para permitir o acesso de proteínas de reparo ao sítio de lesão do DNA (SMERDON et al., 1983). Figura 3. Representação esquemática de um octâmero de histonas consistindo de duas moléculas de H2A, H2B, H3 e H4. Adaptado de ZAIDI et al., A molécula de DNA sofre danos constantemente e o estresse oxidativo resulta não apenas em dano às bases e açúcares, mas também pode causar danos à fita simples (single-strand breaks - SSB) ou danos à fita dupla (double-strand breaks - DSB) (HASSA; HOTTIGER, 2005). Contudo, uma DSB pode também ocorrer a partir de replicação de uma SSB não reparada (BILSLAND; DOWNS, 2005; HASSA; HOTTIGER, 2005). Por ser observada na dupla fita (HASSA; HOTTIGER, 2005) a DSB é a lesão mais deletéria ao DNA para a sobrevivência celular e integridade do genoma (KHANNA; JACKSON, 2001; JACKSON, 2002).

41 41 A resposta celular global à DSB tem sido considerada como uma cascata de transdução de sinal clássica onde as lesões são detectadas por sensores proteicos que ativam cascatas de proteínas quinases, o que resulta em amplificação e a diversificação do sinal através de uma série de moléculas efetoras (KHANNA; JACKSON, 2001; JACKSON, 2002). Esse mecanismo de detecção e sinalização dos danos, conhecido como checkpoint (ponto de verificação), representa a primeira resposta celular contra lesões no DNA (SHACKELFORD et al., 2001). O checkpoint permite que as células interrompam o ciclo celular e tenham tempo para reparar os danos, antes de recomeçar o ciclo e completar eventos subsequentes, como a replicação de DNA e mitose (SHACKELFORD et al., 2001). Dentre os sinais de amplificação, as modificações na cromatina e suas histonas parecem exercer um papel crucial na sinalização do dano do DNA. Modificações nas histonas podem servir como um sinal de amplificação para marcar posições específicas de dano ao DNA e proporcionar uma interação ou um sítio de localização para os mecanismos de reparo correspondentes (HASSA; HOTTIGER, 2005). A histona H2A possui três subfamílias, a H2A1-H2A2, a H2AZ e a H2AX (RAGAKOU et al., 1998). Em mamíferos, de acordo com o tipo celular, a H2A1-H2A2 varia em função do percentual de H2AZ e H2AX (RAGAKOU et al., 1998) e estas representam, respectivamente, cerca de 10% e 2-25% do total de histonas (ZWEIDLER, 1976). A H2AX constitui uma das principais variantes da histona H2A (FERNANDEZ- CAPETILLO et al., 2004) e tem grande relevância por possuir um resíduo de serina altamente conservado que é rapidamente fosforilado, um processo que parece ser essencial para a sinalização de dano e recrutamento de fatores de reparo (BERRA; MENCK, 2006, RAGAKOU et al., 1998). A fosforilação da histona H2AX ocorre no resíduo de serina 139 da região carboxi-terminal (C-terminal), resultando na γ-h2ax (KARAGIANNIS; EL-OSTA, 2007), cuja modificação está relacionada especificamente à DSB (FERNANDEZ- CAPETILLO et al., 2004). A γ-h2ax atua como um marcador sensível à DSB sendo considerada uma ferramenta valiosa para a identificação deste tipo de dano (KARAGIANNIS; EL-OSTA, 2007). A fosforilação da H2AX é essencial para a retenção e posterior aumento na concentração de fatores de reparo aos sítios de dano do DNA e para amplificar o sinal de DSB (BILSLAND; DOWNS, 2005). Quando ocorre uma DSB, em poucos minutos forma-se um foco nuclear de γ- H2AX que recruta fatores de reparo como o complexo MRN, MDC1 e 53BP1

42 42 (BUCHMANN; SKAAR; DECAPRIO, 2004). O complexo MRN é extremamente conservado e é formado pelas proteínas Mre11, Rad50 e Nbs1 (D'AMOURS; JACKSON, 2002; TAUCHI et al., 2002). Este complexo está envolvido no reparo inicial da DSB devido a sua capacidade de se ligar ao DNA lesado (PETRINI et al., 2001; D'AMOURS; JACKSON, 2002). O complexo MRN se adere ao sítio da DSB, tão logo o dano ocorra (KOBAYASHI et al., 2002; TAUCHI et al., 2002) e é considerado um dos estágios iniciais da resposta à DSB (UZIEL et al., 2003). A 53BP1 (p53 binding protein 1) foi identificada através da sua habilidade de se ligar à proteína p53 através de sua região BRCT (IWABUCHI et al., 1994), também encontrada em muitas proteínas que atuam em resposta ao dano do DNA (JOO et al., 2002) e que parece mediar as interações proteína-proteína envolvidas nesse processo (IWABUCH et al., 1998). Inicialmente foi proposto que a 53BP1 possuía uma função como um co-ativador transcricional da p53 (IWABUCHI et al., 1998). No entanto, a presença do domínio BRCT sugere que a 53BP1 possui um papel direto na resposta ao dano do DNA (SCHLUTZ et al., 2000). A ligação da 53BP1 ao domínio central da p53 é requerida para a ligação sítio-específica ao DNA lesado (VOGELSTEIN; LANE; LEVINE, 2000). Além disso, a 53BP1 está co-localizada com o foco da γh2ax em células com DSB em avaliação imediata (5 min) e tardia (8 h) (SCHLUTZ et al., 2000). Portanto, a 53BP1 é uma proteína envolvida na resposta ao dano do DNA que é rapidamente recrutada ao sítio da DSB, onde parece funcionar em um subconjunto com a γh2ax (FERNANDEZ-CAPETILLO et al., 2004). Experimento utilizando RNA de interferência demonstrou que a 53BP1 é essencial para o acúmulo de p53 e do checkpoint celular na fase de transição G2-M do ciclo celular, em resposta ao dano do DNA (IWABUCHI et al., 2003), bem como para o recrutamento de fatores relacionados ao reparo do DNA (Figura 4), indicando que a 53BP1 é um fator central para o reparo (IWABUCHI et al., 2003). A 53BP1 se acumula no foco da DSB e sua atuação é dependente da interação com a γh2ax (WARD et al., 2003).

43 43 Figura 4. Via de checkpoint 53BP1-dependente. A DSB resulta na fosforilação da H2AX próximo ao dano do DNA, culminando com o recrutamento e fosforilação da 53BP1 no foco nuclear. A 53BP1, por sua vez, recruta outros fatores, como a p53, e culmina com a parada do ciclo celular, ativação do checkpoint e reparo do DNA. Adaptado de ABRAHAM, Em suma, a resposta ao dano do DNA é constituída por três componentes: sensores de dano, transdutores de sinal e transmissores dos sinais de dano do DNA (ZHOU; ELLEDGE, 2000). Dependendo do nível de dano do DNA, essas ações ativam maquinarias celulares aptas a executarem as três funções de resposta ao dano do DNA. A primeira função é a parada do ciclo celular, que é essencial para a ocorrência das duas outras funções. Após a parada do ciclo celular, a célula será direcionada para o reparo do DNA ou para a apoptose celular (ZHOU; ELLEDGE, 2000; HASSA; HOTTIGER, 2005). A apoptose é um processo complexo e geneticamente determinado, que é estabelecido pelo balanço de fatores anti- e pró-apoptóticos (ANAZETTI; MELO, 2007). Essa morte celular é ativada por mecanismos intrínsecos e extrínsecos, como estresse oxidativo e dano no DNA (JOHNSTONE; RUEFFI; LOWE, 2002). O início, a

44 44 execução e a regulação da apoptose envolve inúmeros fatores bioquímicos, e a família das caspases exercem um papel central na via de sinalização da apoptose (CELESTINO et al., 2009). As caspases são expressas como co-enzimas e, quando ativadas, desencadeiam a morte celular programada (CELESTINO et al., 2009; ZHANG et al., 2013). As caspases são divididas em caspases iniciadoras (caspase-2, -8, -9 e -10) e caspases efetoras (caspase-3, -6 e -7) (STRASSER; O CONNOR; DIXIT, 2000). As caspases iniciadoras são clivadas em resposta a estímulos apoptóticos e ativam as caspases efetoras (GREEN, 2003). As caspases efetoras, por sua vez, ativam a DNase ativada por caspase (caspase-activated DNase - CAD) responsável pela fragmentação internucleossomal do DNA (NAGASE et al., 2003) e resultam na fragmentação do DNA, degradação do citoesqueleto e de proteínas nucleares, bem como a formação de corpos apoptóticos (ELMORE, 2007). Embora os estudos sobre os danos da criopreservação sobre a morfologia e viabilidade celular sejam extensos, ainda são escassos os estudos sobre os efeitos que a criopreservação pode causar ao DNA. Assim, é fundamental que a influência das biotécnicas reprodutivas seja avaliada sob a óptica das alterações causadas sobre o DNA.

45 45 3. JUSTIFICATIVA Como pode ser constato na revisão de literatura, embora existam vários relatos de nascimento de prole saudável em espécies como humanos, murinos e ovinos após a criopreservação de tecido ovariano, resultados como esses não têm sido observados em outras espécies como os caprinos, por exemplo. Uma das razões pode ainda estar relacionada com o próprio método de criopreservação comumente empregado, ou seja, a congelação lenta, no qual os principais danos celulares são decorrentes da formação intracelular de cristais de gelo. Desta forma, a vitrificação tem sido utilizada como uma alternativa para reduzir esses danos, uma vez que neste método, em função da concentração elevada de crioprotetores e da temperatura ultrabaixa, o estado líquido da solução de vitrificação se transforma em um estado sólido amorfo (estado vítreo), no qual não ocorre a formação de cristais de gelo. No entanto, a vitrificação também oferece riscos às células ou tecidos, os quais podem ser decorrentes de uma redução de temperatura ineficiente, toxicidade das altas concentrações de crioprotetores, contaminação pelo nitrogênio líquido, dentre outros. Dentre as técnicas utilizadas para vitrificação de tecido ovariano, a superfície sólida destaca-se pelos diversos estudos realizados e resultados satisfatórios obtidos, como a manutenção da morfologia (SANTOS et al., 2007) e viabilidade (CARVALHO et al., 2011) folicular similar ao tecido fresco. Contudo, essa técnica constitui-se de um sistema aberto que permite o contato com o vapor de nitrogênio, que, de acordo com alguns autores, também oferece risco de contaminação para o material biológico (GROUT; MORRIS, 2009). Portanto, nesta tese foi desenvolvido um sistema fechado de superfície sólida utilizando um dispositivo manufaturado em aço inoxidável que, além de evitar o contato direto com o vapor ou o próprio nitrogênio líquido, é um excelente condutor de calor. Além disso, o dispositivo desenvolvido é prático e possibilita a manipulação das soluções crioprotetoras ou de remoção dos crioprotetores de forma rápida e segura, reduzindo também os riscos de contaminação das amostras pelos manipuladores. Adicionalmente, o dispositivo também permite a criopreservação simultânea de vários fragmentos de forma eficaz, bem como possibilita a vitrificação de dimensões maiores de tecido ovariano, como a metade de ovário e o ovário inteiro. Apesar das vantagens proporcionadas por essa técnica frente a outras já descritas na literatura, a criopreservação, seja por congelação lenta ou vitrificação, pode aumentar os níveis de ROS que culminam com alteração na molécula de DNA e consequente

46 46 perturbação na função celular. Portanto, na tentativa de minimizar danos dessa natureza, é necessário o aperfeiçoamento das soluções empregadas na vitrificação, como por exemplo, a utilização de agentes antioxidantes visando reduzir a produção de ROS. A utilização da espécie caprina nesta tese tem um significado tanto para a pesquisa básica, como para a pesquisa aplicada. Para a pesquisa básica, devido à estrutura morfológica e funcional do ovário, assim como devido ao processo de foliculogênese da cabra apresentar similaridades ao da mulher, o ovário caprino é amplamente utilizado como modelo para extrapolação em estudos com ovários humanos. Além disso, no que concerne ao estudo de folículos pré-antrais, a espécie caprina já é bastante estudada pela nossa equipe, o que nos fornece bastantes subsídios para uma análise mais segura do comportamento folicular após os procedimentos de criopreservação e cultivo in vitro. No tocante à pesquisa aplicada, a utilização da espécie caprina para esse estudo é de grande interesse, pois os resultados poderão ser utilizados para a preservação do material genético de animais de alto valor zootécnico, raças em risco de extinção, bem como de animais transgênicos. Especificamente em relação a esses últimos, é conhecido que caprinos transgênicos têm sido produzidos com a finalidade de secretar substâncias terapêuticas no leite (FREITAS et al., 2012). Aliado a isso, essa espécie tem ainda outro valor agregado para a saúde humana, pois seu leite representa uma alternativa nutricional viável para indivíduos que apresentam sensibilidade à lactose bovina. Desta forma, o desenvolvimento de uma técnica de vitrificação segura e eficiente e o aperfeiçoamento das soluções utilizadas no procedimento, visando reduzir as crioinjúrias, é de extrema relevância para a pesquisa e consequente avanço da criobiologia, bem como para a aplicabilidade prática do processo de criopreservação do material genético de fêmeas.

47 47 4. HIPÓTESES CIENTÍFICAS Todas as etapas do processo de vitrificação podem ser realizadas em um sistema fechado de superfície sólida, garantindo mais segurança à amostra a ser criopreservada; A utilização de um dispositivo que possibilite a vitrificação vários fragmentos ovarianos, bem como a metade de um ovário ou ovário inteiro não altera a morfologia e viabilidade folicular; A vitrificação de tecido ovariano em fragmento, metade de ovário e ovário inteiro realizada em um novo dispositivo fechado não afeta a capacidade de desenvolvimento folicular; A adição de catalase no procedimento de vitrificação reduz os níveis de ROS e os consequentes danos celulares.

48 48 5. OBJETIVOS 5.1 OBJETIVO GERAL Desenvolver uma técnica de vitrificação em um sistema fechado que permita a criopreservação de vários fragmentos, metade ou ovário inteiro, bem como a realização de todos os procedimentos em um mesmo dispositivo. 5.2 OBJETIVOS ESPECÍFICOS Avaliar a morfologia e viabilidade folicular após vitrificação em fragmento, metade de ovário e ovário inteiro por um novo sistema de superfície sólida fechado; Verificar o efeito da adição de catalase na solução de vitrificação e/ou remoção do agente crioprotetor sobre a morfologia e viabilidade folicular e níveis de ROS; tecido ovariano; Avaliar a fragmentação do DNA de folículos pré-antrais após vitrificação do Investigar a imunomarcação de proteínas envolvidas no dano e reparo do DNA de folículos pré-antrais após vitrificação do tecido ovariano.

49 49 6. CAPÍTULO 1 Caracterização dos danos celulares em gametas femininos e embriões após criopreservação Characterization of cellular damage in female gametes and embryos after cryopreservation Periódico: Acta Scientiae Veterinariae, v. 40, n. 3, p. 1046, 2012.

50 50 RESUMO A criopreservação é uma biotécnica utilizada com sucesso em gametas femininos e embriões. Esta técnica possui grande importância para a propagação do material genético de animais de alto valor zootécnico, bem como para preservar a fertilidade de mulheres que precisem de tratamentos oncológicos. Contudo, a criopreservação pode resultar em danos à membrana, às organelas citoplasmáticas e ao núcleo celular. A primeira estrutura a sofrer os danos decorrentes da criopreservação é a membrana celular, responsável pela homeostase no interior da célula. A criopreservação também altera a estrutura morfológica e distribuição das gotas lipídicas, resultando em danos aos lipídios associados ao citoesqueleto celular causando deformação e ruptura do citoesqueleto. Entre as organelas celulares, as mitocôndrias são mais sensíveis ao procedimento de criopreservação, uma vez que os cristais de gelo intracelulares decorrentes da criopreservação ocasionam danos à crista e matriz mitocondrial. Além da mitocôndria, o retículo endoplasmático também se mostra sensível à criopreservação, sendo observada alterações da morfologia desta organela após a vitrificação de embriões. É também conhecido que a criopreservação pode resultar em fragmentação do DNA culminando com parada do desenvolvimento e morte celular. Além disso, a criopreservação também pode ocasionar anormalidades cromossômicas, sendo a aneuploidia a mais frequente e associada à baixa taxa de nascimentos após a criopreservação de oócitos. A redução na sobrevivência de oócitos e embriões após a criopreservação parece estar diretamente relacionada aos danos em diferentes compartimentos e estruturas celulares, os quais são essenciais para a manutenção do metabolismo celular. Assim, observa-se a necessidade de se obter protocolos de criopreservação capazes de manter a integridade dos diferentes componentes celulares. Palavras-chave: Crioinjúria. Oócitos. Organelas celulares. Tecido ovariano.

51 51 Caracterização dos danos celulares em gametas femininos e embriões após criopreservação Characterization of Cellular Damage in Female Gametes and Embryos after Cryopreservation Adeline de Andrade Carvalho, Luciana Rocha Faustino, Simone Vieira Castro, José Ricardo de Figueiredo & Ana Paula Ribeiro Rodrigues ABSTRACT Background: Cryopreservation is a biotech successfully employed in female gametes and embryos. This technique is of great importance for propagation of genetic material from animals with high-value livestock, as well as to preserve the fertility of women undergoing cancer treatments. However, low temperatures can result in damage to different cellular compartments and organelles. This damage culminates in reduced viability, since they affect cell metabolism. Review: Cryopreservation consists of maintenance of biological material at low temperatures, in which chemical reactions are ceased, however, allowing the cells to preserve their viability. However, the decrease of temperature and subsequent warming may result in cellular damage. These damages occur in the cell membrane, cytoplasmic organelles and the cell nucleus. It is believed that the first cell structure undergoing cryoinjury is the plasma membrane, responsible for maintaining homeostasis within the cell, and the loss of plasma membrane during temperature reduction is reported to be the main damage. The membrane damage due to cryopreservation appears to correlate with the reduction of thermal energy at low temperatures, thus limiting the movement of molecules through the phospholipids of lipid bilayer. Cryopreservation also alters the morphology, structure and cellular distribution of lipid droplets, reducing the survival of oocytes and embryos. The physical state changes, besides changing physicochemical properties of intracellular lipid may also result in damage to lipids associated with the cellular cytoskeleton. The interaction between cell lipid phase and components of cytoskeleton is complex and hardening of these lipids can cause deformation and

52 52 disruption of cytoskeleton with consequent negative effect on cell survival and development. The disruption of cytoskeleton can also be intrinsic to change in dehydration and cellular form that follow the cryopreservation process. Among the cellular organelles, mitochondria are sensitive to cryopreservation procedures, since the formation of intracellular ice crystals considered one of the most relevant cryoinjury, leading to damage to the mitochondrial cristae and matrix. Another important organelle that undergoes damage as result of cryopreservation is the endoplasmic reticulum, that change in morphology has been described after vitrification of embryos. It is also known that cryopreservation may result in fragmentation of DNA even in the absence of deformation of the cellular morphology, and that these changes can lead to delay in the development or cell death. In addition to the direct damage to double-stranded DNA, cryopreservation may trigger chromosomal abnormalities, the aneuploidy is the most frequent and seems to compromise the developmental competence of oocytes in addition to being indicated as the main factor for the low achieve of live births. Conclusion: Cryopreservation is an important alternative for the preservation of gametes and embryos, however, the cells are subjected to unfavorable conditions that can compromise cell recovery after thawing/warming. The main cause of reduction in survival oocytes and embryos after cryopreservation appear to be related to damage in different cellular compartments and structures, which are essential for maintaining cell metabolism. Thus, it is observed the need to achieve cryopreservation protocols capable of maintaining the integrity of different cellular components. Keywords: cryopreservation, cryoinjury cellular, oocytes, female gametes, embryos, ovarian tissue. Descritores: criopreservação, crioinjúria celular, oócitos, gametas femininos, embriões, tecido ovariano.

53 53 I. INTRODUÇÃO II. BASES GERAIS DA CRIOPRESERVAÇÃO CELULAR III. CARACTERÍSTICAS GERAIS DAS CÉLULAS EUCARIÓTICAS IV. PRINCIPAIS DANOS CELULARES CAUSADOS PELA CRIOPRESERVAÇÃO 1. Danos de membrana 2. Danos em gotículas lipídicas intracitoplasmáticas e citoesqueleto 3. Danos em organelas celulares 4. Danos nucleares V. CONCLUSÃO VI. REFERÊNCIAS I. INTRODUÇÃO A criopreservação é uma técnica que tem despertado grande interesse para a reprodução assistida nos últimos 15 anos, principalmente desde os primeiros relatos de nascimentos em ovinos [39] e humanos [25] após o transplante de tecido ovariano previamente criopreservado. Portanto, é compreensível a aplicação cada vez mais frequente dessa técnica com a finalidade de preservação de gametas femininos com o objetivo final de manutenção da função reprodutiva da fêmea ou mesmo a produção de crias após impossibilidade de reprodução natural ou radicalmente, após a morte do animal. Considerando a crescente incidência de doenças cancerígenas, aliada ao sucesso atual dos tratamentos oncológicos, a criopreservação tem ganhado ênfase na medicina reprodutiva humana por representar uma alternativa para que mulheres, sobretudo as jovens, possam gerar filhos após o tratamento do câncer [78]. Além disso, a criopreservação tem sido bastante difundida no âmbito da veterinária por permitir a disseminação de material genético de animais de alto valor genético e grande produtividade [117]. Adicionalmente, a criopreservação também tem sido considerada uma vantajosa ferramenta para preservar animais em vias de extinção [114]. Vários estudos têm sido realizados visando aperfeiçoar o processo de criopreservação de gametas femininos, seja na forma matura [72,78,102] ou imatura [11,49,74], como meio de permitir um melhor aproveitamento do potencial reprodutivo

54 54 mesmo após a morte ou impossibilidade da função reprodutiva da fêmea. Além da criopreservação de gametas femininos, a criopreservação de embriões também tem sido bastante estudada e amplamente difundida e estabelecida para aplicação tanto em humanos [86,87] quanto em animais [27,83]. Contudo, ainda observa-se a inexistência de um protocolo ideal [67], haja vista as baixas taxas de sobrevivência e desenvolvimento oocitário até embrião normal [60]. Além disso, também são baixas as taxas de sobrevivência e implantação embrionária após criopreservação, as quais ainda são consideradas muito inferiores àquelas obtidas quando se trata de embriões frescos [57]. A criopreservação de células germinativas pode ser realizada tanto por congelação lenta como por vitrificação. Ambos os métodos têm sido empregados em tecido ovariano [66,71], oócitos [12,29,30] e embriões [60,85]. Contudo, esse procedimento ainda é apontado por alguns autores como uma técnica prejudicial às células, que pode resultar em danos em diferentes compartimentos celulares, como por exemplo, na membrana celular [55], nas organelas [63,94] e no núcleo [45,67]. O conhecimento e a caracterização desses danos são de grande relevância para a criobiologia, visto que a intensidade com que as lesões celulares ocorrem pode incapacitar as células de superarem grandes danos, consequentemente, perdendo sua viabilidade. Desta forma, a presente revisão tem o objetivo de descrever os principais danos originados em consequência dos procedimentos de criopreservação em tecido ovariano, oócito maturo e embriões oriundos de seres humanos e animais. II. BASES GERAIS DA CRIOPRESERVAÇÃO CELULAR A criopreservação consiste na manutenção de material biológico a temperaturas criogênicas, nas quais todas as reações químicas, processos biológicos e atividades físicas intra e extracelulares estão suspensas, contudo, as células conseguem manter-se íntegras, preservando sua viabilidade [91]. Essas temperaturas são denominadas criogênicas, sendo frequentemente utilizado o nitrogênio líquido (-196ºC) para alcançá-las [7]. Em temperaturas entre 0 e 25ºC a atividade celular torna-se lenta, mas ainda está presente. Contudo, abaixo de -40ºC as trocas físico-químicas são cessadas e, para garantir a preservação celular por tempo indeterminado, as células devem ser mantidas a temperaturas inferiores a -130ºC na presença de agentes crioprotetores [7].

55 55 Em regiões frias, algumas plantas [9] e animais [22,84] desenvolveram uma resistência natural às baixas temperaturas. Essa resistência consiste na capacidade de possibilitar que a água mantenha-se superesfriada em temperaturas próximas a -40ºC [9]. Esta adaptação é denominada de aclimatação e geralmente envolve a síntese de açúcares intra e extracelulares que aumentam a pressão osmótica das células e reduzem a injúria por plasmólise a baixas temperaturas [9,22]. Contudo, em 1949 foi realizada a descoberta de uma substância com a capacidade de atravessar a membrana celular e reduzir a formação de cristais de gelo [58,82]. Esta substância, isto é, o glicerol, bem como outras com propriedades similares, como o propanodiol, etilenoglicol e dimetilsulfóxido, passaram desde então a ser utilizadas com sucesso na criopreservação de células e tecidos [17,111]. Apesar dos avanços na criobiologia, tanto a redução de temperatura quanto o posterior aquecimento celular podem resultar em danos na estrutura da célula [9,28]. Esses danos podem ocorrer na membrana celular [17], nas organelas citoplasmáticas [47,49,50] e até mesmo no núcleo da célula [23,67]. Em virtude disso, várias pesquisas têm sido realizadas com o intuito de conhecer as crioinjúrias ocasionadas e amenizar ou reverter os danos celulares decorrente dessas injúrias [29,30,107]. Devido à complexidade da estrutura celular eucariótica e as várias organelas essenciais para a sobrevivência da mesma, cada organela será descrita em maiores detalhes a seguir. III. CARACTERÍSTICAS GERAIS DAS CÉLULAS EUCARIÓTICAS As células de organismos multicelulares apresentam forma e estrutura variáveis e se diferenciam de acordo com sua função. No entanto, todas as células eucarióticas apresentam uma organização básica similar (Figura 1). Esta organização consiste em uma membrana celular externa, constituída por uma bicamada lipídica com proteínas dispostas nesta bicamada [37]. Esta membrana é responsável por delimitar o citoplasma, composto por citosol, organelas celulares, proteínas e íons; e o núcleo, que alberga o material genético da célula, o qual é um compartimento altamente organizado e separado do citoplasma por uma membrana porosa denominada carioteca [41].

56 56 Figura 1. Imagem ilustrativa de uma célula eucariótica evidenciando as organelas internas no citoplasma e no núcleo. Imagem concedida por Thibodeau e Patton [103]. O citoplasma celular, além de albergar fluidos e enzimas, também contém estruturas físicas altamente organizadas, denominadas organelas intracelulares [33]. Toda esta estrutura é mantida com auxílio de uma complexa rede filamentosa chamada de citoesqueleto. O citoesqueleto é uma estrutura constituída por microtúbulos formados por tubulina α e β, microfilamentos de actina e filamentos intermediários específicos de certas células. Todos estes elementos assumem, além da função esquelética, outras funções de acordo com as proteínas as quais estão associados [49]. Nas células eucarióticas, o citoesqueleto tem como função principal coordenar a distribuição de organelas nas células e manter a forma celular. Sendo, portanto, o citoesqueleto responsável pela sustentação e resistência celular, bem como por alterações na forma e distribuição das organelas desencadeadas por interações entre a célula e seu meio e, entre células diferentes [41]. Os microtúbulos executam diversas funções, dentre elas, a manutenção da estrutura celular, o transporte de moléculas, bem como estão envolvidos na divisão celular, uma vez que participam da formação do fuso meiótico [30]. No citoplasma também estão presentes as organelas responsáveis pela respiração e energia celular, conhecidas como mitocôndrias [20]. A distribuição destas organelas parece estar associada com o nível de metabolismo celular, através da conversão de piruvato à adenosina trifosfato (ATP), substância que atua como fonte de energia para a célula [41]. As células eucarióticas também possuem organelas formadas por uma interconexão de túbulos e vesículas. Estas estruturas, conhecidas como retículo

57 57 endoplasmático, são constituídas por membrana, matriz endoplasmática e um meio aquoso que ocupa o espaço entre os túbulos e vesículas. O retículo endoplasmático pode ou não ter sua superfície recoberta por ribossomos, sendo, então, denominado de retículo endoplasmático rugoso e liso, respectivamente [70]. O retículo endoplasmático rugoso ou granular possui a capacidade de sintetizar novas moléculas proteicas, enquanto o retículo endoplasmático liso, também chamado de agranular, tem como função a síntese de substâncias lipídicas, incluindo a produção de hormônios esteróides [70]. As substâncias produzidas pelo retículo endoplasmático são liberadas no meio extracelular através de encapsulamento pelas vesículas do complexo de Golgi. Essa organela possui membranas semelhantes às membranas do retículo endoplasmático agranular e geralmente é composta por várias camadas de vesículas achatadas e empilhadas, sendo proeminente em células secretoras [96]. O núcleo celular é um compartimento organizado no qual são encontrados os cromossomos, responsáveis por armazenar as informações genéticas [54]. Durante a divisão celular os cromossomos encontram-se aderidos ao fuso meiótico, formado por microtúbulos e microfilamentos de actina [78]. O núcleo é considerado o centro de controle da célula por conter os genes que determinam as características proteicas da célula [54], incluindo proteínas estruturais e enzimas que controlam as atividades nucleares e citoplasmáticas [41]. Cada compartimento celular citado desempenha um importante papel para manutenção da homeostase celular. Entretanto, essa homeostase pode ser comprometida em virtude de alterações em diferentes estruturas celulares decorrentes da criopreservação, conforme detalhado no próximo tópico. IV. PRINCIPAIS DANOS CELULARES CAUSADOS PELA CRIOPRESERVAÇÃO 1. Danos de membrana De forma geral, todas as membranas celulares são sensíveis às crioinjúrias, porém, a sobrevivência da célula parece estar mais diretamente relacionada com a integridade da membrana plasmática do que com as membranas que delimitam as organelas. A membrana celular possui maior relevância por atuar no procedimento de criopreservação como uma barreira semipermeável entre o citoplasma e o meio extracelular, permitindo o movimento (efluxo/influxo) de água e agentes crioprotetores,

58 58 fundamental para a preservação da célula a temperaturas ultra-baixas [105]. Acredita-se que a membrana seja o primeiro compartimento a sofrer injúrias decorrentes do frio e que estas injúrias estejam correlacionadas com a redução de temperatura a qual a célula é exposta [99]. Um dos graves danos decorrentes da criopreservação é a perda de parte da membrana plasmática durante a redução de temperatura [1]. Esta perda membranária é resultado da intensa desidratação celular que precisa ocorrer com o intuito de reduzir a formação intracelular de gelo de modo a garantir o sucesso da criopreservação, desde que esta não seja excessiva. Durante a desidratação excessiva e consequente estresse hídrico, as células se retraem e ocorre uma contração da membrana celular. Esta contração resulta na aproximação de porções de membrana permitindo uma interação da bicamada lipídica com ocasional fusão da membrana [94], ocorrendo consequentemente formação de vesículas e perda de parte do material da membrana. Essa alteração pode culminar com a perda de elasticidade da membrana e lise da célula ao retornar às condições isotônicas normais [1]. Os danos de membrana decorrentes da criopreservação também parecem estar relacionados com a redução da energia térmica a baixas temperaturas e consequente limitação do movimento de moléculas na bicamada lipídica da membrana [37]. Esses danos também são influenciados pela composição lipídica da membrana, que influencia diretamente suas propriedades, inclusive a resistência ao estresse térmico [5,119,121]. Esta composição parece variar de acordo com o desenvolvimento e tipo celular. Já foi demonstrado, na espécie ovina, que a membrana plasmática de zigotos e oócitos em diferentes estágios de desenvolvimento possuem diferentes temperaturas de solidificação, sugerindo ainda que essa variação está relacionada com a composição fosfolipídica e concentração de colesterol da membrana [120]. Ao avaliar ovários humanos criopreservados utilizando a congelação lenta na presença de dimetilsulfóxido (DMSO), Martinez-Madri [62] observaram que 96,7% dos folículos ovarianos apresentavam membranas celular e nuclear intactas. A congelação lenta de tecido ovariano de cutias (Dasyprocta aguti) com propanodiol também foi eficaz em preservar as membranas do oócito e das células da granulosa [114]. Contudo, em caprinos foram relatadas alterações na membrana nuclear (Figura 2A) após congelação em meio contendo DMSO e sacarose [17].

59 59 Figura 2. Fotomicrografias demonstrativas da ultraestrutura de folículos ovarianos e oócitos submetidos a procedimentos de criopreservação. (A) Folículo primordial de mulher incluso em ovário inteiro congelado/descongelado evidenciando um oócito (O) com ruptura de membrana nuclear e condensação da cromatina (seta preta) no núcleo do oócito (N). Entre as células foliculares (Fc) percebe-se célula folicular alterada com condensação da cromatina (seta branca). Imagem concedida por Martinez-Madrid [62] e autorizada pela Elsevier. (B) Oócito bovino imaturo congelado/descongelado com gotícula lipídica intacta (1) e com lipólise parcial (2). Observam-se áreas de lipólise (seta branca) e mitocôndrias (m). Aumento de 8000x. Figura adaptada de Isachenko [48] e autorizada por Wiley Job Network. (C) Oócitos equinos maturos vitrificados/aquecidos com enturgecimento de mitocôndrias e redução de elétrondensidade da matriz mitocondrial (setas pretas). Figura concedida por Hochi [46] e autorizada pela Elsevier. (D) Folículo suíno incluso em tecido ovariano congelado/descongelado com mitocôndrias túrgidas (m). (l): gotículas lipídicas, (Nu): núcleo, (CG): células da granulosa e (*): espaços vazios. Figura concedida por Borges [13] e autorizada pela Elsevier. (E) Folículo ovariano humano incluso em tecido vitrificado/aquecido com presença de poros na membrana nuclear (setas pretas) e retículo endoplasmático (ER) e mitocôndrias (M) bem preservados, semelhante ao tecido fresco. Figura concedida por Sheikhi [95] e autorizada pela Oxford Journals.

60 60 Especificamente em oócitos, a camada glicoprotéica denominada zona pelúcida, exerce a importante função de impedir a polispermia e, também, se mostra sensível aos procedimentos de criopreservação [55,98,106]. A presença de vacúolos e debris na zona pelúcida, por exemplo, já foi relatada após criopreservação de ovários de camundongas, seja através da congelação lenta ou da vitrificação [55]. Em geral, sabese que a criopreservação de oócitos ocasiona uma redução na taxa de fecundação do oócito [98] provavelmente por mudanças estruturais da zona pelúcida. Essas alterações parecem ser ocasionadas pela liberação precoce dos grânulos corticais [16,36,52,64] devido a um aumento de cálcio após procedimentos de criopreservação [56], resultando no enrijecimento da zona pelúcida [52]. Contudo, o exato mecanismo que conduz a esse aumento de cálcio no oócito ainda não é completamente conhecido. Em embriões criopreservados foi demonstrada uma sensibilidade relativamente alta da membrana plasmática, uma vez que o processo de congelação/descongelação de embriões reduziu em cerca de cinco vezes a fluidez da membrana de embriões de camundongos [2]. Contudo, ao avaliar a transição da fase cristalina líquida para a fase cristalina gel (Tm) de embriões e oócitos maturos (MII) e imaturos (VG) de mulheres, Ghetler et al. [37] observaram que a membrana celular de embriões possui uma Tm mais baixa que a de oócitos, tornando-os menos sensíveis às crioinjúrias. Esta variável está correlacionada com uma maior resistência ao frio, uma vez que a passagem dos lipídios da fase líquida para a fase gel ocorre a uma temperatura mais baixa, na qual os processos biológicos e a cinética de lesão são lentos. Desta forma, acredita-se que os danos na membrana possam ser reduzidos através da perfusão dos agentes crioprotetores a uma temperatura acima da Tm da membrana celular, possibilitando o transporte de crioprotetor e água através da membrana quando a bicamada lipídica ainda encontra-se em fase líquida, facilitando o transporte transmembrana [19,51,118]. 2. Danos nas gotículas lipídicas intracitoplasmáticas e citoesqueleto O sucesso dos protocolos de criopreservação de tecido ovariano, oócitos e embriões parece ser dificultado, em grande parte, pela presença de lipídios (Figura 2B), tanto na forma de gotículas lipídicas intracitoplasmáticas [35] quanto na composição da membrana celular [37], principalmente nas espécies suína [13] e canina [50]. Além disso, o procedimento de vitrificação altera a morfologia, estrutura e distribuição celular das gotículas de lipídios [34], reduzindo a sobrevivência de oócitos e embriões [37].

61 61 Na vitrificação de oócitos e embriões suínos, algumas pesquisas têm sido realizadas com o intuito de reduzir a quantidade de lipídio intracelular [67] e aumentar a sobrevivência oocitária [35] e embrionária [67]. Contudo, a centrifugação e a remoção química utilizadas nos tratamentos de delipação podem causar danos aos oócitos e embriões, tornando as células mais frágeis ao processo, especialmente a membrana celular, que se torna mais sensível [35]. As gotículas lipídicas parecem estar relacionadas aos filamentos intermediários do citoesqueleto [15,43]. Estes filamentos formam uma rede que se estende do núcleo à membrana plasmática envolvendo grande parte das organelas celulares [15] e já foram descritos em associação com o retículo endoplasmático [80], complexo de Golgi [65] e gotículas lipídicas intracitoplasmáticas [43]. A interação de filamentos intermediários com gotas lipídicas foi reforçada pela associação dessas estruturas com a vimentina (grupo de proteínas constituintes dos filamentos intermediários), observada por Traub [104], embora a finalidade dessa interação ainda seja desconhecida. No entanto, acredita-se que a interação lipídio-citoesqueleto possa estar relacionada à manutenção da morfologia celular [10], embora o mecanismo pelo qual este processo ocorra ainda também não esteja elucidado. As mudanças de estado físico, além de alterarem as propriedades físicoquímicas dos lipídios intracelulares [49] podem resultar em danos também nos lipídios associados ao citoesqueleto celular [48] (Figura 3). A interação entre a fase lipídica das células e os elementos do citoesqueleto é complexa e o enrijecimento desses lipídios pode causar deformação e ruptura do citoesqueleto [49], com consequente influência na sobrevivência e desenvolvimento celular [47,88,112].

62 62 Figura 3. Imagens representativas do padrão de citoesqueleto de oócitos felinos imaturos submetidos à criopreservação evidenciando microfilamentos em vermelho e microtúbulos em verde. Microfilamentos difusos no ooplasma com uma concentração ligeiramente maior na zona pelúcida (A), microtúbulos uniformemente distribuídos por todo ooplasma (A ). Microfilamentos e microtúbulos distribuídos de forma irregular no citoplasma (B e B ). Barras representativas de 50µm. Figura concedida por Luciano [59] e autorizada pela Elsevier. O rompimento do citoesqueleto pode ser uma alteração intrínseca às mudanças na forma e desidratação celular que acompanham o processo de criopreservação [113]. Em oócitos, as crioinjúrias parecem afetar principalmente os microtúbulos [3] e a organização do citoesqueleto [75]. Esses criodanos podem também ser decorrentes da exposição aos agentes crioprotetores, que podem ocasionar a despolimerização de microtúbulos e microfilamentos e causar a destruição dos componentes do citoesqueleto [24]. A exposição ao crioprotetor, etapa fundamental da criopreservação, resultou em discreta redução no percentual de distribuição normal dos microfilamentos em oócitos bovinos congelados [94] e oócitos suínos vitrificados [90]. Além disso, a congelação de oócitos bovinos demonstrou um efeito negativo sobre os microfilamentos, observado pela drástica redução de oócitos com distribuição normal dos microfilamentos [94]. Contudo, alguns estudos têm mostrado a eficiência de protocolos de criopreservação com menores danos ao citoesqueleto celular. Em camundongas, a avaliação de oócitos imaturos criopreservados (congelação lenta), posteriormente submetidos à maturação in vitro, não revelou qualquer alteração significativa na

63 63 organização de microtúbulos e microfilamentos [29]. Em oócitos maturos de equinos vitrificados por OPS (Open Pulled Straws), Tharasanit et al. [102] observaram um rompimento no citoesqueleto celular, porém, a frequência dessa alteração foi baixa. Alterações irreversíveis na estrutura dos microtúbulos podem ser ocasionadas em decorrência do estresse osmótico, do efeito solução e da formação de cristais de gelo intracelulares, que são efeitos intrínsecos ao processo de criopreservação [94]. A manutenção da morfologia dos microfilamentos é tão importante quanto a manutenção da morfologia dos microtúbulos. A preservação do fuso meiótico de oócitos em MII é a principal dificuldade da criopreservação destas estruturas. Nesta fase, os cromossomos encontram-se dispostos na placa equatorial e os microtúbulos ligados aos cromossomos estão estendidos [26], tornando-se mais vulneráveis às crioinjúrias. Vários estudos têm sugerido que a criopreservação causa alterações na polimerização da tubulina de microtúbulos do fuso de oócitos em MII, ocasionando uma ruptura no fuso meiótico e consequente desorganização da cromatina [81,100]. Danos no fuso meiótico já foram relatados após a vitrificação de oócitos de camundongas [38], ovelhas [100] e mulheres [61]. Em oócitos de coelha ovulados e congelados não foi perceptível a presença de actina polimerizada (componente dos microfilamentos), sendo observada a presença de microfilamentos apenas no corpúsculo polar [111]. Contudo, algumas equipes sugerem que o citoesqueleto de oócitos em estágio de vesícula germinativa seja mais rígido que microtúbulos e microfilamentos de oócitos em estágio MII [4]. Uma hipótese é que em função da complexa interação entre a fase lipídica das células e os elementos do citoesqueleto, o enrijecimento dos lipídios pode ocasionar uma deformação e até mesmo ruptura do citoesqueleto. No citoesqueleto rígido de oócitos em vesícula germinativa o enrijecimento em decorrência dos procedimentos de criopreservação torna-se, aparentemente, permanente, enquanto oócitos em MII parecem reverter estes danos em virtude da característica flexível de seu citoesqueleto [48]. 3. Danos em organelas celulares Durante o procedimento de criopreservação, as células podem sofrer severos danos em sua estrutura. Esses danos estão relacionados com a integridade das organelas celulares e podem resultar em retardo no crescimento folicular [92] e embrionário [67] ou até mesmo culminar com a morte da célula [62]. As mitocôndrias, organelas essenciais para o metabolismo celular, são sensíveis aos procedimentos de criopreservação [12,73], apresentando criodanos

64 64 ocasionados tanto pela congelação lenta [62] quanto pela vitrificação [66]. Aparentemente, a causa mais relevante desses danos é a formação de cristais de gelo intracelular, que induz a danos nas cristas e na matriz das mitocôndrias [69], acarretando em distanciamento das membranas mitocondriais e danos, principalmente, à membrana mitocondrial interna [79]. A manutenção da morfologia e atividade mitocondrial são características indispensáveis para diversos eventos que estão envolvidos com a maturação citoplasmática e retomada da meiose [108], fertilização [115] e desenvolvimento embrionário [8]. Desta forma, a preservação dessas organelas caracteriza-se como um dos grandes desafios da criopreservação, uma vez que as mitocôndrias estão relacionadas com a produção de energia celular [8,41] e, consequentemente, a integridade mitocondrial está correlacionada com a viabilidade celular [88]. A vitrificação de tecido ovariano de camundongas está relacionada com a redução na quantidade de cristas mitocondriais, alterações na morfologia mitocondrial [66] e aumento no número de mitocôndrias [55,66] tanto nas células da granulosa quanto nos oócitos. Após criopreservação rápida (redução de 1 C/min) de ovário humano inteiro também foi observada redução nas cristas mitocondriais [62]. No entanto, em tecido ovariano humano submetido à congelação lenta observou-se um elevado número de mitocôndrias em oócitos de folículos primordiais e primários morfologicamente normais, além de matriz com baixa densidade e poucas cristas periféricas, características consideradas normais em oócitos em estado quiescente ou em desenvolvimento inicial [71]. Em oócitos humanos maturos vitrificados foi verificada a presença de mitocôndrias com matriz elétron-densa e cristas bem preservadas. Contudo, foi observada uma fragmentação da matriz mitocondrial e desintegração da membrana de algumas mitocôndrias [12]. Já após a congelação lenta de oócitos humanos maturos (MII), as mitocôndrias encontravam-se uniformemente distribuídas no citoplasma. No entanto, estas mitocôndrias possuíam aparentes danos nas cristas mitocondriais, caracterizadas por cristas que não atravessavam a matriz elétron-densa. Além disso, em um alto percentual de oócitos criopreservados (72%) foi observada uma redução na densidade da matriz mitocondrial [40]. Quando a congelação lenta foi utilizada em ovários de camundongas, foi observada presença de mitocôndrias túrgidas e com poucas cristas [66].

65 65 As mitocôndrias também têm sido bastante investigadas em embriões criopreservados em diferentes espécies, como bovinos [107] e suínos [31], uma vez que o ATP produzido pelas mitocôndrias é essencial para diversos processos celulares em embriões em desenvolvimento, incluindo a divisão celular e replicação do DNA genômico [8]. Em embriões de camundongos, após a congelação lenta, foi observado que a maioria das mitocôndrias apresentava-se agrupada, principalmente, ao longo da membrana celular. Dentre as mitocôndrias presentes no citoplasma, grande parte exibiu um baixo potencial de membrana, evidenciando que a criopreservação é capaz de induzir a despolarização da membrana mitocondrial [2]. Em bovinos, a congelação lenta de embriões de 7 dias não demonstrou alterações nas mitocôndrias. Contudo, ao se criopreservar embriões bovinos de 13 dias, observou-se danos na membrana das mitocôndrias e perda da homogeneidade de sua matriz [69]. Apesar da presença de danos nas mitocôndrias decorrentes do procedimento de criopreservação, um estudo com blastocistos bovinos vitrificados sugere que esse tipo de dano pode ser revertido após algumas horas de incubação, cultivando-se os embriões pós-aquecimento [107]. Nesse estudo, embriões analisados logo depois de aquecidos demonstraram alterações mitocondriais e redução de elétron-densidade da matriz ou mitocôndrias túrgidas e com aumento da elétron-densidade da matriz. Curiosamente, após 4 h de incubação, as mitocôndrias retomaram seu tamanho normal e apenas uma minoria apresentava áreas com redução de elétron-densidade. Após 24 h de incubação, as mitocôndrias apresentavam-se com formato normal e matriz elétron-densa. De forma contrária, em blastocistos suínos vitrificados observou-se o desacoplamento da membrana mitocondrial interna e matriz mitocondrial com redução de elétron-densidade [53]. Ainda após vitrificação de blastocistos suínos, Fabian et al. [31] observaram uma degeneração extensiva das mitocôndrias com desligamento parcial das membranas interna e externa quando os embriões foram cultivados por 24 h após aquecimento. Outra importante organela que sofre danos em decorrência da criopreservação é o retículo endoplasmático, cuja modificação na morfologia foi observada após a vitrificação de embriões suínos, resultando em dilatação do retículo endoplasmático liso e presença de pequenas vesículas [31]. Alterações nessa organela também foram perceptíveis em oócitos suínos [13] e caprinos [17], com enturgecimento da mesma após a congelação do tecido ovariano (Figuras 2C e 2D). Acredita-se que essa deformação ocorre como resultado de mudanças no balanço iônico causado por alterações na permeabilidade da membrana plasmática [21]. O entumecimento de

66 66 retículo endoplasmático e cristas mitocondriais [23,45] também foi observado após a vitrificação de oócitos bovinos maturos e imaturos, com estreita proximidade entre as gotículas lipídicas, mitocôndrias e retículo endoplasmático [23]. Contudo, a congelação lenta de oócitos imaturos inclusos em tecido ovariano bovino mostrou-se eficiente na preservação dos retículos endoplasmáticos (liso e rugoso), não sendo perceptíveis alterações nessas organelas [18]. Em tecido ovariano ovino, após a congelação lenta foi observado um número variável de vesículas, complexo de Golgi bem desenvolvido e retículos endoplasmáticos (liso e rugoso) agregados entre si ou formando um complexo com mitocôndrias ou vesículas [93]. Essas características evidenciam a preservação eficaz destas organelas, uma vez que também foram observadas em tecido ovariano fresco de ovinos [32], caprinos [97] e humanos [44]. A preservação de mitocôndrias e retículos endoplasmáticos (liso e rugoso) também foi observada nos oócitos e células da granulosa de ovários de camundongas submetidos ao procedimento de vitrificação [42]. As crioinjúrias resultantes da congelação lenta de tecido ovariano humano mostram-se sutis, uma vez que após aplicação da técnica observou-se numerosos complexos de Golgi e retículo endoplasmático liso e rugoso preservados no citoplasma das células foliculares [71]. A vitrificação de tecido ovariano humano também não resultou em grandes alterações nas organelas celulares, confirmado pela presença de complexos de Golgi e retículos endoplasmáticos bem definidos e abundantes (Figura 2E) [95]. Contudo, quando a vitrificação foi empregada em oócitos maturos humanos, complexos de Golgi foram encontrados apenas ocasionalmente e o citoplasma oocitário mostrou-se ocupado de forma homogênea por vesículas dilatadas de retículo endoplasmático liso, em virtude da ruptura destas organelas. Em adição, complexos retículo endoplasmático - mitocôndrias foram encontrados esporadicamente [12]. 4. Danos nucleares A sobrevivência imediata de uma célula depende da sua capacidade de evitar alterações no seu DNA. Apesar do grande esforço da célula para manter a integridade do seu material genético, diversos processos desafiam essa capacidade intrínseca. Sabese que a criopreservação pode resultar em fragmentação do DNA, mesmo na ausência de deformação da morfologia celular. Porém, os mecanismos subjacentes a esses danos ainda não são conhecidos [68]. Além disso, já foi demonstrado que os cromossomos são muito susceptíveis a alterações decorrentes dos procedimentos de criopreservação [14].

67 67 Estas alterações podem ser divididas em estruturais e numéricas. As alterações numéricas podem ainda ser subdividas em alterações na qual todo o genoma é multiplicado (poliploidias) e alterações no qual apenas poucos cromossomos são duplicados ou perdidos (aneuploidias) [54]. Dentre as alterações cromossômicas, a aneuploidia é a mais frequente e parece comprometer o desenvolvimento competente do oócito [116], além de ser indicada como o principal fator para a baixa obtenção de nascidos vivos [14,67]. Essas alterações cromossômicas também podem ser decorrentes da criopreservação de oócitos. Van der Elst et al. [109] observaram que ao criopreservarem oócitos de camundongas, a formação parcial do fuso meiótico ocasiona o deslocamento cromossômico em alguns oócitos, podendo resultar em aneuploidia ou retenção do segundo corpúsculo polar no momento da fecundação originando, consequentemente, embriões poliplóides. Em oócitos, o estágio de maturação (oócito imaturo ou oócito maturo) tem sido implicado como um fator que afeta a qualidade e a competência no desenvolvimento após criopreservação [45,76]. Os principais danos da criopreservação parecem resultar principalmente da ruptura do fuso meiótico [89] (Figura 4) em decorrência da sensibilidade dos microtúbulos à redução de temperatura [23]. No entanto, esse dano pode ser minimizado pela capacidade dos microtúbulos do fuso meiótico de se reorganizar durante o resfriamento/aquecimento [110]. As espécies bovina e humana, no entanto, parecem possuir uma menor capacidade de recuperação do fuso meiótico devido à falta de material pericentriolar em alguns oócitos [110]. Essas alterações nos microtúbulos são de fundamental importância para o desenvolvimento de um oócito competente, pois os microtúbulos participam da formação do fuso meiótico e estão associados com a segregação cromossômica anormal [30].

68 68 Figura 4. Padrão de organização do fuso meiótico e de cromossomos em oócitos ovinos maturos submetidos à vitrificação. Fuso normal (A) com cromossomos alinhados na placa metafásica (A ). Fuso assimétrico (B e B ). Coluna da esquerda: marcação de β- tubulina, coluna da direita: marcação do DNA com Hoechst. Figura concedida por Asgari [6] e autorizada pela Elsevier. Em oócitos de coelhas naturalmente ovulados e congelados com DMSO foi observado um elevado número de microtúbulos em torno dos cromossomos, semelhante ao observado em oócitos não criopreservados. No entanto, quando os oócitos foram congelados na presença de propanodiol, o fuso meiótico não apresentava conformação normal, além de apresentarem microtúbulos dispersos no citoplasma celular [111]. Analisando-se oócitos suínos imaturos submetidos à vitrificação, foi observada uma redução de oócitos com organização do fuso normal (79,5% no controle ou não vitrificado vs 10,1% vitrificado) e, consequentemente, um aumento de oócitos com fuso anormal (15,6% controle vs 46,5% vitrificado) e ausente (4,8% controle vs 43,2% vitrificado). Curiosamente, os oócitos vitrificados mantiveram o alinhamento cromossômico regular, mesmo quando apresentavam fuso anormal. Quando avaliada a percentagem de F-actina (componente dos microfilamentos que formam o fuso meiótico) foi observado que a vitrificação de oócitos imaturos (VG) parece ser mais deletéria aos microfilamentos do que a vitrificação de oócitos maturos (16,9 vs 37,2% respectivamente). Contudo, o procedimento de vitrificação, independente do estágio de maturação oocitária, mostrou uma redução no percentual de normalidade do fuso quando comparado a oócitos frescos (72,3%) [117].

69 69 Após vitrificação de oócitos maturos de camundongas observou-se uma redução de cromossomos normais de oócitos desnudos vitrificados (67,2%) quando comparados a oócitos frescos (80,4%). Além disso, a taxa de fuso meiótico normal reduziu de 79,8% para 60,6%, quando os oócitos foram submetidos à vitrificação [77]. No entanto, a congelação lenta de oócitos maturos de camundongas parece ser mais danosa ao fuso meiótico, visto que o formato de barril característico do fuso meiótico foi reduzido de 97% em oócitos não criopreservados para 18% em oócitos congelados. Os demais oócitos congelados exibiram características anormais do fuso como por exemplo, fuso fusiforme ou retração nos pólos. A congelação lenta também resultou em menor percentual de cromossomos corretamente alinhados (78%) quando comparados a oócitos não congelados (97%) [30]. Em oócitos maturos ovinos vitrificados, também foi perceptível a redução do alinhamento cromossômico normal (79,14% em oócitos frescos vs 11,11% em oócitos vitrificados) [6]. Em pesquisa realizada com embriões humanos foi observado que a sobrevivência embrionária pós-congelação está relacionada com o número de células, cujo núcleo foi preservado, e a redução da sobrevivência embrionária foi relacionada com o maior número de células do embrião no momento da criopreservação [101], sugerindo que embriões em estágio mais avançado podem ser mais susceptíveis às crioinjúrias. A vitrificação de embriões suínos resultou em um acréscimo na perda de gestações [67] correlacionada principalmente com aneuplodia [14]. No entanto, ainda não é conhecido o mecanismo exato pelo qual essas alterações cromossômicas são ocasionadas nem o estágio ao qual o embrião está mais vulnerável aos danos nucleares. V. CONCLUSÃO A criopreservação é uma importante alternativa para a preservação de gametas e embriões, sendo, por isso, bastante aplicada para armazenar o material genético de animais com alto valor zootécnico, bem como restaurar a fertilidade de mulheres após tratamentos oncológicos. Contudo, este procedimento submete as células a condições desfavoráveis que podem comprometer a recuperação celular após descongelação/aquecimento. Conforme apontado no decorrer desta revisão, diversos autores têm demonstrado que a causa na redução da sobrevivência de oócitos, folículos ovarianos (presentes ou isolados do tecido ovariano) e embriões após criopreservação está relacionada com danos em diferentes compartimentos e estruturas celulares. Essas

70 70 estruturas são essenciais para o metabolismo e viabilidade da célula e, portanto, a aplicação de um protocolo de criopreservação capaz de manter essas estruturas intactas deve levar em conta o grau de desenvolvimento, tipo e número de células. Declaration of interest. The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. REFERÊNCIAS 1. Acker J.P. & McGann L.E Protective effect of intracellular ice during freezing? Cryobiology. 46(2): Ahn H.J., Sohn I.P., Kwon H.C., Jo D.H., Park Y.D. & Min C.K Charateristics of the cell membrane fluidity, actin fibers, and mitochondrial disfunctions of frozen-thawed two-cell mouse embryos. Molecular Reproduction and Development. 61(4): Albertini D.F. & Eppig J.J Unusual cytoskeletal and chromatin configurations in mouse oocytes that are atypical in meiotic progression. Developmental Genetics. 16(1): Allworth A.E. & Albertini D.F Meiotic maturation in cultured bovine oocytes is accompanied by remodeling of the cumulus cell cytoskeleton. Developmental Biology. 158(1): Arav A., Pearl M. & Zeron Y Does membrane lipid profile explain chilling sensitivity and membrane lipid phase transition of spermatozoa and oocytes? Cryo Letters. 21(3): Asgari V., Hosseini S.M., Ostadhosseini S., Hajian M. & Nars-Esfahani M.H Time dependent effect of post warming interval on microtubule organization, meiotic status, and parthenogenetic activation of vitrified in vitro matured sheep oocytes. Theriogenology. 75(5): Bakhach J The cryopreservation of composite tissues - Principles and recent advancement on cryopreservation of different type of tissues. Organogenesis. 5(3): Bavister B.D Culture of pre-implantation embryo: facts and artifacts. Human Reproduction Update. 1(2): Benson E.E Cryopreservation Theory. In: Reed B.M. (Ed). Plant Cryopreservation: A Practical Guide. Corvallis: Springer, pp

71 Bodin S., Soulet C., Tronchère H., Sié P., Gachet C., Plantavid M. & Payrastre B Integrin-dependent inter-action of lipid rafts with the actin cytoskeleton in activated human platelets. Journal of Cell Science. 118(4): Bogliolo L., Ariu F., Fois S., Rosati I., Zedda M.T., Leoni G., Succu S., Pau S. & Ledda S Morphological and biochemical analysis of immature ovine oocytes vitrified with or without cumulus cells. Theriogenology. 68(8): Bonetti A., Cervi M., Tomei F., Marchini M., Ortolani F. & Manno M Ultrastructural evaluation of human metaphase II oocytes after vitrification: closed versus open devices. Fertility and Sterility. 95(3): Borges E.N., Silva R.C., Futino D.O., Rocha-Junior C.M.C., Amorim C.A., Báo S.N. & Lucci C.M Cryopreservation of swine ovarian tissue: Effect of different cryoprotectants on the structural preservation of preantral follicle oocytes. Cryobiology. 59(2): Burgoyne P.S., Holland K. & Stephens R Incidence of numerical chromosome anomalies in human pregnancy estimation from induced and spontaneous abortion data. Human Reproduction. 6(4): Carmo-Fonseca M. & David-Ferreira J.F Interactions of intermediate filaments with cell structures. Electron Microscopy Reviews. 3(1): Carroll J., Depypere H. & Matthews C.D Freeze-thaw-induced changes of the zona pellucida explains de-creased rates of fertilization in frozen-thawed mouse oocytes. Journal of Reproduction and Fertility. 90(2): Castro S.V., Carvalho A.A., Silva C.M., Faustino L.R., Campello C.C., Lucci C.M., Báo S.N., Figueiredo J.R. & Rodrigues A.P.R Freezing solution containing dimethylsulfoxide and fetal calf serum maintains survival and ultrastructure of goat preantral follicles after cryopreservation and in vitro culture of ovarian tissue. Cell and Tissue Research. 346(2): Celestino J.J.H., Santos R.R., Lopes C.A.P., Martins F.S., Matos M.H.T., Melo M.A.P., Báo S.N., Rodrigues A.P.R., Silva J.R.V. & Figueiredo J.R Preservation of bovine preantral follicle viability and ultra-structure after cooling and freezing of ovarian tissue. Animal Reproduction Science. 108(3-4): Cha K.Y., Chung H.M., Lim J.M., Ko J.J., Han S.Y., Choi D.H. & Yoon T.K Freezing immature oocytes. Molecular and Cellular Endocrinology. 169(1-2):

72 Chan D.C Mitochondria: Dynamic organelles in disease, aging, and development. Cell. 125(7): Coss R.A., Dewey W.C. & Bamburg J.R Effects of hyperthermia (41,5 ) on Chinese hamster ovary cells analyzed in mitosis. Cancer Research. 39: Crowe J.H., Hoekstra F.A. & Crowe L.M Anhydrobiosis. Annual review of Physiology. 54: Diez C., Duque P., Gómez E. Hidalgo C.O., Tamargo C., Rodríguez A., Fernández L., De La Varga S., Frenández A., Facal N. & Carbajo M Bovine oocyte vitrification before or after meiotic arrest: effects on ultrastructure and developmental ability. Theriogenology. 64 (2): Dobrinsky J.R Advancements in cryopreservation of domestic animal embryos. Theriogenology. 57(1) Donnez J., Dolmans M.M., Demylle D., Jadoul P., Pirard C., Squifflet J., Martinez-Madrid B. & Van Langendonckt A Livebirth after orthotopic transplantation of cryopreserved ovarian tissue. The Lancet. 364(9443): Ducibella T., Schultz R.M. & Ozil J.P Role of calcium signals in early development. Seminars in Cell & Developmental Biology. 17(2): Dulioust E., Toyama K., Busnel M.C., Moutier R., Carlier M., Marchaland C., Ducot B., Roubertoux P. & Auroux M Long-term effects of embryo freezing in mice. Proceedings of the National Academy of Sciences of the United States of America. 92(2): Elliott J.A.W Introduction to the special issue: Thermodynamic aspects of cryobiology. Cryobiology. 60(1): Eroglu A., Toner M., Leykin L. & Toth T.L Cytoskeleton and polyploidy after maturation and fertilization of cryopreserved germinal vesicle-stage mouse oocytes. Journal of Assisted Reproduction and Genetics. 15(7): Eroglu A., Toth T.L. & Toner M Alterations of the cytoskeleton and polyploidy induced by cryopreservation of metaphase II mouse oocytes. Fertility and Sterility. 69(5): Fabian D., Gjørret J.O., Berthelot F., Martinat-Botté F. & Maddox-Hyttel P Ultrastructure and cell death of in vivo derived and vitrified porcine blastocysts. Molecular Reproduction and Development. 70(2):

73 Fair T., Hulshof S.C.J., Hyttel P., Greve T. & Boland M Oocyte ultrastructure in bovine primordial to early tertiary follicles. Anatomy and Embryology. 195(4): Foster L.J., Hoog C.L., Zhang Y., Zhang Y., Xie X., Mootha V.K. & Mann M A mammalian organelle map by protein correlation profiling. Cell. 125(1): Fu X.W., Shi W.Q., Zhang Q.J., Zhao X.M., Yan C.L., Hou Y.P., Zhou G.B., Fan Z.Q., Suo L., Wusiman A., Wang Y.P & Zhu S.E Positive effects of Taxol pretreatment on morphology, distribution and ultrastructure of mitochondria and lipid droplets in vitrification of in vitro matured porcine oocytes. Animal Reproduction Science. 115(1-4): Fu X.W., Wu G.Q., Li J.J., Hou Y.P., Zhou G.B., Suo L., Wang Y.P. & Zhu S.E Positive effects of Forskolin (stimulator of lipolysis) treatment on cryosurvival of in vitro matured porcine oocytes. Theriogenology. 75(2): Fuku E., Xia L. & Downey B.R Ultrastructural changes in bovine oocytes cryopreserved by vitrification. Cryobiology. 32 (2) Ghetler Y., Yavin S., Shalgi R. & Arav A The effect of chilling on membrane lipid phase transition in human oocytes and zygotes. Human Reproduction. 20(12): Gomes C.M., Silva C.A.S., Acevedo N., Baracat E., Serafini P. & Smith G.D Influence of vitrification on mouse metaphase II oocyte spindle dynamics and chromatin alignment. Fertility and Sterility. 90(4): Gosden R.G., Baird D.T., Wade J.C. & Webb R Restoration of fertility to oophorectomized sheep by ovarian autografts stored at -196 C. Human Reproduction. 9(4): Gualtieri R., Iaccarino M., Mollo V., Prisco M., Iaccarino S. & Talevi R Slow cooling of human oocytes: ultrastructural injuries and apoptotic status. Fertility and Sterility. 91(4): Guyton A.C. & Hall J.E The Cell and Its Functions. In: Textbook of Medical Physiology. Philadelphia: Elsevier Saunders, pp Haidari K. Salehnia M. & Valojerdi M.R The effect of leukemia inhibitory factor and coculture on the in vitro maturation and ultrastructure of vitrified and nonvitrified isolated mouse preantral follicles. Fertility and Sterility. 90(6):

74 Hall P.F The roles of calmodulin, actin, and vimentin in steroid synthesis by adrenal cells. Steroids. 62(1): Hertig A.T. & Adams E.C Studies on the human oocyte and its follicle. I. Ultrastructural and histochemical observation on the primordial follicle stage. The Journal of Cell Biology. 34(2): Hochi S., Ito K., Hirabayashi M., Ueda M., Kimura K. & Hanada A Effect of nuclear stages during IVM on the survival of vitrified-warmed bovine oocytes. Theriogenology. 49(4): Hochi S., Kozawa M., Fujimoto T., Hondo E., Yamada J. & Oguri N In vitro maturation and transmission electron microscopic observation of horse oocytes after vitrification. Cryobiology. 33(3): Hyttel P., Vajta G. & Callesen H Vitrification of bovine oocytes with the open pulled straw method: ultra-structural consequence. Molecular Reproduction and Development. 56(1): Isachenko V., Isachenko E., Michelmann H.W., Alabart J.L., Vazquez I., Bezugly N. & Nawroth F Lipolysis and ultrastructural changes of intracellular lipid vesicles after cooling of bovine and porcine GV-oocytes. Anatomia, Histologia, Embryologia. 30(6): Isachenko V., Soler C., Isachenko E., Perez-Sanchez F. & Grishchenko V Vitrification of immature porcine oocytes: effects of lipid droplets, temperature, cytoskeleton, and addition and removal of cryoprotectant. Cryobiology. 36(3): Ishijima T., Kobayashi Y., Lee D.S., Ueta Y.Y., Matsui M., Lee J.Y., Suwa Y., Miyahara K. & Suzuki H Cryopreservation of canine ovaries by vitrification. Journal of Reproduction and Development. 52(2): Jelinkova L., Selman H.A., Arav A., Strehler E., Reeka N. & Sterzik K Twin pregnancy after vitrification of 2-pronuclei human embryos. Fertility and Sterility. 77(2): Johnson M.H., Pickering S.J. & George M.A The influence of cooling on the properties of the zona pellucida of the mouse oocyte. Human Reproduction. 3(3): Kaidi S., Bernard S., Lambert P., Massip A., Dessy F. & Donnay I Effect of conventional controlled-rate freezing and vitrification on morphology and

75 75 metabolism of bovine blastocysts produced in vitro. Biology of Reproduction. 65(4): Karp G O núcleo da célula e o controle da expressão gênica. In: Biologia Celular e Molecular. 3.ed. Barueri: Manole, pp Kim G.A., Kim H.Y., Kim J.W., Lee G., Lee E. & Lim J.M Ultrastructural deformity of ovarian follicles induced by different cryopreservation protocols. Fertility and Sterility. 94(4): Larman M.G., Sheehan C.B. & Gardner D.K Calcium-free vitrification reduces cryoprotectant-induced zona pellucida hardening and increases fertilization rates in mouse oocytes. Reproduction. 131(1): Lin T.A., Chen C.H., Sung L.Y., Carter M.G., Chen Y.E., Du F., Ju J.C. & Xu J Open-pulled straw vitrification differentiates cryotolerance of in vitro cultured rabbit embryos at the eight-cell stage. Theriogenology. 75(4): Lovelock J.E The haemolysis of human red blood cells by freezing and thawing. Biochimica et Biophysica Acta. 10(3): Luciano A.M., Chigioni S., Lodde V., Franciosi F., Luvoni G.C. & Modina S.C Effect of different cryopreservation protocols on cytoskeleton and gap junction mediated communication integrity in feline germinal vesicle stage oocytes. Cryobiology. 59(1): Magli M.C., Lappi M., Ferraretti A., Capoti A., Ruberti A. & Gianaroli L Impact of oocyte cryopreservation on embryo development. Fertility and Sterility. 93(2): Martinéz-Burgos M., Herrero L., Magías D., Salvanes R., Mantoya M.C., Cobo A.C. & Garcia-Velasco J Vitrification versus slow freezing of oocytes: effects on morphologic appearance, meiotic spindle configuration, and DNA damage. Fertility and Sterility. 95(1): Martinez-Madrid B., Camboni A., Dolmans M.M., Nottola S., Van Langendonckt A. & Donnez J Apoptosis and ultrastructural assessment after cryopreservation of whole human ovaries with their vascular pedicle. Fertility and Sterility. 87(5): Massip A., Mermillod P. & Dinnyes A Morphology and biochemistry of in vitro produced bovine embryos: implications for their cryopreservation. Human Reproduction. 10(11):

76 Matson P.L., Graefling J., Junk S.M., Yovich J.L. & Edirisinghe W.R Cryopreservation of oocytes and embryos: use of a mouse model to investigate effects upon zona hardness and formulate treatment strategies in an in vitro fertilization programme. Human Reproduction. 12(7): Mayerson P.L. & Brumbaugh J.A Lavender, chick melanocyte mutant with defective melanosome translocation: a possible role for 10 nm filaments and microfilaments but not microtubules. Journal of Cell Science. 51: Mazoochi T., Salehnia M., Valojerdi M.R. & Mowla J Morphologic, ultrastructural, and biochemical iden-tification of apoptosis in vitrified-warmed mouse ovarian tissue. Fertility and Sterility. 90(4): Men H., Agca Y., Riley L. & Crister J.K Improved survival of vitrified porcine embryos after partial delipa-tion through chemically stimulated lipolysis and inhibition of apoptosis. Theriogenology. 66(8): Men H., Monson R.L. & Rutledge Effect of meiotic stages and maturation protocols on bovine oocyte s resistance to cryopreservation. Theriogenology. 57(3): Mohr L.R. & Trounson A.O Structural changes associated with freezing of bovine embryos. Biology of Reproduction. 25(5): Mothes W., Heinrich S.U., Graf R., Nilsson I., Von Heijne G., Brunner J. & Rapoport T.A Molecular mechanism of membrane protein integration into the endoplasmic reticulum. Cell. 89(4): Nottola S.A., Camboni A., Van Langendonkt A., Demylle D., Macchiarelli G., Dolmans M.M., Martinez-Madrid B., Correr S. & Donnez J Cryopreservation and xenotransplantation of human ovarian tissue: an ultrastructural study. Fertility and Sterility. 90(1): Nottola S.A., Cotticchio G., Sciajno R., Gambardella A., Maione M., Scaravelli., Bianchi S., Macchiarelli G. & Borini A Ultrastructural markers of quality in human mature oocytes vitrified using cryoleaf and cryoloop. Reproductive BioMedicine Online. 19(Suppl 3): Nottola S.A., Macchiarelli G., Coticchio G., Bianchi S., Cecconi S, De Santis L. Scaravelli G., Flamigni C. & Borini A Ultrastructure of human mature oocytes after slow cooling cryopreservation using different sucrose concentrations. Human Reproduction. 22(4):

77 Oktay K., Newton H., Aubard Y., Salha O. & Gosden R.G Cryopreservation of immature human oocytes and ovarian tissue: an emerging technology? Fertility and Sterility. 69(1): Overstrom E.W., Paqui-Platls D., Toner M. & Cravacho E.G Cryoprotectant and thermal effect on cytoskeletal organization and IVF rate of mouse oocytes. Biology of Reproduction. 42(Suppl 1): Palasz A.T. & Mapletoft R.J Cryopreservation of mammalian embryos and oocytes: Recent advances. Biotechnology Advances. 14(2): Park S.E., Chung H.M., Cha K.Y., Hwang W.S., Lee E.S. & Lim J.M Cryopreservation of ICR mouse oocytes: improved post-thawed preimplantation development after vitrification using Taxol, a cytoskeleton stabilizer. Fertility and Sterility. 75(6): Park S.E., Son W.Y., Lee SH., Lee K.A., Ko J.J. & Cha K.Y Chromosome and spindle configurations of human oocytes matured in vitro after cryopreservation at the germinal vesicle stage. Fertility and Sterility. 68(5): Partridge R.J., Wrathall A.E. & Leese H.J Glucose uptake and lactate production by single frozen-thawed bovine embryos produced in vivo or by in vitro fertilization. Journal of Reproduction and Fertility. 13: Pelliniemi L.J., Dym M. & Paranko J Cytoplasmic filaments in fetal Leydig cells. Annals of the New York Academy of Sciences. 383(1): Pickering S.J. & Johnson M.H The influence of cooling on the organization of the meiotic spindle of the mouse oocyte. Human Reproduction. 2(3): Polge C., Smith A.U., Parkes A.S Revival of spermatozoa after vitrification and dehydration at low tempera-tures. Nature. 164(4172): Popelková M., Chrenek P., Pivko J., Makarevich A.V., Kubovičová E. & Kačmárik J Survival and ultrastructure of gene-microinjected rabbit ambryos after vitrification. Zygote. 13(4): Potts M Desiccation tolerance of prokaryotes. Microbiological Reviews. 58(4): Ptak G., Dattena M., Loi P., Tischner M. & Cappai P Ovum pick-up in sheep: efficiency of in vitro embryo production, vitrification and birth of offspring. Theriogenology. 52(6):

78 Quintans C.J., Donaldson M.J., Bertolino M.V. & Pasqualini R.S Birth of two babies using oocytes that were cryopreserved in a choline-based freezing médium. Human Reproduction. 17(12): Reed M.L., Lane M., Gardner D.K., Jensen N.L. & Thompson J Vitrification of human blastocysts using the cryoloop method: successful clinical application and birth of offspring. Journal of Assisted Reproduction and Genetics. 19(6): Rho G.J., Kim S.N, Yoo J.G., Balasubramanian S., Lee H.J & Choe S.Y Microtubulin configuration and mitochondrial distribution after ultra-rapid cooling of bovine oocytes. Molecular Reproduction and Development. 63(4): Rienzi L., Martinez F., Ubaldi F., Minasi M.G., Iacobelli M., Tesarik J. & Greco E Polscop analysis of meiotic spindle changes in living metaphase II human oocytes during the freezing and thawing procedures. Human Reproduction. 19: Rojas C., Palomo M.J., Albarracín J.L. & Mogas T Vitrification of immature and in vitro matured pig oocytes: study of distribution of chromosomes, microtubules, and actin microfilaments. Cryobiology. 49(3): Rubinsky B The energy equation for freezing of biological tissue. Journal of Heat Transfer. 111(4): Santos R.R., Knijn H.M., Vos P.L.A.M., Oei C.H.Y., Van Loon T., Colenbrander B., Gadella B.M., Van den Hurk R. & Roelen B.A.J Complete follicular development and recovery of ovarian function of frozen-thawed, autotransplanted caprine ovarian cortex. Fertility and Sterility. 91(Suppl 4): Santos R.R., Rodrigues A.P.R., Costa S.H.F., Silva J.R.V., Matos M.H.T., Lucci C.M., Báo S.N., Van Den Hurk R. & Figueiredo J.R Histological and ultrastructural analysis of cryopreserved sheep preantral follicles. Animal Reproduction Science. 91(3-4): Saunders K.M. & Parks J.E Effects of cryopreservation procedures on the cytology and fertilization rate of in vitro-matured bovine oocytes. Biology of Reproduction. 61(1): Sheikhi M., Hultenby., Niklasson B., Lundqvist. & Hovatta O Clinical grade vitrification of human ovarian tissue: an ultrastructural analysis of follicles and stroma in vitrified tissue. Human Reproduction. 26(3):

79 Shorter J. & Warren G Golgi architecture and inheritance. Annual Review of Cell and Developmental Biology. 18: Silva J.R.V., Báo S.N., Lucci C.M., Carvalho F.C.A., Andrade E.R., Ferreira M.A.L. & Figueiredo J.R Morphological and ultrastructural changes occurring during degeneration of goat preantral follicles preserved in vitro. Animal Reproduction Science. 66(3-4): Somfai T., Ozawa M., Noguchi J., Kaneko H., Karja N.W.K., Farhudin M., Dinnyés A., Nagai T. & Kikuchi K Developmental competence of in vitrofertilized porcine oocytes after in vitro maturation and solid surface vitrification: Effect of cryopreservation on oocyte antioxidative system and cell cycle stage. Cryobiology. 55(2): Steponkus P.L Role of the plasma membrane in freezing injury and cold acclimation. Annual Review of Plant Physiology. 35(1): Succu S., Leoni G.G., Bebbere D., Berlinguer F., Mossa F., Bogliolo L., Madeddu M., Ledda S. & Naitana S Vitrification devices affect structural and molecular status of in vitro matured ovine oocytes. Molecular Reproduction and Development. 74(10): Testart J., Lassalle B., Belaisch-Allart J., Hazout A., Forman R., Rainhorn J.D. & Frydman R High pregnancy rate after early human embryo freezing. Fertility and Sterility. 46(2): Tharasanit T., Colenbrander B. & Stout T.A.E Effect of maturation stage at cryopreservation on post-thaw cytoskeleton quality and fertilizability of equine oocytes. Molecular Reproduction and Development. 73(5): Thibodeau G.A. & Patton K.T Células e Tecidos. In: Estrutura e Funções do Corpo Humano. 11.ed. Barueri: Manole, pp Traub P., Perides G., Kuhn S. & Scherberth A Efficient interaction of nonpolar lipids with intermediate filaments of the vimentin type. European Journal of Cell Biology. 43(1): Uemura M. & Steponkus P.L A contrast of the plasma membrane lipid composition of oat and rye leaves in relation to freezing tolerance. Plant Physiology. 104(2): Vajta G., Holm P., Kuwayama M., Booth P.J., Jacobsen H., Greve T. & Callesen H Open pulled straw (OPS) vitrification: a new way to reduce

80 80 cryoinjuries of bovine ova and embryos. Molecular Reproduction and Development. 51(1): Vajta G., Hyttel P. & Callesen H Morphological changes of in-vitroproduced bovine blastocysts after vitrification, in-straw direct rehydration, and culture. Molecular Reproduction and Development. 48(1): Van Blerkom J Microtubule mediation of cytoplasmic and nuclear maturation during the early stages of resumed meiosis in cultured mouse oocyte. Proceedings of the National Academy of Sciences of the United States of America. 88(11): Van der Elst J., Nerinckx S. & Van Steirteghem A Association of ultrarapid freezing of mouse oocytes with increased polyploid at the pronucleate stage, reduced cell numbers in blastocysts, and impaired fetal development. Journal of Reproduction and Fertility. 99(1): Vincent C. & Johnson M.H Cooling, cryoprotectants, and the cytoskeleton of the mammalian oocytes. Oxford Reviews of Reproductive Biology. 14: Vincent C., Garnier V., Heyman H. & Renard J.P Solvent effects on cytoskeletal organization and in-vivo survival after freezing of rabbit oocytes. Journal of Reproduction and Fertility. 87(2): Vincent C., Pickering S.J. & Johnson M.H The hardening effect of dimethylsulfoxide on the mouse zona pellucida requires the presence of an oocyte and is associated with a reduction in the number of cortical granules present. Journal of Reproduction and Fertility. 89(1): Vincent C., Pickering S.J., Johnson M.H. & Quick S.J Dimethylsulphoxide affects the organization of microfilaments in the mouse oocyte. Molecular Reproduction and Development. 26(3): Wanderley L.S., Luz H.K.M., Faustino L.R., Lima I.M.T., Lopes C.A.P., Silva A.R., Báo S.N., Campello C.C., Rodrigues A.P.R. & Figueiredo J.R Ultrastructural features of agouti (Dasyprocta aguti) preantral follicles cryopreserved using dimethyl sulfoxide, ethylene glycol and propanediol. Theriogenology. 77(2): Whitaker M Calcium at fertilization and in early development. Physiological Reviews. 86(1):

81 Wu B., Tong J. & Leibo S.P Effects of cooling germinal vesicle-stage bovine oocytes on meiotic spindle formation following in vitro fertilization. Molecular Reproduction and Development. 54(4): Wu C., Rui R., Dai J., Zhang C., Ju S., Xie B., Lu X. & Zheng X Effects of cryopreservation on the developmental competence, ultrastructure and cytoskeletal structure of porcine oocytes. Molecular Reproduction and Development. 73(11): Yoon T.K., Chung H.M., Lim J.M., Han S.Y., Ko J.J. & Cha K.Y Pregnancy and delivery of healthy infants developed from vitrified oocytes in a stimulated in vitro fertilization-embryo transfer program. Fertility and Sterility. 74(1): Zeron Y., Ocheretny A., Kedar O., Borochov A., Sklan D. & Arav A Seasonal changes in bovine fertility: relation to developmental competence of oocytes, membrane properties and fatty acid composition of follicles. Reproduction. 121(3): Zeron Y., Sklan D. & Arav A Effect of polyunsaturated fatty acid supplementation on biophysical parameters and chilling sensitivity of ewe oocytes. Molecular Reproduction and Development. 61(2): Zeron Y., Tomczak M., Crowe J. & Arav A The effect of liposomes on thermotropic membrane phase transitions of bovine spermatozoa and oocytes: implications for reducing chilling sensitivity. Cryobiology. 45(2):

82 82 7. CAPÍTULO 2 Desenvolvimento de um novo dispositivo de vitrificação Development of a new vitrification device Depósito de Patente ao Instituto Nacional de Propriedade Industrial (INPI).

83 83 RESUMO O presente capítulo refere-se à invenção de um dispositivo inovador para a criopreservação de tecido ovariano de cabras. Esse novo dispositivo é um sistema fechado que evita o contato direto do tecido ovariano com o nitrogênio líquido, prevenindo assim, a contaminação com patógenos resistentes a temperaturas criogênicas (-196 o C). O novo dispositivo também fornece maior facilidade na adição e retirada das soluções de vitrificação e remoção dos agentes crioprotetores, além de permitir que vários fragmentos de tecido ovariano sejam vitrificados simultaneamente. Devido à sua forma e tamanho, esse dispositivo também permite a vitrificação de hemi ou ovário inteiro. A presente invenção se situa no campo da Biotecnologia e por seu caráter confidencial, o Relatório Descritivo de Patente de Invenção enviado ao INPI não está inserido nesta tese. Contudo, uma breve descrição pode ser obtida a partir dos artigos científicos publicados com a utilização deste dispositivo (capítulos subsequentes). Palavras-chave: Patente. Sistema fechado. Técnica de vitrificação.

84 84 Dispositivo de criopreservação e processos de vitrificação e aquecimento utilizando tal dispositivo Ana Paula Ribeiro Rodrigues; José Ricardo de Figueiredo; Adeline de Andrade Carvalho; Luciana Rocha Faustino; Simone Vieira Castro; Cleidson Manoel Gosmes da Silva Atualmente, a vitrificação tem sido bastante utilizada para a criopreservação de tecido ovariano, por minimizar os danos causados pela formação intracelular de gelo, comumente observada no processo de congelação lenta. Para isso, vários pesquisadores têm desenvolvido diferentes técnicas de vitrificação, nas quais os focos principais são a redução do volume da solução de vitrificação e aumento da taxa de resfriamento. De acordo com a literatura, essas técnicas têm oferecido resultados satisfatórios. No entanto, a grande maioria, por ser um sistema aberto, não evita os riscos de contaminação da amostra pelo contato direto com o nitrogênio líquido. Portanto, considerando essa problemática, ou seja, a não disponibilidade de um sistema fechado que permita a vitrificação do tecido ovariano com um mínimo volume de solução, sem contato direto com o nitrogênio líquido, fomos estimulados a desenvolver uma nova técnica de vitrificação. Além dessa caracterísitca, esse novo dispositivo é manufaturado em aço inoxidável, o que garante durabilidade e uma alta resistência à alterações de temperatura. Além disso, pode ser reutilizado após esterilização, além de possibilitar uma rápida troca de calor, acelerando os processos de redução de temperatura e posterior aquecimento do material vitrificado. Por apresentar forma cilíndrica, esse novo dispositivo garante a uniformidade da redução de temperatura por toda a amostra, oferecendo assim maior seguraça da realização do procedimento. A partir desta invenção realizada nesta tese, bem como pelos resultados satisfatórios obtidos, foi solicitado ao Instituto Nacional de Propriedade Industrial (INPI) o depósito da patente intitulada DISPOSITIVO DE CRIOPRESERVAÇÃO E PROCESSOS DE VITRIFICAÇÃO E AQUECIMENTO UTILIZANDO TAL DISPOSITIVO. A invenção tem como inventores Profa. Dra. Ana Paula Ribeiro Rodrigues; Prof. Dr. José Ricardo de Figueiredo; M.Sc. Adeline de Andrade Carvalho; Dra. Luciana Rocha Faustino; M.Sc. Simone Vieira Castro; Dr. Cleidson Manoel

85 85 Gosmes da Silva. O pedido para o depósito de patente foi realizado no dia 19 de julho de 2012 e a partir da obtenção do número de protocolo (Anexo 1, pág. 179), os resultados obtidos com os experimentos realizados foram publicados em revistas científicas. A técnica desenvolvida nesta tese também foi utilizada em projetos de outros pós-graduandos como: 1. Estratégias para maximização ou preservação do potencial reprodutivo de fêmeas: das células-tronco germinativas aos folículos pré-antrais. Tese de Luciana Rocha Faustino (2013), PPGCV. 2. Criopreservação e cultivo in vitro de ovário ovino: análise de crescimento e matriz extracelular ovariana. Dissertação de Francisca Tuelly Bandeira de Oliveira (2013), PPGCV. Por seu caráter confidencial, o Relatório Descritivo de Patente de Invenção, enviado ao INPI, não pôde constar nesta tese. Contudo, breves descrições do dispositivo bem como dos processos de vitrificação e aquecimento utilizando o referido dispositivo também são obtidas nos capítulos subsequentes desta tese. O pedido de patente já possui Certificado de Adição de Invenção pelo INPI (Anexo 2, pág. 183) e o documento comprobatório de depósito encontra-se no Anexo 1 desta tese.

86 86 8. CAPÍTULO 3 A espessura do tecido pode influenciar o resultado da vitrificação de córtex ovariano caprino Tissue thickness may influence the outcome of vitrification of goat ovarian cortex Periódico: Acta Scientiae Veterinariae, v. 41, p , 2013.

87 87 RESUMO A principal vantagem da criopreservação de fragmentos ovarianos é a pouca espessura do tecido, que facilita a penetração dos agentes crioprotetores, mas o tamanho do tecido pode não ser um fator limitante para alcançar sucesso após a criopreservação de tecido ovariano. Essa informação é de grande significância considerando que a criopreservação de hemi-ovário e ovário inteiro pode conservar um maior ou total contingente de folículos primordiais presentes no ovário. Assim, o objetivo desse estudo foi avaliar a vitrificação de diferentes dimensões de tecido ovariano na morfologia, viabilidade e diâmetro foliculares, bem como a densidade de células do estroma. Para tanto, o tecido ovariano foi vitrificado em fragmento, hemi-ovário e ovário inteiro e, após o aquecimento, os folículos pré-antrais foram examinados através de corante viral (azul de tripan) e análise histológica. Os folículos pré-antrais incubados com azul de tripan foram considerados viáveis se o oócito e células da granulosa permaneciam não corados. Os folículos pré-antrais foram classificados como morfologicamente normais somente quando eles continham oócito e células da granulosa intactos. O diâmetro folicular foi mensurado considerando os eixos maior e menor de cada folículo; a média dessas duas mensurações foi utilizada para determinar o diâmetro de cada folículo. A densidade das células do estroma foi avaliada por calcular o número de células do estroma em uma área de µm. Não houve diferença no percentual de folículos morfologicamente normais e viáveis após a vitrificação quando comparado ao tecido ovariano fresco, independente da dimensão de tecido ovariano vitrificado. Além disso, não houve diferença no diâmetro folicular quando comparadas as diferentes dimensões de tecido ovariano vitrificadas. Entretanto, após a vitrificação foi observada uma redução na densidade de células do estroma. Esta redução foi mais intensa após a vitrificação de hemi-ovário e ovário inteiro. Em conclusão, a manutenção da morfologia e viabilidade folicular demonstrou que a vitrificação de tecido ovariano caprino sob as condições aplicadas neste estudo pode ser realizada em quaisquer das dimensões de tecido ovariano (fragmento, hemi-ovário e ovário inteiro). Palavras-chave: Criopreservação. Hemi-ovário. Ovário inteiro. Viabilidade celular.

88 88 Tissue Thickness May Influence the Outcome of Vitrification of Goat Ovarian Cortex Adeline de Andrade Carvalho, Luciana Rocha Faustino, Simone Vieira Castro, Cleidson Manoel Gomes da Silva, Cláudio Cabral Campello, José Ricardo de Figueiredo & Ana Paula Ribeiro Rodrigues ABSTRACT Background: The main advantage of the cryopreservation of ovarian fragments is a thinner tissue, which facilitates the penetration of cryoprotective agents, but the size of tissue may not be a limiting factor in achieving a successful cryopreservation of the ovarian tissue. This information is highly significant considering that the cryopreservation of hemi-ovary or whole ovary may preserve the entire or major part of the contingent of primordial follicles of ovarian fragments. Therefore, the aim of this study was to evaluate the vitrification of different dimensions goat ovarian tissue on the follicular morphology, viability, diameter, and the stromal cell density. Materials, Methods & Results: The ovarian tissue was vitrified as fragment, hemiovary, or whole ovary, and after warming, the preantral follicles were examined by trypan blue dye exclusion test and histological analysis. Preantral follicles incubated with trypan blue were considered viable if the oocyte and granulosa cells remained unstained. Preantral follicles were classified as morphologically normal only when they contained intact oocyte and granulosa cells. The follicular diameter was measured considering the major and minor axes of each follicle; the average of these 2 measurements was used to determine the diameter of each follicle. Ovarian stroma cells density was evaluated by calculating the number of stromal cell in an area of µm. There was no difference in the percentage of morphologically normal and viable follicles after vitrification compared to the control (fresh tissue), regardless of the dimension of the vitrified ovarian tissue (P> 0.05). In addition, there were no differences in the follicular diameter after ovarian tissue vitrification, independent of the dimension (P> 0.05). However, after vitrification, a decrease in the ovarian stromal cells density was observed (P< 0.05). This reduction was more intense after the vitrification

89 89 of the hemi-ovary and whole ovary, compared to the ovarian fragment vitrification (P< 0.05). Discussion: No differences were observed in the percentages of morphologically normal and viable follicles from fresh or vitrified ovarian tissue (fragment, hemi-ovary, and whole ovary). These results are in agreement with other reports that did not show morphological changes after cryopreservation of the whole ovary, and the ovarian fragments. With respect to follicular diameter, only the diameter of the preantral follicles in ovarian tissue vitrified as hemi-ovary was similar to that observed in the fresh control, in the present study. The results demonstrate that fragments and whole ovary vitrification had greater cell dehydration (exposure to VS) and/or less cell rehydration (VS removal), showing that minor adjustments are needed in the protocols of cryoprotectants addition or removal from the fragments and the whole ovary. However, this reduction in follicular diameter did not appear to have affected the follicular architecture or cellular viability, which were maintained in all dimensions of ovarian tissue undergoing vitrification. A reduction in the stromal cell density was observed, especially in the hemi-ovary and whole ovary as compared to the ovarian fragment. Previous reports have shown that ovarian stromal cells are responsible for the production of essential substances for follicular development and these substances are fundamental for follicles development and these cells tend to be more sensitive to cryopreservation procedure than ovarian follicles. In conclusion, the maintenance of follicular morphology and viability demonstrated that vitrification of goat ovarian tissue under the conditions applied in this study can be performed in any dimension of ovarian tissue (fragment, hemi-ovary, and whole ovary). Keywords: cryopreservation, follicular morphology, ovarian tissue thickness, stromal cell density.

90 90 INTRODUCTION The cryopreservation of ovarian tissue has as its main objective to safeguard female fertility by preserving thousands of preantral follicles enclosed in the ovarian cortex [4]. Among the livestock species, goats are a commercially interesting species [20] and, therefore, efforts have been made to develop germplasm banks for the genetic preservation of animals possessing higher value [5]. Moreover, because the ovary dimensions from goats and sheep are similar to those from human [21], these species are considered as viable alternatives to achieve cryopreservation protocols in humans. The ovarian tissue of ruminants has been cryopreserved in fragments [11] or even as hemi-ovary [2] or whole ovary [10]. The main advantage of the cryopreservation of ovarian fragments is to have a thinner tissue, which facilitates the penetration of cryoprotective agents [17], but the size of tissue may not be a limiting factor in achieving a successful cryopreservation of the ovarian tissue [16]. This information is highly significant considering that the cryopreservation of hemi-ovary or whole ovary may preserve the entire or major part of the contingent of primordial follicles that, when transplanted, can increase the chances of pregnancy [14]. The success of sheep ovarian tissue cryopreservation, for example, has been demonstrated by birth of healthy offspring after transplantation of different dimensions (ovarian fragments [9]; hemi-ovary [2]; whole ovary [10]). However, in goats, only the cryopreservation of ovarian tissue fragments has been reported [19]. The aim of this study was to evaluate the influence of different dimension of ovarian tissue (fragment, hemi-ovary, or whole ovary) on the ovarian stroma cells density, preantral follicles morphological changes, and preantral follicles viability enclosed in goat ovarian tissue vitrified. MATERIALS AND METHODS Collection and vitrification of goat ovarian tissue Ovaries were collected at a local abattoir from adult crossbred goats (n = 5). Immediately postmortem, ovaries were washed in 70% alcohol, followed by two washes in HEPES-buffered minimum essential medium (MEM 1 ) supplemented with antibiotics (100 µg/ml penicillin 1 and 100 µg/ml streptomycin 1 ). This medium was also used to transport ovaries (at 20 C) to the laboratory, within 1 h after they were recovered. In the

91 91 laboratory, ovaries (average size cm) were divided into 2 halves, in which a hemi-ovary was cut into small fragments (3 3 1 mm), parts of which were either immediately used a fresh control or subjected to the vitrification procedure. The remaining hemi-ovary, and the other whole ovary were also cryopreserved, resulting in 3 dimensions for ovarian tissue vitrification: fragments, hemi-ovary, and whole ovary. The vitrification solution 1 (VS1) was composed of MEM supplemented with 10% ethylene glycol 2 (EG), 10% dimethylsulfoxide 2 (DMSO), 0.25M sucrose 1, and 10 mg/ml bovine serum albumin (BSA 1 ). The vitrification solution 2 (VS2) had the same composition of VS1, except that the concentration of cryoprotectants was increased (20% EG and 20% DMSO). The ovarian fragments were exposed to VS1 for 4 min, and VS2 for 1 min. To vitrify the hemi-ovaries and whole ovaries, both were exposed to VS1 and VS2 for 8 and 2 min, respectively. The solutions were perfused through hilum into whole ovaries. All the tissue dimensions were vitrified using a cryodevice according to the logistics of the solid surface vitrification. This device is a cylinder made by stainless steel, a good conductor of heat, which enables rapid temperature reduction. Moreover, this device has a lid to be closed, avoiding tissue contact with liquid nitrogen during vitrification. After cryostorage (up to 1 week), the vitrified material was removed from the liquid nitrogen and warmed by maintaining the device at room temperature (~25 C; 1 min for ovarian fragments and hemi-ovaries, and 2 min for whole ovaries) followed by immersion in water bath at 37 C (ovarian fragments: 30 s; hemi-ovary: 1 min, and whole ovary: 2 min). After warming, the cortical tissue from hemi-ovary and whole ovary were cut into small fragments (3 3 1 mm). For each treatment (fresh control, fragment, hemi-ovary and whole ovary) two samples (i.e. fragments) of ovarian tissues were used for histological and viability analysis. The VS removal was performed by in a three-step equilibrium (5 min each) in (i) MEM + 3 mg/ml BSA M sucrose, (ii) MEM + 3mg/mL BSA M sucrose, and finally (iii) MEM + 3 mg/ml BSA. Histological analysis The ovarian fragments were fixed in Carnoy s solution (4 h), embedded in paraffin, serially sectioned (7 µm) and were stained with Hematoxylin-Eosin. Only preantral follicles with visible nuclei were counted. Preantral follicles (one or more layers of granulosa cells and no antral cavity, i.e., primordial, primary, and secondary follicles) were classified as morphologically normal only when they contained intact

92 92 oocyte and granulosa cells (Figure 1A). The follicular diameter was measured using Nikon NIS Elements software, considering the major and minor axes of each follicle; the average of these 2 measurements was used to determine the diameter of each follicle. Thirty follicles were analyzed per treatment. Ovarian stroma cells density was evaluated by calculating the number of stromal cell in an area of µm (Figure 1B). For each treatment, ten fields per slide were assessed and the mean number of stromal cell per field was calculated [8]. Viability analysis The preantral follicles were isolated mechanically from all treatment using the method of Lucci [12]. Briefly, samples were cut into small pieces with a tissue chopper 3 adjusted to a sectioning interval of 75 µm. Samples were placed in MEM supplemented with 3 mg/ml BSA, and suspended 100 times with a large Pasteur pipette (inner diameter ~1600 µm), followed by 100 times with a smaller Pasteur pipette (inner diameter ~600 µm) to dissociate preantral follicles from stroma. The obtained material was then passed through a 200 µm nylon mesh filter. This procedure was performed within 10 min at room temperature (RT; approximately 25 C). The viability of preantral follicles was assessed by the trypan blue dye exclusion test. Briefly, 5 µl of 0.4% trypan blue was added to 100 µl of isolated and suspended preantral follicles, which were incubated for 1 min at RT [4]. Afterwards, follicles were examined with an inverted microscope 4 and classified as viable if the oocyte and granulosa cells remained unstained (Figure 1C). Statistical analysis For all data, Kolmogorov-Smirnov and Bartlett tests were used to confirm normal distribution and homogeneity of variances, respectively. The percentages of morphologically normal, stromal cell density and follicular diameters were submitted to ANOVA followed Student-Newman-Keuls test. The percentages of viable follicles were compared by Chi-Square test. For all the statistical analyses, P< 0.05 was considered significant, and the results were expressed as mean ± SD.

93 93 Figure 1. Morphological characteristics and viability of preantral follicles enclosed in different dimensions of goat ovarian tissue. (A1-A2) Photomicrograph of morphologically normal goat preantral follicles in the fresh control (A1) and atretic preantral follicle after the cryopreservation of the whole ovary (A2). Note the measurement of follicular diameter in A1, obtained by performing by 2 transverse measurements. In A2, the follicular degeneration is evidenced by a retraction of the ooplasm (black arrow) and nuclear pyknosis (*) [Bar = 15 µm]. (B1-B2) Photomicrographs of ovarian stroma with normal (fresh control; B1) and reduced (whole ovary; B2) cell density. Observe the marking areas randomly selected for evaluation [Bar= 50 µm]. (C1-C2) Images of preantral follicles unstained, viable follicle (fresh control; C1) and stained, non-viable follicle (hemi-ovary; C2), with trypan blue [Bar = 20 µm]. RESULTS Follicular morphology displayed no significant variation among morphologically normal preantral follicles obtained from fresh control (68.80%) and preantral follicles from vitrified tissue in fragment (61.40%), hemi-ovary (53.80%), and whole ovary (56.00%, P> 0.05) [Table 1]. Similar results were observed for follicular viability under these 3 vitrification conditions, i.e., fragment (90.00%), hemi-ovary (93.33%), and whole ovary (93.33%). The stromal cell density was reduced after vitrification, irrespective of the tissue thickness, compared to the fresh control ( cells; P< 0.05). Moreover, this

94 94 reduction post vitrification was significantly higher in hemi-ovary ( cells) and whole ovary ( cells) as compared to the reduction observed after the vitrification of ovarian fragments ( cells; P< 0.05). The measurement of the follicular diameter before (fresh control) and after cryopreservation in the different dimensions of ovarian tissue showed that only the vitrification in hemi-ovary (31.33 µm) maintained follicular diameter similar to the fresh control (33.08 µm; P> 0.05). However, no significant reduction in the follicular diameter (Table 1) was observed among the different dimensions of vitrified ovarian tissue, i.e., fragment (30.07 µm), hemi-ovary (31.33 µm), and whole ovary (29.49 µm). Table 1. Morphology, viability, follicular diameter, and stromal cell density after ovarian tissue vitrification at different dimensions (fragment, hemi-ovary, and whole ovary). Treatments Morphologically normal Viable Follicular Stromal cells density preantral follicles (%) preantral diameter (µm) (cells/100 x 100 µm) (mean ± SD) * follicles (%) * (mean ± SD) * (mean ± SD) * Fresh control ± 6.50 A A ± 6.18 A ± A Fragment ± 7.02 A A ± 4.28 B ± B Hemi-ovary ± A A ± 4.58 AB ± C Whole ovary ± 9.46 A A ± 3.01 B ± C *Five animals were used. For each treatment, two samples: one sample to histological analysis and another one to viability analysis were used for each animal. Ovarian tissues samples were obtained from hemi-ovary and whole ovary after vitrification. A,B,C Different superscripts letters indicate statistically significant differences (P< 0.05). DISCUSSION The results of this study showed that vitrification of ovarian fragments as either hemi-ovary or whole ovary can be used for the cryopreservation of goat ovarian tissue. This observation is supported by the fact that no differences were observed in the percentages of morphologically normal and viable follicles from fresh or vitrified ovarian tissue (fragment, hemi-ovary, and whole ovary). These results are in agreement

95 95 with other reports which showed that morphological changes observed after cryopreservation of the whole ovary [1], and the ovarian fragments [11] were similar to those obtained from fresh tissue. With respect to follicular diameter, only the diameter of the preantral follicles in ovarian tissue vitrified as hemi-ovary was similar to that observed in the fresh control, in the present study. The results demonstrate that fragments and whole ovary vitrification had greater cell dehydration (exposure to VS) and/or less cell rehydration (VS removal), showing that minor adjustments are needed in the protocols of cryoprotectants addition or removal from the fragments and the whole ovary. However, this reduction in follicular diameter did not appear to have affected the follicular architecture and cellular viability, which were maintained in all dimensions of ovarian tissue undergoing vitrification. The trypan blue is a vital dye which is only able to enter cells with compromised membranes and color them blue [6]. The histological assessment of viability by trypan blue proves to be a reliable method [13,18], and it is noteworthy that the trypan blue dye exclusion test has been successfully used to evaluate viability of preantral follicles after cryopreservation and in vitro culture in mice [3], goats [20] and women [7]. In the present study, a reduction in the stromal cell density was also observed, especially in the hemi-ovary and whole ovary as compared to the ovarian fragment. We reiterated prior hypothesis that lesser thickness in the fragments might have favored both ovarian perfusion of cryoprotectants as well as a uniform reduction of temperature throughout the entire length of the ovarian tissue, which in turn may have minimized the damage to the ovarian stromal cells. Additionally, previous reports have shown that ovarian stromal cells are responsible for the production of essential substances for follicular development, i.e., growth factors and peptides [15]. These substances are fundamental for follicles development in vivo or in vitro after cryopreservation and these cells tend to be more sensitive to cryopreservation procedure than ovarian follicles [8]. Thus, an evaluation of ovarian stromal cells can be a valuable tool in establishing cryopreservation protocols owing to the greater sen-sitivity of these cells, which may show cryoinjuries in the ovarian tissue not easily observed in the follicular analysis. In conclusion, the maintenance of follicular morphology and viability demonstrated that vitrification of goat ovarian tissue under the conditions applied in this study can be performed in any dimension of ovarian tissue (fragment, hemi-ovary, and whole ovary). A more accurate analysis of ovarian tissue should be addressed in order

96 96 to reveal changes in the hemi-ovary and whole ovary, which were not detect by histological analysis, as ultrastructural or functional changes that could be observed by transmission electron microscopy and in vitro culture/transplantation, respectively. SOURCES AND MANUFACTURERS 1 Sigma Chemical Co., St. Louis, MO, USA. 2 Dinâmica Química, Diadema, SP, Brazil. 3 The Mickle Laboratory Engineering Co., Gomshal, Surrey, UK. 4 Nikon, Tokyo, Japan. Ethical approval. This experiment was approved and performed under the guidelines of Ethics Committee for Animal Use of State University of Ceará. Declaration of interest. The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper. REFERENCES 1. Arav A., Revel A., Nathan Y., Bor A., Gacitua H., Yavin S., Gavish Z., Uri M. & Elami A Oocyte recovery, embryo development and ovarian function after cryopreservation and transplantation of whole sheep ovary. Human Reproduction. 20(12): Bordes A., Lornage J., Demirci B., Franck M., Courbiere B., Guerin J.F. & Salle B Normal gestations and live births after orthotopic autograft of vitrified-warmed hemi-ovaries into ewes. Human Reproduction. 20(10): Carroll J. & Gosden R.G Transplantation of frozen-thawed mouse primordial follicles. Human Reproduction. 8(8): Carvalho A.A., Faustino L.R., Silva C.M.G., Castro S.V., Luz H.K.M., Rossetto R., Lopes C.A.P., Campello C.C., Figueiredo J.R., Rodrigues A.P.R. & Costa A.P.R Influence of vitrification techniques and solutions on the morphology and survival of preantral follicles after in vitro culture of caprine ovarian tissue. Theriogenology. 76(5): Castro S.V., Carvalho A.A., Silva C.M.G., Faustino L.R., Campello C.C., Lucci C.M., Báo S.N., Figueiredo J.R. & Rodrigues A.P.R Freezing solution containing dimethylsulfoxide and fetal calf serum maintains survival and

97 97 ultrastructure of goat preantral follicles after cryopreservation and in vitro culture of ovarian tissue. Cell Tissue Research. 346(2): Dolmans M.M., Michaux N., Camboni A., Martinez-Madrid B., Van Langendonckt A., Nottola S.A. & Donnez J Evaluation of Liberase, a purified enzyme blend, for the isolation of human primordial and primary ovarian follicles. Human Reproduction. 21(2): Fauque P., Amor A.B., Joanne C., Agnani G., Bresson J.L. & Roux C Use of trypan blue staining to assess the quality of ovarian cryopreservation. Fertility and Sterility. 87(5): Faustino L.R., Santos R.R., Silva C.M.G., Pinto L.C., Celestino J.J.H., Campello C.C., Figueiredo J.R. & Rodrigues A.P.R Goat and sheep ovarian tissue cryopreservation: Effects on the morphology and development of primordial follicles and density of stromal cell. Animal Reproduction Science. 122(1-2): Gosden R.G., Baird D.T., Wade J.C. & Webb R Restoration of fertility to oophorectomized sheep by ovarian autografts stored at -196 C. Human Reproduction. 9(4): Imhof M., Bergmeister H., Lipovac M., Rudas M., Hofstetter G. & Huber J Orthotopic microvascular rea-nastomosis of whole cryopreserved ovine ovaries resulting in pregnancy and live birth. Fertility and Sterility. 85(Suppl 1): Kagawa N., Silber S. & Kuwayama M Successful vitrification of bovine and human ovarian tissue. Reproductive BioMedicine Online. 18(4): Lucci C.M., Amorim C.A., Baó S.N., Figueiredo J.R., Rodrigues A.P.R., Silva J.R.V. & Gonçalves P.B.D Effect of the interval of serial sections of ovarian tissue in the tissue chopper on the number of isolated caprine preantral follicles. Animal Reproduction Science. 56(1): Merdassi G., Mazoyer C., Guerin J.F., Saad A., Salle B. & Lornage J Examination of viability and quality of ovarian tissue after cryopreservation using simple laboratory methods in ewe. Reproductive Biology and Endocrinology. 9(78): Oktay K. & Buyuk E The potential of ovarian tissue transplant to preserve fertility. Expert Opinion on Biological Therapy. 2(4): Picton H.M., Harris S.E., Muruvi W. & Chambers E.L The in vitro growth and maturation of follicles. Reproduction. 136(6):

98 Salle B., Demirci B., Franck M., Berthollet C. & Lornage J Long-term follow-up of cryopreserved hemi-ovary autografts in ewes: pregnancies, births, and histologic assessment. Fertility and Sterility. 80(1): Salle B., Demirci B., Franck M., Rudigoz R.C., Guerin J.F. & Lornage J Normal pregnancies and live births after autograft of frozen-thawed hemi-ovaries into ewes. Fertility and Sterility. 77(2): Sanfilippo S., Canis M., Ouchchane L., Botchorishvili R., Artonne C., Janny L. & Brugnon F Viability assessment of fresh and frozen/thawed isolated human follicles: reliability of two methods (Trypan blue and Calcein AM/ethidium homodimer-1). Journal of Assisted Reproduction and Genetics. 28(12): Santos R.R., Amorim C., Cecconi S., Fassbender M., Imhof M., Lornage J., Paris M., Schoenfeldt V. & Martinez-Madrid B Cryopreservation of ovarian tissue: An emerging technology for female germline preservation of endangered species and breeds. Animal Reproduction Science. 122(3-4): Santos R.R., Tharasanit T., Van Haeften T., Figueiredo J.R., Silva J.R.V. & Van den Hurk R Vitrification of goat preantral follicles enclosed in ovarian tissue by using conventional and solid-surface vitrification methods. Cell and Tissue Research. 327(1): Wallin A., Ghahremani M., Dahm-Kähler P. & Brännström M Viability and function of the cryopreserved whole ovary: in vitro studies in the sheep. Human Reproduction. 24(7):

99 99 9. CAPÍTULO 4 Novo método de grande capacidade inovadora para vitrificação de caprinos ovários: Ovarian Tissue Cryosystem (OTC) Novel wide-capacity method for vitrification of caprine ovaries: Ovarian Tissue Cryosystem (OTC) Periódico: Animal Reproduction Science, v. 138, n. 3-4, p , 2013.

100 100 RESUMO O objetivo deste estudo foi verificar a eficiência de uma nova técnica para vitrificação de tecido ovariano sem o contato direto com o nitrogênio líquido, o Ovarian Tissue Cryosystem (OTC). De cada par ovariano, fragmentos foram imediatamente recuperados e fixados para análise (controle fresco) ou o tecido ovariano foi fragmentado em diferentes dimensões (fragmento, hemi-ovário, ovário inteiro), sendo parte do tecido posteriormente cultivada in vitro por dois dias. A vitrificação foi realizada utilizando o OTC. O OTC consiste de uma estrutura cilíndrica feita de aço inoxidável e composta por três peças (base, insert e tampa), as quais podem ser fechadas, evitando o contato com o nitrogênio líquido durante o procedimento de vitrificação. Antes e após o cultivo in vitro o tecido ovariano foi avaliado por histologia. Independente da dimensão de tecido vitrificada foi observada uma redução (P<0,05) no percentual de folículos morfologicamente normais no tecido ovariano submetido à vitrificação quando comparado ao controle fresco. Além disso, a análise ultra-estrutural demonstrou uma grande extensão de degeneração folicular quando realizada a vitrificação de ovário inteiro. A manutenção da morfologia folicular após o cultivo in vitro foi maior quando a vitrificação foi realizada em fragmentos ovarianos quando comparada vitrificação realizada em hemi-ovário e ovário inteiro. Em conclusão, o Ovarian Tissue Cryosystem (OTC) abre novas possibilidades para a vitrificação de fragmentos de tecido ovariano caprino. Palavras-chave: Criopreservação. Folículos pré-antrais. Tecido ovariano. Ultraestrutura.

101 101 Novel wide-capacity method for vitrification of caprine ovaries: Ovarian Tissue Cryosystem (OTC) A.A. Carvalho a,, L.R. Faustino a, C.M.G. Silva a, S.V. Castro a, C.A.P. Lopes a, R.R. Santos b,c, S.N. Báo d, J.R. Figueiredo a, A.P.R. Rodrigues a a Laboratory of Manipulation of Oocytes and Preantral Follicles, Faculty of Veterinary, State University of Ceará, Fortaleza, CE, Brazil b Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands c Animal Science Post-graduation Program, Federal University of Pará, Brazil d Laboratory of Microscopy, Department of Cell Biology, University of Brasília, Brasília, DF, Brazil ABSTRACT In this study we aimed testing the efficiency of a newly developed device for vitrification of ovaries without contact with liquid nitrogen, Ovarian Tissue Cryosystem (OTC). From each ovarian pair, fragments were recovered and immediately fixed for analysis (fresh control) or submitted to vitrification (fragments, hemi-ovary or whole ovary), either or not followed by in vitro culture for two days. Vitrification was performed using the OTC system. The OTC is a cylindrical structure made by stainless steel and composed by three pieces (basis, insert and cover), which can be hermetically closed avoiding contact of the tissue with liquid nitrogen during vitrification. Before and after culture, the ovarian tissue was histologically evaluated. Independently from the size of the ovarian tissue, it was observed a decrease (P < 0.05) in the rates of normal preantral follicles when fragments (58.1%), hemi-ovary (54.4%) and whole ovary (54.3%) were vitrified, in comparison with fresh control (68.1%). These data were confirmed by ultrastructural analysis, which showed a great extension of degeneration in follicles vitrified in the whole ovary. Follicular survival after vitrification followed by culture was higher (P < 0.05) when ovarian fragments were vitrified (36.1%) than in those enclosed in vitrified hemi-ovary (22.3%) or whole ovary

102 102 (18.4%). In conclusion, the Ovarian Tissue Cryosystem (OTC) opens a new possibility for successful vitrification of caprine ovarian fragments. Keywords: Cryopreservation. Goat. Preantral follicles. Ovary.

103 Introduction Cryopreservation of ovarian tissue has been applied in clinical practice since the reports of ovarian function recovery in human (Aubard et al., 2001), domestic animals (Wallin et al., 2009; Arav et al., 2010) and endangered species (Shaw et al., 2000). The main advantage of this technique is the preservation of oocytes enclosed in primordial follicles (Lin et al., 2008). The success of ovarian tissue cryopreservation can be recognized by the live birth in different animal species (mice: Takahashi et al., 2001; Chen et al., 2006; rabbit: Almodin et al., 2004; birds: Liu et al., 2010; sheep: Salle et al., 2003; Bordes et al., 2005; and human: Donnez et al., 2004, 2012; Sánchez- Serrano et al., 2010; Dittrich et al., 2012; Revelli et al., 2013). All human live births from cryopreserved ovarian tissue, until now has been obtained after a slow freezing program. However, there is still a discussion about which method is better for tissue cryopreservation. The slow freezing has the advantage of better diffusion of solutes during freezing (Dittrich et al., 2007). Nevertheless, the vitrification can also be an extremely valuable technique for cryopreservation of complex systems, such as tissues and whole organs, due to possibility of avoiding ice formation (Fahy et al., 2006; Dittrich et al., 2007). This technique has gained attention because the formation of hexagonal intracellular crystal ice is avoided (Keros et al., 2009), and often can be performed without equipment. There are many strategies to perform vitrification of cells and tissues. Among them, the use of plastic cryovals or straws are reported (Rahimi et al., 2004; Bordes et al., 2005). However, the polypropylene or polyvynil chloride is not a good heat conductor, which can compromise the chilling rates in the material to be vitrified (Sansinena et al., 2012). As an attempt to increase the rate of vitrification, techniques such as solid-surface vitrification has been applied, resulting in the preservation of follicular morphology and viability (Santos et al., 2007), as well as in the preservation of the oocyte ultrastructure (Lunardi et al., 2012). However, when used an open system, the sample exposure to the nitrogen vapour may allow the exposure to pathogens resistant to cryogenic temperatures (Grout and Morris, 2009). The risk of contamination is also observed in other vitrification techniques such as the cryotissue (Kagawa et al., 2009), the needle immersed vitrification (Wang et al., 2008) and the direct cover vitrification (Zhou et al., 2010). In all these used techniques, the rates of success are variable and tissue may be directly exposed to liquid nitrogen or its vapour.

104 104 Therefore, to improve heat exchange without expose the ovarian tissue to contaminants, we have developed a device for the vitrification of caprine ovarian tissue. Such a device, so-called Ovarian Tissue Cryosystem (OTC) will also facilitate the vitrification process in all phases, i.e. cryoprotectant equilibrium, heat exchange, tissue storage, and cryoprotectant removal. Furthermore, it should be applied to vitrify simultaneous several ovarian tissue fragments, large tissue pieces (hemi-ovary) or even the whole ovary. 2. Materials and methods This experiment was approved and performed under the guidelines of Ethics Committee for Animal Use of State University of Ceará. Except where otherwise stated, all chemicals were obtained from Sigma (Sigma Chemical Co., St. Louis, MO, USA). 2.1 Collection and preparation of goat ovarian tissue Ovaries from adult goats (n=5) were collected at a local slaughterhouse. Immediately post-mortem, ovaries were washed once in 70% alcohol for 10 s, followed by two washes in HEPES-buffered minimum essential medium (MEM) supplemented with 100 µg/ml penicillin and 100 µg/ml streptomycin. This medium was also used to ovaries transportation (at 20 C) to the laboratory, within 1 h after they were collected. At the laboratory, for each ovarian pair, one ovary was divided into two halves. From one hemi-ovary, small fragments (3 mm 3 mm 1 mm) were obtained. Part of the fragments were either immediately destined to non-vitrified tissue (fresh control) or submitted to the vitrification procedure. The remaining ovary as well as the other hemiovary were also used for the same vitrification procedure used for the fragments. For the vitrification procedure a new cryodevice called Ovarian Tissue Cryosystem (OTC) was developed by our team. Both non-vitrified tissue and vitrified tissues (fragment, hemiovary, whole ovary) were cultured for 2 days, and subsequently analyzed by light microscopy and transmission electronic microscopy (Fig. 1).

105 105 Fig. 1. Experimental design to assess the effect of vitrification of different dimensions of ovarian tissue (fragment, hemi-ovary, whole ovary) on the morphology of goat preantral follicles. LM: light microscopy; TEM: transmission electronic microscopy; IVC: in vitro culture. 2.2 Vitrification and warming procedures by OTC Vitrification of ovarian fragments, hemi-ovary or whole ovary was performed. Equilibrium of the samples in the vitrification solution (VS) was performed gradually in two steps: (i) VS1 contained MEM supplemented with 10 mg/ml BSA, 0.25 M sucrose, 10% ethylene glycol (EG) (Dinâmica - Dinâmica Química, Diadema, Brazil) and 10% dimethyl sulfoxide (DMSO) (Dinâmica). Similarly, (ii) VS2 was composed of MEM supplemented with 10 mg/ml BSA, 0.25 M sucrose, 20% EG and 20% DMSO. The fragments were initially exposed to VS1 for 4 min. Subsequently, they were exposed to VS2 for 1 minute. Regarding exposure of the hemi-ovaries to the VS1 for 8 min and VS2 during 2 min, the tissue was randomly punctured before the ovary was exposed to the cryoprotectant as previously described (Kim et al., 2010). The whole ovaries were perfused through the hilum by a needle (31 G). Subsequently, the vitrification solution (2 ml) was slowly injected (10 seconds), after which the whole ovary was immersed in the vitrification solution. The same procedure was performed for VS1 and VS2. The whole ovaries remained immersed for 8 min in VS1 and for 2 min in VS2. All procedures for exposure to cryoprotectant agents to vitrification were performed in OTC, which was closed and immediately immersed and stored in liquid nitrogen for one

106 106 week. For the warming, OTC containing the vitrified samples was exposed to room temperature ( 25 C) (1 minute for ovarian fragments and hemi-ovary, and 2 min for whole ovaries), then OTC was immersed at 37 C in a water bath for 30 seconds (ovarian fragments), 1 minute (hemi-ovary), and 2 min (whole ovary). After warming, both hemi-ovary and whole ovary were fragmented in pieces of 3x3x1 mm and submitted to VS removal, as well as the ovarian fragments. VS removal was performed by in a three-step equilibrium (5 min each) in (i) MEM + 3 mg/ml BSA M sucrose, (ii) MEM + 3mg/mL BSA M sucrose, and finally (iii) MEM + 3 mg/ml BSA. 2.3 Ovarian Tissue Cryossystem (OTC) As shown in Fig. 2, OTC is a cylindrical structure composed by three structures: (i) a basis (2.1 cm height; 2.8 cm diameter and 0.2 cm thickness), in which the samples are placed, (ii) an insert (2.8 cm height; 2.3 cm diameter and 0.1 cm thickness) containing 20 perforation to allow exposure and removal of VS, and (iii) a cover (2.0 cm height; 2.8 cm diameter and 0.2 cm thickness) to close the device hermetically. The insert is necessary to reduce the tissue surrounding media and speed up the ultrarapid cooling which is necessary in vitrification. The OTC is made by stainless steel, and it can support temperatures lower than 196 C and higher than 200 C under high pressure, allowing its sterilization and reutilization. 2.4 In vitro culture Non-vitrified (fresh control) and vitrified ovarian tissues were cultured during 2 days. The in vitro culture was performed at 39 C in 5% CO 2 in a humidified incubator, and all media were incubated for 1 hour before use. The culture medium consisted of α-mem (ph ) supplemented with ITS (1.0 mg/ml insulin, 5.5 mg/ml transferrin, and 5.0 ng/ml selenium), 2 mmol/l glutamine, 2 mmol/l hypoxantine, 1.25 mg/ml BSA, 50 µg/ml ascorbic acid, 50 µg/ml recombinant follicle stimulating hormone (rfsh), and 100 µg/ml penicillin-streptomycin (Faustino et al., 2010).

107 Histological analysis Samples were fixed in Millonig s solution (phosphate-buffered 40% vol/vol formaldehyde in water) for 12 h, dehydrated in a graded series of ethanol, clarified with xylene, embedded in paraffin wax, and serially sectioned into 7 µm sections. Every fifth section was mounted on a glass slide, stained with hematoxylin-eosin (HE), and evaluated using a light microscope (Nikon, Tokyo, Japan) at magnification of 400x. In each treatment, a total of 150 preantral follicles (30 per animal) were examined, which were defined as an oocyte surrounded either by one layer flattened or cuboidal granulosa cells, or several layers cuboidal granulosa cells without antrum. The quality of the preantral follicles was classified according to the parameters previously described (Pinto et al., 2008). Briefly, morphologically normal follicles contained an intact oocyte and granulosa cells, whereas degenerated follicles contained an oocyte with a pyknotic nucleus, ooplasma shrinkage and/or granulosa cell layers that had disorganized and detached from the basement membrane. To avoid evaluating and counting the same follicle more than once, preantral follicles were analyzed only in the sections in which an oocyte nucleus was observed. 2.6 Transmission electron microscopy Ultrastructural analysis was performed using preantral follicles obtained from non-vitrified tissue (fresh control), vitrified (fragment, hemi-ovary and whole ovary) and fragment and hemi-ovary cultured in vitro. Briefly, small pieces of ovarian cortex with maximum dimension of 1 mm 3 were fixed in Karnovsky solution (2% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer ph 7.2) for 3 hours at RT. After fixation, the specimens were rinsed in buffer and post-fixed in 1% osmium tetroxide, 0.8% potassium ferricyanide and 5 mm CaCl 2 in 0.1 M sodium cacodylate buffer for 1 hour at RT and in-block contrasted with uranyl acetate. Subsequently the samples were dehydrated in acetone and embedded in Spurr resin. Semi-thin sections (4 μm) were cut and stained with toluidine blue and analysed by light microscopy at 400x magnification. Ultra-thin sections (70-75 nm) were obtained from preantral follicles that were classified as morphologically normal in semi-thin sections according to standard histological criteria. Then, ultra-thin sections were examined under a transmission electron microscope (Jeol JEM 1011, Jeol, Tokyo, Japan)

108 108 operating at 80 kv. The density and integrity of ooplasmic and granulosa cell organelles, as well as vacuolization, and basement membrane integrity were evaluated. Fig. 2. Ovarian Tissue Cryosystem: New stainless steel device developed for the vitrification procedures. (A) OTC opened enabling the visualization of its 3 constituent parts: basis (a), insert (b) cover (c). Note the perforations in the upper portion of the insert to facilitate placement and removal of solutions. (B) Exposure of the tissue (hemiovary) to vitrification solution in the basis of the OTC. (C) Inclusion of the insert in the basis of the OTC allows for observation of aseptic handling of the insert. (D) Closure of the basis, with the insert already enclosed, with the cover of the OTC. (E) Storage of OTC, containing the sample to be vitrified in the liquid nitrogen dewars. Note that this system prevents contact of the vitrified sample with liquid nitrogen.

109 Statistical analysis Percentages of morphologically normal follicles were initially submitted to Kolmogorov-Smirnov and Bartlett tests to confirm normal distribution and homogeneity of variances, respectively. The percentages of morphologically normal follicles were compared using one-way ANOVA. The differences were considered to be significant when P < 0.05 and results were expressed as mean ± standard error of means (SEM). 3. Results 3.1 Histological analysis A total of 1200 preantral follicles (150 follicles/ treatment) were analyzed. Morphological features of normal and atretic preantral follicles are shown in Fig. 3. Immediately after warming (non-cultured tissue), the percentages of normal follicles was decreased (P < 0.05) in comparison with fresh control (68.1%), independently on the tissue size, i.e. fragment (58.1%), hemi-ovary (54.5%) or whole ovary (54.3%). However, no differences (P > 0.1) were found due to tissue size (Table 1). Fig. 3. Photomicrographs of goat ovarian cortical histological sections. (A) Normal primordial follicle. (B) Degenerated follicles with retraction of ooplasm. Nu, nucleus; GC, granulosa cells; arrows, shrunken ooplasm. After IVC, the percentages of normal follicles was also decreased (P < 0.05) in vitrified-warmed samples in comparison with cultured control. Only freshly culture ovarian tissue (cultured control) preserved similar percentages of normal follicles as in

110 110 the fresh control. Furthermore, vitrification of ovarian fragments presented greater (P < 0.05) rates of normal preantral follicles (36.1%) than those vitrified as hemi-ovary (22.3%) and whole ovary (18.4 %). Table 1 Percentage of morphologically normal preantral follicles enclosed in fresh ovarian tissue and vitrified into fragments, hemi-ovary or whole ovary, before and after in vitro culture. Treatments Non-cultured In vitro culture (%) (%) Control 68.1 ± 1.4 Aa 55.1 ± 2.1 Aa Fragment vitrified 58.1 ± 0.6 Ba 36.1 ± 1.6 Bb Hemi-ovary vitrified 54.4 ± 1.5 Ba 22.3 ± 0.9 Cb Whole ovary vitrified 54.3 ± 0.8 Ba 18.4 ± 0.8 Cb Data are mean ± SEM. A,B,C Different upper-case letters within a column indicate significant difference (P < 0.05). a,b Different lower-case letters within a row indicate significant difference before and after culture in the same treatment (P < 0.05). 3.2 Transmission electron microscopy After ultrastructural analysis only normal follicles observed in semi-thin sections were evaluated. The follicles from fresh control showed well-delimited membranes, few vacuoles, and organelles uniformly distributed throughout the cytoplasm. Round mitochondria were the most evident organelle (Fig. 4A). After ovarian tissue vitrification fragment and hemi-ovary, the follicles were well-preserved, similar to the fresh control, with nucleus well-delimited by the nuclear envelope, and granulosa cells showed normal appearance. Nevertheless, we observed some discreet changes in those follicles, e.g. presence of larger vacuoles (Fig. 4B and C). Follicles vitrified in the whole ovary, and non-cultured, exhibited several signals of vacuolization, multivesicular bodies in the ooplasm and granulosa cells detachment from the oocyte (Fig. 4D). Ultrastructural analysis after IVC was performed only in those follicles previously vitrified within ovarian fragments or hemi-ovary. Although

111 111 follicles from vitrified/cultured fragments presented some vacuoles, mitochondrial shape was normal and the follicles were intact (Fig. 5A). Follicles recovered from vitrified hemi-ovary and subsequently cultured, exhibited several vacuoles and granulosa cells detachment from the oocyte (Fig. 5B). Fig. 4. Electron micrographs of goat preantral follicles from fresh control (A) and after vitrification of fragments (B), hemi-ovary (C), and whole ovary (D). Note in A, B and C the normal follicular ultrastructure with round mitochondria and intact granulosa cells, and a degenerated preantral follicle in D. GC: granulosa cells; O: oocyte; Nu: nucleus; n: nucleolus; m: mitochondria; V: vacuole; arrow: nuclear envelope; *: empty spaces. Scale bars = 5 µm. 4. Discussion In the present study, we have developed a device, the Ovarian Tissue Cryosystem (OTC), to improve the capacity of vitrification of several ovarian fragments

112 112 simultaneously and, in the future, it can be applied also for the preservation of greater structures such as hemi-ovary and whole ovary. Fig. 5. Electron micrographs of goat preantral follicles of in vitro cultured tissues after vitrification of fragments (A) and hemi-ovary (B). Note in (A), a well-preserved preantral follicle and in (B), a follicle in advanced stage of degeneration. GC: granulosa cells; O: oocyte; m: mitochondria; V: vacuole; *: empty spaces. Scale bars = 5 µm. Slow freezing of ovarian tissue has been indicated because of the cell morphology preservation (Isachenko et al., 2007) and unnafected mrna expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (Isachenko et al., 2009) after freezing-thawing of ovarian tissue. However, vitrification of ovarian tissue also resulted in preserved follicular morphology and viability (Santos et al., 2007) and stromal density (Keros et al., 2009; Ting et al., 2011). Indeed, several studies have shown no differences when slow freezing and vitrification were compared regarding preservation of follicular morphology (Isachenko et al., 2009; Kim et al., 2011), ultrastructure (Kim et al., 2011), percentages of necrotic cells (Rahimi et al., 2004) and tissue revascularization after transplantation (Rahimi et al., 2010). Vitrification, moreover, has the advantage to avoid the formation of hexagonal ice crystals (Keros et al., 2009). In this study, the vitrification was performed without any contact with liquid nitrogen, avoiding the risks of contamination with pathogens that are resistant to such temperatures (Grout and Morris, 2009). Recently, Bos-Mikich et al. (2012) also used a closed metal container for vitrification, which also avoids the direct contact of the sample with liquid nitrogen. However, samples were disposed in plastic cryovials after

113 113 be placed in the metal container to avoid contact with liquid nitrogen. Using the OTC, the cryoprotectant exposure and removal is easily performed, without any direct contact of the operator with the vitrification solution, and no need of cryovials or straws. This device follows the logistic of the solid-surface vitrification method, previously described as a successful method for caprine (Santos et al., 2007) and human (Huang et al., 2008) ovarian tissue cryopreservation. Moreover, OTC is made of a material resistant to mechanical shock and extreme temperature changes. Although we have observed a decrease in the rates of normal preantral follicles after vitrification, this is not a surprisingly finding once many other authors have found the same independently on the applied technique (Isachenko et al., 2007; Huang et al., 2008; Zhou et al., 2010; Carvalho et al., 2011). Such a decrease might be caused by the osmotic stress to which cells are exposed during vitrification (Vajta et al., 1998), toxicity of cryoprotectants (Aye et al., 2010), basement membrane impairment (Ghetler et al., 2005) and other alterations at ionic (Gualtieri et al., 2011) or molecular (David et al., 2011) level. Thus, we believe follicular degeneration observed in different cellular compartments may have been influenced by such changes. The ooplasm vacuolization was the cell damage more frequently found in this study, a result similar to the observed by Oskam et al. (2010). Vacuolization was prominent in follicles vitrified enclosed in hemi-ovary and whole ovary. Probably our perfusion procedure was inefficient to allow the proper penetration of the vitrification solution in the tissue. According Wallin et al. (2009) vitrification of ovaries from small ruminants is difficult due the large ovarian volume, becoming difficult a proper perfusion and cryoprotectant removal after warming, as well as may affect heat exchange, explaining our ultrastructural findings. One must bear in mind that the success of the vitrification method can only be evaluated by transplantation of the ovarian tissue, e.g. into the SCID-mouse (Gook et al., 2005), because only in such conditions it is possible to evaluate tissue recovery after ischemic stress, the period required for graft revascularization, and survival and proliferation of stromal cells, which are essential for follicle survival and development. However, IVC of ovarian tissue after vitrification-warming appears as a suitable and rapid tool to indicate which protocols should be taken for further studies. Cellular alterations were more evident after IVC. It is well known that after cryopreservation the cells need an adaptation time (hours or days) to recover their metabolism allowing the identification of the cell alterations or even death (Rahimi et al., 2004; Choi et al., 2008). Furthermore, Men et al. (2003) have shown that

114 114 cryopreservation makes follicles less tolerant to IVC and more susceptible to cell death. Therefore, we suggest that vitrified/warmed cells have different needs during IVC, and a specific protocol to culture of cryopreserved preantral follicles should be developed. In conclusion, the Ovarian Tissues Cryossystem opens a new possibility for successful vitrification of caprine ovarian fragments. Acknowledgments This work was supported by CNPq, FINEP and CAPES, Brazil. A.A. Carvalho, J.R. Figueiredo, S.N. Báo and A.P.R Rodrigues are supported by a grant from CNPq. References Almodin, C.G., Minguetti-Camara, V.C., Meister, H., Ferreira, J., Franco, R.L., Cavalcante, A.A., Radaelli, M.R.M., Bahls, A.S., Moron, A.F., Murta, C.G.V., Recovery of fertility after grafting of cryopreserved germinative tissue in female rabbits following radiotherapy. Hum. Reprod. 19, Arav, A., Gavish, Z., Elami, A., Natan, Y., Revel, A., Silber, S., Gosden, R.G., Patrizio, P., Ovarian function 6 years after cryopreservation and transplantation of whole sheep ovaries. Reprod. Biomed. Online 20, Aubard, Y., Poirot, C., Piver, P., Galinat, S., Teissier, M.P., Are there indications for ovarian tissue cryopreservation? Fertil. Steril. 76, Aye, M., Giorgio, C., Mo, M.Di., Botta, De., Perrin, A., Courbiere, B.J., Assessment of the genotoxicity of three cryoprotectans used for human oocyte vitrification: dimethyl sulfoxide, ethylene glycol and propylene glycol. Food Chem. Toxicol. 48, Bordes, A., Lornage, J., Demirci, B., Franck, M., Courbiere, B., Guerin, J.F., Salle, B., Normal gestations and live births after orthotopic autograft of vitrified warmed hemi-ovaries into ewes. Hum. Reprod. 20, Bos-Mikich, A., Marques, L., Rodrigues, J.L., Lothhammer, N., Frantz, N , The use of a metal container for vitrification of mouse ovaries, as a clinical grade model for human ovarian tissue cryopreservation, after different times and temperatures of transport. J Assist Reprod Genet. 29,

115 115 Carvalho, A.A., Faustino, L.R., Silva, C.M.G., Castro, S.V., Luz, H.K.M., Rossetto, R., Lopes, C.A.P., Campello, C.C., Figueiredo, J.R., Rodrigues, A.P.R., Costa, A.P.R., Influence of vitrification techniques and solutions on the morphology and survival of preantral follicles after in vitro culture of caprine ovarian tissue. Theriogenology 76, Chen, S.U., Chien, C.L. Wu. M.Y., Chen. T.H., Lai, S.M., Lin, C.W., Yang, Y.S., Novel direct cover vitrification for cryopreservation of ovarian tissues increases follicle viability and pregnancy capability in mice. Hum. Reprod. 21, Choi, J.Y., Lee, B.E., Lee, E.Y., Yoon, B.K., Bae, D.S., Choi, D.S., Cryopreservation of ovarian tissues temporarily suppresses the proliferation of granulosa cells in mouse preantral follicles. Cryobiology 56, David, A., Dolmans, M.M., Langendonckt, A.V., Donnez, J., Amorim, C.A., Immunohistochemical localization of growth factors after cryopreservation and 3 weeks xenotransplantation of human ovarian tissue. Fertil Steril. 95, Dittrich, R., Lotz, L., Keck, G., Hoffmann, I., Mueller, A., Beckmann, M.W., van der Ven, H., Montag, M., Live birth after ovarian tissue autotransplantation following overnight transportation before cryopreservation. Fertil Steril. 97, Dittrich, R., Mueller, A., Hoffmann, I., Beckmann, M.W., Maltaris, T., Cryopreservation of complex systems: slow freezing has not had its day yet. Rejuvenation Res. 10, Donnez, J., Dolmans, M.M., Demylle, D., Jadoul, P., Pirard, C., Squifflet, J., Martinez- Madrid, B., Van Langendonckt, A., Livebirth after orthotopic transplantation of cryopreserved ovarian tissue. Lancet 364, Donnez, J., Jadoul, P., Pirard, C., Hutchings, G., Demylle, D., Squifflet, J., Smitz, J., Dolmans, M.M., Live birth after transplantation of frozen-thawed ovarian tissue after bilateral oophorectomy for benign disease. Fertil. Steril. 98, Fahy, G.M., Wowk, B., Wu, J., Cryopreservation of complex systems: the missing link in the regenerative medicine supply chain. Rejuvenation Res. 9, Faustino, L.R., Santos, R.R., Silva, C.M.G., Pinto, L.C., Celestino, J.J.H., Campello, C.C., Figueiredo, J.R., Rodrigues, A.P.R., Goat and sheep ovarian tissue cryopreservation: Effects on the morphology and development of primordial follicles and density of stromal cell. Anim. Reprod. Sci. 122,

116 116 Ghetler, Y., Yavin, S., Shalgi, R., Arav, A., The effect of chilling on membrane lipid phase transition in human oocytes and zygotes. Hum. Reprod. 20, Gook, D.A., Edgar, D.H., Borg, J., Archer, J., McBain, J.C., Diagnostic assessment of the developmental potential of human cryopreserved ovarian tissue from multiple patients using xenografting. Hum Reprod. 20, Grout, B.W.W., Morris, G.J., Contaminated liquid nitrogen vapour as a risk factor in pathogen transfer. Theriogenology 71, Gualtieri, R., Mollo, V., Barbato, V., Fiorentino, I., Iaccarino, M., Talevi, R., Ultrastructure and intracellular calcium response during activation in vitrified and slow-frozen human oocytes. Hum. Reprod. 26, Huang, L., Mo, Y., Wang, W., Li, Y., Zhang, Q., Yang, D., Cryopreservation of human ovarian tissue by solid-surface vitrification. Eur. J. Obstet. Gynecol. Reprod. Biol. 139, Isachenko, V., Isachenko, E., Reinsberg, J., Montag, M., van der Ven, K., Dorn, C., Roesing, B., van der Ven, H., Cryopreservation of human ovarian tissue: comparison of rapid and conventional freezing. Cryobiology 55, Isachenko, V., Lapidus, I., Isachenko, E., Krivokharchenko, A., Kreienberg, R., Woriedh, M., Bader, M., Weiss, J.M., Human ovarian tissue vitrification versus conventional freezing: morphological, endocrinological, and molecular biological evaluation. Reproduction 138, Kagawa, N., Silber, S., Kuwayama, M., Successful vitrification of bovine and human ovarian tissue. Reprod. Biomed. Online 18, Keros, V., Xella, S., Hultenby, K., Pettersson, K., Sheikhi, M., Volpe, A., Hreinsson, J., Hovatta, O., Vitrification versus controlled-rate freezing in cryopreservation of human ovarian tissue. Hum. Reprod. 24, Kim, G.A., Kim, H.Y., Kim, H.Y., Lee, G., Lee, E., Ahn, J.Y., Park, J.H., Lim, J.M., Effectiveness of slow freezing and vitrification for long-term preservation of mouse ovarian tissue. Theriogenology 75, Kim, G.A., Kim, H.Y., Kim, J.W., Lee, G., Lee, E., Lim, J.M., Ultrastructural deformity of ovarian follicles induced by different cryopreservation protocols. Fertil. Steril. 94, Lin, T.C., Yen, J.M., Kuo, T.C., Gong, K.B., Hsu, K.H., Hsu, T.T., Comparison of the developmental potential of 2-week-old preantral follicles derived from

117 117 vitrified ovarian tissue slices, vitrified whole ovaries and vitrified/transplanted newborn mouse ovaries using the metal surface method. BMC Biotechnol. 8, Liu, J., Song, Y., Cheng, K.M., Silversides, F.G., Production of donor-derived offspring from cryopreserved ovarian tissue in japanese quail (Coturnix japonica). Biol. Reprod. 83, Lunardi, F.O., Araújo, V.R., Faustino, L.R., Carvalho, A.A., Gonçalves, R.F.B., Bass, C.S., Báo, S.N., Nameb, K.P.O., Campello, C.C., Figueiredo, J.R., Rodrigues, A.P.R., Morphologic, viability and ultrastructural analysis of vitrified sheep preantral follicles enclosed in ovarian tissue. Small Rumin. Res. 107, Men, H., Monson, R.L., Parrish, J.J., Rutledge, J.J., Degeneration of cryopreserved bovine oocytes via apoptosis during subsequent culture. Cryobiology 47, Oskam, I.C., Asadi, B.A., Santos, R.R., Histologic and ultrastructural features of cryopreserved ovine ovarian tissue: deleterious effect of 1,2-propanediol applying different thawing protocols. Fertil. Steril. 93, Pinto, L.C., Santos, R.R., Faustino, L.R., Silva, C.M.G., Luz, V.B., Júnior, J.E.M., Soares, A.A.X., Celestino, J.J.H., Mafezoli, J., Campello, C.C., Figueiredo, J.R., Rodrigues, A.P.R., Quantification of dimethyl sulfoxide perfusion in sheep ovarian tissue: a predictive parameter for follicular survival to cryopreservation. Biopreserv Biobank 6, Rahimi, G., Isachenko, E., Isachenko, V., Sauer, H., Wartenberg, M., Tawadros, S., Hescheler, J., Mallmann, P., Nawroth, F., Comparison of necrosis in human ovarian tissue after conventional slow freezing or vitrification and transplantation in ovariectomized SCID mice. Reprod. Biomed. Online 9, Rahimi, G., Isachenko, V., Kreienberg, R., Sauer, H., Todorov, P., Tawadros, S., Mallmann, P., Nawroth, F., Isachenko, E., Re-vascularisation in human ovarian tissue after conventional freezing or vitrification and xenotransplantation. Eur. J. Obstet. Gynecol. Reprod. Biol. 149, Revelli, A., Marchino, G., Dolfin, E., Molinari, E., Delle Piane, L., Salvagno, F., Benedetto, C., Live birth after orthotopic grafting of autologous cryopreserved ovarian tissue and spontaneous conception in Italy. Fertil Steril. 99,

118 118 Salle, B., Demirci, B., Franck, M., Berthollet, C., Lornage, J., Long-term followup of cryopreserved hemi-ovary autografts in ewes: pregnancies, births, and histologic assessment. Fertil. Steril. 80: Sánchez-Serrano, M., Crespo, J., Mirabet, V., Cobo, A.C., Escribá, M.J., Simón, C., Pellicer, A., Twins born after transplantation of ovarian cortical tissue and oocyte vitrification. Fertil. Steril. 93, e11-e13. Sansinenaa, M., Santos, M.V., Zaritzky, N., Chirife, J., Comparison of heat transfer in liquid and slush nitrogen by numerical simulation of cooling rates for French straws used for sperm cryopreservation. Theriogenology 77, Santos, R.R., Tharasanit, T., Van Haeften, T., Figueiredo, J.R., Silva, J.R.V., Van den Hurk, R Vitrification of goat preantral follicles enclosed in ovarian tissue by using conventional and solid-surface vitrification methods. Cell Tissue Res. 327, Shaw, J.M., Oranratnachai, A., Trounson, A.O., Fundamental cryobiology of mammalian oocytes and ovarian tissue. Theriogenology 53, Takahashi, E., Miyoshi, I., Nagasu, T., Rescue of a transgenic mouse line by transplantation of a frozen-thawed ovary obtained postmortem. Contemp. Top. Lab. Anim. Sci. 40, Ting, A.Y., Yeoman, R.R., Lawson, M.S., Zelinski, M.B., In vitro development of secondary follicles from cryopreserved rhesus macaque ovarian tissue after slowrate freeze or vitrification. Hum. Reprod. 26, Vajta, G., Holm, P., Kuwayama, M., Booth, P.J., Jacobsen, H., Greve, T., Callesen, H., Open pulled straw (OPS) vitrification: a new way to reduce cryoinjuries of bovine ova and embryos. Mol. Reprod. Dev. 51, Wallin, A., Ghahremani, M., Dahm-Kähler, P., Brännström, M., Viability and function of the cryopreserved whole ovary: in vitro studies in the sheep. Hum. Reprod. 24, Wang, Y., Xiao, Z., Li, L., Fan, W., Li, S.W., Novel needle immersed vitrification: a practical and convenient method with potential advantages in mouse and human ovarian tissue cryopreservation. Hum. Reprod. 23, Zhou, X.H., Wu, Y.J., Shi, J., Xia, Y.X., Zheng, S.S., Cryopreservation of human ovarian tissue: comparison of novel direct cover vitrification and conventional vitrification. Cryobiology 60,

119 CAPÍTULO 5 Adição de catalase às soluções de vitrificação mantém a estabilidade dos folículos préantrais ovarianos Catalase addition to vitrification solutions maintains ovarian preantral follicles stability Periódico: Research in Veterinay Science (Submetido em outubro de 2013).

120 120 RESUMO O objetivo deste estudo foi verificar se a adição de catalase (20 UI/mL) em diferentes etapas da vitrificação de tecido ovariano caprino afeta os níveis de ROS, morfologia e viabilidade folicular, densidade de células do estroma, apoptose e expressão de proteínas relacionadas à sinalização de dano (γh2ax) e reparo (53BP1) do DNA. O tecido ovariano foi analisado fresco (controle) ou após a vitrificação: sem catalase (-/-), com catalase nas soluções de vitrificação (+/-), com catalase nas soluções de lavagem (- /+) ou com catalase em ambas as soluções (+/+). A vitrificação sem catalase (-/-) resultou em maior nível de ROS que o controle. A adição de catalase, independente da etapa em que foi adicionada, manteve os níveis de ROS similar ao controle. Não existiu diferença entre os tratamentos quando analisada a viabilidade folicular, densidade de células do estroma e detecção de γh2ax e 53BP1. Também não foi observada diferença na morfologia folicular e fragmentação do DNA nos grupos vitrificados. Em conclusão, a adição de catalase nas soluções de vitrificação previne a formação de ROS em tecido ovariano caprino vitrificado. Palavras-chave: Apoptose. Criopreservação. Dano ao DNA. Espécies reativas de oxigênio.

121 121 Catalase addition to vitrification solutions maintains ovarian preantral follicles stability AA Carvalho a*, LR Faustino a, CMG Silva a, SV Castro a, CH Lobo b, FW Santos c, RR Santos d,e, CC Campello a, V Bordignon f, JR Figueiredo a, APR Rodrigues a a- Laboratory of Manipulation of Oocytes and Preantral Follicles, Faculty of Veterinary, State University of Ceará, Fortaleza, CE, Brazil; b- Laboratory of Animal Physiology, Department of Animal Science, Federal University of Ceará, Fortaleza, CE, Brazil; c- Laboratório de Biotecnologia da Reprodução (BIOTECH), Universidade Federal do Pampa (UNIPAMPA), Uruguaiana, RS, Brazil; d- Faculty of Veterinary Medicine, Utrecht University, Utrecht, Netherlands; e- Animal Science Post-graduation Program, Federal University of Pará, Belém, PA, Brazil; f- Department of Animal Science, McGill University, Ste-Anne-de-Bellevue, QC, Canada Abstract The aim of this study was to verify whether the addition of catalase (20 IU/mL) at different steps of goat ovarian tissue vitrification affects ROS levels, follicular morphology and viability, stromal cells density, apoptosis and the expression of proteins related to DNA-damage signalling (γh2ax) and repair (53BP1). Goat ovarian tissues were analyzed fresh (control) or after vitrification: without catalase (VS-/WS-), with catalase in vitrification solutions (VS+/WS-), with catalase in washing solutions (VS- /WS+) or with catalase in both solutions (VS+/WS+). The vitrification without catalase had higher ROS levels that the control. The catalase, regardless the step of addition, maintained ROS levels similar to the control. There were no difference between treatments regarding follicular viability, stromal cells density and detection of γh2ax and 53BP1. There was no difference in follicular morphology and DNA fragmentation between groups vitrified. In conclusion, catalase addition to vitrification solutions prevents ROS formation in cryopreserved goat ovarian tissues. Keywords: cryopreservation; ovary; ROS levels; DNA damage; apoptosis.

122 122 Introduction Cryopreservation has been largely used for genetic material preservation from males and females (Fernández-Santos et al., 2008; Gupta et al., 2010; Luz et al., 2012). However, the exposure of biological samples to cryoprotectant agents associated with rapid cooling and warming rates generate physical and chemical changes (Fernández- Santos et al., 2008). These changes may lead to an increase in production of reactive oxygen species (ROS; Wang et al., 1997), resulting in oxidative stress (Agarwal et al., 2005). ROS include hydroxyl radical (OH ), superoxide anion ( O - 2 ) and hydrogen peroxide (H 2 O 2 ) (Rahimi et al., 2003; Agarwal et al., 2005). H 2 O 2 is a nonpolar molecule, which crosses the cell membrane easily (Choi et al., 2005), and can be converted to OH (Yan et al., 2009), a highly reactive and toxic radical to the cell. The increase in ROS levels affects the cell microenvironment (Fernández-Santos et al., 2008) resulting in damage to the cell morphology (Luz et al., 2012) and possibly in DNA (Imlay and Linn, 1988; Lopes et al., 1998). ROS diffusion into the cell results in damages that can be identified in proteins, lipids and nucleic acid (Guérin et al., 2001), and may also modulate gene expression (Harvey et al., 2002), leading to cell apoptosis (Yang et al., 1998). ROS can react rapidly with nucleotides (Evans and Cooke, 2004), inducing DNA double-strand break (DSB; Ménézo et al., 2010), which can be evidenced by the phosphorylation of the histone H2AX (γh2ax), one of the proteins responsible for DNA DSB signaling (Burma et al., 2001). After H2AX phosphorylation, other proteins involved in DNA repair, such as the 53BP1 (p53 binding protein 1), are recruited to the sites of DNA damage (Rappold et al., 2001). 53BP1 is a p53 binding protein, which binds to the central binding domain of p53 and moves to the site of DNA damage in response to DSB (Ward et al., 2003). Despite the occurrence of the cellular events mentioned above, cells have natural defense mechanisms against oxidative stress comprising the action of antioxidants, which act inhibiting ROS production or capturing and inactivating them (Veal et al., 2007). Procedures such as cryopreservation may result in increased ROS production (Mazzili et al., 1995, Wang et al., 1997) or reduction of antioxidants (Bilodeau et al., 2000), with consequent alteration of the cellular redox. For this reason, addition of antioxidants has been investigated in cryopreservation of sperm (Baumber et al., 2003; Chi et al., 2008), oocytes (Dinara et

123 123 al., 2001; Gupta et al., 2010) and ovarian tissue (Melo et al., 2011; Luz et al., 2012; Sanfilippo et al., 2013). Since supplementation of cryopreservation solutions with antioxidants has only recently being investigated, there is a need to better understand the role of these substances in a complex tissue as the ovary. The cellular antioxidant defense systems against the excessive ROS production can be divided into enzymatic and non-enzymatic (Kefer et al., 2009). The main enzymatic antioxidants involved in ROS detoxification are glutathione peroxidase, superoxide dismutase and catalase (Bilodeau et al., 2000). The latter is responsible for the hydrolysis of H 2 O 2 into water and oxygen (Fernández-Santos et al., 2008), removing this important initiator of chain reactions that can lead to formation of other ROS (Aitken et al., 1995). Higher ROS production can also occur during the resumption of cell metabolism after freezing and thawing (Agarwal et al., 2005). Although previous studies have investigated the effect of catalase addition during the warming procedure (Kim et al., 2004; Fernández-Santos et al., 2008), the ideal period for the inclusion of antioxidants during the cryopreservation process (e.g., vitrification or cryoprotectants removal) has so far not been properly tested. Therefore, the aim of this study was to assess the effect of catalase supplementation of vitrification and washing solutions on ROS production in vitrified-warmed goat ovarian tissues. Materials and Methods This experiment was approved and performed under the guidelines of Ethics Committee for Animal Use of the State University of Ceará. The cryoprotectants (ethylene glycol and dimethyl sulfoxide) were obtained from Dinâmica (Dinâmica Química, Diadema, SP, Brazil) and the other chemicals were obtained from Sigma (Sigma Chemical Co., St. Louis, MO, USA), unless otherwise stated. The ph was adjusted to 7.4 in all solutions used in this study. Preparation of ovarian tissue Ovaries (n = 10) were collected from 5 adult cross-bred goats (Capra hircus) at a local slaughterhouse. Immediately postmortem, the ovaries were washed once in 70%

124 124 ethanol for 10 sec and then washed twice in HEPES-buffered minimum essential medium (MEM) supplemented with 100 µg/ml penicillin and 100 µg/ml streptomycin. Ovaries were then transported to the laboratory in MEM at 20 C within 1 h after collection. At the laboratory, ovaries were stripped of the surrounding fat and fibrous tissue and the ovarian cortex from each ovarian pair was cut into small fragments (n=18; 3 x 3 x 1 mm) using a scalpel blade under sterile conditions. Part of the fragments (n=6) were used as fresh control samples and the remaining fragments (n=12) were vitrified. Experimental design and vitrification procedures The ovarian fragments were exposed to vitrification solutions (VS) and washing/removal solutions (WS) of cryoprotectant agents, either with or without catalase (from bovine liver; Sigma: C1345), resulting in four different conditions: (1) vitrification without catalase followed by washing without catalase (VS-/WS-), (2) vitrification without catalase followed by washing with catalase (VS-/WS+), (3) vitrification with catalase followed by washing without catalase (VS+/WS-) and (4) vitrification with catalase followed by washing with catalase (VS+/WS+). The catalase concentration (20 IU/mL) used in this study was based on a previous study from Luz et al. (2012), who observed similar rates of morphologically normal preantral follicles after freezing goat ovarian tissues as compared to fresh ovarian tissues. The vitrification was performed using the Ovarian Tissue Cryosystem (OTC), a new vitrification protocol developed by our team (Carvalho et al., 2013). Briefly, the fragments were exposed to two VS. The VS1 consisted of MEM supplemented with 10 mg/ml bovine serum albumin (BSA), 0.25 M sucrose, 10% ethylene glycol (EG) and 10% dimethyl sulfoxide (DMSO). VS2 had a similar composition of VS1 but with higher concentration of cryoprotectans (20% EG and 20% DMSO). Tissue fragments (n=6) were either exposed to vitrification solutions (VS1 and VS2) without catalase or (n=6) to the same solutions but with catalase. The fragments were initially exposed to VS1 for 4 min followed by VS2 for 1 min. Both exposures were performed using the OTC. The vitrification solution was then removed and the OTC containing the ovarian tissue was closed and immediately immersed vertically into liquid nitrogen. After cryostorage for up to one week, OTCs containing the vitrified ovarian fragments were warmed in air at room temperature (RT 25 C) for 1 min, followed by immersion in a

125 125 water bath (37 C) for 30 sec. After warming, the cryoprotectants were removed by a three-step washing solutions (WS; 5 min each) in WS1: MEM + 3 mg/ml BSA M sucrose, WS2: MEM + 3 mg/ml BSA M sucrose and WS3: MEM + 3 mg/ml BSA. The three WS were either supplemented or not with catalase (20 IU/mL). ROS levels The ROS levels were determined by a spectrofluorimetric method, using 2,7 - dihydrodichlorofluorescein diacetate (DCHF-DA) assay (Loetchutinat et al., 2005). Prior, fresh control and vitrified tissues were homogenized in cold ice 50 mm Tris HCl, ph 7.5 (1/10, w/v). The homogenate was centrifuged for 10 min at 3000 g, and the pellet was discarded. The low-speed supernatants (S1) were separated and used for ROS levels assays. To estimate the level of ovarian homogenate ROS production an aliquot of S1 (10 µl) was incubated with 10 µl of DCHF-DA (1mM) and the oxidation of DCHF-DA to fluorescent dichlorofluorescein was measured for the detection of intracellular ROS. The DCF fluorescence intensity emission was recorded at 520 nm (with 480 nm excitation) using a Spectrofluorimeter (Shimadzu model RF-5301PC) 30 min after the addition of DCHF-DA to the medium. Evaluation of follicular morphology and stromal cells density Fresh control and vitrified-warmed ovarian fragments were fixed in Carnoy s solution at RT for 4 h, dehydrated in a graded series of ethanol, clarified with xylene, embedded in paraffin wax, and serially sectioned into 7 µm thickness. The sections were stained with hematoxylin and eosin for histological analysis and follicular morphology was examined by microscope (magnification x400). For each treatment, 150 preantral follicles were counted only in sections where the oocyte nucleus was visible. Preantral follicles were morphologically classified as (i) normal if they contained an intact oocyte and intact granulosa cells and (ii) degenerate if they contained a pyknotic oocyte nucleus, shrunken ooplasm, accompanied or not by disorganized granulosa cells (e.g. increase in volume with or without detachment from the basement membrane). The presence of at least one of the afore mentioned features was indicative of atresia.

126 126 Ovarian stroma cells density was evaluated by calculating the number of stromal cells in an area of µm. For each treatment, ten fields per animal were assessed, resulting a total of 50 fields per treatment, and the mean number of stromal cells per field was calculated. Viability analysis by trypan blue and by fluorescent markers Preantral follicles were isolated from the fresh control and vitrified-warmed ovarian fragments by the mechanical method described by Lucci et al. 1999, with slight modifications. Briefly, with a tissue chopper (The Mickle Laboratory Engineering, Gomshal, Surrey, United Kingdom) adjusted to sectioning interval of 75 μm, samples were cut into small pieces and placed in 2 ml MEM supplemented with 3 mg/ml BSA. Samples were then suspended 100 times with a large Pasteur pipette (inner diameter ~1600 µm), followed by 100 times with a smaller Pasteur pipette (inner diameter ~600 µm) to dissociate preantral follicles from stroma. The suspension obtained was then passed through a 200 µm nylon mesh filter. This procedure was performed within 10 min at RT. To each 100 µl of follicular suspension, 5 µl of 0.4% trypan blue was added and incubated for 1 min a RT. Evaluation of trypan blue staining was carried out under an inverted microscope (Nikon, Tokyo, Japan) at magnification x400. Follicles were classified as viable if the oocyte and <10% granulosa cells remained unstained, whereas those which had the oocyte and/or 10% granulosa stained in blue were considered nonviable follicles (Lopes et al., 2009). Stained cells indicate plasma membrane disruption, and penetration of trypan blue dye. In total, 30 follicles were evaluated per treatment. For viability analysis by fluorescent markers, preantral follicles found after follicular isolation were transferred to 100 μl droplets of MEM. The viability was evaluated by adding 4 µm calcein-am and 2 µm ethidium homodimer-1 (Molecular Probes, Invitrogen, Karlsruhe, BW, Germany) to each drop of MEM that contained the isolated follicles. Samples were then incubated at 37 C for 15 min. Afterward, preantral follicles were examined using an epifluorescence microscope (Nikon, Tokyo, Japan) at magnification x400. The wave lengths used for excitation/emission were 458/515 nm for calcein AM and 525/590 nm for ethidium homodimer-1. Follicles exhibiting green fluorescence, which indicates the cleavage of the AM group from calcein through esterases activity, were considered viable. Follicles displaying red fluorescence, which

127 127 indicates plasma membrane disruption and binding of ethidium to chromatin, were classified as non-viable (Santos et al., 2007). Thirty preantral follicles were analyzed in each treatment. DNA fragmentation assay for the detection of apoptotic cells (TUNEL staining) DNA fragmentation was analyzed by TUNEL (terminal deoxynucleotidyl transferase-mediated biotinylated deoxyuridine triphosphates nick end-labeling) assay. In situ TUNEL analyses were performed using the In Situ Cell Death Detection Kit, POD (Roche Applied Science, Mannheim, BW, Germany), according to manufacturer s instructions. Tissue samples from fresh and vitrified-warmed groups were fixed with 4% (w/v) paraformaldehyde in PBS (ph 7.2) and subsequently dehydrated and embedded in paraffin wax (Dinâmica, Diadema, SP, Brazil). Tissues sections (5 µm) mounted on Superfrost Plus slides (Knittel Glass, Bielefeld, NW, Germany) were deparaffinized with Citrisolve (Fisher Scientific, Ottawa, Ontario, Canada) and rehydrated in a graded ethanol series. Antigen retrieval was performed by incubating tissue sections in 0.01 M sodium citrate buffer (ph 6.0) for 5 min, in a pressure cooker. Sections were washed in PBS and the slides incubated with 3% H 2 O 2 in methanol. Sections were then washed in PBS and blocked for 1 h at RT using PBS containing 1% BSA. After washing twice in PBS (5 min), slides were incubated with a TUNEL reaction mixture (50 µl) for 1 h at 37 C, followed by rinsing in PBS for 5 min (3 times). Converter POD was added (Roche Applied Science) and the location of the protein expression was demonstrated by incubation with diaminobenzidine (DAB; 0.05% DAB in Tris/HCl, ph 7.6, 0.03% H 2 O 2 ). Finally, sections were counterstained with hematoxylin. Follicles were considered with fragmented DNA when oocytes were detected with a dark brown stained nucleus (Demirci et al., 2002). As an internal positive control, sections were treated with 10 unit/ml DNase I (Invitrogen, Carlsbad, CA, USA) in 1 mg/ml BSA, for 10 min at RT, before incubation with the TUNEL reaction mixture to induce nonspecific breaks in the DNA. Negative control sections consisted of omitting the terminal deoxynucleotidyl transferase enzyme.

128 128 RNA extraction and Real-time PCR (qpcr) The fresh control and vitrified tissue samples were used for RNA extraction. Isolation of total RNA was performed using Trizol (Invitrogen, São Paulo, SP, Brazil) following manufacturer's recommendations. Briefly, the tissues were macerated in 1 ml of Trizol and the organic portion was separated from the aqueous phase by adding 200 µl of chloroform and centrifuged at g for 15 min, at 4 C. After centrifugation, to the supernatant the same volume of ethanol 70% was added. Total RNA was purified from this supernatant using the column system PureLink RNA Mini Kit (Invitrogen, Carlsbad, CA, USA), according to manufacturer's instructions. RNA preparations were subjected to DNase I treatment with a PureLink DNase (Invitrogen, Carlsbad, CA, USA). After this treatment, RNA was washed with the provided buffer solutions and then re-suspended in 30 μl RNAse free water. RNA quality and concentration were determined in a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, MA, USA). Prior to reverse transcription, the RNA samples were incubated for 5 min at 65 C, and then chilled on ice. Reverse transcription was then performed in a total volume of 20 μl made up of 0.5 µg sample RNA, 4 μl 5X reverse transcriptase buffer (Invitrogen, São Paulo, SP, Brazil), 8 units RNaseOUT, 150 units Superscript III reverse transcriptase, U random primers (Invitrogen), 10 mm DTT and 0.5 mm of each dntp. This mix was submitted at 25 C for 5 min, 50 C for 40 min and 70 C for 15 min. The resulting cdna was stored at -20 C until later use. Minus RT blanks were prepared under the same conditions but without inclusion of reverse transcriptase. Quantification of mrna levels for Bcl-2 and Bax was performed using Power SYBR Green PCR Master Mix. Real-time PCR (qpcr) reactions were carried out using 1 μl cdna as template in 10 μl of Power SYBR Green PCR Master Mix (PE Applied Biosystems, Foster City, CA, USA), 7.4 μl of ultra-pure water and 0.5 μm of each primer (Table 1). The reference gene glyceraldehyde-3-phosphatedehydrogenase (GADPH) was selected as an endogenous control for normalization and to study gene expression stability in all samples. The thermal cycling profile for the first round of PCR was as follows: initial denaturation at 95 C for 10 min, then 40 PCR cycles (15 sec 95 C, 1 min 60 C, 1 min 72 C), followed by a final extension of 10 min at 72 C. The specificity for each primer set was tested performing the melting procedure, starting fluorescence acquisition at 60 C and taking measurements at 10-sec intervals until the temperature reached 95 C. All reactions were performed using the i-

129 129 cycler IQ5 system (Bio-Rad Laboratories, Hercules, CA, USA). The ΔΔCT method was used to transform threshold cycle values into normalized relative expression levels (Schmittgen and Livak, 2008). Table 1. Oligonucleotide primers for GADPH, BCL-2 and BAX used in the gene expression analyses. Target gene Primer sequence (5 3 ) Sense * Position Genbank accession no. GADPH TGTTTGTGATGGGCGTGAACCA S ATGGCGTGGACAGTGGTCATAA AS NM_ BCL-2 ATGTGTGTGGAGAGCGTCAA S GCCAGGAGAAATCAAACAGG AS XM_ BAX GTTTTCCGACGGCAACTTC S GGATGGTCCTGATCAACTCG AS JN *S sense; AS antisense. GAPDH: Glyceraldehyde 3-phosphate dehydrogenase. Immunofluorescence detection of γh2ax and 53BP1 proteins In this analysis we used rabbit polyclonal primary antibodies for detection of γh2ax (ab2893, Abcam Inc., Cambridge, MA, USA) and 53BP1 (#4937, Cell Signaling Technology Inc, Beverly, MA, USA). These proteins are involved in DNAdamage repair mechanisms. The Alexa Fluor 488 anti-rabbit IgG Conjugate (#44125S, Cell Signaling Technology Inc.) was used as secondary antibody. In the negative control samples the primary antibodies were omitted. The ovarian tissues derived from fresh control and vitrified samples were prepared as described for the TUNEL technique. After antigen retrieval, slides were incubated overnight at 4 C with the primary antibodies diluted 1:500 (γh2ax) and 1:100 (53BP1) in blocking solution (0.1% BSA in PBS). Then, the slides were incubated with the secondary antibody (Alexa Fluor 488) diluted 1:500 in blocking solution for 1 h at RT and counterstained with Evans Blue (1:2000). The slides were then mounted with Vectashield Mounting Media (Vector Laboratories, Inc., Burlingame, CA, USA). Image evaluations of the preantral follicles were performed

130 130 using a laser scanning confocal microscope (LSM 710, Zeiss, Oberkochen, Germany). All analyzes were performed using the same configuration. Statistical analysis All data were initially submitted to Kolmogorov-Smirnov and Bartlett tests to confirm normal distribution and homogeneity of variances, respectively. The results obtained from these first analyses were then subjected to analysis of variance using the PROC GLM procedure of SAS. Percentages of morphologically normal follicles and stromal cells density were compared using Student-Newman-Keuls (SNK) test and ROS levels evaluation was compared using ANOVA one-way followed by post-hoc Duncan s test. Data of follicular viability (assessed through Trypan Blue and fluorescent probes assays) were analyzed for the dispersion of frequencies using the χ² test. Data for relative expression by qpcr, which did not show homogeneity of variance, were analyzed using a Kruskal- Wallis non-parametric test. Percentages of TUNEL-positive follicles were compared by Fisher's exact test. The differences were considered to be significant when P<0.05 and results were expressed as mean ± standard error of means (SEM). Results ROS levels Groups containing catalase showed ROS levels similar to the fresh control group. On the other hand, ovarian tissues vitrified and washed in the absence of catalase (VS-/WS-) resulted in higher ROS levels compared to the fresh control and VS+/WScatalase groups (Fig. 1).

131 131 Fig. 1. ROS levels expressed as fluorescence intensity in non-vitrified (fresh control) and vitrified ovarian tissues in the presence or absence of catalase in vitrification/washing solutions. A,B indicate statistical difference (P<0.05) between groups. Evaluation of follicular morphology, viability and stromal cells density To evaluate follicular morphology, 150 follicles per treatment were analyzed, totalizing 750 follicles. Morphologically normal or atretic follicles were observed in the fresh control as well as in the vitrified ovarian tissues, as shown in Fig. 2A and 2B, respectively. Fig. 2. Follicular morphology analysis (A-B), apoptosis detection (C-D) and follicular viability evaluation by trypan blue (E-F) and fluorescent markers (G-H).

132 132 Morphologically normal (A) and degenerate (B) preantral follicle stained with HE. Note in (B) granulosa cells disorganization and ooplasm shrinkage (asterisk). Positive (C) and negative (C') control for TUNEL assay. Vitrified ovarian tissues were analyzed by TUNEL assay (D). Arrows indicate TUNEL-positive reaction; arrowhead indicates TUNEL-negative reaction. Viable (E) and non-viable (F) follicles unstained and stained by Trypan blue, respectively. Viable follicle (G) and non-viable follicle (H) labeled with calcein-am (green) and ethidium homodimer-1 (red), respectively. GC granulosa cells, O oocyte; Nu nucleus. Scale bars = 30 µm. In the fresh control group, approximately 70% of the follicles were morphologically normal. This percentage was reduced (P<0.05) after vitrification, regardless of the addition of catalase (Fig. 3). However, no significant differences were observed between vitrified groups (P>0.05). Among the morphological changes, shrinkage of ooplasm and granulosa cells disorganization were the most frequently changes observed in all treatments. Fig. 3. Percentage (mean SEM) of morphologically normal preantral follicles. Goat ovarian tissues were non-vitrified (fresh control) or vitrified-thawed in the presence or absence of catalase in vitrification/washing solutions. A,B indicate statistical difference (P<0.05) between treatment. The analysis of stromal cells density revealed no significant alteration after vitrification in any of the conditions tested (VS-/WS-; VS+/WS-; VS-/WS+ and

133 133 VS+/WS+) compared to the fresh control group (P>0.05). Similarly, there were no differences among treatments in the follicular viability after vitrification, either assessed by Trypan blue or fluorescent markers (Table 2). Table 2. Stromal cells density and follicular viability (Trypan blue, Calcein AM/ethidium and TUNEL-positive follicles) in non-vitrified (fresh control) and vitrified ovarian tissues in presence or absence of catalase. Stroma cells Trypan Calcein TUNEL-positive Treatments density blue AM/ethidium follicles mean ± SEM %(n) %(n) %(n) Fresh control ± A (28) A (29) A (4) AB VS-/WS ± A (25) A (27) A (2) AB VS+/WS ± A (24) A (25) A 6.67 (1) B VS-/WS ± A (25) A (26) A (2) AB VS+/WS ± A (28) A (28) A (5) A Different superscripts within columns indicate statistical difference between treatments (P<0.05). DNA fragmentation assay for the detection of apoptotic cells (TUNEL staining) The analysis of preantral follicles enclosed in the ovarian tissue showed presence of TUNEL-negative and TUNEL-positive follicles in all treatments (Fig. 2C and 2D). Among the fragments subjected to vitrification, the VS+/WS- group showed lower percentage of TUNEL-positive follicles (6.67%). This percentage was significantly lower when compared to VS+/WS+ (Table 2). However, the percentage of follicles with DNA fragmentation (TUNEL-positive) in these treatments did not differ from the fresh control and other vitrified groups (VS-/WS-, VS-/WS+). As shown in Fig. 2C, no TUNEL-positive signal was observed in the negative control fragments, while TUNEL staining (brown staining) was consistently observed in the positive control samples.

134 134 Real-time PCR (qpcr) qpcr was performed to assess the relative mrna expression of BCL 2 and BAX genes as indicators of apoptosis. Expression of these genes was assessed in non-vitrified (fresh control) and vitrified ovarian tissues in the presence or absence of catalase in vitrification/washing solutions. There were no significant differences in gene expression between treatments (Fig. 4). Fig. 4. Relative Bcl 2 /Bax mrna expression in non-vitrified (fresh control) and vitrified ovarian tissue in the presence or absence of catalase in vitrification/washing solutions. Immunofluorescence staining for γh2ax and 53BP1 Immunofluorescence analysis was performed in order to localize proteins involved in signaling (γh2ax) and repair (53BP1) of DNA damage. Analysis of preantral follicles obtained before and after vitrification showed no labeling of γh2ax protein in any of the tested groups. However, positive immunostaining for 53BP1 protein was observed in granulosa cells from all follicular categories analyzed (Fig. 5). The positive immunostaining was observed as green foci in granulosa cells, and this pattern was observed in all treatments. Negative controls, obtained by excluding the primary antibodies, showed no signs of immunoreactivity.

135 135 Fig. 5. Immunodetection of 53BP1 protein (green bright fluorescent spots) in goat ovarian tissue from the fresh control and after vitrification. (A) Preantral follicle from a negative control sample showing a follicle without fluorescent signal for 53BP1. (B-D) Goat ovarian follicles positively labeled for 53BP1. Note primordial (B), primary (C) and secondary (D) follicles with granulosa cells labeled and the absence of fluorescence signal in the oocytes. GC granulosa cells; O oocyte. Scale bars = 30 µm.

136 136 Discussion In the present study, the effects of the addition of catalase at different steps of the vitrification process on follicular morphology and viability, as well as on ROS production were investigated in goat ovarian tissues. Furthermore, it was evaluated whether the vitrification process influences the expression of anti and pro-apoptotic genes and DNA integrity after vitrification and warming of goat preantral follicles. In this study, the absence of catalase in both vitrification and washing solutions (VS-/WS- group) resulted in higher percentage of ROS compared to fresh ovarian tissues. It is already known that the cryopreservation procedure induces ROS production (Dinara et al., 2001, Rahimi et al., 2003) and results in plasma membrane lipid peroxidation (Luz et al., 2012). In addition, the plasma membrane also undergoes excessive chemical and physical stress due to high salt concentrations and low temperatures (Holt and North, 1994). These effects can damage the cytoskeleton (Hinshaw et al., 1986) and increase apoptosis (Yang et al., 1998), due to changes in the structure and permeability of the cell membrane (Dinara et al., 2001). Based on the results obtained in this study, we propose that the addition of catalase at any step of vitrification procedure is necessary to prevent ROS production caused by cryopreservation. This is probably due to the catalase action on breaking down H 2 O 2 to water and oxygen (Chi et al., 2008). In the present study, the percentage of morphologically normal follicles after vitrification was reduced, regardless the addition of catalase. This result may be due to damages caused by dehydration and osmotic variations (Paynter et al., 1999), which are characterized by cytoplasmic shrinkage. Regardless the addition of catalase, no reduction was observed on follicular viability after vitrification, which is in agreement with previous studies (Onions et al., 2008; Castro et al., 2011). Nonetheless, viability results confirmed that the vitrification procedure (ovarian tissue cryosystem - OTC) used in this study (Carvalho et al., 2013), caused neither disruption in cell membrane (assessed by trypan blue) nor inactivation of cell enzymatic metabolism (assessed by calcein-am). Stromal cells density was not decreased by any of the treatments tested in the present study, which suggests that the OTC protocol satisfactorily preserved the stromal cells population and that the oxidative stress do not seem to affect stromal cells. These cells are important in the production of peptides and growth factors that are necessary

137 137 for cell growth and development (Picton et al., 2008). Previous studies have shown that stromal cells are susceptible to cryopreservation injures (Keros et al., 2009; Faustino et al., 2010). Therefore, a vitrification protocol that maintains the density of these cells is crucial to achieve adequate follicular development after warming. In general, when a cell is subjected to stress conditions such as exposure to cryoprotectant agents and cooling/thawing procedures, the imbalance between ROS/antioxidants can induce DNA DSBs (Nowicki et al., 2004), which may lead to cell apoptosis (Cao et al., 2010; Franke et al., 2010). Cell cycle checkpoints and DNA repair are the most important cellular defenses against stress factors (Kang et al., 2012), and the histone H2AX phosphorylation is one of the major signs observed after DNA damage. However, in the ovarian tissue vitrification conditions used in this study there was no fluorescent signal for γh2ax in chromatin of goat preantral follicles. However, it has to be consider that changes induced by cryopreservation in preantral follicles require an incubation period to be revealed (Paynter et al., 1999). On the other hand, 53BP1 was detected in granulosa cells of all follicles analyzed in this study, regardless of the treatment and follicular category. 53BP1 is a protein that has a great ability to bind the p53 protein (Iwabuchi et al., 1994; Schlutz et al., 2000, Abraham, 2002) and it is known as the guardian of the genome (Mazoochi et al., 2009) because it promotes DNA repair or apoptosis during cell checkpoints (Bourougaa et al., 2010). A study performed by Jullien et al. (2002) showed that 53BP1 is located at kinetochores in a hyperphosphorylated form during mitosis (from prophase to metaphase), indicating that this protein also plays a role in the mitotic process. Other studies have demonstrated a close relationship of 53BP1 with cell cycle, showing that 53BP1-deficient cells have deficient G2/M checkpoint (Fernandez-Capetillo et al., 2002), and that mitotic cells have higher expression of p53 (Tritarelli et al., 2004). The closely relationship of 53BP1 with the cell cycle suggests that the presence of this protein in granulosa cells of preantral follicles observed in the present work is likely not related to DNA damage response. The lack of γh2ax in these cells supports this hypothesis. Indeed, it is possible that the presence of the 53BP1 is due to the fact that these cells are proliferating. Our qpcr results demonstrated that there was no unbalance in Bcl2/Bax expression ratio. This result is similar to previous findings reported by Mazoochi et al. (2009) after mouse ovaries vitrification. Bcl2 is a survival molecule which resides in nuclear envelope and mitochondria and it is known as an anti-apoptotic protein

138 138 responsible for preventing the beginning of cell death (Hussein et al., 2006; Srivastava et al., 2010). Contrarily, Bax is a pro-apoptotic protein that stimulates the beginning of cell death (Hsu and Hsueh, 1998). The unbalance of Bcl2/Bax is the initial factor in the apoptotic process (Oltvai et al., 1993), which is followed by caspase activation (Zhang et al., 2013), and DNA fragmentation (Hsu and Hsueh, 1998). In this study, vitrification performed with or without catalase did not alter the proportion of preantral follicles with DNA fragmentation compared to the fresh control follicles. The protocol used in this study caused minimal cellular changes on morphological and molecular aspects of preantral follicles. In this study, we have not found significant differences in DNA fragmentation (assessed by TUNEL) among vitrified and fresh control groups. While this suggests that the vitrification protocol used in this study preserves DNA integrity, an incubation period might be necessary for the apoptosis cascade and DNA fragmentation to occur. Indeed, activation of endogenous endonuclease in necessary to cleave genomic DNA resulting in its fragmentation (Mazoochi et al., 2008). Nonetheless, cell apoptosis has been described in follicles that were evaluated without incubation after cryopreservation (Rahimi et al., 2003; Xiao et al., 2010; Chang et al., 2011). We have found that supplementation of catalase in both vitrification and washing solutions (VS+/WS+) resulted in higher percentages of follicles with DNA fragmentation compared to when catalase was present only in vitrification solution (VS+/WS-). Similarly, it has been reported by other investigators that excess of antioxidants result in cell toxicity not only in ovarian tissue but also in cryopreserved sperm and embryos (Donnelly et al., 1999; Wang et al., 2002; Luz et al., 2012). In conclusion, findings in the present study indicate that presence of catalase reduces detrimental effects of vitrification in goat ovarian tissues. Furthermore, since ROS levels in ovarian tissues vitrified in the presence of catalase (VS+/WS-) remained unchanged compared to the fresh tissues, we propose that the best step for addition of catalase is in the vitrification solution. Acknowledgments This work was supported by CNPq, FINEP and CAPES, Brazil. A.A. Carvalho, J.R. Figueiredo and A.P.R Rodrigues are supported by a grant from CNPq.

139 139 References Abraham, R.T Identification of TOR signaling complexes: more TORC for the cell growth engine. Cell 111, Agarwal, A., Gupta, S., Sharma, R Oxidative stress and its implications in female infertility - a clinician's perspective. Reproductive Biomedicine Online 11, Aitken, R.J., Paterson, M., Fisher, H., Buckingham, D.W., Van Duin, M Redox regulation of tyrosine phosphorylation in human spermatozoa and its role in the control of human sperm function. Journal of Cell Science 108, Baumber, J., Ball, B.A., Linfor, J.J., Meyers, S.A Reactive oxygen species and cryopreservation promote DNA fragmentation in equine spermatozoa. Journal of Andrology 24, Bilodeau, J.F., Chatterjee, S., Sirard, M.A., Gagnon, C Levels of antioxidant defenses are decreased in bovine spermatozoa after a cycle of freezing and thawing. Molecular Reproduction and Development 55, Bourougaa, K., Naski, N., Boularan, C., Mlynarczyk, C., Candeias, M.M., Marullo, S., Fåhraeus, R Endoplasmic reticulum stress induces G2 cell-cycle arrest via mrna translation of the p53 isoform p53/47. Molecular Cell 38, Burma, S., Chen, B.P., Murphy, M., Kurimasa, A., Chen, D.J ATM phosphorylates histone H2AX in response to DNA double-strand breaks. Journal of Biological Chemistry 9, Cao, X.H., Wang, A.H., Wang, C.L., Mao, D.Z., Lu, M.F., Cui, Y.Q., Jiao, R.Z Surfactin induces apoptosis in human breast cancer MCF-7 cells through a ROS/JNK-mediated mitochondrial/caspase pathway. Chemico-Biological Interactions 183, Carvalho, A. A., Faustino, L. R., Silva, C. M. G., Castro, S. V., Lopes, C. A. P., Santos, R. R., Báo, S. N., Figueiredo, J. R., Rodrigues, A. P. R. (2013). Novel wide-capacity method for vitrification of caprine ovaries: Ovarian Tissue Cryosystem (OTC). Animal Reproduction Science 138, Castro, S.V., Carvalho, A.A., Silva, C.M.G., Faustino, L.R., Campello, C.C., Lucci, C.M., Báo, S.N., Figueiredo, J.R., Rodrigues, A.P.R Freezing solution containing dimethylsulfoxide and fetal calf serum maintains survival and

140 140 ultrastructure of goat preantral follicles after cryopreservation and in vitro culture of ovarian tissue. Cell and Tissue Research 346, Chang, C.C., Lin, C.J., Sung, L.Y., Kort, H.I., Tian, X.C., Nagy, Z.P Impact of phase transition on the mouse oocyte spindle during vitrification. Reproductive Biomedicine Online 22, Chi, H.J., Kim, J.H., Ryu, C.S., Lee, J.Y., Park, J.S., Chung, D.Y., Choi, S.Y., Kim, M.H., Chun, E.K., Roh, S.I Protective effect of antioxidant supplementation in sperm-preparation medium against oxidative stress in human spermatozoa. Human Reproduction 23, Choi, M.H., Lee, I.K., Kim, G.W., Kim, B.U., Han, Y.H., Yu, D.Y., Park, H.S., Kim, K.Y., Lee, J.S., Choi, C., Bae, Y.S., Lee, B.I., Rhee, S.G., Kang, S.W Regulation of PDGF signalling and vascular remodelling by peroxiredoxin II. Nature 435, Demirci, B., Salle, B., Frappart, L., Franck, M., Guerin, J.F., Lornage, J Morphological alterations and DNA fragmentation in oocytes from primordial and primary follicles after freezing-thawing of ovarian cortex in sheep. Fertility and Sterility 77, Dinara, S., Sengoku, K., Tamate, K., Horikawa, M., Ishikawa, M Effects of supplementation with free radical scavengers on the survival and fertilization rates of mouse cryopreserved oocytes. Human Reproduction 16, Donnelly, E.T., McClure, N., Lewis, S.E The effect of ascorbate and alphatocopherol supplementation in vitro on DNA integrity and hydrogen peroxideinduced DNA damage in human spermatozoa. Mutagenesis 14, Evans, M.D., Cooke, M.S Factors contributing to the outcome of oxidative damage to nucleic acids. Bioessays 26, Faustino, L.R., Santos, R.R., Silva, C.M.G., Pinto, L.C., Celestino, J.J.H., Campello, C.C., Figueiredo, J.R., Rodrigues, A.P.R Goat and sheep ovarian tissue cryopreservation: Effects on the morphology and development of primordial follicles and density of stromal cell. Animal Reproduction Science 122, Fernandez-Capetillo, O., Chen, H.T., Celeste, A., Ward, I., Romanienko, P.J., Morales, J.C., Naka, K., Xia, Z., Camerini-Otero, R.D., Motoyama, N., Carpenter, P.B., Bonner, W.M., Chen, J., Nussenzweig, A DNA damage-induced G2-M

141 141 checkpoint activation by histone H2AX and 53BP1. Nature Cell Biology 4, Fernández-Santos, M.R., Domínguez-Rebolledo, A.E., Esteso, M.C., Garde, J.J., Martínez-Pastor, F Catalase supplementation on thawed bull spermatozoa abolishes the detrimental effect of oxidative stress on motility and DNA integrity. International Journal of Andrology 32, Franke, J.C., Plötz, M., Prokop, A., Geilen, C.C., Schmalz, H.G., Eberle, J New caspase-independent but ROS-dependent apoptosis pathways are targeted in melanoma cells by an iron-containing cytosine analogue. Biochemical Pharmacology 79, Guérin, P., El Mouatassim, S., Ménézo, Y Oxidative stress and protection against reactive oxygen species in the pre-implantation embryo and its surroundings. Human Reproduction Update 7, Gupta, M.K., Uhm, S.J., Lee, H.T Effect of vitrification and betamercaptoethanol on reactive oxygen species activity and in vitro development of oocytes vitrified before or after in vitro fertilization. Fertility and Sterility 93, Harvey, A.J., Kind, K.L., Thompson, J.G REDOX regulation of early embryo development. Reproduction 123, Hinshaw, D.B., Sklar, L.A., Bohl, B., Schraufstatter, I.U., Hyslop, P.A., Rossi, M.W., Spragg, R.G., Cochrane, C.G Cytoskeletal and morphologic impact of cellular oxidant injury. The American Journal of Pathology 123, Holt, W.V., North, R.D Effects of temperature and restoration of osmotic equilibrium during thawing on the induction of plasma membrane damage in cryopreserved ram spermatozoa. Biology of Reproduction 51, Hsu, S.Y., Hsueh, A.J.W Intracellular mechanisms of ovarian cell apoptosis. Molecular and Cellular Endocrinology 145, Hussein, M.R., Bedaiwy, M.A., Falcone, T Analysis of apoptotic cell death, Bcl- 2, and p53 protein expression in freshly fixed and cryopreserved ovarian tissue after exposure to warm ischemia. Fertility and Sterility 85, Imlay, J.A., Linn, S DNA damage and oxygen radical toxicity. Science 240,

142 142 Iwabuchi, K., Bartel, P.L., Li, B., Marraccino, R., Fields, S Two cellular proteins that bind to wild-type but not mutant p53. Proceedings of the National Academy of Sciences of the United States of America 91, Jullien, D., Vagnarelli, P., Earnshaw, W.C., Adachi, Y Kinetochore localization of the DNA damage response component 53BP1 during mitosis. Journal of Cell Science 115, Kang, M.A., So, E.Y., Simons, A.L., Spitz, D.R., Ouchi, T DNA damage induces reactive oxygen species generation through the H2AX-Nox1/Rac1 pathway. Cell Death and Disease 3, 1-8. Kefer, J,C., Agarwal, A., Sabanegh, E Role of antioxidants in the treatment of male infertility. International Journal of Urology 16, Keros, V., Xella, S., Hultenby, K., Pettersson, K., Sheikhi, M., Volpe, A., Hreinsson, J., Hovatta, O Vitrification versus controlled-rate freezing in cryopreservation of human ovarian tissue. Human Reproduction 24, Kim, S.S., Yang, H.W., Kang, H.G., Lee, H.H., Lee, H.C., Ko, D.S., Gosden, R.G Quantitative assessment of ischemic tissue damage in ovarian cortical tissue with or without antioxidant (ascorbic acid) treatment. Fertility and Sterility 82, Loetchutinat. C., Kothan, S., Dechsupa, S., Meesungnoen, J., Jay-Gerin, J.P., Mankhetkorn, S Spectrofluorometric determination of intracellular levels of reactive oxygen species in drug-sensitive and drug-resistant cancer cells using the 2,7 -dichlorofluorescein diacetate assay Radiat. Physical Chemistry Chemical Physics 323, Lopes, C.A.P., Santos, R.R., Celestino, J.J.H., Melo, M.A.P., Chaves, R.N., Campello, C.C., Silva, J.R.V., Báo, S.N., Jewgenow, K., Figueiredo, J.R Short-term preservation of canine preantral follicles: Effects of temperature, medium and time. Animal Reproduction Science 115, Lopes, S., Jurisicova, A., Sun, J.G., Casper, R.F Reactive oxygen species: potential cause for DNA fragmentation in human spermatozoa. Human Reproduction 13, Lucci, C.M., Amorim, C.A., Báo, S.N., Figueiredo, J.R., Rodrigues, A.P.R., Silva, J.R.V., Gonçalves, P.B.D Effect of the interval of serial sections of ovarian tissue in the tissue chopper on the number of isolated caprine preantral follicles. Animal Reproduction Science 56,

143 143 Luz, H.K.M., Santos, R.R., Wanderley, L.S., Faustino, L.R., Silva, C.M.G., Carvalho, A.A., Campello, C.C., Santos, F.W., Figueiredo, J.R., Rodrigues, A.P.R Catalase prevents lipid peroxidation and enhances survival of caprine preantral follicles cryopreserved in a 1,2-propanediol-freezing medium. Biopreservation and Biobanking 10, Mazoochi, T.M., Salehnia, M., Valojerdi, M.R., Mowla, S.J Morphologic, ultrastructural, and biochemical identification of apoptosis in vitrified-warmed mouse ovarian tissue. Fertility and Sterility 90, Mazoochi, T., Salehnia, M., Pourbeiranvand, S., Forouzandeh, M., Mowla, S.J., Hajizadeh, E Analysis of apoptosis and expression of genes related to apoptosis in cultures of follicles derived from vitrified and non-vitrified ovaries. Human Reproduction 15, Mazzilli, F., Rossi, T., Sabatini, L., Pulcinelli, F.M., Rapone, S., Dondero, F., Gazzaniga, P.P Human sperm cryopreservation and reactive oxygen species (ROS) production. Acta Europaea Fertilitatis 26, Melo, M.A.P., Oskam, I.C., Celestino, J.J.H., Carvalho, A.A., Castro, S.V., Figueiredo, J.R., Rodrigues, A.P.R., Santos, R.R Adding ascorbic acid to vitrification and IVC medium influences preantral follicle morphology, but not viability. Reproduction in Domestic Animals 46, Ménézo, Y., Dale, B., Cohen, M DNA damage and repair in human oocytes and embryos: a review. Zygote 18, Nair, S.J., Brar, A.S., Ahuja, C.S., Sangha, S.P.S., Chaudhary, K.C A comparative study on lipid peroxidation, activities of antioxidant enzymes and viability of cattle and buffalo bull spermatozoa during storage at refrigeration temperature. Animal Reproduction Science 96, Nowicki, M.O., Falinski, R., Koptyra, M., Slupianek, A., Stoklosa, T., Gloc, E., Nieborowska-Skorska, M., Blasiak, J., Skorski, T BCR/ABL oncogenic kinase promotes unfaithful repair of the reactive oxygen species dependent DNA double-strand breaks. Blood 104, Oltvai, Z.N., Milliman, C.L., Korsmeyer, S.J Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 74,

144 144 Onions, V.J., Mitchell, M.R., Campbell, B.K., Webb, R Ovarian tissue viability following whole ovine ovary cryopreservation: assessing the effects of sphingosine- 1-phosphate inclusion. Human Reproduction 23, Paynter, S.J., Cooper, A., Fuller, B.J., Shaw, R.W Cryopreservation of bovine ovarian tissue: structural normality of follicles after thawing and culture in vitro. Cryobiology 38, Picton, H.M., Harris, S.E., Muruvi, W., Chambers, E.L The in vitro growth and maturation of follicles. Reproduction 136, Rahimi, G., Isachenko, E., Sauer, H., Isachenko, V., Wartenberg, M., Hescheler, J., Mallmann, P., Nawroth, F Effect of different vitrification protocols for human ovarian tissue on reactive oxygen species and apoptosis. Reproduction, Fertility, and Development 15, Rappold, I., Iwabuchi, K., Date, T., Chen, J Tumor suppressor p53 binding protein 1 (53BP1) is involved in DNA damage-signaling pathways. The Journal of Cell Biology 153, Sanfilippo, S., Canis, M., Romero, S., Sion, B., Déchelotte, P., Pouly, J.L., Janny, L., Smitz, J., Brugnon, F Quality and functionality of human ovarian tissue after cryopreservation using an original slow freezing procedure. Journal of Assisted Reproduction and Genetics 30, Santos, R.R., Tharasanit, T., Van Haeften, T., Figueiredo, J.R., Silva, J.R., Van den Hurk, R Vitrification of goat preantral follicles enclosed in ovarian tissue by using conventional and solid-surface vitrification methods. Cell and Tissue Research 327, Schmittgen, T.D., Livak, K.J Analyzing real-time PCR data by the comparative C T method. Nature Protocols 3, Schultz, L.B., Chehab, N.H., Malikzay, A., Halazonetis, T.D p53 binding protein 1 (53BP1) is an early participant in the cellular response to DNA double-strand breaks. The Journal of Cell Biology 151, Sicherle, C.C., Maia, M.S., Bicudo, S.D., Rodello, L., Azevedo, H.C Lipid peroxidation and generation of hydrogen peroxide in frozen-thawed ram semen supplemented with catalase or Trolox. Small Ruminant Research 95, Srivastava, M., Simakov, O., Chapman, J., Fahey, B., Gauthier, M.E.A., Mitros, T., Richards, G.S., Conaco, C., Dacre, M., Hellsten, U., Larroux, C., Putnam, N.H., Stanke, M., Adamska, M., Darling, A., Degnan, S.M., Oakley, T.H., Plachetzki, D.

145 145 C., Zhai, Y., Adamski, M., Calcino, A., Cummins, S.F., Goodstein, D.M., Harris, C., Jackson, D.J., Leys, S.P., Shu, S., Woodcroft, B.J., Vervoort, M., Kosik, K.S., Manning, G., Degnan, B.M., Rokhsar, D.S The Amphimedon queenslandica genome and the evolution of animal complexity. Nature 466, Tritarelli, A., Oricchio, E., Ciciarello, M., Mangiacasale, R., Palena, A., Lavia, P., Soddu, S., Cundari, E p53 Localization at centrosomes during mitosis and postmitotic checkpoint are ATM-dependent and require serine 15 phosphorylation. Molecular Biology of the Cell 15, Veal, E.A., Day, A.M., Morgan, B.A Hydrogen peroxide sensing and signaling. Molecular Cell 26, Wang, A.W., Zhang, H., Ikemoto, I., Anderson, D.J., Loughlin, K.R Reactive oxygen species generation by seminal cells during cryopreservation. Urology 49, Wang, X., Falcone, T., Attaran, M., Goldberg, J.M., Agarwal, A., Sharma, R.K Vitamin C and Vitamin E supplementation reduce oxidative stress induced embryo toxicity and improve the blastocyst development rate. Fertility and Sterility 78, Ward, I.M., Minn, K., Jorda, K.G., Chen, J Accumulation of checkpoint protein 53BP1 at DNA breaks involves its binding to phosphorylated histone H2AX. Journal of Biological Chemistry 278, Xiao, Z., Wang, Y., Li, L., Luo, S., Li, S.W Needle immersed vitrification can lower the concentration of cryoprotectant in human ovarian tissue cryopreservation. Fertility and Sterility 94, Yan, G., Chen, J., Hua, Z Roles of H 2 O 2 and OH radical in bactericidal action of immobilized TiO 2 thin-film reactor: An ESR study. Journal of Photochemistry and Photobiology. A, Chemistry 207, Yang, H.W., Hwang, K.J., Kwon, H.C., Kim, H.S., Choi, K.W., Oh, K.S Detection of reactive oxygen species (ROS) and apoptosis in human fragmented embryos. Human Reproduction 13, Zhang, J.M., Wanga, H.C., Wanga, H.X., Ruan, L.H., Zhang, Y.M., Li, J.T., Tian, S., Zhang, Y.C Oxidative stress and activities of caspase-8, -9, and -3 are involved in cryopreservation-induced apoptosis in granulosa cells. European Journal of Obstetrics, Gynecology, and Reproductive Biology 166,

146 CONCLUSÕES A utilização de um sistema de superfície sólida fechado (Ovarian Tissue Cryosystem - OTC) mantém a viabilidade e ultraestrutura de tecido ovariano caprino vitrificado em pequenos fragmentos (3x3x1 mm). A adição de 20 UI/mL de catalase em soluções utilizadas para a vitrificação de tecido ovariano caprino mantém os níveis de ROS similar aos observados no tecido ovariano fresco. A vitrificação do tecido ovariano utilizando o OTC não resultou em danos à cromatina de folículos pré-antrais detectáveis pela fosforilação da H2AX ou fragmentação da molécula de DNA.

147 PERSPECTIVAS A técnica de criopreservação desenvolvida nesse estudo mostrou-se eficiente e segura para a vitrificação de fragmentos de tecido ovariano caprino de forma rápida, eficiente e segura. Contudo, o procedimento ainda precisa ser aperfeiçoado para a vitrificação de hemi e ovário inteiro. A criopreservação de dimensões maiores de tecido ovariano é salutar na reprodução assistida por assegurar a preservação de grande parte ou do completo pool folicular. Além disso, a vitrificação de ovário inteiro é de grande relevância por permitir preservar não só os folículos ovarianos, mas também o aporte vascular do órgão, pois favorece o posterior transplante e revascularização tecidual, culminando com menor perda folicular em decorrência de hipóxia. Assim, evidencia-se a necessidade de mais estudos nessa área, inclusive aperfeiçoando-se os protocolos de exposição/perfusão dos crioprotetores, o que, em nossa opinião, pode ter sido uma das razões para os resultados pouco satisfatórios no caso da vitrificação de hemi ou ovário inteiro. Após o cultivo in vitro realizado nesta tese, observou-se uma maior degeneração dos folículos previamente vitrificados. As agressões celulares sofridas durante a exposição aos crioprotetores e resfriamento e posterior aquecimento, parecem tornar as células mais sensíveis. Desta forma, as condições de cultivo devem ser as mais adequadas possíveis no sentido de garantir aporte nutricional e hormonal necessário para a recuperação celular. Portanto, acredita-se que um sistema de cultivo in vitro específico para folículos criopreservado deve ser estabelecido. Além disso, o resfriamento e aquecimento celular podem resultar em aumento de ROS. Nesta tese foi observada a necessidade de adição de catalase, contudo, dimensões maiores de tecido ovariano podem necessitar de concentrações mais elevadas deste ou de outro antioxidante. Conforme mostrado, as ROS têm o DNA como um dos principais alvos, evidenciando a necessidade de estudos aprofundados desta relação, uma vez que a criopreservação visa não somente a preservação da morfologia e viabilidade celular, como também perspectiva de geração de descendentes saudáveis, obviamente com o genoma bem preservado. Por fim, os resultados para a vitrificação de tecido ovariano caprino utilizando o OTC mostraram-se promissores, o que abre novas perspectivas para a utilização desta técnica para a criopreservação de tecido ovariano em outras espécies, inclusive a espécie humana.

148 REFERÊNCIAS BIBLIOGRÁFICAS ABRAHAM, R. T. Checkpoint signalling: focusing on 53BP1. Nature Cell Biology, v. 4, n. 12, p. e277-e-279, ABRAHAM, R.T. Identification of TOR signaling complexes: more TORC for the cell growth engine. Cell, v. 111, n. 1, p. 9-12, ACKER, J. P.; MCGANN, L. E. Protective effect of intracellular ice during freezing? Cryobiology, v. 46, n. 2, p , AGARWAL, A.; GUPTA, S.; SHARMA, R. Oxidative stress and its implications in female infertility - a clinician's perspective. Reproductive Biomedicine Online, v. 11, n. 5, p , AHN, H. J.; SOHN, I. P.; KWON, H. C.; JO, D. H.; PARK, Y. D.; MIN, C. K. Characteristics of the cell membrane fluidity, actin fibers, and mitochondrial dysfunctions. Molecular Reproduction and Development, v. 61, n. 4, p , AITKEN, R. J.; PATERSON, M.; FISHER, H.; BUCKINGHAM, D. W.; VAN DUIN, M. Redox regulation of tyrosine phosphorylation in human spermatozoa and its role in the control of human sperm function. Journal of Cell Science, v. 108, n. 5, p , ALBERTINI, D. F.; EPPIG, J. J. Unusual cytoskeletal and chromatin configurations in mouse oocytes that are atypical in meiotic progression. Developmental Genetics, v. 16, n. 1, p , ALLWORTH, A. E.; ALBERTINI, D. F. Meiotic maturation in cultured bovine oocytes is accompanied by remodeling of the cumulus cell cytoskeleton. Developmental Biology v. 158, n. 1, p , ALMODIN, C. G.; MINGUETTI-CAMARA, V. C.; MEISTER, H.; FERREIRA, J.; FRANCO, R. L.; CAVALCANTE, A. A.; RADAELLI, M. R. M.; BAHLS, A. S.; MORON, A. F.; MURTA, C. G. V.; Recovery of fertility after grafting of cryopreserved germinative tissue in female rabbits following radiotherapy. Human Reproduction, v. 19, n. 6, p , AMORIM, C. A.; DOLMANS, M. M.; DAVID, A.; JAEGER, J.; VANACKER, J.; CAMBONI, A.; DONNEZ, J.; VAN LANGENDONCKT, A. Vitrification and xenografting of human ovarian tissue. Fertility and Sterility, v. 98, n. 5, p , ANAZETTI, M. C.; MELO, P. S. Morte celular por apoptose: uma visão bioquímica e molecular. Metrocamp Pesquisa, v. 1, n. 1, p , 2007.

149 149 ARAV, A.; GAVISH, Z.; ELAMI, A.; NATAN, Y.; REVEL, A.; SILBER, S.; GOSDEN, R. G.; PATRIZIO, P. Ovarian function 6 years after cryopreservation and transplantation of whole sheep ovaries. Reproductive Biomedicine Online, v. 20, n. 1, p , ARAV, A.; PEARL, M.; ZERON, Y. Does membrane lipid profile explain chilling sensitivity and membrane lipid phase transition of spermatozoa and oocytes? Cryo Letters, v. 21, n. 3, p , ARAV, A.; REVEL, A.; NATHAN, Y.; BOR, A.; GACITUA, H.; YAVIN, S.; GAVISH, Z.; URI, M.; ELAMI, A. Oocyte recovery, embryo development and ovarian function after cryopreservation and transplantation of whole sheep ovary. Human Reproduction, v. 20, n. 12, p , ASGARI, V.; HOSSEINI, S. M.; OSTADHOSSEINI, S.; HAJIAN, M.; NARS- ESFAHANI, M. H. Time dependent effect of post warming interval on microtubule organization, meiotic status, and parthenogenetic activation of vitrified in vitro matured sheep oocytes. Theriogenology, v. 75, n. 5, p , AUBARD, Y.; POIROT, C.; PIVER, P.; GALINAT, S.; TEISSIER, M. P. Are there indications for ovarian tissue cryopreservation? Fertilility and Sterility, v. 76, n. 2, p , AYE, M.; GIORGIO, C.; MO, M. DI.; BOTTA, DE.; PERRIN, A.; COURBIERE, B. J. Assessment of the genotoxicity of three cryoprotectans used for human oocyte vitrification: dimethyl sulfoxide, ethylene glycol and propylene glycol. Food and Chemical Toxicology, v. 48, n. 7, p , BAGCHI, A.; WOODS, E. J.; CRITSER, J. K. Cryopreservation and vitrification: Recent advances in fertility preservation technologies. Expert Review of Medical Devices, v. 5, n. 3, p , BAIARDI, G.; RUIZ, R. D.; FIOL DE CUNEO, M.; PONCE, A. A.; LACUARA, J. L.; VINCENTI, L. Differential effects of pharmacologically generated reactive oxygen species upon functional activity of epididymal mouse spermatozoa. Canadian Journal of Physiology and Pharmacology, v. 75, n. 3, p , BAKHACH, J. The cryopreservation of composite tissues - Principles and recent advancement on cryopreservation of different type of tissues. Organogenesis, v. 5, n. 3, p , BALABAN, B.; URMAN, B.; ATA, B.; ISIKLAR, A.; LARMAN, MG.; HAMILTON, R.; GARDNER, D. K. A randomized controlled study of human day 3 embryo cryopreservation by slow freezing or vitrification: vitrification is associated with higher survival, metabolism and blastocyst formation. Human Reproduction, v. 23, n. 9, p , 2008.

150 150 BALL, B. A. Oxidative stress, osmotic stress and apoptosis: impacts on sperm function and preservation in the horse. Animal Reproductive Science, v. 107, n. 3-4, p , BAUMBER, J.; BALL, B. A.; LINFOR, J. J.; MEYERS, S. A. Reactive oxygen species and cryopreservation promote DNA fragmentation in equine spermatozoa. Journal of Andrology, v. 24, n. 4, p , BAVISTER, B. D. Culture of pre-implantation embryo: facts and artifacts. Human Reproduction Update, v. 1, n. 2, p , BEDNAR, J.; HOROWITZ, R. A.; DUBOCHET, J.; WOODCOCK, C. L. Chromatin conformation and salt-induced compaction: three-dimensional structural information from cryoelectron microscopy. The Journal of Cell Biology, v. 131, n. 6, p , 1995 BEEBE, L.; NOTTLE, M. Development of a commercial embryo freezing protocol for the conservation, transportation and importation of pig genetics 2e-105. Report prepared for the Co-operative Research Centre for an Internationally Competitive Pork Industry, p. 1-12, BEN-AHARON, I.; BAR-JOSEPH, H.; TZARFATY, G.; KUCHINSKY, L.; RIZEL, S.; STEMMER, S. M.; SHALGI, R. Doxorubicin-induced ovarian toxicity. Reproductive Biology and Endocrinology, v. 8, n. 20, p. 1-7, BENSON, E. E. Cryopreservation Theory. In: Reed B.M. (Ed). Plant Cryopreservation: A Practical Guide, 542p. Corvallis: Springer, 2008, p BERRA, C. M.; MENCK, C. F. M.; DI MASCI, P. Estresse oxidativo, lesões no genoma e processos de sinalização no controle do ciclo celular. Química Nova, v. 29, n. 6, p , BIELANSKI, A.; NADINDAVIS, S.; SAPP, T.; LUTZE-WALLACE, C. Viral contamination of embryos cryopreserved in liquid nitrogen. Cryobiology, v. 40, n. 2, p , BIELANSKI, A.; VAJTA, G. Risk of contamination of germplasm during cryopreservation and cryobanking in IVF units. Human Reproduction, v.24, n. 10, p , BILODEAU, J. F.; CHATTERJEE, S.; SIRARD, M. A.; GAGNON, C. Levels of antioxidant defenses are decreased in bovine spermatozoa after a cycle of freezing and thawing. Molecular Reproduction and Development, v. 55, n. 3, p , BILSLAND, E.; DOWNS, J. A. Tails of histones in DNA double-strand break repair. Mutagenesis, v. 20, n. 3, p , 2005.

151 151 BODIN, S.; SOULET, C.; TRONCHÈRE, H.; SIÉ, P.; GACHET, C.; PLANTAVID, M.; PAYRASTRE, B. Integrin-dependent interaction of lipid rafts with the actin cytoskeleton in activated human platelets. Journal of Cell Science, v. 118, n. 4, p , BOGLIOLO, L.; ARIU, F.; FOIS, S.; ROSATI, I.; ZEDDA, M. T.; LEONI, G.; SUCCU, S.; PAU, S.; LEDDA, S. Morphological and biochemical analysis of immature ovine oocytes vitrified with or without cumulus cells. Theriogenology, v. 68, n. 8, p , BONETTI, A.; CERVI, M.; TOMEI, F.; MARCHINI, M.; ORTOLANI, F.; MANNO, M. Ultrastructural evaluation of human metaphase II oocytes after vitrification: closed versus open devices. Fertility and Sterility, v. 95, n, 3, p , BORDES, A.; LORNAGE, J.; DEMIRCI, B.; FRANCK, M.; COURBIERE, B.; GUERIN, J. F.; SALLE, B. Normal gestations and live births after orthotopic autograft of vitrified-warmed hemi-ovaries into ewes. Human Reproduction, v. 20, n. 10, p , BORGES, E. N.; SILVA, R. C.; FUTINO, D. O.; ROCHA-JUNIOR, C. M. C.; AMORIM, C. A.; BÁO S. N.; LUCCI, C. M. Cryopreservation of swine ovarian tissue: Effect of different cryoprotectants on the structural preservation of preantral follicle oocytes. Cryobiology, v. 59, n. 2, p , BOS-MIKICH, A.; MARQUES, L.; RODRIGUES, J. L.; LOTHHAMMER, N.; FRANTZ, N. The use of a metal container for vitrification of mouse ovaries, as a clinical grade model for human ovarian tissue cryopreservation, after different times and temperatures of transport. The Journal of Obstetrics and Gynaecology Research, v. 29, n. 11, p , BOUROUGAA, K.; NASKI, N.; BOULARAN, C.; MLYNARCZYK, C.; CANDEIAS, M. M.; MARULLO, S.; FÅHRAEUS, R. Endoplasmic reticulum stress induces G2 cellcycle arrest via mrna translation of the p53 isoform p53/47. Molecular Cell, v. 38, n 1, p , BUCHMANN, A. M.; SKAAR, J. R.; DECAPRIO, J. A. Activation of a DNA damage checkpoint response in a TAF1-defective cell line. Molecular and Cellular Biology, v. 24, n. 12, p , BURGOYNE, P. S.; HOLLAND, K.; STEPHENS, R. Incidence of numerical chromosome anomalies in human pregnancy estimation from induced and spontaneous abortion data. Human Reproduction, v. 6, n. 4, p , BURMA, S.; CHEN, B. P.; MURPHY, M.; KURIMASA, A.; CHEN, D. J. ATM phosphorylates histone H2AX in response to DNA double-strand breaks. Journal of Biological Chemistry, v. 276, n. 45, p , 2001.

152 152 CAO, X. H.; WANG, A. H.; WANG, C. L.; MAO, D. Z.; LU, M. F.; CUI, Y. Q.; JIAO, R. Z. Surfactin induces apoptosis in human breast cancer MCF-7 cells through a ROS/JNK-mediated mitochondrial/caspase pathway. Chemico-Biological Interactions, v. 183, n. 3, p , CARMO-FONSECA, M.; DAVID-FERREIRA, J. F. Interactions of intermediate filaments with cell structures. Electron Microscopy Reviews, v. 3, n. 1, p , CARROLL, J.; DEPYPERE, H.; MATTHEWS, C.D. Freeze-thaw-induced changes of the zona pellucida explains decreased rates of fertilization in frozen-thawed mouse oocytes. Journal of Reproduction and Fertility, v. 90, n. 2, p , CARROLL, J.; GOSDEN, R. G. Transplantation of frozen-thawed mouse primordial follicles. Human Reproduction, v. 8, n. 8, p , CARVALHO, A. A.; FAUSTINO, L. R.; SILVA, C. M. G.; CASTRO, S. V.; LUZ, H. K. M.; ROSSETTO, R.; LOPES, C. A. P.; CAMPELLO, C. C.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R.; COSTA, A. P. R. Influence of vitrification techniques and solutions on the morphology and survival of preantral follicles after in vitro culture of caprine ovarian tissue. Theriogenology, v. 76, n. 5, p , CARVALHO, A. A.; FAUSTINO, L. R.; SILVA, C. M. G.; CASTRO, S. V.; LOPES, C. A. P.; SANTOS, R. R.; BÁO, S. N.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R. Novel wide-capacity method for vitrification of caprine ovaries: Ovarian Tissue Cryosystem (OTC). Animal Reproduction Science, v. 138, n 3-4, p , CASTRO, S. V.; CARVALHO, A. A.; SILVA, C. M. G.; FAUSTINO, L. R.; CAMPELLO, C. C.; LUCCI, C. M.; BÁO, S. N.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R. Freezing solution containing dimethylsulfoxide and fetal calf serum maintains survival and ultrastructure of goat preantral follicles after cryopreservation and in vitro culture of ovarian tissue. Cell Tissue Research, v. 346, n. 2, p , CELESTINO, J. J. H.; CHAVES, R. N.; MATOS, M. H. T.; SARAIVA, M. V. A.; SILVA, J. R. V.; BRUNO, J. B.; MAIA-JÚNIOR, J. E.; FIGUEIREDO, J. R. Mechanisms of atresia in ovarian follicles. Animal Reproduction, v. 6, n. 4, p , CELESTINO, J. J. H.; SANTOS, R. R.; LOPES, C. A. P.; MARTINS, F. S.; MATOS, M. H. T.; MELO, M. A. P.; BÁO, S. N.; RODRIGUES, A. P. R.; SILVA, J. R. V.; FIGUEIREDO, J. R. Preservation of bovine preantral follicle viability and ultrastructure after cooling and freezing of ovarian tissue. Animal Reproduction Science, v. 108, n. 3-4, p , CHA, K. Y.; CHUNG, H. M.; LIM, J. M.; KO, J. J.; HAN, S. Y.; CHOI, D. H.; YOON, T. K. Freezing immature oocytes. Molecular and Cellular Endocrinology, v. 169, n. 1-2, p , 2000.

153 153 CHAN, D. C. Mitochondria: Dynamic organelles in disease, aging, and development. Cell, v. 125, n. 7, p , CHANG, C. C.; LIN, C. J.; SUNG, L. Y.; KORT, H. I.; TIAN, X. C.; NAGY, Z. P. Impact of phase transition on the mouse oocyte spindle during vitrification. Reproductive Biomedicine Online, v. 22, n. 2, p , CHEN, S. U.; CHIEN, C. L.; WU, M. Y.; CHEN, T. H.; LAI, S. M.; LIN, C. W.; YANG, Y. S. Novel direct cover vitrification for cryopreservation of ovarian tissues increases follicle viability and pregnancy capability in mice. Human Reproduction, v. 21, n. 9, p , CHI, H. J.; KIM, J. H.; RYU, C. S.; LEE, J. Y.; PARK, J. S.; CHUNG, D. Y.; CHOI, S. Y.; KIM, M. H.; CHUN, E. K.; ROH, S. I. Protective effect of antioxidant supplementation in sperm-preparation medium against oxidative stress in human spermatozoa. Human Reproduction, v. 23, n. 5, p , CHOI, J. Y.; LEE, B. E.; LEE, E. Y.; YOON, B. K.; BAE, D. S.; CHOI, D. S. Cryopreservation of ovarian tissues temporarily suppresses the proliferation of granulosa cells in mouse preantral follicles. Cryobiology, v. 56, n. 1, p , CHOI, J.; LEE, J. Y.; LEE, E.; YOON, B. K.; BAE, D.; CHOI, D. Cryopreservation of the mouse ovary inhibits the onset of primordial follicle development. Cryobiology, v. 54, n. 1, p , CHOI, M. H.; LEE, I. K.; KIM, G. W.; KIM, B. U.; HAN, Y. H.; YU, D. Y.; PARK, H. S.; KIM, K. Y.; LEE, J. S.; CHOI, C.; BAE, Y. S.; LEE, B. I.; RHEE, S. G.; KANG, S. W. Regulation of PDGF signalling and vascular remodelling by peroxiredoxin II. Nature, v. 435, n. 7040, p , CHOI, W. J.; YEO, H. J..; SHIN, J. K.; LEE, S. A.; LEE, J. H.; PAIK, W. Y. Effect of vitrification method on survivability, follicular growth and ovulation of preantral follicles in mice. The Journal of Obstetrics and Gynaecology Research, v. 33, n. 2, p , CORTVRINDT, R.; SMITZ, J. In vitro follicle growth: achievements in mammalian species. Reproduction in Domestic Animals, v. 36, n. 1, p. 3-9, COSS, R. A.; DEWEY, W. C.; BAMBURG, J. R. Effects of hyperthermia (41,5 ) on Chinese hamster ovary cells analyzed in mitosis. Cancer Research, v. 39, p , COURBIERE, B.; ODAGESCU, V.; BAUDOT, A.; MASSARDIER, J.; MAZOYER, C.; SALLE, B.; LORNAGE, J. Cryopreservation of the ovary by vitrification as an alternative to slow-cooling protocols. Fertility and Sterility, v. 90, n. 3, p , 2006.

154 154 COX, S. L.; SHAW, J.; JENKIN, G. Transplantation of cryopreserved fetal ovarian tissue to adult recipients in mice. Journal of Reproduction and Fertility, v. 107, n. 2, p , COZZI, E.; WHITE, D. J. The generation of transgenic pigs as potential organ donors for humans. Nature Medicine, v. 1, n. 9, p , CROWE, J. H.; HOEKSTRA, F. A.; CROWE, L. M. Anhydrobiosis. Annual review of Physiology, v. 54, p , D'AMOURS, D.; JACKSON, S. P. The Mre11 complex: at the crossroads of DNA repair and checkpoint signaling. Nature Reviews, v. 3, n. 5, p , DAVID, A.; DOLMANS, M. M.; LANGENDONCKT, A. V.; DONNEZ, J.; AMORIM, C. A. Immunohistochemical localization of growth factors after cryopreservation and 3 weeks xenotransplantation of human ovarian tissue. Fertility and Sterility, v. 95, n. 4, p , DELA PEÑA, E.C.; TAKAHASHI, Y.; KATAGIRI, S.; ATABAY, E.C.; NAGANO, M. Birth of pups after transfer of mouse embryos derived from vitrified preantral follicles. Reproduction, v. 123, n. 4, p , DEMIRCI, B.; SALLE, B.; FRAPPART, L.; FRANCK, M.; GUERIN, J. F.; LORNAGE, J. Morphological alterations and DNA fragmentation in oocytes from primordial and primary follicles after freezing-thawing of ovarian cortex in sheep. Fertility and Sterility, v. 77, n. 3, p , DIEZ, C.; DUQUE, P.; GÓMEZ, E.; HIDALGO, C. O.; TAMARGO, C.; RODRÍGUEZ, A.; FERNÁNDEZ, L., DE LA VARGA, S.; FRENÁNDEZ, A.; FACAL, N.; CARBAJO, M. Bovine oocyte vitrification before or after meiotic arrest: effects on ultrastructure and developmental ability. Theriogenology, v. 64, n. 2, p , DINARA, S.; SENGOKU, K.; TAMATE, K.; HORIKAWA, M.; ISHIKAWA, M. Effects of supplementation with free radical scavengers on the survival and fertilization rates of mouse cryopreserved oocytes. Human Reproduction, v. 16, n. 9, p , DITTRICH, R.; LOTZ, L.; KECK, G.; HOFFMANN, I.; MUELLER, A.; BECKMANN, M. W.; VAN DER VEN, H.; MONTAG, M. Live birth after ovarian tissue autotransplantation following overnight transportation before cryopreservation. Fertilility and Sterility, v. 97, n. 2, p , DITTRICH, R.; MUELLER, A.; HOFFMANN, I.; BECKMANN, M. W.; MALTARIS, T. Cryopreservation of complex systems: slow freezing has not had its day yet. Rejuvenation Research, v. 10, n. 1, p , 2007

155 155 DOBRINSKY, J. R. Advancements in cryopreservation of domestic animal embryos. Theriogenology, v. 57, n. 1, p , DOLMANS, M. M.; MICHAUX, N.; CAMBONI, A.; MARTINEZ-MADRID, B.; VAN LANGENDONCKT, A.; NOTTOLA, S. A.; DONNEZ, J. Evaluation of Liberase, a purified enzyme blend, for the isolation of human primordial and primary ovarian follicles. Human Reproduction, v. 21, n. 2, p , DONNELLY, E. T.; MCCLURE, N.; LEWIS, S. E. The effect of ascorbate and alphatocopherol supplementation in vitro on DNA integrity and hydrogen peroxide-induced DNA damage in human spermatozoa. Mutagenesis, v. 14, n. 5, p , DONNEZ, J.; DOLMANS, M. M.; DEMYLLE, D.; JADOUL, P.; PIRARD, C.; SQUIFFLET, J.; MARTINEZ-MADRID, B.; VAN LANGENDONCKT, A. Livebirth after orthotopic transplantation of cryopreserved ovarian tissue. The Lancet, v. 364, n. 9443, p , DONNEZ, J.; JADOUL, P.; PIRARD, C.; HUTCHINGS, G.; DEMYLLE, D.; SQUIFFLET, J.; SMITZ, J.; DOLMANS, M. M. Live birth after transplantation of frozen-thawed ovarian tissue after bilateral oophorectomy for benign disease. Fertility and Sterility, v. 98, n. 3, p , DONNEZ, J.; SQUIFFLET, J.; JADOUL, P.; DEMYLLE, D.; CHERON, A. C.; VAN LANGENDONCKT, A.; DOLMANS, M. M. Pregnancy and live birth after autotransplantation of frozen thawed ovarian tissue in a patient with metastatic disease undergoing chemotherapy and hematopoietic stem cell transplantation. Fertility and Sterility, v. 95, n. 5, p.1787.e e4, DOWLING, D. K.; SIMMONS, L. W. Reactive oxygen species as universal constraints in life-history evolution. Proceeding. Biological Science, v. 276, n. 1663, p , DUCIBELLA, T.; SCHULTZ, R. M.; OZIL, J. P. Role of calcium signals in early development. Seminars in Cell & Developmental Biology, v. 17, n. 2, p , DULIOUST, E.; TOYAMA, K.; BUSNEL, M. C.; MOUTIER, R.; CARLIER, M.; MARCHALAND, C.; DUCOT, B.; ROUBERTOUX, P.; AUROUX, M. Long-term effects of embryo freezing in mice. Proceedings of the National Academy of Sciences of the United States of America, v. 92, n. 2, p , ELLIOTT, J. A. W. Introduction to the special issue: Thermodynamic aspects of cryobiology. Cryobiology, v. 60, n. 1, p. 1-3, ELMORE, S. Apoptosis: a review of programmed cell death. Toxicologic Pathology, v. 35, n. 4, p , 2007.

156 156 EL-WAHSH, M.; FULLER, B.; DAVIDSON, B.; ROLLES, K. Hepatic cold hypoxia and oxidative stress: implications for ICAM-1 expression and modulation by glutathione during experimental isolated liver preservation. Cryobiology, v. 47, n. 2, p , ERNST, E.; BERGHOLDT, S.; JØRGENSEN, J. S.; ANDERSEN, C. Y. The first woman to give birth to two children following transplantation of frozen/thawed ovarian tissue. Human Reproduction, v. 25, n. 5, p , EROGLU, A.; TONER, M.; LEYKIN, L.; TOTH, T. L. Cytoskeleton and polyploidy after maturation and fertilization of cryopreserved germinal vesicle-stage mouse oocytes. Journal of Assisted Reproduction and Genetics, v. 15, n. 7, p , EROGLU, A.; TOTH, T. L.; TONER, M. Alterations of the cytoskeleton and polyploidy induced by cryopreservation of metaphase II mouse oocytes. Fertility and Sterility, v. 69, n. 5, p , EVANS, M. D.; COOKE, M. S. Factors contributing to the outcome of oxidative damage to nucleic acids. Bioessays, v. 26, n. 5, p , EVANS, M. D.; DIZDAROGLU, M.; COOKE, M. S. Oxidative DNA damage and disease: induction, repair and significance. Mutation Research, v. 567, n. 1, p. 1-61, FABIAN, D.; GJØRRET, J. O.; BERTHELOT, F.; MARTINAT-BOTTÉ, F.; MADDOX-HYTTEL, P. Ultrastructure and cell death of in vivo derived and vitrified porcine blastocysts. Molecular Reproduction and Development, v. 70, n. 2, p , FADDY, M. J. Follicle dynamics during ovarian ageing. Molecular and Cellular Endocrinology, v. 163, n. 1-2, p , FAHY, G. M.; MACFARLANE, D. R.; ANGELL, C. A.; MEZYMAN, H. A. T. Vitrification as an approach to cryopreservation. Cryobiology, 20, , FAHY, G. M.; WOWK, B.; WU, J. Cryopreservation of complex systems: the missing link in the regenerative medicine supply chain. Rejuvenation Research, v. 9, n. 2, p , FAIR, T.; HULSHOF, S. C. J.; HYTTEL, P.; GREVE, T.; BOLAND, M. Oocyte ultrastructure in bovine primordial to early tertiary follicles. Anatomy and Embryology, v. 195, n. 4, p , FAUQUE, P.; AMOR, A. B.; JOANNE, C.; AGNANI, G.; BRESSON, J. L.; ROUX, C. Use of trypan blue staining to assess the quality of ovarian cryopreservation. Fertility and Sterility, v. 87, n. 5, p , 2007.

157 157 FAUSTINO, L. R.; SANTOS, R. R.; SILVA, C. M. G.; PINTO, L. C.; CELESTINO, J. J. H.; CAMPELLO, C. C.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R. Goat and sheep ovarian tissue cryopreservation: Effects on the morphology and development of primordial follicles and density of stromal cell. Animal Reproduction Science, v. 122, n. 1-2, p , FERNANDEZ-CAPETILLO, O.; CHEN, H. T.; CELESTE, A.; WARD, I.; ROMANIENKO, P. J.; MORALES, J. C.; NAKA, K.; XIA, Z.; CAMERINI-OTERO, R. D.; MOTOYAMA, N.; CARPENTER, P. B.; BONNER, W. M.; CHEN, J.; NUSSENZWEIG, A. DNA damage-induced G2-M checkpoint activation by histone H2AX and 53BP1. Nature Cell Biology, v. 4, n. 12, p , FERNANDEZ-CAPETILLO, O.; LEE, A.; NUSSENZWEIG, M.; NUSSENZWEIG, A. H2AX: the histone guardian of the genome. DNA Repair, v. 3, n. 8-9, p , FERNÁNDEZ-SANTOS, M. R.; DOMÍNGUEZ-REBOLLEDO, A. E.; ESTESO, M. C.; GARDE, J. J.; MARTÍNEZ-PASTOR, F. Catalase supplementation on thawed bull spermatozoa abolishes the detrimental effect of oxidative stress on motility and DNA integrity. International Journal of Andrology, v. 32, n. 4, p , FIGUEIREDO, J. R.; CELESTINO, J. J. H.; RODRIGUES, A. P. R.; SILVA, J. R. V. Importância da biotécnica de MOIFOPA para o estudo da foliculogênese e produção in vitro de embriões em larga escala. Revista Brasileira de Reprodução Animal, v. 31, n. 2, p , FIGUEIREDO, J. R.; RODRIGUES, A. P. R.; AMORIM, C. A.; SILVA, J. R. V. Manipulação de oócitos inclusos em folículos ovarianos pré-antrais - MOIFOPA. In: GONÇALVES, P. B. D.; FIGUEIREDO, J. R.; FREITAS, V. J. F. (Eds.), Biotécnicas aplicadas à reprodução animal, 2 ed.,395p. São Paulo: Roca, 2008, p FOSTER, L. J.; HOOG, C. L.; ZHANG, Y.; ZHANG, Y.; XIE, X.; MOOTHA, V. K.; MANN, M. A mammalian organelle map by protein correlation profiling. Cell, v. 125, n. 1, p , FRANKE, J. C.; PLÖTZ, M.; PROKOP, A.; GEILEN, C. C.; SCHMALZ, H. G.; EBERLE, J. New caspase-independent but ROS-dependent apoptosis pathways are targeted in melanoma cells by an iron-containing cytosine analogue. Biochemical Pharmacology, v. 79, n. 4, p , FREITAS, V. J. F.; SEROVA, I. A.; MOURA, R. R.; ANDREEVA, L. E.; MELO, L. M.; TEIXEIRA, D. I. A.; PEREIRA, A. F.; LOPES JR, E. S.; DIAS, L. P. B.; NUNES- PINHEIRO, D. C. S.; SOUSA, F. C.; ALCÂNTARA NETO, A. S.; ALBUQUERQUE, E. S.; MELO, C. H. S.; RODRIGUES, V. H. V.; BATISTA, R. I. T. P.; DVORIANCHIKOV, G. A.; SEROV, O. L. The establishment of two transgenic goat lines for mammary gland hg-csf expression. Small Ruminant Research, v. 105, n. 1-3, p , 2012.

158 158 FU, X. W.; SHI, W. Q.; ZHANG, Q. J.; ZHAO, X. M.; YAN, C. L.; HOU, Y. P.; ZHOU, G. B.; FAN, Z. Q.; SUO, L.; WUSIMAN, A.; WANG, Y. P.; ZHU, S. E. Positive effects of Taxol pretreatment on morphology, distribution and ultrastructure of mitochondria and lipid droplets in vitrification of in vitro matured porcine oocytes. Animal Reproduction Science, v. 115, n. 1-4, p , FU, X.W.; WU, G. Q.; LI, J. J.; HOU, Y. P.; ZHOU, G. B.; SUO, L.; WANG, Y. P.; ZHU, S. E. Positive effects of Forskolin (stimulator of lipolysis) treatment on cryosurvival of in vitro matured porcine oocytes. Theriogenology, v. 75, n. 2, p , FUKU, E.; XIA, L.; DOWNEY, B. R. Ultrastructural changes in bovine oocytes cryopreserved by vitrification. Cryobiology, v. 32, n. 2, p , GARTNER L. P.; HIATT, J. L. Sistema Reprodutor Feminino. In: GARTNER L. P.; HIATT, J. L. Tratado de Histologia em Cores, 3 ed., 576p. Rio de Janeiro: Elsevier Brasil, 2007, p GHETLER, Y.; YAVIN, S.; SHALGI, R.; ARAV, A. The effect of chilling on membrane lipid phase transition in human oocytes and zygotes. Human Reproduction, v. 20, n. 12, p , GLAMOCLIJA, V.; VILOVIC, K.; SARAGA-BABIC, M.; BARANOVIC, A.; SAPUNAR, D. Apoptosis and active caspase-3 expression in human granulosa cells. Fertility and Sterility, v. 83, n. 2, p , GOMES, C. M.; SILVA, C. A. S.; ACEVEDO, N.; BARACAT, E.; SERAFINI, P.; SMITH, G. D. Influence of vitrification on mouse metaphase II oocyte spindle dynamics and chromatin alignment. Fertility and Sterility, v. 90, n. 4, p , GOOK, D. A.; EDGAR, D. H.; BORG, J.; ARCHER, J.; MCBAIN, J. C. Diagnostic assessment of the developmental potential of human cryopreserved ovarian tissue from multiple patients using xenografting. Human Reproduction, v. 20, n. 1, p , GOSDEN, R. G.; BAIRD, D. T.; WADE, J. C.; WEBB, R. Restoration of fertility to oophorectomized sheep by ovarian autografts stored at -196 C. Human Reproduction, v. 9, n. 4, p , GOUGEON, A. Dynamics for human follicular growth: morphologic, dynamic, and functional aspects. In: LEUNG, P. C. K.; ADASHI, E. Y. (Eds.), The ovary, 2 ed., 664p. San Diego: Elsevier Academic Press, 2004, p GREEN, D. R. Overview: apoptotic signaling pathways in the immune system. Immunological Reviews, v. 193, n. 1, p. 5-9, 2003.

159 159 GROUT, B. W. W.; MORRIS, G. J. Contaminated liquid nitrogen vapour as a risk factor in pathogen transfer. Theriogenology, v. 71, n. 7, p , GUALTIERI, R.; IACCARINO, M.; MOLLO, V.; PRISCO, M.; IACCARINO, S.; TALEVI, R. Slow cooling of human oocytes: ultrastructural injuries and apoptotic status. Fertility and Sterility, v. 91, n. 4, p , GUALTIERI, R.; MOLLO, V.; BARBATO, V.; FIORENTINO, I.; IACCARINO, M.; TALEVI, R. Ultrastructure and intracellular calcium response during activation in vitrified and slow-frozen human oocytes. Human Reproduction, v. 26, n. 9, p , GUÉRIN, P.; El MOUATASSIM, S.; MENEZO, Y. Oxidative stress and protection against reactive oxygen species in the pre-implantation embryo and its surroundings. Human Reproduction Update, v. 7, n. 2, p , GUPTA, M. K.; UHM, S. J.; LEE, H. T. Effect of vitrification and betamercaptoethanol on reactive oxygen species activity and in vitro development of oocytes vitrified before or after in vitro fertilization. Fertility and Sterility, v. 93, n. 8, p , GUYTON, A. C.; HALL, J. E. Female physiology before pregnancy and female hormones. In: GUYTON, A. C.; HALL, J. E. Textbook of Medical Physiology, 11 ed., 1152p. Philadelphia: Elsevier Saunders, 2006, p GUYTON, A. C.; HALL, J. E. The Cell and Its Functions. In: GUYTON, A. C.; HALL, J. E. (Eds) Textbook of Medical Physiology, 1120p. Philadelphia: Elsevier Saunders, 2006, p HAFEZ, B.; HAFEZ, E. S. E. Anatomia da reprodução feminina. In: HAFEZ, B.; HAFEZ, E. S. E. Reprodução Animal, 7 ed., 513p. São Paulo: Manole, 2004, p HAIDARI, K.; SALEHNIA, M.; VALOJERDI, M. R. The effect of leukemia inhibitory factor and coculture on the in vitro maturation and ultrastructure of vitrified and nonvitrified isolated mouse preantral follicles. Fertility and Sterility, v. 90, n. 6, p , HALL, P.F. The roles of calmodulin, actin, and vimentin in steroid synthesis by adrenal cells. Steroids, v. 62, n. 1, p , HALLIWELL, B.; GUTTERIDGE, J. M. The chemistry of oxygen radicals and other derived species. In: HALLIWELL, B.; GUTTERIDGE, J. M. (Eds.), 3 ed. Free radicals in biology and medicine, 976 p. London: Clarendon Press, Oxford, 1999, p HARVEY, A. J.; KIND, K. L.; THOMPSON, J. G. REDOX regulation of early embryo development. Reproduction, v. 123, n. 4, p , 2002.

160 160 HASEGAWA, A.; MOCHIDA, N.; OGASAWARA, T.; KOYAMA, K. Pup birth from mouse oocytes in preantral follicles derived from vitrified and warmed ovaries followed by in vitro growth, in vitro maturation, and in vitro fertilization. Fertility and Sterility, v. 86, n. 4, p , HASHIMOTO, S.; SUZUKI, N.; YAMANAKA, M.; HOSOI, Y.; ISHIZUKA, B.; MORIMOTO, Y. Effects of vitrification solutions and equilibration times on the morphology of cynomolgus ovarian tissues. Reproductive BioMedicine Online, v. 21, n. 4, p , HASSA, P. O.; HOTTIGER, M. O. An epigenetic code for DNA damage repair pathways? Biochemistry and Cell Biology, v.83, n. 3, p , HERTIG, A. T.; ADAMS, E. C. Studies on the human oocyte and its follicle. I. Ultrastructural and histochemical observation on the primordial follicle stage. The Journal of Cell Biology, v. 34, n. 2, p , HINSHAW, D. B.; SKLAR, L. A.; BOHL, B.; SCHRAUFSTATTER, I. U.; HYSLOP, P. A.; ROSSI, M. W.; SPRAGG, R. G.; COCHRANE, C. G. Cytoskeletal and morphologic impact of cellular oxidant injury. The American Journal of Pathology, v. 123, n. 3, p , HIRSHFIELD, A. N. Development of follicles in the mammalian ovary. International Review of Cytology, v. 124, p , HOCHI, S.; ITO, K.; HIRABAYASHI, M.; UEDA, M.; KIMURA, K.; HANADA, A. Effect of nuclear stages during IVM on the survival of vitrified-warmed bovine oocytes. Theriogenology, v. 49, n. 4, p , HOCHI, S.; KOZAWA, M.; FUJIMOTO, T.; HONDO, E.; YAMADA, J.; OGURI, N. In vitro maturation and transmission electron microscopic observation of horse oocytes after vitrification. Cryobiology, v. 33, n. 3, p , HOLT, W. V.; NORTH, R. D. Effects of temperature and restoration of osmotic equilibrium during thawing on the induction of plasma membrane damage in cryopreserved ram spermatozoa. Biology of Reproduction, v. 51, n. 3, p , HSU, S. Y.; HSUEH, A. J. W. Intracellular mechanisms of ovarian cell apoptosis. Molecular and Cellular Endocrinology, v. 145, n. 1-5, p , Acesso em 30/10/2013 às 11:58h. HUANG, J.; LI, Q.; ZHAO, R.; LI, W.; HAN, Z.; CHEN, X.; XIAO, B.; WU, S.; JIANG, Z.; HU, J.; LIU, L. Effect of sugars on maturation rate of vitrified-thawed immature porcine oocytes. Animal Reproduction Science, v. 106, n. 1-2, p , 2008.

161 161 HUANG, L.; MO, Y.; WANG, W.; LI, Y.; ZHANG, Q.; YANG, D. Cryopreservation of human ovarian tissue by solid-surface vitrification. European Journal of Obstetrics & Gynecology and Reproductive Biology, v.139, n. 2, p , HULSHOF, S. C. J.; DIJKSTRA, G.; VAN DER BEEK, E. M.; BEVERS, M. M.; FIGUEIREDO, J. R.; BECKERS, J. F.; VAN DEN HURK, R. Immunocytochemical localization of vasoactive intestinal peptide and neuropeptide Y in the bovine ovary. Biology of Reproduction, v. 50, n. 3, p , HUSSEIN, M. R.; BEDAIWY, M. A.; FALCONE, T. Analysis of apoptotic cell death, Bcl-2, and p53 protein expression in freshly fixed and cryopreserved ovarian tissue after exposure to warm ischemia. Fertility and Sterility, v. 85, Suppl 1, p , HYTTEL, P.; VAJTA, G.; CALLESEN, H. Vitrification of bovine oocytes with the open pulled straw method: ultrastructural consequence. Molecular Reproduction and Development, v. 56, n. 1, p , IMHOF, M.; BERGMEISTER, H.; LIPOVAC, M.; RUDAS, M.; HOFSTETTER, G.; HUBER, J. Orthotopic microvascular reanastomosis of whole cryopreserved ovine ovaries resulting in pregnancy and live birth. Fertility and Sterility, v. 85, Suppl 1, p , IMLAY, J. A.; LINN, S. DNA damage and oxygen radical toxicity. Science, v. 240, n. 4857, p , ISACHENKO, E.; ISACHENKO, V.; RAHIMI, G.; NAWROTH, F. Cryopreservation of human ovarian tissue by direct plunging into liquid nitrogen. European Journal of Obstetrics, Gynecology, and Reproductive Biology, v.108, n. 2, p , ISACHENKO, V.; ISACHENKO, E.; MICHELMANN, H. W.; ALABART, J. L.; VAZQUEZ, I.; BEZUGLY, N.; NAWROTH, F. Lipolysis and ultrastructural changes of intracellular lipid vesicles after cooling of bovine and porcine GV-oocytes. Anatomia, Histologia, Embryologia, v. 30, n. 6, p , ISACHENKO, V.; ISACHENKO, E.; REINSBERG, J.; MONTAG, M.; VAN DER VEN, K.; DORN, C.; ROESING, B.; VAN DER VEN, H. Cryopreservation of human ovarian tissue: comparison of rapid and conventional freezing. Cryobiology, v. 55, n. 3, p , ISACHENKO, V.; LAPIDUS, I.; ISACHENKO, E.; KRIVOKHARCHENKO, A.; KREIENBERG, R.; WORIEDH, M.; BADER, M.; WEISS, J. M. Human ovarian tissue vitrification versus conventional freezing: morphological, endocrinological, and molecular biological evaluation. Reproduction, v. 138, n. 2, p , ISACHENKO, V.; SOLER, C.; ISACHENKO, E.; PEREZ-SANCHEZ, F.; GRISHCHENKO, V. Vitrification of immature porcine oocytes: effects of lipid

162 162 droplets, temperature, cytoskeleton, and addition and removal of cryoprotectant. Cryobiology, v. 36, n. 3, p , ISHIJIMA, T.; KOBAYASHI, Y.; LEE, D. S.; UETA, Y. Y.; MATSUI, M.; LEE, J. Y.; SUWA, Y.; MIYAHARA, K.; SUZUKI, H. Cryopreservation of canine ovaries by vitrification. Journal of Reproduction and Development, v. 52, n. 2, p , IWABUCHI, K.; BARTEL, P. L.; LI, B.; MARRACCINO, R.; FIELDS, S. Two cellular proteins that bind to wild-type but not mutant p53. Proceedings of the National Academy of Sciences of the United States of America, v. 91, n. 13, p , IWABUCHI, K.; LI, B.; MASSA, H. F.; TRASK, B. J.; DATE, T.; FIELDS, S. Stimulation of p53-mediated Transcriptional Activation by the p53-binding proteins, 53BP1 and 53BP2. The Journal of Biological Chemistry, v. 273, n. 40, p , JACKSON, S. P. Sensing and repairing DNA double-strand breaks. Carcinogenesis, v. 23, n. 5, p , JELINKOVA, L.; SELMAN, H. A.; ARAV, A.; STREHLER, E.; REEKA, N.; STERZIK, K. Twin pregnancy after vitrification of 2-pronuclei human embryos. Fertility and Sterility. V. 77, n. 2, p , JOHNSON, M. H.; PICKERING, S. J.; GEORGE, M. A. The influence of cooling on the properties of the zona pellucida of the mouse oocyte. Human Reproduction, v. 3, n. 3, p , JOHNSTONE, R. J.; RUEFFI, A. A.; LOWE, S. W. Apoptosis: a link between cancer genetics and chemotherapy. Cell, v. 108, n. 2, p , JOO, W. S.; JEFFREY, P. D.; CANTOR, S. B.; FINNIN, M. S.; LIVINGSTON, D. M.; PAVLETICH, N. P. Structure of the 53BP1 BRCT region bound to p53 and its comparison to the Brca1 BRCT structure. Genes & Development, v. 16, n. 5, p , JULLIEN, D.; VAGNARELLI, P.; EARNSHAW, W. C.; ADACHI, Y. Kinetochore localisation of the DNA damage response component 53BP1 during mitosis. Journal of Cell Science, v. 115, n. 1, p , JUNQUEIRA, L. C.; CARNEIRO J. Aparelho reprodutor feminino. In: JUNQUEIRA, L. C.; CARNEIRO J. Histologia Básica, 10 ed., 427p. Rio de Janeiro: Guanabara Koogan, 2004, p KADER, A.; BISCOTTI, C.; AGARWAL, A.; SHARMA, R.; FALCONE, T. Comparison of post-warming degeneration and apoptosis of porcine ovarian tissue following vitrification using the Ohio-Cryo device and slow cryopreservation. Fertility and Sterility, v. 90, p. S288, 2008.

163 163 KAGAWA, N.; SILBER, S.; KUWAYAMA, M. Successful vitrification of bovine and human ovarian tissue. Reproductive BioMedicine Online, v. 18, n. 4, p , KAIDI, S.; BERNARD, S.; LAMBERT, P.; MASSIP, A.; DESSY, F.; DONNAY, I. Effect of conventional controlled-rate freezing and vitrification on morphology and metabolism of bovine blastocysts produced in vitro. Biology of Reproduction, v. 65, n. 4, p , KANG, M. A.; SO, E. Y.; SIMONS, A. L.; SPITZ, D. R.; OUCHI, T. DNA damage induces reactive oxygen species generation through the H2AX-Nox1/Rac1 pathway. Cell Death and Disease, v. 3, n. e249, p. 1-8, KARAGIANNIS, T. C.; EL-OSTA, A. Chromatin modifications and DNA doublestrand breaks: the current state of play. Leukemia, v. 21, n. 2, p , KARP, G O núcleo da célula e o controle da expressão gênica. In: KARP, G. (Ed). Biologia Celular e Molecular, 3 ed, 786p. Barueri: Manole, 2002, p KĄTSKA-KSIĄŻKIEWICZ, L. Recent achievements in in vitro culture and preservation of ovarian follicles in mammals. Reproductive Biology, v. 6, n. 1, p. 3-16, KAWAMURA, K.; CHENG, Y.; SUZUKI, N.; DEGUCHI, M.; SATO, Y.; TAKAE, S.; HO, C. H.; KAWAMURA, N.; TAMURA, M.; HASHIMOTO, S.; SUGISHITA, Y.; MORIMOTO, Y.; HOSOI, Y.; YOSHIOKA, N.; ISHIZUKA, B.; HSUEH, A. J. Hippo signaling disruption and Akt stimulation of ovarian follicles for infertility treatment. Proceedings of the National Academy of Sciences of the United States of America, v. 110, n. 43, p , KEFER, J. C.; AGARWAL, A.; SABANEGH, E. Role of antioxidants in the treatment of male infertility. International Journal of Urology, v. 16, n. 5, p , KEROS, V.; XELLA, S.; HULTENBY, K.; PETTERSSON, K.; SHEIKHI, M.; VOLPE, A.; HREINSSON, J.; HOVATTA, O. Vitrification versus controlled-rate freezing in cryopreservation of human ovarian tissue. Human Reproduction, v. 24, n. 7, p , KHANNA, K.K.; JACKSON, S. P. DNA double-strand breaks: signaling, repair and the cancer connection. Nature Genetics, v. 27, n. 3, p , KHORASANIZADEH, S. The nucleosome: from genomic organization to genomic regulation. Cell, v. 116, n. 2, p , KIESS, W.; GALLAHER, B. Hormonal control of programmed cell death/apoptosis. European Journal of Endocrinology, v.138, n. 5, p , 1998.

164 164 KIM, G. A.; KIM, H. Y.; KIM, H. Y.; LEE, G.; LEE, E.; AHN, J. Y.; PARK, J. H.; LIM, J. M. Effectiveness of slow freezing and vitrification for long-term preservation of mouse ovarian tissue. Theriogenology, v. 75, n. 6, p , KIM, G. A.; KIM, H. Y.; KIM, J. W.; LEE, G.; LEE, E.; LIM, J. M. Ultrastructural deformity of ovarian follicles induced by different cryopreservation protocols. Fertility and Sterility, v. 94, n. 4, p , KIM, S. H.; KU, S. Y.; SUNG, K. C.; KANG, M. J.; KIM, S. A.; KIM, H. S.; OH, S. K.; JEE, B. C.; SUH, C. S.; CHOI, Y. M.; KIM, J. G.; MOON, S. Y. Simplified EM grid vitrification is a convenient and efficient method for mouse mature oocyte cryopreservation. Yonsei Medical Journal, v. 47, n. 3, p , KIM, S. S.; YANG, H. W.; KANG, H. G.; LEE, H. H.; LEE, H. C.; KO, D. S.; GOSDEN, R. G. Quantitative assessment of ischemic tissue damage in ovarian cortical tissue with or without antioxidant (ascorbic acid) treatment. Fertility and Sterility, v. 82, n. 3, p , KOBAYASHI, J.; TAUCHI, H.; SAKAMOTO, S.; NAKAMURA, A.; MORISHIMA, K.; MATSUURA, S.; KOBAYASHI, T.; TAMAI, K.; TANIMOTO, K.; KOMATSU, K. NBS1 localizes to gamma-h2ax foci through interaction with the FHA/BRCT domain. Current Biology, v. 12, n. 21, p , KOWALTOWSKI, A. J.; VERCESI, A. E. Mitochondrial damage induced by conditions of oxidative stress. Free Radical Biology and Medicine, v. 26, n. 3-4, p , LANE, M.; MAYBACH, J. M.; GARDNER D. K. Addition of ascorbate during cryopreservation stimulates subsequent embryo development. Human Reproduction, v. 17, n. 10, p , LARMAN, M. G.; SHEEHAN, C. B.; GARDNER, D. K. Calcium-free vitrification reduces cryoprotectant-induced zona pellucida hardening and increases fertilization rates in mouse oocytes. Reproduction, v. 131, n. 1, p , LIN, T. A.; CHEN, C. H.; SUNG, L. Y.; CARTER, M. G.; CHEN, Y. E.; DU, F.; JU, J. C.; XU, J. Open-pulled straw vitrification differentiates cryotolerance of in vitro cultured rabbit embryos at the eight-cell stage. Theriogenology, v. 75, n. 4, p , LIN, T. C.; YEN, J. M.; KUO, T. C.; GONG, K. B.; HSU, K. H.; HSU, T. T. Comparison of the developmental potential of 2-week-old preantral follicles derived from vitrified ovarian tissue slices, vitrified whole ovaries and vitrified/transplanted newborn mouse ovaries using the metal surface method. BMC Biotechnology. v. 8, n. 38, p. 1-13, 2008.

165 165 LIU, J.; SONG, Y.; CHENG, K. M.; SILVERSIDES, F. G. Production of donor-derived offspring from cryopreserved ovarian tissue in japanese quail (Coturnix japonica). Biology of Reproduction, v. 83, n. 1, p , LOETCHUTINAT, C.; KOTHAN, S.; DECHSUPA, S.; MEESUNGNOEN, J.; JAY- GERIN, J. P.; MANKHETKORN, S. Spectrofluorometric determination of intracellular levels of reactive oxygen species in drug-sensitive and drug-resistant cancer cells using the 2,7 -dichlorofluorescein diacetate assay. Radiation Physical and Chemistry, v. 72, n. 2-3, p , LOPES, C. A. P.; SANTOS, R. R.; CELESTINO, J. J. H.; MELO, M. A. P.; CHAVES, R. N.; CAMPELLO, C. C.; SILVA, J. R. V.; BÁO, S. N.; JEWGENOW, K.; FIGUEIREDO, J. R. Short-term preservation of canine preantral follicles: Effects of temperature, medium and time. Animal Reproduction Science, v. 115, n. 1-4, p , LOPES, S.; JURISICOVA, A.; SUN, J. G.; CASPER, R. F. Reactive oxygen species: potential cause for DNA fragmentation in human spermatozoa. Human Reproduction, v. 13, n. 4, p , LORNAGE, J.; COURBIÈRE, B.; MAZOYER, C.; ODAGESCU, V.; BAUDOT, A.; BORDES, A.; POIREL, M. T.; FRANCK, M.; SALLE, B. Vitrification du tissu ovarien: cortex et ovaire entier chez la brebis. Gynécologie Obstétrique & Fertilité, v. 34, n. 9, p , LOVELOCK, J. E. The haemolysis of human red blood cells by freezing and thawing. Biochimica et Biophysica Acta, v. 10, n. 3, p , LUCCI, C. M.; AMORIM, C. A.; BAÓ, S. N.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R.; SILVA, J. R. V.; GONÇALVES, P. B. D. Effect of the interval of serial sections of ovarian tissue in the tissue chopper on the number of isolated caprine preantral follicles. Animal Reproduction Science, v. 56, n. 1, p , LUCIANO, A. M.; CHIGIONI, S.; LODDE, V.; FRANCIOSI, F.; LUVONI, G. C.; MODINA, S. C. Effect of different cryopreservation protocols on cytoskeleton and gap junction mediated communication integrity in feline germinal vesicle stage oocytes. Cryobiology, v. 59, n. 1, p , LUGER, K.; MADER, A.W.; RICHMOND, R. K.; SARGENT, D. F.; RICHMOND, T. J. Crystal structure of the nucleosome core particle at 2.8 Å resolution. Nature, v. 389, n. 6648, p , LUNARDI, F. O.; ARAÚJO, V. R.; BERNUCI, M. P.; LUNARDI, L. O.; GONÇALVES, R. F.; CARVALHO, A. A.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R. Restoring fertility after ovarian tissue cryopreservation: a half century of research. Zygote, v. 21, n. 4, p , 2012.

166 166 LUNARDI, F. O.; ARAÚJO, V. R.; FAUSTINO, L. R.; CARVALHO, A. A.; GONÇALVES, R. F. B.; BASS, C. S.; BÁO, S. N.; NAMEB, K. P. O.; CAMPELLO, C. C.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R. Morphologic, viability and ultrastructural analysis of vitrified sheep preantral follicles enclosed in ovarian tissue. Small Ruminant Research, v. 107, n. 2-3, p , LUYET, B. J.; GEHENIO, P. M (Eds.), Life and death at low temperatures, 341p. Normandy: Biodynamica, LUZ, H. K. M.; SANTOS, R. R.; WANDERLEY, L. S.; FAUSTINO, L. R.; SILVA, C. M. G.; CARVALHO, A. A.; CAMPELLO, C. C.; SANTOS, F. W.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R. Catalase prevents lipid peroxidation and enhances survival of caprine preantral follicles cryopreserved in a 1,2-propanediol-freezing medium. Biopreservation and Biobanking, v. 10, n. 4, p , MAGLI, M. C.; LAPPI, M.; FERRARETTI, A.; CAPOTI, A.; RUBERTI, A.; GIANAROLI, L. Impact of oocyte cryopreservation on embryo development. Fertility and Sterility, v. 93, n. 2, p , MAGOFFIN, D.; KUMAR, A.; YILDIZ, B. AZZIZ, R. Endocrinology of the ovary. In: MELMED, S.; CONN, P. M. Endocrinology: basic and clinical principle, 2 ed., 450p Totowa: Humana Press, 2005, p MALTARIS, T.; BECKMANN, M. W.; DITTRICH, R. Fertility preservation for young female cancer patients. In Vivo, v. 23, n. 1, p , MARTINÉZ-BURGOS, M.; HERRERO, L.; MAGÍAS, D.; SALVANES, R.; MANTOYA, M. C.; COBO, A. C.; GARCIA-VELASCO, J. Vitrification versus slow freezing of oocytes: effects on morphologic appearance, meiotic spindle configuration, and DNA damage. Fertility and Sterility, v. 95, n. 1, p , MARTINEZ-MADRID, B.; CAMBONI, A.; DOLMANS, M. M.; NOTTOLA, S.; VAN LANGENDONCKT, A.; DONNEZ, J. Apoptosis and ultrastructural assessment after cryopreservation of whole human ovaries with their vascular pedicle. Fertility and Sterility, v. 87, n. 5, p , MASSIP, A.; MERMILLOD, P.; DINNYES, A. Morphology and biochemistry of in vitro produced bovine embryos: implications for their cryopreservation. Human Reproduction, v. 10, n. 11, p , MATSON, P. L.; GRAEFLING, J.; JUNK, S. M.; YOVICH, J. L.; EDIRISINGHE, W. R. Cryopreservation of oocytes and embryos: use of a mouse model to investigate effects upon zona hardness and formulate treatment strategies in an in vitro fertilization programme. Human Reproduction, v. 12, n. 7, p , 1997.

167 167 MAYERSON, P. L.; BRUMBAUGH, J. A. Lavender, chick melanocyte mutant with defective melanosome translocation: a possible role for 10 nm filaments and microfilaments but not microtubules. Journal of Cell Science, v. 5, p , MAZOOCHI, T. M.; SALEHNIA, M.; VALOJERDI, M. R.; MOWLA, S. J. Morphologic, ultrastructural, and biochemical identification of apoptosis in vitrifiedwarmed mouse ovarian tissue. Fertility and Sterility, v. 90, Suppl 4, p , MAZOOCHI, T.; SALEHNIA, M.; POURBEIRANVAND, S.; FOROUZANDEH, M.; MOWLA, S. J.; HAJIZADEH, E. Analysis of apoptosis and expression of genes related to apoptosis in cultures of follicles derived from vitrified and non-vitrified ovaries. Human Reproduction, v. 15, n. 3, p , MAZZILLI, F.; ROSSI, T.; SABATINI, L.; PULCINELLI, F. M.; RAPONE, S.; DONDERO, F.; GAZZANIGA, P. P. Human sperm cryopreservation and reactive oxygen species (ROS) production. Acta Europaea Fertilitatis, v. 26, n. 4, p , McGEE, E. A.; HSUEH, A. J. Initial and cyclic recruitment of ovarian follicles. Endocrine Reviews, v. 21, n. 2, p , MELO, M. A. P.; OSKAM, I. C.; CELESTINO, J. J. H.; CARVALHO, A. A.; CASTRO, S. V.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R.; SANTOS, R. R. Adding ascorbic acid to vitrification and IVC medium influences preantral follicle morphology, but not viability. Reproduction in Domestic Animals, v. 46, n. 4, p , MEN, H.; AGCA, Y.; RILEY, L.; CRISTER, J. K. Improved survival of vitrified porcine embryos after partial delipation through chemically stimulated lipolysis and inhibition of apoptosis. Theriogenology, v. 66, n. 8, p , MEN, H.; MONSON, R. L.; PARRISH, J. J.; RUTLEDGE, J. J. Degeneration of cryopreserved bovine oocytes via apoptosis during subsequent culture. Cryobiology, v. 47, n. 1, p , MEN, H.; MONSON, R. L.; RUTLEDGE. Effect of meiotic stages and maturation protocols on bovine oocyte s resistance to cryopreservation. Theriogenology, v. 57, n. 3, p , MÉNÉZO, Y.; DALE, B.; COHEN, M. DNA damage and repair in human oocytes and embryos: a review. Zygote, v. 18, n. 4, p , MERDASSI, G.; MAZOYER, C.; GUERIN, J. F.; SAAD, A.; SALLE, B.; LORNAGE, J. Examination of viability and quality of ovarian tissue after cryopreservation using simple laboratory methods in ewe. Reproductive Biology and Endocrinology, v. 9, n. 78, p. 1-7, 2011.

168 168 MOHR, L. R.; TROUNSON, A. O. Structural changes associated with freezing of bovine embryos. Biology of Reproduction, v. 25, n. 5, p , MONIRUZZAMAN, M.; BAO, R. M.; TAKETSURU, H.; MIYANO, T. Development of vitrified porcine primordial follicles in xenografts. Theriogenology, v. 72, n. 2, p , MOTHES, W.; HEINRICH, S. U.; GRAF, R.; NILSSON, I.; VON HEIJNE, G.; BRUNNER, J.; RAPOPORT, T. A. Molecular mechanism of membrane protein integration into the endoplasmic reticulum. Cell, v. 89, n. 4, p , MUKAIDA, T.; OKA, C. Vitrification of oocytes, embryos and blastocysts. Best Practice & Research. Clinical Obstetricts & Gynaecology, v. 26, n. 6, p , NAGASE, H.; FUKUYAMA, H.; TANAKA, M.; KAWANE, K.; NAGATA, S. Mutually regulated expression of caspase-activated DNase and its inhibitor for apoptotic DNA fragmentation. Cell Death and Differentiation, v. 10, n. 1, p , NAIR, S. J.; BRAR, A. S.; AHUJA, C. S.; SANGHA, S. P. S.; CHAUDHARY, K. C. A comparative study on lipid peroxidation, activities of antioxidant enzymes and viability of cattle and buffalo bull spermatozoa during storage at refrigeration temperature. Animal Reproduction Science, v. 96, n. 1-2, p , NOTTOLA, S. A.; CAMBONI, A.; VAN LANGENDONKT, A.; DEMYLLE, D.; MACCHIARELLI, G.; DOLMANS, M. M.; MARTINEZ-MADRID, B.; CORRER, S.; DONNEZ, J. Cryopreservation and xenotransplantation of human ovarian tissue: an ultrastructural study. Fertility and Sterility, v. 90, n. 1, p , NOTTOLA, S. A.; COTTICCHIO, G.; SCIAJNO, R.; GAMBARDELLA, A.; MAIONE, M.; SCARAVELLI, G.; BIANCHI, S.; MACCHIARELLI, G.; BORINI, A. Ultrastructural markers of quality in human mature oocytes vitrified using cryoleaf and cryoloop. Reproductive BioMedicine Online, v. 19, Suppl 3, p , NOTTOLA, S. A.; MACCHIARELLI, G.; COTICCHIO, G.; BIANCHI, S.; CECCONI, S.; DE SANTIS, L.; SCARAVELLI, G.; FLAMIGNI, C.; BORINI, A. Ultrastructure of human mature oocytes after slow cooling cryopreservation using different sucrose concentrations. Human Reproduction, v. 22, n. 4, p , NOWICKI, M. O.; FALINSKI, R.; KOPTYRA, M.; SLUPIANEK, A.; STOKLOSA, T.; GLOC, E.; NIEBOROWSKA-SKORSKA, M.; BLASIAK, J.; SKORSKI, T. BCR/ABL oncogenic kinase promotes unfaithful repair of the reactive oxygen species dependent DNA double-strand breaks. Blood, v. 104, n. 12, p , ODANI, M.; KOMATSU, Y.; OKA, S.; IWAHASHI, H. Screening of genes that respond to cryopreservation stress using yeast DNA microarray. Cryobiology, v. 47, n. 2, p , 2003.

169 169 OKTAY, K.; BUYUK, E. The potential of ovarian tissue transplant to preserve fertility. Expert Opinion on Biological Therapy, v. 2, n. 4, p , OKTAY, K.; NEWTON, H.; AUBARD, Y.; SALHA, O.; GOSDEN, R. G. Cryopreservation of immature human oocytes and ovarian tissue: an emerging technology? Fertility and Sterility, v. 69, n. 1, p. 1-7, OLTVAI, Z. N.; MILLIMAN, C. L.; KORSMEYER, S. J. Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell, v. 74, n. 4, p , ONIONS, V. J.; MITCHELL, M. R.; CAMPBELL, B. K.; WEBB, R. Ovarian tissue viability following whole ovine ovary cryopreservation: assessing the effects of sphingosine-1-phosphate inclusion. Human Reproduction, v. 23, n. 3, p , OSKAM, I. C.; ASADI, B. A.; SANTOS, R. R. Histologic and ultrastructural features of cryopreserved ovine ovarian tissue: deleterious effect of 1,2-propanediol applying different thawing protocols. Fertility and Sterility, v. 93, n. 8, p , OVERSTROM, E. W.; PAQUI-PLATLS, D.; TONER, M.; CRAVACHO, E. G. Cryoprotectant and thermal effect on cytoskeletal organization and IVF rate of mouse oocytes. Biology of Reproduction, v. 42, Suppl 1, p. 175, PALASZ, A. T.; MAPLETOFT, R. J. Cryopreservation of mammalian embryos and oocytes: Recent advances. Biotechnology Advances, v. 14, n. 2, p , PARK, S. E.; CHUNG, H. M.; CHA, K. Y.; HWANG, W. S.; LEE, E. S.; LIM, J. M. Cryopreservation of ICR mouse oocytes: improved post-thawed preimplantation development after vitrification using Taxol, a cytoskeleton stabilizer. Fertility and Sterility, v. 75, n. 6, p , PARK, S. E.; SON, W. Y.; LEE, S. H.; LEE, K. A.; KO, J. J.; CHA, K. Y. Chromosome and spindle configurations of human oocytes matured in vitro after cryopreservation at the germinal vesicle stage. Fertility and Sterility, v. 68, n. 5, p , PARTRIDGE, R. J.; WRATHALL, A. E.; LEESE, H. J. Glucose uptake and lactate production by single frozen-thawed bovine embryos produced in vivo or by in vitro fertilization. Journal of Reproduction and Fertility, v. 13, p PAYNTER, S. J.; COOPER, A.; FULLER, B. J.; SHAW, R. W. Cryopreservation of bovine ovarian tissue: structural normality of follicles after thawing and culture in vitro. Cryobiology, v. 38, n. 4, p , PELLINIEMI, L. J.; DYM, M.; PARANKO, J. Cytoplasmic filaments in fetal Leydig cells. Annals of the New York Academy of Sciences, v. 383, n. 1, p , 1982.

170 170 PETRINI, J. H.; MASER, R. S.; BRESSAN, D. A. The Mre11-Rad50 complex. In: HOEKSTRA, M. F. (Ed.), DNA damage and repair. 432 p. Totowa: Humana Press, 2001, p PICKERING, S. J.; JOHNSON, M. H. The influence of cooling on the organization of the meiotic spindle of the mouse oocyte. Human Reproduction, v. 2, n. 3, p , PICTON, H. M.; HARRIS, S. E.; MURUVI, W.; CHAMBERS, E. L. The in vitro growth and maturation of follicles. Reproduction, v. 136, n. 6, p , PINTO, L. C.; SANTOS, R. R.; FAUSTINO, L. R.; SILVA, C. M. G.; LUZ, V. B.; JÚNIOR, J. E. M.; SOARES, A. A. X.; CELESTINO, J. J. H.; MAFEZOLI, J.; CAMPELLO, C. C.; FIGUEIREDO, J. R.; RODRIGUES, A. P. R. Quantification of dimethyl sulfoxide perfusion in sheep ovarian tissue: a predictive parameter for follicular survival to cryopreservation. Biopreservation and Biobanking, v. 6, n. 4, p , POLGE, C.; SMITH, A. U.; PARKES, A. S. Revival of spermatozoa after vitrification and dehydration at low temperatures. Nature, v. 164, n. 4172, p. 666, POPELKOVÁ, M.; CHRENEK, P.; PIVKO, J.; MAKAREVICH, A. V.; KUBOVIČOVÁ, E.; KAČMÁRIK, J. Survival and ultrastructure of gene-microinjected rabbit embryos after vitrification. Zygote, v. 13, n. 4, p , POSILLICO, S.; KADER, A.; FALCONE, T.; AGARWAL, A. Ovarian tissue vitrification: Modalities, challenges and potentials. Current Women s Health Reviews, v. 6, n. 4, p , POTTS, M. Desiccation tolerance of prokaryotes. Microbiological Reviews, v. 58, n. 4, p , PTAK, G.; DATTENA, M.; LOI, P.; TISCHNER, M.; CAPPAI, P. Ovum pick-up in sheep: efficiency of in vitro embryo production, vitrification and birth of offspring. Theriogenology, v. 52, n. 6, p , QUINTANS, C. J.; DONALDSON, M. J.; BERTOLINO, M. V.; PASQUALINI, R. S. Birth of two babies using oocytes that were cryopreserved in a choline-based freezing medium. Human Reproduction, v. 17, n. 12, p , RAHIMI, G.; ISACHENKO, E.; ISACHENKO, V.; SAUER, H.; WARTENBERG, M.; TAWADROS, S.; HESCHELER, J.; MALLMANN, P.; NAWROTH, F. Comparison of necrosis in human ovarian tissue after conventional slow freezing or vitrification and transplantation in ovariectomized SCID mice. Reproductive Biomedicine Online, v. 9, n. 2, p , 2004.

171 171 RAHIMI, G.; ISACHENKO, E.; SAUER, H.; ISACHENKO, V.; WARTENBERG, M.; HESCHELER, J.; MALLMANN, P.; NAWROTH, F. Effect of different vitrification protocols for human ovarian tissue on reactive oxygen species and apoptosis. Reproduction, Fertility and Development, v. 15, n. 6, p , RAHIMI, G.; ISACHENKO, V.; KREIENBERG, R.; SAUER, H.; TODOROV, P.; TAWADROS, S.; MALLMANN, P.; NAWROTH, F.; ISACHENKO, E. Revascularisation in human ovarian tissue after conventional freezing or vitrification and xenotransplantation. European Journal of Obstetrics & Gynecology and Reproductive Biology, v. 149, n. 1, p , RAJKOVIC, A.; PANGAS, S. A.; MATZUK, M. M. Follicular development: Mouse, sheep and human models In: NEILL, J. D. (Ed.), Knobil and Neill s Physiology of Reproduction, 3296p. Los Angeles: Elsevier, 2006, p RAPPOLD, I.; IWABUCHI, K.; DATE, T.; CHEN, J. Tumor suppressor p53 binding protein 1 (53BP1) is involved in DNA damage-signaling pathways. The Journal of Cell Biology, v. 153, n. 3, p , REED, M. L.; LANE, M.; GARDNER, D. K.; JENSEN, N. L.; THOMPSON, J. Vitrification of human blastocysts using the cryoloop method: successful clinical application and birth of offspring. Journal of Assisted Reproduction and Genetics, v. 19, n. 6, p , RHO, G. J.; KIM, S. N.; YOO, J. G.; BALASUBRAMANIAN, S.; LEE, H. J.; CHOE, S. Y. Microtubulin configuration and mitochondrial distribution after ultra-rapid cooling of bovine oocytes. Molecular Reproduction and Development, v. 63, n. 4, p , RIENZI, L.; MARTINEZ, F.; UBALDI, F.; MINASI, M. G.; IACOBELLI, M.; TESARIK, J.; GRECO, E. Polscope analysis of meiotic spindle changes in living metaphase II human oocytes during the freezing and thawing procedures. Human Reproduction, v. 19, n. 3, p , ROGAKOU, E. P.; PILCH, D. R.; ORR, A. H.; IVANOVA, V. S.; BONNER, W. M. DNA Double-stranded Breaks Induce Histone H2AX Phosphorylation on Serine 139. The Journal of Biological Chemistry, v. 273, n. 10, p , ROJAS, C.; PALOMO, M. J.; ALBARRACÍN, J. L.; MOGAS, T. Vitrification of immature and in vitro matured pig oocytes: study of distribution of chromosomes, microtubules, and actin microfilaments. Cryobiology, v. 49, n. 3, p , RUBINSKY, B. Principles of low temperature cell preservation. Heart Failure Reviews, v. 8, n. 3, p , RUBINSKY, B. The energy equation for freezing of biological tissue. Journal of Heat Transfer, v. 111, n. 4, p , 1989.

172 172 SAKI, G.; RAHIM, F.; ZERGANI, M. J. Vitrification of small volume of normal human sperms: use of open pulled straw carrier. Journal of Medical Sciences, v. 9, n. 1, p , SALEHNIA, M.; SHEIKHI, M.; POURBEIRANVAND, S.; LUNDQVIST, M. Apoptosis of human ovarian tissue is not increased by either vitrification or rapid cooling. Reproductive Biomedicine Online, v. 25, n. 5, p , SALLE, B.; DEMIRCI, B.; FRANCK, M.; BERTHOLLET, C.; LORNAGE, J. Longterm follow-up of cryopreserved hemi-ovary autografts in ewes: pregnancies, births, and histologic assessment. Fertility and Sterility, v. 80, n. 1, p , SALLE, B.; DEMIRCI, B.; FRANCK, M.; RUDIGOZ, R. C.; GUERIN, J. F.; LORNAGE, J. Normal pregnancies and live births after autograft of frozen-thawed hemi-ovaries into ewes. Fertility and Sterility, v. 77, n. 2, p , SÁNCHEZ-SERRANO, M.; CRESPO, J.; MIRABET, V.; COBO, A. C.; ESCRIBÁ, M. J.; SIMÓN, C.; PELLICER, A. Twins born after transplantation of ovarian cortical tissue and oocyte vitrification. Fertility and Sterility, v. 93, n. 1, p. e11-e13, SANFILIPPO, S.; CANIS, M.; OUCHCHANE, L.; BOTCHORISHVILI, R.; ARTONNE, C.; JANNY, L.; BRUGNON, F. Viability assessment of fresh and frozen/thawed isolated human follicles: reliability of two methods (Trypan blue and Calcein AM/ethidium homodimer-1). Journal of Assisted Reproduction and Genetics, v. 28, n. 12, p , SANFILIPPO, S.; CANIS, M.; ROMERO, S.; SION, B.; DÉCHELOTTE, P.; POULY, J. L.; JANNY, L.; SMITZ, J.; BRUGNON, F. Quality and functionality of human ovarian tissue after cryopreservation using an original slow freezing procedure. Journal of Assisted Reproduction and Genetics, v. 30, n. 1, p , SANSINENA, M.; SANTOS, M. V.; ZARITZKY, N.; CHIRIFE, J. Comparison of heat transfer in liquid and slush nitrogen by numerical simulation of cooling rates for French straws used for sperm cryopreservation. Theriogenology, v. 77, n. 8, p , SANTOS, R. R.; AMORIM, C.; CECCONI, S.; FASSBENDER, M.; IMHOF, M.; LORNAGE, J.; PARIS, M.; SCHOENFELDT, V.; MARTINEZ-MADRID, B. Cryopreservation of ovarian tissue: An emerging technology for female germline preservation of endangered species and breeds. Animal Reproduction Science, v. 122, n. 3-4, p , SANTOS, R. R.; CELESTINO, J. J. H.; LOPES, C. A. P.; MELO, M. A. P.; RODRIGUES, A. P. R.; FIGUEIREDO, J. R. Criopreservação de folículos ovarianos pré-antrais de animais domésticos. Revista Brasileira de Reprodução Animal, v. 32, n. 1, p. 9-15, 2008.

173 173 SANTOS, R. R.; KNIJN, H. M.; VOS, P. L. A. M.; OEI, C. H. Y.; VAN LOON, T.; COLENBRANDER, B.; GADELLA, B. M.; VAN DEN HURK, R.; ROELEN, B. A. J. Complete follicular development and recovery of ovarian function of frozen-thawed, autotransplanted caprine ovarian cortex. Fertility and Sterility, v. 91, Suppl 4, p , SANTOS, R. R.; RODRIGUES, A. P. R.; COSTA, S. H. F.; SILVA, J. R. V.; MATOS, M. H. T.; LUCCI, C. M.; BÁO, S. N.; VAN DEN HURK, R.; FIGUEIREDO, J. R. Histological and ultrastructural analysis of cryopreserved sheep preantral follicles. Animal Reproduction Science, v. 91, n. 3-4, p , SANTOS, R. R.; THARASANIT, T.; VAN HAEFTEN, T.; FIGUEIREDO, J. R.; SILVA, J. R. V.; VAN DEN HURK, R. Vitrification of goat preantral follicles enclosed in ovarian tissue by using conventional and solid-surface vitrification methods. Cell and Tissue Research, v. 327, n. 1, p , SAUMANDE, J. La folliculogenèse chez les ruminants. Recueil de Médicine Véterinarie, v. 167, n. 34, p , SAUNDERS, K. M.; PARKS, J. E. Effects of cryopreservation procedures on the cytology and fertilization rate of in vitro-matured bovine oocytes. Biology of Reproduction, v. 61, n. 1, p , SCHMITTGEN, T. D.; LIVAK, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols, v. 3, n. 6, p , SCHULTZ, L. B.; CHEHAB, N. H.; MALIKZAY, A.; HALAZONETIS, T. D. p53 Binding Protein 1 (53BP1) is an early participant in the cellular response to DNA double-strand breaks. The Journal of Cell Biology, v. 151, n. 7, p , SHACKELFORD, R. E.; INNES, C. L.; SIEBER, S. O.; HEINLOTH, A. N.; LEADON, S. A.; PAULES, R. S. The Ataxia telangiectasia gene product is required for oxidative stress-induced G1 and G2 checkpoint function in human fibroblasts. The Journal of Biological Chemistry, v. 276, n. 24, p , SHAW, J. M.; ORANRATNACHAI, A.; TROUNSON, A. O. Fundamental cryobiology of mammalian oocytes and ovarian tissue. Theriogenology, v. 53, n. 1, p , SHEIKHI, M.; HULTENBY, K.; NIKLASSON, B.; LUNDQVIST. M.; HOVATTA, O. Clinical grade vitrification of human ovarian tissue: an ultrastructural analysis of follicles and stroma in vitrified tissue. Human Reproduction, v. 26, n. 3, p , SHORTER, J.; WARREN, G. Golgi architecture and inheritance. Annual Review of Cell and Developmental Biology, v. 18, p , 2002.

174 174 SICHERLE, C. C.; MAIA, M. S.; BICUDO, S. D.; RODELLO, L.; AZEVEDO, H. C. Lipid peroxidation and generation of hydrogen peroxide in frozen-thawed ram semen supplemented with catalase or Trolox. Small Ruminant Research, v. 95, n 2-3, p , SILVA, A. R.; SOUZA, A. L. P.; SANTOS, E. A. A.; LIMA, G. L.; PEIXOTO, G. C. X.; SOUZA,. C.; CASTELO, T. S. Formação de bancos de germoplasma e sua contribuição para a conservação de espécies silvestres no Brasil. Ciência Animal, v. 22, n. 1, p , 2012a. SILVA, J. R. V.; BÁO, S. N.; LUCCI, C. M.; CARVALHO, F. C. A.; ANDRADE, E. R.; FERREIRA, M. A. L.; FIGUEIREDO, J. R. Morphological and ultrastructural changes occurring during degeneration of goat preantral follicles preserved in vitro. Animal Reproduction Science, v. 66, n. 3-4, p , SILVA, M. A.; PEIXOTO, G. C. X.; LIMA, G. L.; BEZERRA, J. A. B.; CAMPOS, L. B.; PAIVA, A. L. C.; PAULA, V. V.; SILVA, A. R. Cryopreservation of collared peccaries (Tayassu tajacu) sêmen using a powdered coconut water (ACP-116c) based extender plus various concentrations of egg yolk and glycerol. Theriogenology, v. 78, n. 3, p , 2012b. SMERDON, M. J. Rearrangements of chromatin structure in newly repaired regions of deoxyribonucleic acid in human cells treated with sodium butyrate or hydroxyurea. Biochemistry, v. 22, n. 14, p , SOMFAI, T.; OZAWA, M.; NOGUCHI, J.; KANEKO, H.; KARJA, N. W. K.; FARHUDIN, M.; DINNYÉS, A.; NAGAI, T.; KIKUCHI, K. Developmental competence of in vitro-fertilized porcine oocytes after in vitro maturation and solid surface vitrification: Effect of cryopreservation on oocyte antioxidative system and cell cycle stage. Cryobiology, v. 55, n. 2, p , SRIVASTAVA, M.; SIMAKOV, O.; CHAPMAN, J.; FAHEY, B.; GAUTHIER, M. E. A.; MITROS, T.; RICHARDS, G. S.; CONACO, C.; DACRE, M.; HELLSTEN, U.; LARROUX, C.; PUTNAM, N. H.; STANKE, M.; ADAMSKA, M.; DARLING, A.; DEGNAN, S. M.; OAKLEY, T. H.; PLACHETZKI, D. C.; ZHAI, Y.; ADAMSKI, M.; CALCINO, A.; CUMMINS, S. F.; GOODSTEIN, D. M.; HARRIS, C.; JACKSON, D. J.; LEYS, S. P.; SHU, S.; WOODCROFT, B. J.; VERVOORT, M.; KOSIK, K. S.; MANNING, G.; DEGNAN, B. M.; ROKHSAR, D. S. The Amphimedon queenslandica genome and the evolution of animal complexity. Nature, v. 466, n. 7307, p , STEPONKUS, P. L. Role of the plasma membrane in freezing injury and cold acclimation. Annual Review of Plant Physiology, v. 35, n. 1, p , STEPONKUS, P. L.; LYNCH, D. V. Freeze/thaw-induced destabilization of the plasma membrane and the effects os cold acclimation. Journal of Bioenergetics and Biomembranes, v. 21, n, 1, p, 21-41, 1989.

175 175 STOREY, K. B. Strategies for exploration of freeze responsive gene expression: advantages in vertebrate freeze tolerance. Cryobiology, v. 48, n. 2, p , STRASSER, A.; O CONNOR, L.; DIXIT, V. M. Apoptosis signaling. Annual Review of Biochemistry, v. 69, p , SUCCU, S.; LEONI, G. G.; BEBBERE, D.; BERLINGUER, F.; MOSSA, F.; BOGLIOLO, L.; MADEDDU, M.; LEDDA, S.; NAITANA, S. Vitrification devices affect structural and molecular status of in vitro matured ovine oocytes. Molecular Reproduction and Development, v. 74, n. 10, p , SUGIMOTO, M.; MAEDA, S.; MANABE, N.; MIYAMOTO, H. Development of infantile rat ovaries autotransplanted after cryopreservation by vitrification. Theriogenology, v. 53, n. 5, p , TAKAHASHI, E.; MIYOSHI, I.; NAGASU, T. Rescue of a transgenic mouse line by transplantation of a frozen-thawed ovary obtained postmortem. Contemporary Topics in Laboratory Animal Science, v. 40, n. 4, p , TATONE, C.; DI EMIDIO, G.; VENTO, M.; CIRIMINNA, R.; ARTINI, P. G. Cryopreservation and oxidative stress in reproductive cells. Gynecological Endocrinology, v. 26, n. 8, , TAUCHI, H.; KOBAYASHI, J.; MORISHIMA, K.; MATSUURA, S.; NAKAMURA, A.; SHIRAISHI, T.; ITO, E.; MASNADA, D.; DELIA, D.; KOMATSU, K. The forkhead-associated domain of NBS1 is essential for nuclear foci formation after irradiation but not essential for hrad50 hmre11 NBS1 complex DNA repair activity. The Journal of Biological Chemistry, v. 276, n. 1, p TESTART, J.; LASSALLE, B.; BELAISCH-ALLART, J.; HAZOUT, A.; FORMAN, R.; RAINHORN, J. D.; FRYDMAN, R. High pregnancy rate after early human embryo freezing. Fertility and Sterility, v. 46, n. 2, p , THARASANIT, T.; COLENBRANDER, B.; STOUT, T. A. E. Effect of maturation stage at cryopreservation on post-thaw cytoskeleton quality and fertilizability of equine oocytes. Molecular Reproduction and Development, v. 73, n. 5, p , THIBODEAU, G. A.; PATTON K. T. Células e Tecidos. In: THIBODEAU, G. A.; PATTON K. T, Estrutura e Funções do Corpo Humano, 11 ed., 630p. Barueri: Manole, 2006, p TILLY, J. L. Apoptosis and ovarian function. Reviews of Reproduction, v. 1, n. 3, p , TRAUB, P.; PERIDES, G.; KUHN, S.; SCHERBERTH, A. Efficient interaction of nonpolar lipids with intermediate filaments of the vimentin type. European Journal of Cell Biology, v. 43, n. 1, p , 1987.

176 176 TRITARELLI, A.; ORICCHIO, E.; CICIARELLO, M.; MANGIACASALE, R.; PALENA, A.; LAVIA, P.; SODDU, S.; CUNDARI, E. p53 Localization at centrosomes during mitosis and postmitotic checkpoint are ATM-dependent and require serine 15 phosphorylation. Molecular Biology of the Cell, v. 15, n. 8, p , TSANG, W. H.; CHOW, K. L. Mouse embryo cryopreservation utilizing a novel highcapacity vitrification spatula. Biotechniques, v.46, n. 7, p , UEMURA, M.; STEPONKUS, P. L. A contrast of the plasma membrane lipid composition of oat and rye leaves in relation to freezing tolerance. Plant Physiology, v. 104, n. 2, p , UZIEL, T.; LERENTHAL, Y.; MOYAL, L.; ANDEGEKO, Y.; MITTELMAN, L.; SHILOH, Y. Requirement of the MRN complex for ATM activation by DNA damage. The EMBO Journal, v. 22, n. 20, p , VAJTA, G.; HOLM, P.; KUWAYAMA, M.; BOOTH, P. J.; JACOBSEN, H.; GREVE T.; CALLESEN, H. Open pulled straw (OPS) vitrification: A new way to reduce cryoinjuries of bovine ova and embryos. Molecular Reproduction and Development, v. 51, n. 1, p , VAJTA, G.; HYTTEL, P.; CALLESEN, H. Morphological changes of in-vitroproduced bovine blastocysts after vitrification, in-straw direct rehydration, and culture. Molecular Reproduction and Development, v. 48, n. 1, p. 9-17, VAN BLERKOM, J. Microtubule mediation of cytoplasmic and nuclear maturation during the early stages of resumed meiosis in cultured mouse oocyte. Proceedings of the National Academy of Sciences of the United States of America, v. 88, n. 11, p , VAN DER ELST, J.; NERINCKX, S.; VAN STEIRTEGHEM, A. Association of ultrarapid freezing of mouse oocytes with increased polyploid at the pronucleate stage, reduced cell numbers in blastocysts, and impaired fetal development. Journal of Reproduction and Fertility, v. 99, n. 1, p , VARGHESE, A. C.; DU PLESSIS, S. S.; FALCONE, T.; AGARWAL, A. Cryopreservation/ transplantation of ovarian tissue and in vitro maturation of follicles and oocytes: Challenges for fertility preservation. Reproductive Biology and Endocrinology, v. 6, n. 47, p. 1-10, VEAL, E. A.; DAY, A. M.; MORGAN, B. A. Hydrogen peroxide sensing and signaling. Molecular Cell, v. 26, n. 1, p. 1-14, VINCENT, C.; GARNIER, V.; HEYMAN, H.; RENARD, J. P. Solvent effects on cytoskeletal organization and in-vivo survival after freezing of rabbit oocytes. Journal of Reproduction and Fertility, v. 87, n. 2, p , 1989.

177 177 VINCENT, C.; JOHNSON, M. H. Cooling, cryoprotectants, and the cytoskeleton of the mammalian oocytes. Oxford Reviews of Reproductive Biology, v. 14, p , VINCENT, C.; PICKERING, S. J.; JOHNSON, M. H. The hardening effect of dimethylsulfoxide on the mouse zona pellucida requires the presence of an oocyte and is associated with a reduction in the number of cortical granules present. Journal of Reproduction and Fertility, v. 89, n. 1, p , VINCENT, C.; PICKERING, S. J.; JOHNSON, M. H.; QUICK, S. J. Dimethylsulphoxide affects the organization of microfilaments in the mouse oocyte. Molecular Reproduction and Development, v. 26, n. 3, p , VOGELSTEIN, B.; LANE, D.; LEVINE, A. J. Surfing the p53 network. Nature, v. 408, n. 6810, p , WALLIN, A.; GHAHREMANI, M.; DAHM-KÄHLER, P.; BRÄNNSTRÖM, M. Viability and function of the cryopreserved whole ovary: in vitro studies in the sheep. Human Reproduction, v. 24, n. 7, p , WANDERLEY, L. S.; LUZ, H. K. M.; FAUSTINO, L. R.; LIMA, I. M. T.; LOPES, C. A. P.; SILVA, A. R.; BÁO, S. N.; CAMPELLO, C. C.; RODRIGUES, A. P. R.; FIGUEIREDO, J. R. Ultrastructural features of agouti (Dasyprocta aguti) preantral follicles cryopreserved using dimethyl sulfoxide, ethylene glycol and propanediol. Theriogenology, v. 77, n. 2, p , WANG, A. W.; ZHANG, H.; IKEMOTO, I.; ANDERSON, D. J.; LOUGHLIN, K. R. Reactive oxygen species generation by seminal cells during cryopreservation. Urology, v. 49, n. 6, p , WANG, X.; CATT, S.; PANGESTU, M. TEMPLE-SMITH, P. Successful in vitro culture of pre-antral follicles derived from vitrified murine ovarian tissue: oocyte maturation, fertilization, and live births. Reproduction, v. 141, n. 2, p , WANG, X.; FALCONE, T.; ATTARAN, M.; GOLDBERG, J. M.; AGARWAL, A.; SHARMA, R. K. Vitamin C and Vitamin E supplementation reduce oxidative stress induced embryo toxicity and improve the blastocyst development rate. Fertility and Sterility, v. 78, n. 6, p , WANG, Y.; XIAO, Z.; LI, L.; FAN, W.; LI, S. W. Novel needle immersed vitrification: a practical and convenient method with potential advantages in mouse and human ovarian tissue cryopreservation. Human Reproduction, v. 23, n. 10, p , WARD, I. M.; MINN, K.; JORDA, K. G.; CHEN, J. accumulation of checkpoint protein 53BP1 at DNA breaks involves its binding to phosphorylated histone H2AX. The Journal of Biological Chemistry, v. 278, n. 22, p , 2003.

178 178 WHITAKER, M. Calcium at fertilization and in early development. Physiological Reviews, v. 86, n. 1, p , WHITELEY, G. S. W.; FULLER, B. J.; HOBBS, K. E. F. Deterioration of cold-stored tissue specimens due to lipid peroxidation: modulation by antioxidants at high subzero temperatures. Cryobiology, v. 29, n. 6, p , WOODCOCK, C. L.; DIMITROV, S. Higher-order structure of chromatin and chromosomes. Current Opinion in Genetics & Development. v. 11, n. 2, p , WU, B.; TONG, J.; LEIBO, S. P. Effects of cooling germinal vesicle-stage bovine oocytes on meiotic spindle formation following in vitro fertilization. Molecular Reproduction and Development, v. 54, n. 4, p , WU, C.; RUI, R.; DAI, J.; ZHANG, C.; JU, S.; XIE, B.; LU, X.; ZHENG, X. Effects of cryopreservation on the developmental competence, ultrastructure and cytoskeletal structure of porcine oocytes. Molecular Reproduction and Development, v. 73, n. 11, p , XIAO, Z.; WANG, Y.; LI, L.; LUO, S.; LI, S. W. Needle immersed vitrification can lower the concentration of cryoprotectant in human ovarian tissue cryopreservation. Fertility and Sterility, v. 94, n. 6, p , YAN, G.; CHEN J.; HUA Z. Roles of H 2 O 2 and OH radical in bactericidal action of immobilized TiO 2 thin-film reactor: An ESR study. Journal of Photochemistry and Photobiology A: Chemistry, v. 207, n. 2-3, p , YANG, H. W.; HWANG, K. J.; KWON, H. C.; KIM, H. S.; CHOI, K. W.; OH, K. S. Detection of reactive oxygen species (ROS) and apoptosis in human fragmented embryos. Human Reproduction, v. 13, n. 4, p , YOON, T. K.; CHUNG, H. M.; LIM, J. M.; HAN, S. Y.; KO, J. J.; CHA, K. Y. Pregnancy and delivery of healthy infants developed from vitrified oocytes in a stimulated in vitro fertilization-embryo transfer program. Fertility and Sterility, v. 74, n. 1, p , ZAIDI, S.; CHOI, M.; WAKIMOTO, H.; MA, L.; JIANG, J.; OVERTON, J. D.; ROMANO-ADESMAN, A.; BJORNSON, R. D.; BREITBART, R. E.; BROWN, K. K.; CARRIERO, N. J.; CHEUNG, Y. H.; DEANFIELD, J.; DE PALMA, S.; FAKHRO, K. A.; GLESSNER, J.; HAKONARSON, H.; ITALIA, M. J.; KALTMAN, J. R.; KASKI, J.; KIM, R.; KLINE, J. K.; LEE, T.; LEIPZIG, J.; LOPEZ, A.; MANE, S. M.; MITCHELL, L. E.; NEWBURGER, J. W.; PARFENOV, M.; PE ER, I.; PORTER, G.; ROBERTS, A. E.; SACHIDANANDAM, R.; SANDERS, S. J.; SEIDEN, H. S.; STATE, M. W.; SUBRAMANIAN, S.; TIKHONOVA, I. R.; WANG, W.; WARBURTON, D.; WHITE, P. S.; WILLIAMS, I. A.; ZHAO, H.; SEIDMAN, J. G.; BRUECKNER, M.; CHUNG, W. K.; GELB, B. D.; GOLDMUNTZ, E.; SEIDMAN, C.

179 179 E.; LIFTON, R. P. De novo mutations in histone-modifying genes in congenital heart disease, Nature, v. 498, n. 7453, p , ZERON, Y.; OCHERETNY, A.; KEDAR, O.; BOROCHOV, A.; SKLAN, D.; ARAV, A. Seasonal changes in bovine fertility: relation to developmental competence of oocytes, membrane properties and fatty acid composition of follicles. Reproduction, v. 121, n. 3, p , ZERON, Y.; SKLAN, D.; ARAV, A. Effect of polyunsaturated fatty acid supplementation on biophysical parameters and chilling sensitivity of ewe oocytes. Molecular Reproduction and Development, v. 61, n. 2, p , ZERON, Y.; TOMCZAK, M.; CROWE, J.; ARAV, A. The effect of liposomes on thermotropic membrane phase transitions of bovine spermatozoa and oocytes: implications for reducing chilling sensitivity. Cryobiology, v. 45, n. 2, p , ZHANG, J. M.; LI, L. X.; YANG, Y. X.; LIU, X. L; WAN, X. P. Is caspase inhibition a valid therapeutic strategy in cryopreservation of ovarian tissue? Journal of Assisted Reproduction Genetics, v. 26, n. 7, p , ZHANG, J. M.; WANG, H. C.; WANG, H. X.; RUAN, L. H.; ZHANG, Y. M.; LI, J. T.; TIAN, S.; ZHANG, Y. C. Oxidative stress and activities of caspase-8, -9, and -3 are involved in cryopreservation induced apoptosis in granulosa cells. European Journal of Obstetrics & Gynecology and Reproductive Biology, v. 166, n. 1, p , ZHOU, B. B.; ELLEDGE, S. J. The DNA damage response: putting checkpoints in perspective. Nature, v. 408, n. 6811, p , ZHOU, X. H.; WU, Y. J.; SHI, J.; XIA, Y. X.; ZHENG, S. S. Cryopreservation of human ovarian tissue: Comparison of novel direct cover vitrification and conventional vitrification. Cryobiology, v. 60, n. 2, p , ZHOU, X. H.; WU, Y. J.; SHI, J.; XIA, Y. X.; ZHENG, S. S. Cryopreservation of human ovarian tissue: Comparison of novel direct cover vitrification and conventional vitrification. Cryobiology, v. 60, n. 2, p , ZUCKERMAN, S. The number of oocytes in the mature ovary. Recent Progress in Hormone Research, v. 6, p , ZWEIDLER, A. Complexity and variability of the histone complement. Life Sciences. Research Report, v. 4, p , 1976.

180 14. ANEXOS 180

181 14.1. DEPÓSITO DE PATENTE 181

182 182

183 183

184 184

185 14.2. CONSULTA À BASE DE DADOS DO INPI 185

186 14.3. APROVAÇÃO DO COMITÊ DE ÉTICA 186

187 14.4. PUBLICAÇÕES DE RESULTADOS PARCIAIS 187

188 188

189 189

190 190

191 191