UNIVERSIDADE ESTADUAL DO CEARÁ PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS VETERINÁRIAS

Transcrição

1 0 UNIVERSIDADE ESTADUAL DO CEARÁ PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS VETERINÁRIAS NATHALIE JIATSA DONFACK AUTO E XENOTRANSPLANTE PARA RESTAURAÇÃO DA FUNÇÃO OVARIANA APÓS VITRIFICAÇÃO DE TECIDO OVARIANO CAPRINO FORTALEZA-CEARÁ 2017

2 1 NATHALIE JIATSA DONFACK AUTO E XENOTRANSPLANTE PARA RESTAURAÇÃO DA FUNÇÃO OVARIANA APÓS VITRIFICAÇÃO DE TECIDO OVARIANO CAPRINO Tese apresentada ao Curso de Doutorado em Ciências Veterinárias do Programa de Pós- Graduação em Ciências Veterinárias da Faculdade de Veterinária da Universidade Estadual do Ceará, como requisito parcial para a obtenção do título de Doutor em Ciências Veterinárias. Área de Concentração: Reprodução e Sanidade Animal. Linha de Pesquisa: Reprodução e Sanidade de Pequenos Ruminantes. Orientador: Profa. Dra. Ana Paula Ribeiro Rodrigues FORTALEZA-CEARÁ 2017

3 2 Dados Internacionais de Catalogação na Publicação Universidade Estadual do Ceará Sistema de Bibliotecas Jiatsa Donfack, Nathalie. Auto e xenotransplante para restauração da função ovariana após vitrificação de tecido ovariano caprino [recurso eletrônico] / Nathalie Jiatsa Donfack CD-ROM: il.; 4 ¾ pol. CD-ROM contendo o arquivo no formato PDF do trabalho acadêmico com 183 folhas, acondicionado em caixa de DVD Slim (19 x 14 cm x 7 mm). Tese (doutorado) - Universidade Estadual do Ceará, Faculdade de Veterinária, Programa de Pós- Graduação em Ciências Veterinárias, Fortaleza, Área de concentração: Reprodução e Sanidade Animal. Orientação: Prof.ª Dra. Ana Paula Ribeiro Rodrigues. Coorientação: Prof.ª Dra. Kele Amaral Alves. 1. Vitrificação. 2. Transplante. 3. Cultivo in vitro. 4. Folículos pré-antrais. 5. Cabra. I. Título.

4 3 NATHALIE JIATSA DONFACK AUTO E XENOTRANSPLANTE PARA RESTAURAÇÃO DA FUNÇÃO OVARIANA APÓS VITRIFICAÇÃO DE TECIDO OVARIANO CAPRINO Tese apresentada ao Curso de Doutorado em Ciências Veterinárias do Programa de Pós- Graduação em Ciências Veterinárias da Faculdade de Veterinária da Universidade Estadual do Ceará, como requisito parcial para a obtenção do título de Doutor em Ciências Veterinárias. Área de Concentração: Reprodução e Sanidade Animal. Aprovada em: 18/12/2017 BANCA EAMINADORA

5 4 Dedico, À memória do meu Pai e à minha vitoriosa mãe, Este é o fruto das suas dores diárias na chuva e no sol, que este trabalho seja para vocês um verdadeiro motivo de orgulho e encorajamento. Ao meu esposo Ludovic Kenfack Doungue, pelo seu apoio incondicional Aos meus irmãos amados, Freddy, Valery, Judith, Christian, Loic, Pelo apoio, confiança e amor; sem eles a realização deste trabalho seria impossível.

6 5 AGRADECIMENTOS Agradeço a Deus por ser a luz que me guia estando presente em cada segundo da minha vida me dando força, proteção e coragem para continuar a caminhada. À Universidade Estadual do Ceará (UECE) e ao Programa de Pós-graduação em Ciências Veterinárias (PPGCV) pela oportunidade e contribuição que tiveram para a minha formação profissional. À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) pelo incentivo concedido na forma de bolsas de estudo no Brasil. Ao Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) pelo auxílio financeiro dessa pesquisa. Ao Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA) da UECE, por toda aprendizagem durante esse período, bem como pelo suporte para execução da presente tese. Aos profissionais da Universidade de Fortaleza (UNIFOR) pela realização deste trabalho À minha orientadora Profa. Dra. Ana Paula Ribeiro Rodrigues, muito obrigada pela oportunidade recebida e confiança na execução deste trabalho, por ter sido uma profissional sempre dedicada, ética e presente em todos os momentos. Ao professor Prof. Dr. José Ricardo de Figueiredo, por ter me aceito no LAMOFOPA, pelo apoio e por toda a sabedoria que a mim, foi transmitida. Aos Doutores Kele Alves e Benner Alves, pela ajuda e contribuição neste trabalho, por terem se mostrado sempre disponíveis a me ajudar. Agradecimento especial às Doutoras Jamily Bruno e Rebeca Rocha, que passaram de co-orientadores a amigas, duas profissionais que contribuíram efetivamente para a realização desta tese. Obrigada pela troca de conhecimentos, pelo carinho e principalmente, por toda a experiência e companheirismo. À doutora Laritza Lima e Denise Guerreiro por todo o conhecimento teórico e prático sobre imunohistoquímica, etapa essencial no desenvolvimento desse trabalho. Aos meus grandes amigos, Gildas Mbemya, Luciana Mascena, Naiza Arcângela, Andréa Moreira, Érica Leal, Franscisco Léo Nascimento, Luis Alberto Vieira, Marcela Paz, Danielle Calado e Rita Kele, presentes que a vida e o LAMOFOPA me deram. Obrigada por terem me amparado nos momentos mais difíceis e por terem compartilhado momentos de grande alegria.

7 6 Ao Doutor Carlos Lobo e à Anna Clara Accioly por todo o conhecimento teórico e prático sobre à técnica de PCR, outra etapa essencial no desenvolvimento dessa tese e também pelo carinho. Aos colegas que fazem e que fizeram parte do LAMOFOPA por terem me recebido com muita atenção, obrigada pelo carinho e convivência durante todo esse período de realização do doutorado: Luana Gaudênncio, Jesus Cadenas, Valedevane Araújo, Olga Juliana Roldan, Kayse Damasceno, Francielle Lunardi, Giovanna Quintino, Geovania Canafístula, Ivila Lorrine, Renato Félix, Rosane Oliveira, Lidiane Sales, Victor Macedo, Taline Emilia, Deysi Dipaz e Hudson Correia. Ao senhor João Batista pelo carinho especial e convivência durante todo o período de realização do doutorado. Preciso agradecer ainda, às amigas queridas do pensionato Nossa Senhora de Fátima, Rita de Cássia Carvalho e Claudilene Maia Serafim, presentes que Deus me deu. Obrigada pelo carinho e pelo apoio incondicional. Aos meus pais, Simeon Desire Jiatsa e Louise Zambou, agradeço pelo amor incondicional, pela credibilidade, pelo exemplo de caráter e principalmente pelo apoio imensurável para que eu me mantivesse firme, frente às adversidades da vida. Por todo o esforço que dedicaram para que eu tivesse uma educação de qualidade e por terem me ensinado que este é o principal legado que se pode deixar aos filhos. Aos meus irmãos, Jules Freddy Jiatsa Awonfo, Valery Jiatsa Folepe, Judith Caroline Jiatsa Djiofack, Christian Foko e Guy Loic Djiatsa, cujos exemplos sempre busco seguir e por acreditarem em meu potencial; sempre me incentivando a lutar pelos meus sonhos. Pela união em todos os momentos e pela certeza de que sempre podemos contar uns com os outros. Pelo apoio emocional que sempre me deram mesmo estando longe. À minha tia, Thérèse ASIWO pelo exemplo de vida, pela presença em todos os momentos da minha vida. Meu agradecimento mais que especial dedico ao meu Esposo por ter me ensinado que a distância nada representa quando a vontade de estar perto é maior. Nos momentos mais difíceis, sempre me fazendo acreditar que chegaria ao final desta difícil, porém gratificante etapa. Obrigada Ludovic, meu amor. Enfim, agradeço a todos que contribuíram de alguma maneira para que esse trabalho fosse realizado, ou que simplesmente torceram para o meu êxito. Muito obrigada!

8 7 Na vida, somos responsáveis pelo o que somos (Jean-Paul Sartre)

9 8 RESUMO A criopreservação e o transplante de tecido ovariano (TO) têm sido uma alternativa promissora para preservar e restaurar a fertilidade de pacientes, jovens ou adultas, com câncer sob o risco de infertilidade devido aos danos causados pela quimio e/ou radioterapias. Portanto, o objetivo do presente trabalho foi avaliar a regeneração da função ovariana após auto e xenotransplante de TO caprino fresco ou vitrificado. O estudo foi realizado em três fases distintas: Fase I: Autotransplante ortotópico de tecido ovariano caprino fresco ou vitrificado; Fase II: Autotransplante heterotópico e cultivo in vitro de tecido ovariano fresco ou vitrificado e Fase III: Xenotransplante de tecido ovariano caprino fresco ou vitrificado. Nas Fases I e II, o TO foi enxertado na curvatura menor do útero e na cavidade peritoneal, por um período de 6 e 3 meses, respectivamente. Já na fase III, o TO foi enxertado na cavidade peritoneal de camundongos BALB/nude. Na Fase I, após recuperação do TO foi observado um aumento significativo da progesterona nas cabras que receberam TO fresco. Embora o percentual de folículos preantrais morfologicamente normais (FPMN) tenha sido similar entre o TO fresco (controle) e o transplante fresco, nesta condição, a densidade folicular foi significativamente inferior ao controle. Na Fase II, após três meses de transplante, três folículos antrais foram observados na superfície do TO de enxertos fresco ou vitrificado. Nessa fase, o percentual de FPMN no TO oriundo do controle, transplante fresco ou vitrificado, foi similar. Os níveis séricos de estradiol não foram alterados durante o período de transplante, por outro lado, após 7 dias de cultivo in vitro do TO vitrificado ou não, os níveis de progesterona e estradiol reduziram significativamente. As proteínas SDF-1α e Cx37 foram detectadas nos oócitos e células da granulosa de folículos presentes no TO fresco, vitrificado ou apenas cultivado, porém, no TO vitrificado e cultivado, a Cx37 foi encontrada apenas nas células da granulosa. A Cx43 foi detectada nas células da granulosa, células da teca e na zona pelúcida de folículos em todos os tratamentos. Na Fase III, o percentual de FPMN no TO vitrificado ou vitrificado e transplantado foi significativamente reduzido, comparado ao TO fresco ou transplantado. Além disso, no TO vitrificado o percentual de folículos em desenvolvimento foi significativamente superior ao observado no TO fresco, bem como no TO transplantado não vitrificado. A apoptose avaliada pela expressão de mrna para a caspase 3 foi significativamente reduzida no TO transplantado após vitrificação ou

10 9 não, comparado ao TO apenas vitrificado. Em conclusão, em caprinos a função ovariana, bem como os folículos pré-antrais podem se desenvolver até o estágio de folículos antrais após o transplante de TO fresco ou vitrificado. No entanto, muitos esforços ainda precisam ser realizados visando o sucesso completo da técnica de manipulação (transplante ou cultivo in vitro) de folículos pré-antrais após criopreservação. Palavras-chave: Vitrificação. Transplante. Cultivo in vitro. Folículos pré-antrais. Cabra.

11 10 ABSTRACT Cryopreservation and transplantation of ovarian tissue (OT) have been a promising alternative to preserve and restore the fertility of young and adult patients with cancer under the risk of infertility due to the damage caused by chemo and/or radiotherapies. Therefore, the objective of this study was to evaluate the regeneration of ovarian function after auto and xenotransplantation of fresh or vitrified goat OT. The study was conducted in three distinct phases: Phase I: Orthotopic autotransplantation of fresh or vitrified goat OT; Phase II: Heterotopic autotransplantation and in vitro culture of fresh or vitrified ovarian tissue and Phase III: Xenotransplantation of fresh or vitrified goat ovarian tissue. In Phases I and II, OT was grafted under the curvature minor of the uterus and peritoneal cavity, for 6 and 3 months respectively. In phase III, OT was grafted into the peritoneal cavity of BALB/nude mice. In Phase I, after recovery of OT, it was observed a significant increase of progesterone in goats who received fresh OT. Although the percentage of morphologically normal preantral follicles (MNPF) was similar between fresh OT (control) and fresh transplanted OT, in this condition follicular density was significantly lower than control. In Phase II, after three months of transplantation, three antral follicles were observed on the surface of the OT of fresh or vitrified grafts. In this phase, the percentage of MNPF in the OT from the control, fresh or vitrified transplant, was similar. Serum estradiol level was not altered during the transplantation period. On the other hand, after 7 days of in vitro culture of fresh or vitrified OT, progesterone and estradiol levels significantly reduced. SDF-1α and Cx37 proteins were detected in oocytes and granulosa cells of follicles present in fresh, vitrified or fresh cultured OT. However, in vitrified cultured OT, Cx37 was found only in granulosa cells. Cx43 was detected in granulosa cells, theca cells and the zona pellucida of follicles in all treatments. In Phase III, the percentage of MNPF in vitrified or vitrified and transplanted OT significantly reduced when compared to fresh or transplanted fresh OT. In addition, in vitrified OT, the percentage of developing follicles was significantly higher when compared to fresh OT or non-vitrified transplanted OT. Apoptosis evaluated by mrna expression of caspase 3 reduced significantly after transplantation of fresh or vitrified OT when compared to the OT only vitrified. In conclusion, in goats, the ovarian function, as well as the preantral follicles, can develop to the antral stage after transplantation of fresh or vitrified OT. However, its still need many efforts to complete the success of the technique of

12 11 manipulation (transplantation or in vitro culture) of preantral follicles after cryopreservation. Keywords: Vitrification. Transplant. In vitro culture. Preantral follicles. Goat.

13 12 LISTA DE FIGURAS Figura 1 Figura 2 REVISÃO DE LITERATURA (A) Imagem ilustrativa da organização do ovário de mamíferos representando a sequência evolutiva desde os folículos primordiais até à formação da cavidade antral e ovulação, corpos lúteos e albicans na região cortical e vasos na região medular. (B) Ilustração histológica dos folículos ovarianos em deferente estágios de desenvolvimento no córtex do ovário.... Fotomicrografias de folículos pré-antrais analisados por diferentes técnicas: (A) folículo secundário normal e (B) folículo de transição degenerado, caracterizado por retração e picnose do oócito, revelados pela histologia clássica, (C) folículos secundários mostrando marcação das células da granulosa pelo PPH3, por immunohistoquímica, (D) folículo secundário mostrando imunomarcação no oócito e células da granulosa pela Cx43, usando marcadores fluorescentes. O: Oócito, N: Nucléolo, G: Granulosa Figure 1 Figure 2 CAPÍTULO 2 Proportion of normal preantral follicles (1A) and follicle density (1B) in fresh and vitrified ovary fragments before and after transplantation. 1C and 1D histological normal secondary follicles before and after grafting, respectively. a,b Differs within the experimental group. Scale bar= 50μm, Original magnification 40X Proportion of follicular development in fresh control fragments and fresh graft (2A) and Mean progesterone concentration (± SEM) produced by animals from fresh transplanted group during the experimental period of 195 days (2B). The progesterone production from control group animals was evaluated since the insertion of hormonal implant (179 days). a,b Differs within the experimental group. * Statistical difference among treatments in the same day (P < 0, 05) CAPÍTULO 3

14 13 Sepplementary Figure 1. Experimental design exhibiting the distribution of ovarian fragments in six different treatments. n Represent the total number of fragments in each treatment group Figure 1 - Figure 2 Figure 3 Figure 4 Figure 5 (a) Illustration of the caprine ovarian tissue after heterotopic transplantation (A, B,C) and normal preantral follicles histological micrographies from fresh control (d) or transplant (F), vitrified control (E) or transplant (G) ovarian tissue. (a) Immunolocalization of anti-sdf-1α and anti-cd31 in blood vessels of caprine ovarian fragments. Original magmification 40X. Scale bar= 50µm. O, Oocyte; Nu, Nucleus; GC, Granulosa cell and Zp, Zona pellucida Percentage (mean ± SEM) of morphologically normal preantral (Primordial, transition, primary and secondary) (A) and developing (B; transition, primary and secondary) follicles from fresh or vitrified ovarian tissue before and after in vitro culture or transplantation. a,b,c,d Uncommon lowercase letters indicate difference (P < 0.05). Number of animals= 11 animals; Number of ovarian fragments analyzed per animal= 10 to Mean (± SEM) follicular (A) and oocyte (B) diameter of normal preantral (primordial, transition and primary) follicles from fresh or vitrified ovarian tissue before and after in vitro culture or transplantation. a,b,c,d Uncommon lowercase letters indicate difference (P < 0.05). Number of animals = 11; Number of ovarian fragments analyzed per animal=10 to Figure representing follicular density in fresh and vitrified goat ovarian tissue before and after in vitro culture or autotransplantation. a,b,c,d Uncommon lowercase letters indicate difference (P < 0.05). Number of animals = 11. Number of ovarian fragments analyzed per animal=10 to Mean (± SEM) estradiol and progesterone serum concentrations in goats (n=11) subjected to autotransplantation. a,b,c Uncommon lowercase letters indicate differences among days for progesterone concentration (P < 0.05). Estradiol concentration between days (P >

15 14 Figure ). Number of animals = Relative expression of CD31 (A; mean ± SEM) after in vitro culture and transplant of fresh and vitrified ovarian cortex. a,b Within the same follicular class uncommon lowercase letters indicate difference (P < 0.05). Original magnification 40X. Scale bar= 50µm. Number of animals = 4. Number of ovarian fragments analyzed per animal= Figure 1 Figure 2 Figure 3 Figure 4 CAPÍTULO 4 (A) Percentage (mean ± SEM) of morphologically normal preantral (primordial, transition, primary and secondary) follicles and (B) percentage of developing (transition, primary and secondary) follicles (mean ± SEM) from non-culture control and culture of ovarian cortex for seven days. a,b,c Uncommon lowercase letters indicate significant difference (P < 0.05) Representative images of morphological normal follicles (A, Primordial; B, C and D, transitional follicles), PPH3 (E, primary; F, transitional follicles) and SDF-1α (H, antral; and I,primordial follicles) respectively. Scale bar = 50µm Mean concentration (± SEM) of (A) estradiol and (B) progesterone during in vitro culture of caprine ovarian tissue Immunolocalization of Cx37 and Cx43 (green bright fluorescent) in goat ovarian tissue in uncultured (fresh control and vitrification) ovarian fragments and ovarian fragments cultured for 7 days. Fresh control (A: Antral follicle; F: Secondary follicle); Vitrification (B and G transition follicles); In vitro culture (C and H: Antral follicles); Vitrification plus in vitro culture (D: Antral follicle; I: Transition follicle). Scale bar = 50µm Figure 1 CAPÍTULO 5 Steps of ovary xenotransplantation. (A) preparation of ovarian fragments, (B) transplantation of the donor cortical tissue to recipient mice, (C) recovery of the graft after 1 month of transplant. Histological examination of fresh, vitrified and fresh transplanted ovarian tissue showing normal primordial (D, E) and primary (F)

16 15 Figure 2 Figure 3 follicles. O: Oocyte, Nu: Nucleus, GC: Granulosa cells Picrosirius staining (red color: type I collagen and green color: type III collagen) in the goat ovarian cortex before and after xenotransplantation of fresh or vitrified goat ovarian tissue Relative mrna expression (mean ± SEM) of BAX (a), BCL2 (b), caspase 3 (c) and CD31 (d) before and after xenotransplantation of goat ovarian cortex. No significant difference was observed (P>0.05); A,B,C Uncommon uppercase letters indicate difference (P < 0.05)

17 16 LISTA DE TABELAS Table 1 Table 2 CAPÍTULO 1 Summary of some relevant results obtained after xenotransplantation of ovarian tissue in different species... Summary of some relevant results obtained after auto/allotransplantion of ovarian tissue in different species Table - Table 2 CAPÍTULO 3 Primers for quantitative PCR... Association analyses between reproductive techniques (in vitro culture, transplant and vitrification) and the presence of normal preantral follicles Table 1 Table 2 CAPÍTULO 5 List of primers sequences used to analyze the gene expression related to apoptosis and angiogenesis Percentage of morphological normal preantral follicles, follicular density and developing follicles before and after xenotransplantation

18 17 LISTA DE ABREVIATURAS E SIGLAS % Porcentagem C Graus Celsius BL2 B-cell leukemia/lymphoma protein 2 BSA Bovine Serum Albumin (Soro Albumina Bovina) CAPES Coordoneção de Aperfeicoamento Científíco e Tecnológico CD 31 Cluster of Differentiation 31 cdna Complementary Deoxyribonucleic Acid (Ácido Desoxirribonucleico Completar) CNPq Conselho Nacional de Desenvolvimento Científíco e Tecnológico CO2 Dióxido de Carbono DMSO Dimethyl Sulfoxide DNA Deoxyribonucleic Acid (Ácido Desoxirribonucléico) EG Ethylene Glycol FSH Follicle-Stimulating Hormone (Hormônio Folículo Estimulante) GDF-9 Growth Diferentiation Factor-9 (Fator de Crescimento e Diferenciação-9) HEPES 2-[4-(2-hydroxyethyl)-1-piperazine]ethanesulfonic Acid (ácido 4- (2- hidroxietil)-1-piperazina-etanosulfónico) IVF In vitro Fertilization (Fertilização in vitro) Kg Kilogramas L litro LAMOFOPA Laboratório de Manipulação de Oócitos e Folículos Pré-antrais M Molar MEM Minimum Essential Medium (Meio Essencial Mínimo) mg Miligramas Min Minuto ml Mililitro mm Millimolar mm Milímetro MOIFOPA Manipulação de Oócitos Inclusos em Folículos Ovarianos Préantrais NF-_B Nuclear Factor-kappa B (Fator Nuclear Kappa B) ng Nanogram

19 18 NK Natural Killer nmol Nanomol NOD SCID Non-obese Diabetic Severe Combined Immunodeficient OTC Ovarian Tissue Criosystem P<0.05 Probabilidade de erro menor que 5% P>0.05 Probabilidade de erro maior que 5% PAF Paraformaldehyde PAS Periodic Acid Schiff PBS Phosphate Buffered Saline (Tampão Fosfato Salina) PCR Polimerase Chain Reaction (Reação em Cadeia da Polimerase) PH Potencial Hidrogeniônico pmol Picomol POF Premature Ovarian Failure (Falência Ovariana Prematura) PPGCV Programa de Pós-Graduação em Ciências Veterinárias qpcr Quantitative Polimerase Chain Reaction (Reação em Cadeia Polimerase Quantitativa) RNA Ribonucleic Acid (Ácido Ribonucléico) RNAm Messenger Ribonucleic Acid (Ácido Ribonucléico mensageiro) RT Room temperature (temperature ambiente) RT-PCR Reverse Transcription Polymerase Chain Reaction (Transcrição Reversa - Reação em Cadeia da Polimerase) s Segundo S1P Sphingosine-1-Phosphate SCID Severe Combined Immunodeficient SDF-1 α Stroma Cell Derived-Factor 1α UECE Universidade Estadual do Ceará VEGF Vascular Endothelial Growth Factor (Fator de Crescimento Endotelial Vascular) α-mem Minimum Essential Medium Alpha (Meio Essencial Mínimo alfa) μg Microgramas

20 19 SUMÁRIO INTRODUÇÃO REVISÃO DE LITERATURA OVÁRIO MAMÍFERO E A BIOTÉCNICA DE MOIFOPA CRIOPRESERVAÇÃO DE TECIDO OVARIANO CULTIVO IN VITRO DE FOLÍCULOS PRÉ-ANTRAIS TÉCNICAS UTILIZADAS PARA AVALIAÇÃO FOLICULAR APÓS CRIOPRESERVAÇÃO DA EFICIÊNCIA, TRANSPLANTE E CULTIVO IN VITRO Histologia clássica Imunohistoquímica Expressão gênica Produção Hormonal JUSTIFICATIVA HIPÓTESES CIENTÍFICAS OBJETIVOS GERAL ESPECÍFICOS CAPÍTULO CAPÍTULO CAPÍTULO CAPÍTULO CAPÍTULO CONCLUSÕES PERSPECTIVAS REFERÊNCIAS

21 20 1 INTRODUÇÃO Nos últimos anos, as taxas de sobrevivência de pacientes jovens e adultos com câncer têm aumentado consideravelmente devido aos constantes progressos no diagnóstico precoce e tratamento das doenças neoplásicas (TULANDI & GOSDEN, 2004). Entretanto, as pacientes que necessitam de quimio e/ou radioterapia para tratamento oncológico, estão propensas a sofrer problemas reprodutivos, como por exemplo, a falência ovariana prematura (MEIROW et al., 2008). Portanto, o número de mulheres que deseja preservar a fertilidade tem aumentado, consideravelmente. Atualmente, estão disponíveis vários métodos para a preservação da fertilidade e, o mais adequado deles deve considerar os seguintes fatores: o tempo disponível da paciente antes do início tratamento do câncer; a idade da paciente; o tipo de câncer e o tratamento recomendado (DEMEESTERE et al., 2012). Dentre esses métodos disponíveis, a criopreservação do tecido ovariano seguida do transplante (CTO-TP) é uma das opções mais promissoras para a preservação da fertilidade das mulheres que sobrevivem ao câncer. Vários estudos têm relatado que a função endócrina e a fertilidade podem ser restauradas após CTO-TP (SHIKANOV et al., 2011, DONNEZ & DOLMANS 2013, 2014). De acordo com o levantamento bibliográfico mais atual, 86 nascimentos já foram relatados em humanos usando a associação dessas duas técnicas (JENSEN et al., 2016). O transplante pode ser classificado de acordo com o receptor do enxerto em: alotransplante (realizado entre indivíduos de uma mesma espécie), autotransplante (realizado no mesmo indivíduo) e xenotransplante (realizado entre indivíduos de espécies diferentes). De um modo geral, o auto e o xenotransplante são mais amplamente realizados na clinica reprodutiva e na pesquisa, respectivamente. Estudos em camundongos (AUBARD et al., 1999) e em ovinos (GOSDEN et al., 1994) mostraram a restauração da função ovariana e a obtenção de nascimentos após autotransplante de ovário. O autotransplante tem o potencial benefício de restaurar a função endócrina temporária em pacientes que sobrevivem ao câncer (OKTAY et al., 2001), entretanto, para a segurança do indivíduo, este procedimento somente pode ser realizado após a constatação da ausência de células cancerosas no tecido a ser enxertado (KENNY & RODRIGUEZ-WALLBERG, 2012).

22 21 Com relação ao xenotransplante, após o enxerto de tecido ovariano de primatas pré-púberes para camundongos nude, VON CHONFELDT et al. (2011) verificaram a presença de folículos secundários após quatro semanas do transplante. Usando esse tipo de transplante também foi possível verificar o desenvolvimento de folículos pré-antrais bovino até o estágio antral (HOSSEINI et al., 2014). De acordo com esses relatos, o xenotransplante demonstrou ser um excelente modelo de estudo para as funções ovarianas e desenvolvimento de folículos in vivo (VAN EYCK et al., 2009). Além disso, o xenotransplante também é importante para a preservação de animais com infertilidade adquirida ou após a morte, ou ainda para a preservação de espécies selvagens e em risco de extinção (LOTZ et al., 2016, KIKUCHI et al., 2011). Apesar do êxito já evidentemente constatado, alguns pesquisadores alertam para a possibilidade de reintrodução de células malignas após o transplante de tecido ovariano. Para evitar esse risco, o córtex ovariano após criopreservação, pode ser submetido ao cultivo in vitro dos folículos pré-antrais inclusos (in situ) ou isolados do córtex ovariano, visando o crescimento e maturação completa dos oócitos oriundos destes folículos, objetivando a produção in vitro de embriões. Essa técnica é conhecida como manipulação de oócitos inclusos em folículos pré-antrais (MOIFOPA). Utilizando a MOIFOPA, embriões foram obtidos após cultivo in vitro de folículos secundários murinos, isolados de tecido ovariano criopreservado, culminando com gestação e nascimentos de crias viáveis (HASEGAWA et al., 2006). Em pequenos ruminantes, a criopreservação de folículos pré-antrais associada ao cultivo in vitro ainda é muito restrita e a grande maioria dos resultados limita-se a poucos trabalhos na espécie caprina (CARVALHO et al., 2014, LEAL et al., 2017) e ovina (LUNARDI et al., 2015, 2016), oriundos de nossa equipe. Na espécie humana, BIAN et al. (2013) relataram a manutenção da viabilidade e ultraestrutura folicular após criopreservação seguida de cultivo in vitro de folículos isolados. Portanto, os resultados obtidos com cultivo in vitro de folículos pré-antrais de tecido ovariano criopreservado ainda são bastante escassos, pois embora seja uma alternativa para evitar a reintrodução de células malignas, os resultados ainda são pouco expressivos. Para um melhor entendimento da presente tese, a revisão de literatura a seguir abordará alguns aspectos importantes sobre os folículos ovarianos e a biotécnica de MOIFOPA. Serão mostradas ainda a importância e os principais aspectos da criopreservação de ovário associada ao cultivo in vitro ou ao transplante visando a

23 22 preservação de animais de alto valor genético ou a restauração da fertilidade feminina. Além disso, será mostrada também a contribuição científica desta tese para a criopreservação e transplante de tecido ovariano na espécie caprina.

24 23 2 REVISÃO DE LITERATURA 2.1 OVÁRIO MAMÍFERO E A BIOTÉCNICA DE MOIFOPA O ovário é o órgão central do sistema reprodutor feminino, cuja principal função é a diferenciação e liberação de um oócito maduro para fertilização e propagação das espécies (McGEE; HSUEH, 2000). O ovário é composto, na maioria das espécies, por uma região interna ou medular, que consiste de tecido conjuntivo fibroelástico, tecido nervoso e vascular; e por uma região cortical, localizada na parte mais externa, circundada pelo epitélio germinal, o qual contém folículos ovarianos e corpos lúteos em vários estágios de desenvolvimento ou de regressão (LIU et al., 2006) (Figura 1). Figura 1 - (A) Imagem ilustrativa da organização do ovário de mamíferos representando a sequência evolutiva desde os folículos primordiais até à formação da cavidade antral e ovulação, corpos lúteos e albicans na região cortical e vasos na região medular. (B) Ilustração histológica dos folículos ovarianos em diferentes estágios de desenvolvimento no córtex do ovário. O, Oócito; N, Nucléo; G, Granulosa; A, Antrum

25 24 Fonte: (A) (B) SILVA et al., 2004 O folículo é a unidade morfológica e funcional do ovário mamífero e é formado por um oócito circundado por células somáticas (granulosa e/ou tecais). Sua função é proporcionar um ambiente ideal para o crescimento e maturação do oócito ou função exócrina, bem como produzir hormônios e peptídeos ou função endócrina (MCGEE & HSUEH, 2000; PENG et al., 2010). Os folículos ovarianos estão distribuídos no córtex ovariano em duas grandes classes de acordo com a presença da cavidade antral: 1) folículos pré-antrais ou não cavitários (primordiais, transição, primários e secundários) e 2) folículos antrais ou cavitários (terciários e pré-ovulatórios ou de De Graaf). O processo de formação, crescimento e desenvolvimento folicular é conhecido como foliculogênese, o qual tem início quando as células da pré-granulosa circundam os oócitos primários, formando os folículos primordiais (JUENGEL et al., 2002). Após a formação dos folículos primordiais, as células da pré-granulosa param de se multiplicar e entram em um período de quiescência. Durante toda a vida da fêmea, um pequeno grupo de folículos é gradualmente estimulado a crescer, constituindo a etapa de ativação folicular. Após a ativação, ocorre uma série de eventos que promovem o aumento do número de células da granulosa, formação da zona pelúcida e aumento do diâmetro oocitário levando a formação das demais categorias de folículos pré-antrais: os folículos de transição (oócito circundado por células da granulosa pavimentosas e cúbicas), primários (oócito circundado por uma camada completa de células da granulosa de morfologia cúbica) e secundários (várias camadas de células da granulosa cúbicas ao redor do oócito com a zona pelúcida claramente identificada ao redor do oócito) (SILVA et al., 2004). Uma vez ativados, os folículos são recrutados para o desenvolvimento e maturação que são necessários para o sucesso da ovulação e fertilização, ou alternativamente, são perdidos por atresia (MCGEE, HSUEH, 2000). Contudo, durante toda a vida da fêmea, apenas um pequeno grupo de folículos, aproximadamente 0,1%, chega à ovulação (NUTTINCK et al., 1993), diminuindo assim o potencial reprodutivo da fêmea. É importante destacar que do total da população de folículos presentes em um ovário, 90% é composta por folículos pré-antrais. Tendo em vista que os métodos atuais para a produção in vitro de embriões (PIV) dependem da oferta escassa de oócitos competentes provenientes de grandes folículos antrais ou pré-ovulatórios (TELFER, 1998), uma alternativa é a utilização de folículos pré-antrais. Dessa forma, a possibilidade de desenvolver sistemas de cultivo in vitro deve ser considerada, destacando-se, portanto, a biotécnica de MOIFOPA, a qual

26 25 permite a utilização de um grande número de oócitos provenientes de folículos préantrais, os quais poderão ser destinados às técnicas de maturação (MIV) e fertilização in vitro (FIV). A biotécnica de MOIFOPA envolve o isolamento ou recuperação, conservação (resfriamento e criopreservação) e/ou cultivo in vitro de folículos ovarianos pré-antrais (FIGUEIREDO et al., 2008), saudáveis, visando o crescimento e maturação oocitária. Desta forma, no futuro, será possível obter de um único ovário, centenas de folículos ovarianos pré-antrais que, cultivados e submetidos a outras biotécnicas da reprodução, como a FIV e a clonagem, viabilizarão a produção in vitro (PIV) e o aumento no número de crias saudáveis. A MOIFOPA, não somente contribui como também é considerada uma técnica de reprodução assistida (TRA). Além disso, representa uma excelente alternativa para incrementar e auxiliar o desenvolvimento de pesquisas relacionadas à indústria farmacêutica (FIGUEIREDO et al., 2008). Na reprodução humana, a MOIFOPA pode ter importante relevância clínica, uma vez que possibilita o desenvolvimento de estratégias para o restabelecimento da fertilidade de mulheres com risco de falência ovariana prematura. Utilizando a MOIFOPA, um grande estoque de folículos ovarianos pré-antrais poderá ser criopreservado antes de se tornarem atrésicos. Deste modo, a criopreservação associada ao cultivo in vitro de folículos ovarianos pré-antrais inclusos ou isolados do tecido ovariano pode representar uma excelente alternativa para reverter ou reduzir o impacto da perda folicular que ocorre naturalmente ou em decorrência de desordens reprodutivas ou mesmo devido à toxicidade dos tratamentos radio/quimioterápicos. 2.2 CRIOPRESERVAÇÃO DE TECIDO OVARIANO A criopreservação tem sido uma excelente estratégia para a conservação da função do ovário. Esse processo possibilita a preservação de oócitos presentes nos folículos ovarianos que seriam perdidos pelo processo natural de atresia, pelos tratamentos gonadotóxicos ou ainda pela morte do animal (PARIS et al., 2009). De acordo com JAIN & PAULSON (2006), por definição, a criopreservação consiste na preservação de material biológico em temperaturas criogênicas, isto é, a 196 C (nitrogênio líquido) ou ~ -150 C (vapor do nitrogênio líquido). Esta técnica pode ser realizada por dois m todos distintos: congela o lenta ou congela o convencional e

27 26 a vitrifica o. Ambas, congelação lenta e vitrificação diferem entre em si, principalmente pela velocidade de redu o da temperatura empregada congela o lenta caracterizada por uma redu o gradual da temperatura com o o jetivo de reduzir o estresse t rmico na fase de transi o das solu es do estado l quido para o estado s lido NCHE 9 e uso de aixas concentra es de agentes crioprotetores Porém, a principal desvantagem desse método é a formação de cristais de gelo intracelular, responsável por danos nos vasos (ruptura) e a expansão do gelo nos vasos sanguíneo (BAUST et al., 2009). Essas desvantagens podem ser minimizadas ou evitadas pela vitrifica o No processo de vitrifica o os fluidos passam do estado l quido diretamente para um estado s lido amorfo denominado v treo Y M KI et al Por m para que esta transi o ocorra necess ria uma alta viscosidade a qual o tida pela elevada concentra o de agentes crioprotetores e uma r pida redu o da temperatura (WOWK, 2007). Até o presente momento, o m todo de congela o lenta tem sido amplamente aplicado para preservar fol culos pr -antrais de humanos (HERRAIZ et al., 2014), murinos (WANG et al., 2009) e ruminantes (CAMPBELL et al., 2014; MAFFEI et al., 2014). Em humanos adultos, já existem vários (86) relatos de nascimentos ap s autotransplante de c rtex ovariano previamente criopreservado, utilizando a técnica de congelação lenta (DONNEZ et al., 2013). Apesar da grande maioria dos nascimentos terem resultado do transplante do córtex ovariano previamente congelado, atualmente, a vitrificação também tem sido bastante investigada em diferentes espécies (camundongo: HAMID et al., 2015; humano: KAWAMURA et al., 2013; bovino: GUEDES et al., 2017; ovino: LUNARDI et al., 2016 e caprino: CARVALHO et al., 2013), devido à capacidade de redução da formação de gelo. Em humanos, já foi relatado o nascimento de duas crianças saudáveis após o transplante de tecido ovariano previamente vitrificado (KAWAMURA et al., 2013; SUZUKI et al., 2015). De acordo com alguns estudos, a vitrificação permite uma melhor conservação das estruturas foliculares e do estroma ovariano (KEROS et al., 2009), resultando em aumento das taxas de sobrevivência folicular (AMORIM et al., 2011; HERRAIZ et al., 2014), o que pode levar a uma melhor função do tecido após o transplante. Embora, a criopreservação de embriões e oócitos contribua de forma significativa para a preservação da função reprodutiva da fêmea, a criopreservação do tecido ovariano apresenta inúmeras vantagens, como por exemplo: 1) contém toda a

28 27 reserva de folículos primordiais e oocitária; 2) preserva todo o potencial reprodutivo da fêmea; 3) pode ser realizado em qualquer idade oi fase do ciclo estral (SHAW et al., 2000) ou vida reprodutiva da fêmea; 4) é a única alternativa para mulheres que necessitam iniciar o tratamento anticâncer de forma urgente e, 5) envolve menos questões éticas e sociais do que a criopreservação de oócitos e embriões (ZHANG et al., 2009). Para a medicina veterinária, a criopreservação de tecido ovariano também tem uma grande importância, sobretudo para animais domésticos de alto valor genético que venham a óbito de forma inesperada (SHAW et al., 2000), ou até mesmo para os programas de preservação de espécies ameaçadas de extinção. É importante ressaltar que os estudos realizados com espécies animais também são utilizados como modelos translacionais para a espécie humana. Uma vez criopreservado, o tecido ovariano proveniente tanto de humanos quanto de animais, pode ser transplantado, possibilitando a retomada da fun ão end crina e função gametog nica LI et al 8. Ademais pode ainda ser destinado ao cultivo in vitro dos folículos pré-antrais (GOSDEN et al., 2002) inclusos (CARVALHO et al., 2013) ou isolados (LUNARDI et al., 2016) do córtex ovariano. Devido à grande relevância do transplante de tecido ovariano como TRA, foi elaborada uma revisão de literatura intitulada Expectations and limitations of ovarian tissue transplantation Portanto, esse tema está detalhadamente descrito no artigo de revisão apresentado no desta tese, o qual foi publicado em 2017 no Periódico Zygote (Qualis B1). Na impossibilidade de realização do transplante, tanto em mulheres como em fêmeas de animais domésticos ou não, o cultivo in vitro do próprio ovário ou dos folículos pré-antrais após a criopreservação também é uma excelente alternativa para a preservação da fertilidade. Essa técnica, conhecida também como ovário artificial ou MOIFOPA, elimina o risco de reintrodução de células cancerosas nas pacientes, o que poss vel ocorrer ap s o transplante (AMORIM et al., 2009). 2.3 CULTIVO IN VITRO DE FOLÍCULOS PRÉ-ANTRAIS O principal objetivo do cultivo in vitro de folículos pré-antrais é evitar a atresia folicular que ocorre naturalmente in vivo, permitindo o desenvolvimento folicular e assegurando o crescimento e a maturação dos oócitos (FIGUEIREDO et al., 2008)

29 28 presentes o interior desses folículos. O cultivo de folículos pré-antrais pode ser realizado de duas formas: 1) cultivo in vitro de folículos isolados e 2) cultivo in situ, ou seja, cultivo in vitro dos folículos inclusos no tecido ovariano. Grandes progressos têm sido observados no cultivo in vitro de folículos pré-antrais isolados, em diferentes espécies animais, tais como suínos (WU & TIAN, 2007), bubalinos (GUPTA et al., 2008), ovinos (ARUNAKUMARI et al., 2010) e caprinos (SARAIVA et al., 2010; MAGALHÃES et al., 2011). Todos esses estudos resultaram na PIV. Apesar do êxito já relatado, a taxa de embriões produzidos a partir de folículos pré-antrais desenvolvidos in vitro ainda é muito baixa (16% em ovino, ARUNAKAMARI et al., 2010). Por outro lado, o cultivo de folículos pré-antrais in situ, tem a vantagem de manter o contato entre as células foliculares e as do estroma ovariano, possibilitando a ação dos efeitos parácrinos e autócrinos (ABIR et al., 2006). Essa forma de cultivo é considerada de extrema importância para o estudo da ativação de folículos primordiais e do posterior crescimento de folículos primários, em várias espécies (bovinos: MCLAUGHLIN & TELFER, 2010; ovinos: LIMA et al., 2013; humanos: DING et al., 2010 e caprinos: CELESTINO et al., 2009). Um estudo prévio realizado em camundongos reportou um nascimento a partir de folículos primordiais inclusos em tecido, os quais foram crescidos, maturados e fecundados in vitro (EPPIG & O'BRIEN, 1996). Posteriormente, com o aperfeiçoamento do protocolo, o mesmo grupo relatou a produção de embriões, bem como o nascimento de vários camundongos saudáveis (O BRIEN et al., 2003). Mesmo considerando os resultados satisfatórios, seja com o cultivo de folículos pré-antrais isolados ou in situ, os resultados obtidos utilizando folículos pré-antrais previamente criopreservados ainda são extremamente limitados. Em camundongos, HASEGAWA et al. (2006) relataram o nascimento de crias saudáveis, utilizando folículos secundários cultivados in vitro oriundos de tecido ovariano criopreservado. Em animais domésticos, estudos realizados por nossa equipe em ovinos revelaram que folículos pré-antrais (secundários) isolados do tecido ovariano após vitrificação/aquecimento são capazes de crescer e formar antro (Lunardi et al., 2015) e, os oócitos oriundos desses folículos podem retomar a meiose (Lunardi et al., 2016) e até mesmo atingir o estágio de metáfase II após procedimento de maturação in vitro (Lunardi et al., 2017). Na espécie caprina, nossa equipe também já demonstrou que folículos secundários isolados do córtex ovariano previamente vitrificado são capazes

30 29 de atingir o antro após cultivo in vitro por 6 dias (Leal et al., 2017). Apesar de considerarmos promissores os dados obtidos em pequenos ruminantes até o presente momento, continuamos investigando exaustivamente, os folículos criopreservados, após transplante e cultivo in vitro com o intuito de melhorar os nossos resultados. 2.4 TÉCNICAS UTILIZADAS PARA AVALIAÇÃO FOLICULAR APÓS CRIOPRESERVAÇÃO TRANSPLANTE E CULTIVO IN VITRO Histologia clássica A utilização de técnicas para a avaliação da qualidade de folículos pré-antrais in vitro, permite o monitoramento das alterações ocorridas, sendo, portanto, de grande importância para o aperfeiçoamento da técnica de criopreservação do tecido ovariano, seguida do transplante e/ou cultivo in vitro. Nós acreditamos que a partir da análise morfológica folicular, sejamos capazes de identificar um sistema melhorado para garantir, não somente a morfologia, mas também a funcionalidade dos folículos ovarianos (Figura 2A, 2B). A histologia clássica tem sido utilizada para a análise qualitativa de folículos inclusos em tecido ovariano, com a finalidade de verificar alterações na morfologia de todas as estruturas foliculares (membrana plasmática, oócito e suas células somáticas circundantes). Além de ser capaz de identificar alterações morfológicas, a histologia clássica, também identifica o desenvolvimento folicular pela modificação do formato das células da granulosa de pavimentoso para cúbico; pelo aumento no número de células, bem como pela presença de células tecais, logo abaixo da membrana do folículo. Desta forma, é possível classificar os folículos pré-antrais quanto ao seu estádio de desenvolvimento (primordial, intermediário, primário ou secundário), e ainda quanto às suas características morfológicas, em normais ou atrésicos Imunohistoquímica A imunohistoquímica (IHQ) também é uma técnica de valiosa contribuição para a análise dos folículos ovarianos. Essa técnica é baseada na detecção de proteínas

31 30 (antígenos) em secções de tecido por meio de anticorpos específicos. Uma vez estabelecida a ligação antígeno-anticorpo, há uma reação histoquímica colorida visível por microscopia ótica ou fluorocromos com luz ultra-violeta (Figura 2C, 2D). A IHQ é de alta sensibilidade e especificidade; permite a análise de um ou vários antígenos simultaneamente (RAMOS-VARA, 2005). Através da IHQ, proteínas envolvidas nas diferentes fases de desenvolvimento do folículo, como também inúmeras proteínas envolvidas com a estrutura, atividade proliferativa, viabilidade, funcionalidade e até mesmo a morte folicular por apoptose, podem ser identificadas. Dentre as características foliculares mais frequentemente analisadas pela IHQ, destaca-se a capacidade de proliferação das células da granulosa, cuja atividade pode ser identificada através da imunomarcação pela fosfohistona-h3 (PPH3). A histona 3 (H3) é uma proteína nuclear, da cromatina do DNA com um importante papel na condensação dos cromossomos, bem como durante a progressão do ciclo celular, após a fosforilação dos resíduos de serina 10 e 28, durante a transição da fase G2 para a prófase na fase M ou mitose (KIM et al., 2017). Desta forma, na metáfase, a histona H3 está sempre fortemente fosforilada e positiva para PHH3, não sendo, ou sendo minimamente expressa durante a intérfase para PPH3. Isso indica que a marcação para a PPH3 é expressa apenas em células mitoticamente ativas sendo (Figura 2C), portanto, específica para proliferação (LEE et al., 2014). Usando a IHQ é possível também detectar marcadores de células endoteliais, como por exemplo, a al-plaquetária 1 (PECAM-1) conhecida também como cluster de diferenciação 31 (CD31), o fator de crescimento endotelial vascular (VEGF), o fator derivado do estroma (SDF-1α), dentre outros. Os marcadores de células endoteliais são moléculas ligadas à membrana ou moléculas citoplasmáticas, expressas pelas células endoteliais. Durante a vasculogênese, as células endoteliais se diferenciam dos hemangioblastos para formar novos vasos sanguíneos (RAKOCEVIC et al., 2017). Através da IHQ a distribuição das conexinas 37 (Cx37) e 43 (Cx43) as quais exercem grande influência sobre a foliculogênese (GRANOT et al., 2002) também pode ser avaliada. Essas proteínas formam canais intercelulares conhecidos como junções gap que permitem o movimento de íons, metabólitos e moléculas de sinalização de célula para célula. A Cx43 é a principal proteína de junção gap produzida pelas células da granulosa, participando das conexões entre células da granulosa, bem como com

32 31 oócitos (Figura 2 D). Já a Cx37 é expressa tanto pelo oócito quanto pelas células da granulosa adjacentes (KIDDER & MHAWI, 2002). Figura 2 - Fotomicrografias de folículos pré-antrais analisados por diferentes técnicas: (A) folículo secundário normal e (B) folículo de transição degenerado, caracterizado por retração e picnose do oócito, revelados pela histologia clássica, (C) folículos secundários mostrando marcação das células da granulosa pelo PPH3, por immunohistoquímica, (D) folículo secundário mostrando imunomarcação no oócito e células da granulosa pela Cx43, usando marcadores fluorescentes. O: Oócito, N: Nucléolo, G: Granulosa. Fonte: (A, B) SILVA et al., 2004; (C) TING et al., 2012; (D) SILVA et al., Expressão gênica A sobrevivência, o crescimento e a diferenciação celular podem também ser monitorados pela alteração dos padrões da expressão gênica utilizando-se a biologia molecular (MAZERBOURG e HSUEH, 2006). As técnicas de biologia molecular possibilitam a identificação da expressão de genes relacionados ao processo de apoptose como Bax, BCL-2 e Caspase 3. As proteínas intracelulares que regulam diretamente o processo de ativação das caspases constituem a denominada família BCL-2 (DESAGHER & MARTINOU, 2000). Os membros dessa família podem ser divididos em moléculas pró-apoptóticas (BAX) e antiapoptóticas (BCL-2). O equilibro relativo entre as diferentes proteínas, refletindo a formação de homodímeros e heterodímeros (neutralização), define a via de atuação sobre o mecanismo de morte celular programada (ZÖRNIG et al., 2001). Na presença de um sinal apoptótico, a BAX é translocada do citoplasma para as proximidades das mitocôndrias, onde sofre ativação e modificação conformacional, aderindo à membrana mitocondrial externa (FARIA et al., 2006), resultando em poros na membrana e consequente liberação do citocromo c, que em conjunto com a caspase 9, ativa a cascata de caspases efetoras da apoptose. Por outro

33 32 lado, o BCL-2 impede o escape do citocromo c, possivelmente pela formação de heterodímeros com moléculas pró-apoptóticas como a proteína BAX (AMARANTE- MENDES & GREEN, 1999) Produção Hormonal O crescimento e a diferenciação dos folículos cultivados in vitro, bem como a regeneração da função ovariana, podem ser refletidos pela secreção de esteróides. Considerando o seu pequeno tamanho, os folículos secretam relativamente grandes quantidades de esteróides, tais como o estrógeno, e progesterona (LIU et al., 2001), os quais podem ser mensurados a partir de técnicas como a quimioluminescência utilizando o meio de cultivo, no qual os folículos foram mantidos in vitro. O estradiol é requerido para a indução da expressão de receptores para o hormônio luteinizante (LH) nas células da granulosa, o que é um pré-requisito para a ovulação. Assim, a alta atividade estrogênica associada com a alta atividade da aromatase é um bom indicador da dominância fisiológica folicular, do mesmo modo que a inibição da atividade da aromatase pode resultar na atresia folicular (BERGFELT et al., 1999). A habilidade de folículos pré-antrais aumentarem os níveis de estradiol e progesterona indica o desenvolvimento folicular e a diferenciação das células da granulosa. Além disso, dependendo do estádio folicular, os níveis de esteroides podem não ser detectados, ou mesmo serem alterados (WANDJI et al., 1996).

34 33 3 JUSTIFICATIVA Conforme foi mencionado na revisão de literatura, os tratamentos utilizados contra o câncer têm resultado em altas taxas de cura e sobrevivência. Contudo, esses tratamentos são extremamente gonadotóxicos e podem alterar a função ovariana, afetando tanto a produção hormonal como o potencial reprodutivo em quase cem porcento dos casos (DONNEZ et al., 2013). As consequências mais graves são a insuficiência ovariana prematura e a infertilidade, as quais afetam a qualidade de vida das pacientes. Portanto, a restauração da função ovariana, tanto endócrina com excócrina melhoraria substancialmente a qualidade de vida das mulheres depois de terem sobrevivido ao câncer inclusive, com a restauração da própria fertilidade. Sendo o câncer considerado um problema de saúde pública, não somente no Brasil, mas no cenário mundial, essa doença requer grande atenção, sobretudo por parte dos profissionais (pesquisadores, clínicos, etc) que se dedicam ao trabalho de investigação da função reprodutiva, com o intuito de impedir que mulheres submetidas a esses tratamentos sejam privadas do dom de gerar uma criança. Devido aos grandes avanços obtidos nas últimas duas décadas, relacionados às TRAs, as funções ovariana e reprodutiva de mulheres submetidas aos tratamentos oncológicos podem ser restauradas ou regeneradas após a cura da doença, utilizando a criopreservação e transplante de tecido ovariano (QIAO & LI, 2014). Juntas, equipes da Europa e Estados Unidos, já relataram na literatura um total de 86 nascimentos após o transplante de tecido ovariano previamente criopreservado, sendo, portanto, a reversão da falência ovariana prematura uma realidade nesses países. No entanto, no Brasil, até o presente momento não existem relatos de nascimento ou mesmo de gestação utilizando essas técnicas, provavelmente pela escassez de estudos nessa área. Por outro lado, apesar desses resultados, é conhecido que a criopreservação e transplante de tecido ovariano ainda é considerada uma TRA experimental, sendo que a taxa de sucesso varia de 20-30% (SCHMID et al., 2011). É conhecido que muitos dos folículos presentes no tecido ovariano morrem devido à formação de cristais de gelo, fenômeno comumente observado no processo de congelação lenta. Considerando que a vitrificação reduz ou anula a formação de cristais de gelo e, que em humanos já foram relatados nascimentos após o transplante de tecido ovariano vitrificado (KAWAMURA et al., 2013; SUZUKI et al., 2015), em 2013, nossa equipe no LAMOFOPA

35 34 desenvolveu um dispositivo para a vitrificação em superfície sólida do tecido ovariano caprino (CARVALHO et al., 2013). Esse dispositivo denominado ovarian tissue cryossystem (OTC) foi utilizado com sucesso e os dados mostraram que após o cultivo in vitro, 36% dos folículos pré-antrais presentes no tecido ovariano, mantiveram a morfologia similar à observada no tecido fresco. Desta forma, no presente estudo, o OTC foi utilizado para vitrificar o ovário de cabras e, após vitrificação/aquecimento o córtex ovariano foi auto ou xenotransplantado para posterior avaliação da sobrevivência e desenvolvimento folicular, bem como a função ovariana in vivo. A escolha da espécie caprina neste estudo fundamentou-se na similaridade do ovário (tamanho, consistência) e duração do processo de foliculogênese da cabra à espécie humana. Devido a essas características, nós acreditamos que a espécie caprina pode ser utilizada como modelo experimental para a espécie humana. Desse modo, os dados obtidos nesse estudo poderão contribuir de maneira significativa para um melhor entendimento sobre o processo de vitrificação e transplante de tecido ovariano e, consequentemente aumentar as taxas de sucesso. Além disso, os resultados obtidos também poderão ser de extrema relevância para a própria espécie caprina, visando a preservação do material genético de animais de grande valor zootécnico ou risco de extinção.

36 35 4 HIPÓTESES CIENTÍFICAS O tecido ovariano vitrificado utilizando o OTC pode ter a sua função restaurada após o auto ou xenotransplante; O tecido ovariano vitrificado utilizando o OTC pode manter a higidez, as características fisiológicas e a capacidade de desenvolvimento dos folículos préantrais, após o auto ou xenotransplante.

37 36 5 OBJETIVOS 5.1 GERAL Avaliar in vivo (auto e xenotransplante) e in vitro a capacidade de restauração da função ovariana e o desenvolvimento de folículos pré-antrais após a vitrificação do ovário caprino, utilizando o OTC. 5.2 ESPECÍFICOS a) Analisar a morfologia e o desenvolvimento de folículos pré-antrais caprinos após autotransplante (ortotópico ou heterotópico), xenotransplante (heterotópico) ou cultivo in vitro do tecido ovariano fresco ou vitrificado; b) Mensurar os níveis de progesterona sérica após autotransplante ortotópico do tecido ovariano caprino fresco ou vitrificado; c) Mensurar os níveis de progesterona e estradiol após autotransplante heterotópico e cultivo in vitro do tecido ovariano caprino fresco ou vitrificado; d) Avaliar a neovascularização do tecido ovariano caprino após autotransplante heterotópico pela expressão gênica do CD31; e) Verificar a localização e o padrão de distribuição das Cx37 e Cx43, bem como do SDF-1α antes e após o cultivo in vitro de tecido ovariano caprino fresco ou vitrificado; f) Analisar a fibrose e densidade folicular no ovário de cabra, previamente vitrificado, após xenotransplante em camundongos.

38 37 6 CAPÍTULO 1 Expectativas e limitações do transplante do tecido ovariano Expectations and limitations of ovarian tissue transplantation PERIÓDICO: Publicado na Zygote, 1-13, 2017 (Qualis B1)

39 38 RESUMO O progresso constante no diagnóstico e tratamento do câncer aumentou o número e o prognóstico dos sobreviventes ao câncer. No entanto, os efeitos tóxicos da quimioterapia e da radioterapia sobre a função ovariana resultaram em falência ovariana prematura. Os pacientes, portanto, ainda esperam que métodos sejam desenvolvidos para preservar sua fertilidade com sucesso. Várias opções potenciais estão disponíveis para preservar a fertilidade em pacientes que sofrem de falência ovariana prematura, incluindo crioconservação de oócitos imaturos ou maturos e embriões. No entanto, para crianças ou mulheres pré-púberes que necessitam de quimioterapia imediata, a criopreservação do tecido ovariano é a única alternativa. O objetivo desta técnica é posteriormente transplantar o tecido ovariano na cavidade pélvica (local ortotópico) ou em um sítio heterotópico, uma vez que o tratamento oncológico seja concluído e o paciente esteja livre da doença. O transplante de tecido ovariano com um número suficientemente grande de folículos poderia potencialmente restaurar a função endócrina e permitir múltiplos ciclos para a concepção. No entanto, o sucesso do transplante de tecido ovariano ainda tem múltiplos desafios, como o baixo número de folículos no enxerto, que podem afetar sua longevidade, bem como a sobrevivência do tecido durante o processamento ex vivo e o posterior transplante. Portanto, esta revisão teve como objetivo resumir os resultados de transplante ovariano e as potenciais técnicas que foram desenvolvidas para melhorar a sobrevivência do enxerto ovariano. Palavras-chave: Criopreservação, Preservação da fertilidade, Neovascularização, Oncofertilidade, Transplantação

40 39 Expectations and limitations of ovarian tissue transplantation N.J. Donfack 2, K.A. Alves 2, V.R. Araújo 2, A. Cordova 3, 4, J.R. Figueiredo 2, J. Smitz 5 and A.P.R. Rodrigues 1 1 All correspondence to: A.P.R. Rodrigues. Programa de Pós-Graduação em Ciências Veterinárias (PPGCV). Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA). Universidade Estadual do Ceará (UECE). Av. Paranjana, 1700, Campus do Itaperi. Fortaleza CE Brasil. CEP: Tel: Fax: aprrodriguespapers@gmail.com 2 Faculty of VeterinaryMedicine, Laboratory ofmanipulation of Oocytes and Preantral Follicles (LAMOFOPA), State University of Ceará, Fortaleza, CE, Brazil. 3 Department of Biomedical Sciences, Ontario Veterinary College, University of Guelph, 50 Stone Road, Guelph, ON N1G 2W1, Canada. 4 Reproductive Physiology, Toronto Zoo, 361A Old Finch Avenue, Toronto, Ontario, M1B 5K7, Canada. 5 Follicle Biology Laboratory, Center for Reproductive Medicine, UZ Brussel, Laarbeeklaan 101, B-1090 Brussels, Belgium.

41 40 ABSTRACT Constant progress in the diagnosis and treatment of cancer disease has increased the number and prognosis of cancer survivors. However, the toxic effects of chemotherapy and radiotherapy on ovarian function have resulted in premature ovarian failure. Patients are, therefore, still expecting methods to be developed to preserve their fertility successfully. Several potential options are available to preserve fertility in patients who face premature ovarian failure, including immature or mature oocyte and embryo cryopreservation. However, for children or prepubertal women needing immediate chemotherapy, cryopreservation of ovarian tissue is the only alternative. The ultimate aim of this strategy is to implant ovarian tissue into the pelvic cavity (orthotopic site) or in a heterotopic site once oncological treatment is completed and the patient is disease free. Transplantation of ovarian tissue with sufficiently large numbers of follicles could potentially restore endocrine function and allow multiple cycles for conception. However, the success of ovarian tissue transplantation still has multiple challenges, such as the low number of follicles in the graft that may affect their longevity as well as the survival of the tissue during ex vivo processing and subsequent transplantation. Therefore, this review aims to summarize the achievements of ovary grafting and the potential techniques that have been developed to improve ovarian graft survival. Keywords: Cryopreservation, Fertility preservation, Neovascularization, Oncofertility, Transplantation

42 41 Introduction Advances in oncological diagnosis and treatments have provided a considerable increase in survival of cancer patients (Jemal et al., 2012), however, chemo- therapy and/or radiotherapy treatments, including alkylating agents may compromise their future fertility (Anderson & Wallace, 2013). Furthermore, as the number of young cancer survivor s augments, the demand for fertility preservation before cancer therapy increases progressively (Donnez et al., 2006b). Cryopreservation and transplantation are, therefore, the main and most viable options to preserve and thus regenerate the fertility of women who will undergo cancer treatment (Donnez et al., 2013). Especially for children or young patients, the available option to preserve fertility is the cryopreservation of ovarian tissue (slices/fragments) that allows the storage of a large number of primordial and primary follicles (Meirow et al., 2007) and can ensure the restoration of the ovarian endocrine function (Donnez et al., 2013). The cryopreserved ovarian tissue needs, therefore, to be grafted to the patient after a period of storage at low temperatures. More than a half century ago, a study conducted in mice described the first birth after a whole ovary orthotopic transplantation with previous cryopreservation (Parrot, 1960). In humans, the first birth obtained using ovarian tissue cryopreservation and grafting was reported by Donnez et al. (2004) and was a landmark in human reproductive medicine. Since then, the birth of 70 healthy babies (Silber, 2016) has been reported after transplantation of cryopreserved ovarian tissue. Despite these encouraging results, the techniques of cryopreservation and ovarian transplantation to restore reproductive function in women are still considered experimental. New studies are therefore being performed around the world to investigate the best way to restore fertility, either in humans (Burmeister et al., 2013), non-human primates (Amorim et al., 2013), in domestic animals (Fassbender et al., 2007) or in laboratory animals (César et al., 2015). The natural plasticity of the ovary facilitates grafting to different sites in which they can be revascularized and rapidly restore its normal physiology. Furthermore, ovarian tissue can be transplanted orthotopically to the pelvis (Demeestere et al., 2010) or heterotopically in subcutaneous areas, kidney capsule or fat pad (Youm et al., 2015) as well as in other sites (the rectus muscle: Kim et al., 2009; subperitoneal tissue: Stern

43 42 et al., 2011). Regardless of the site, the ovarian graft can undergo ischemia and potentially follicular atresia that represent a challenge to the success of this technique. It is necessary, therefore, to make sure that there is good cell communication between graft and host tissue when the ovary is grafted. The practice of cryostorage followed by transplantation has been restoring fertility and hormone production (in humans: Silber, 2016; and others species: Amorim et al., 2013; Campbell et al., 2014). This option is elective for patients who have high risk of premature ovarian failure (POF) in which oncologists and physicians work together to achieve the patient s glo al well-being (Revelli et al., 2013). Thus, this review will provide an insight into the different factors that affect ovarian functionality after transplantation and some relevant advance to date. Ovarian tissue transplantation The main goal of transplantation of ovarian tissue is the restoration of ovarian endocrine function and fertility especially in young and adult women undergoing cancer treatment (Donnez et al., 2013). The ovary is abundant in primordial follicles in quiescence stage or in rest, which constitute the ovarian reserve. Only a few of them will be activated and develop to an advanced follicular stage (Kim, 2012). Primordial follicles can be cryopreserved and stored at any stage of the female reproductive life, without the need of hormonal treatment. The ovary is a well-suited place for transplantation due to its naturally abundant angiogenic factors that favor the neovascularization process. According to the site of transplantation the procedure is classified as: orthotopic or heterotopic implantation. The first one is defined as tissue transplanted to its place of origin or into the pelvic cavity. In the case of heterotopic implantation, it is defined as tissue transplanted in a different site or in an extra-ovarian region (Sonmezer and Oktay, 2010), such as the abdominal wall (Rodriguez-Wallberg and oktay, 2012) forearm (Oktay et al., 2001), kidney capsule (Youm et al., 2015) or breast (Kim et al., 2004) following cryopreservation process. According to the graft recipient, transplantation can be classified as xenotransplantation (performed in different species), allotransplantation (performed in the same specie) or autotransplantation (performed in the same individual).

44 43 Site of ovarian tissue implantation Orthotopic site In this type of transplantation, the tissue is reimplanted in its original physiological surroundings and the development of transplanted tissue is very effective. The main advantage of orthotopic transplantation of ovarian tissue is the fact that natural conception could occur without the intervention of assisted reproductive techniques. According by Donnez & Dolmans (2015), the pelvic cavity (orthotopic site) would provide the optimal environment for follicular development compared to heterotopic sites as temperature, pressure, paracrine factors, and blood supply are similar to those observed in a physiological situation. On the other side, the disadvantages would be the limited number of fragments able to be transplanted due to the ovarian size. In addition, orthotopic transplantation is an invasive procedure that may cause severe pelvic adhesions (Demeestere et al., 2009). In animal production, the first encouraging results were obtained by Gosden et al. (1994) in sheep. These authors reported the resumption of cyclic activity, pregnancy, getting a life birth after orthotopic autotransplantation of samples of ovarian tissue cryopreserved by slow freezing. After that, Salle et al 2002, 2003 and Bordes et al. (2005) also reported live birth using orthotopic transplantation of frozen-thawed and vitrified ovary respectively in ewes. Imhof et al., 2006 also reported a live birth after orthotopic transplantation of frozen-thawed ovarian tissue in ovine. Moreover, Santos et al., 2009 demonstrated complete follicular development and recovery of endocrine function after cryopreservation and orthotopic autotransplantation of small ovarian fragments in bilaterally ovariectomized goats without administration of hormones. It should be emphasized that the first live birth in humans obtained using the combination of ovarian tissue cryopreservation and orthotopic transplantation was reported by Donnez et al. (2004), which is a landmark in human reproductive medicine. Since then, various authors have been reported live birth after ovary transplantation (Silber et al., 2008; Andersen et al., 2008, Donnez et al., 2011, silber, 2016). Two techniques were successfully used to reimplant fresh or frozen-thawed ovarian tissue in an orthotopic site, within a specially created window on the peritoneum (Donnez et al., 2004) or on the remaining ovary (Donnez et al., 2006a). The large tissue strips (8-10 x 5 mm) of ovarian fragments can be sutured into the remaining

45 44 ovary after the removal of native cortex. However, the transplantation of small pieces (2 x 2 mm), in the medulla space is difficult because it cannot be sutured (Donnez et al., 2008). A normal reproductive lifespan was demonstrated after orthotopic grafting of vitrified ovary in mouse (Liu et al., 2008). Furthermore, Silber et al. (2008) reported reinitiation of ovulatory menstrual cycles and normal serum FSH levels after days after transplantation of fresh and cryopreserved ovarian tissue between a series of monozygotic (MZ) twin pairs. Moreover, it was reported two live births following fresh ovary transplantation between two identical twin sisters and another one live birth after autotransplantation of cryopreserved ovarian tissue (Silber et al., 2008). Burmeister et al. (2013) also reported human pregnancy after ovarian tissue cryopreservation and subsequent orthotopic autotransplantation. Heterotopic site The potential advantages of heterotopic implantation include: avoidance of invasive procedures; easy accessibility of the graft; increased capacity for cortical slices and feasibility for grafting even if severe pelvic adhesions preclude orthotopic transplantation (Kim, 2012). In addition, it is not required the use of general anaesthesia and the removal of the transplanted fragmentsis not difficult (Filatov et al., 2016). However, unlike orthotopic transplantation, natural conception cannot be expected after transplantation of ovarian tissue to heterotopic sites and, therefore, in vitro fertilization (IVF) is required for conception. As mentioned above, ovarian grafts can be transplanted in several different sites, including the bursa cavity, the kidney capsule, and subcutaneous sites. Transplantation in the kidney capsule has been often used due its excellent blood supply that would enhance graft survival (Youm et al., 2015). Graft recovery and oocyte yield are significantly higher from the bursal cavity and kidney capsule compared to subcutaneous site in murine species (Youm et al., 2015). Regardless of the site of transplantation, the ovarian graft will undergo ischemia and potential follicular atresia during the period after transplantation before tissue revascularization; this remains a challenge to the success of this technique (Wang et al., 2012). However, by virtue of their low metabolic rate, primordial follicles are relatively resistant to the effects of oxygen deprivation (Schmidt et al., 2003).

46 45 Heterotopic ovarian transplantation experience in humans and non-human primates is very limited (Amorim et al., 2013). Several heterotopic sites have been tested in humans, including the uterus broad ligament (Gosden et al., 2010), the rectus muscle (Kim et al., 2009), the forearm (Oktay et al., 2001), the breast tissue (Kim et al., 2004), the subcutaneous tissue of the abdomen (Youm et al., 2015) and the subperitoneal tissue (Stern et al., 2011). In studies with primates, other heterotopic sites (omentum, retroperitoneal iliac fossa, uterine serosa, mesosalpinx, and the pelvic wall) were also used (Suzuki et al., 2012). In addition to intraperitoneal (omentum) or subperitoneal sites, the subcutaneous tissue of the abdomen could also provide an adequate environment for follicle growth in both humans and primates (Kim, 2013). However, heterotopic sites may not provide an optimal environment for follicular development due to differences in temperature, paracrine factors and blood supply compared with the intraperitoneal environment (Donnez et al., 2010a). Primate models have been used to find suitable locations to overcome some of these challenges (Igarashi et al., 2010). It has been recently demonstrated high numbers of follicular survival after heterotopic xenotransplantation of human cryopreserved prepubertal ovarian tissue in mice with the remaining of a large pool of dormant primordial follicles in the graft (Luyckx et al., 2013). Furthermore, Stern et al. (2013) reported the first clinical pregnancy following heterotopic grafting of cryopreserved ovarian tissue in a woman after a bilateral oophorectomy. Therefore, the choice of the transplantation sites constitutes an essential factor involved in future graft viability and in the subsequent oocyte competence (Demeestere et al., 2009). Graft recipient of ovarian tissue implantation Xenotransplantion Complex biological processes often require in vivo analysis, and a number of important research have been made using the mice as a model for the study of various biological systems. Humanized mice, or mouse-human chimeras were developed to overcome these constraints and are now an important research tool for in vivo study of human cells and tissues (Shultz et al., 2007). Immunodeficient mice are used to evaluate follicle development and survival after cryopreservation of ovarian tissue. Some studies (table 1) have shown that xenografting of human ovarian tissue in mice has been an

47 46 effective model to study ovarian function and follicle development in vivo (Van Eyck et al., 2009). Since 1960, athymic mice (nude) have been a standard for establishing in vivo models of human malignancies. Due to its lack of thymus, nude mice cannot generate mature T lymphocytes therefore being unable to mount most types of immune responses (Fransolet et al., 2015). This absence of functioning T cells prevents nude mice from rejecting not only allografts, but even xenografts (Fransolet et al., 2015). Another attractive model is the severe combined immunodeficient (SCID) mice (Fransolet et al., 2015). SCID mice were the first and most commonly used model for ovarian xenografts (Aubard, 2003) and were characterized by their scid mutation, which leads to a defect in the recombination of antigen receptor genes, impairing their capacity to generate functional B and T lymphocytes (Custer et al., 1985). Thus, SCID mice can maintain tissues from foreign species without demonstrating a graft versus-host response (Bosma et al., 1983) and consequently, they can serve as a good model for transplantation studies. A few years after SCID mice generation, the scid mutation was transferred into a Non-Obese Diabetic (NOD) background. This transfer leads to NOD- SCID mice, which have reduced natural killer cell (NK-cell) activity in addition to the deficiency in functional B and T cells (Prochazka et al., 1992). Moreover, their ability to activate some components of the complement system is impaired, and these mice are markedly deficient in macrophages (Shultz et al., 2007). In order to develop a novel protocol for the establishment of human ovarian stroma within a mouse model subcutaneously, normal human ovarian tissues were subcutaneously implanted into SCID mice and then the implants were identified by immunohistochemistry. The results demonstrated that human ovarian tissue successfully survives in a SCID mouse host and retains the properties of the original normal ovarian tissues (Fu et al., 2014). Previously, Luyckx et al. (2013) reported that frozen-thawed preantral follicles from prepubertal patients can successfully survive and develop after long-term ovary xenografting. The study conducted by Henry et al. (2015) after xenotransplantation of sheep ovary to SCID and NOD-SCID showed that they are both suitable for studying graft recovery, however, based on histologic analysis, the overall tissue morphology was better preserved in SCID mice. It was reported after xenotransplant of rat ovary into the kidney capsule of immune-deficient mice a significant alteration of the gene responsible for ovarian metabolism and function (Agca et al., 2009). Ishijima et al. (2009) also showed high follicular loss after xenotransplantation of canine cryopreserved ovary in immune-deficient mice.

48 47 Moreover, it was demonstrated that encapsulation of ovarian tissue with VEGF165 in a collagen matrix during xenografting in SCID mouse produces a more rapid onset of functional vessel formation and earlier revascularization of the transplant (Henry et al., 2015). Lotz et al. (2014) reported antral follicle formation after 122 days postxenotransplantation in a single human ovarian fragment of 6 years old without exogenous hormone stimulation. Moreover, it was shown that, isolated human follicles were able to survive after encapsulation in fibrin clots and short-term xenotransplantation (Paulini et al., 2016). Autotransplantation/allotransplantation As mentioned before, the main goal of ovarian tissue transplantation is the restoration of fertility and endocrine function of women who undergo cancer treatments (chemo/radiotherapy). In this context, the efforts made so far by research teams from at least 10 countries have proved that transplantation of cryopreserved ovarian tissue is a promising option to preserve fertility in female patients with cancer. These procedures allow immediate initiation of cancer treatment, as it does not require prior ovarian stimulation nor sperm donation compared to other technologies such as embryo or oocyte cryopreservation. It is very difficult to know the exact number of attempts made to transplant ovarian tissue (fresh and cryopreserved), especially when it is not directly involved with the clinic or even when the main focus of research is the biotechnology of animal production. In fact, according to Donnez & Dolmans (2015), the number of reimplantations performed worldwide is not known. However, excellent results were seen in USA, Brussels, Paris, Spain, Denmark, and Israel. In addition, successes are reported by research teams in Japan, Italy, Germany, and Australia (Stoop et al., 2014). In addition to the excellent restoration rate of ovarian function (95%) and a reasonable gestation rate (23%) obtained when this strategy is applied, it has been observed that, the duration of ovarian function has been maintained for a period from 4 to 5 years (Donnez & Dolmans, 2013, 2014). Autotransplantation of frozen and thawed ovarian tissue is only possible if absence of cancer cells in the graft is confirmed and there is a legitimate concern for the reseeding of malignant cells when carrying out ovarian transplantation (Kenny and Rodriguez-Wallberg, 2012). Disadvantages of ovarian tissue cryopreservation and autotransplantation include the limited life span of the ovarian grafts due to the potential

49 48 post-transplantation window of ischemia responsible for follicular atresia. In addition, for patients with autoimmune or genetic disorders, gonadal auto-transplantation is ineffective in preserving fertility. In such cases, allotransplantation might be the solution (Yi-Hsin et al., 2011). Silber and colleagues reported a series of monozygotic twins (table 2) who underwent ovarian isotransplantation to rescue the sterile sister (Silber, 2005, 2008). Furthermore, orthotopic ovarian allotransplantation has been performed in patients diagnosed with Turner syndrome. This technique was able to restore regular menstruation and ovulation, it raised hormonal concentrations and led to the development of secondary sexual characters (Mhatre and Mhatre, 2006). However, Scott et al. (1987) have shown that immunosuppressive therapy, such as cyclosporine A plus steroid, is needed for ovarian allografts to survive. Factors affecting graft function Follicle loss is one of the major limitations after ovary transplantation. This phenomenon occurs in several steps of the procedure as cited below. Ovarian tissue size The thickness of ovarian cortical strips prior to freezing is critical to enable the perfusion of cryoprotectants and the ensuring of the graft survival. The surface-tovolume ratio of the graft has to be high in order to ensure good penetration and removal of cryoprotectants agents. It reduces the probability of damage caused by ice crystals during freezing and thawing, and by the ischemia and hypoxia that occurs during the initial steps of graft acceptance (Gavish et al., 2008). Currently, ovarian cortical tissue is cryopreserved in strips of 1 2 mm thickness either by slow freezing or vitrification protocols (Kagawa et al., 2009). It has been suggested (Gavish et al., 2008; Revel et al., 2011) that reducing graft dimensions might enhance diffusion of oxygen, growth factors and nutrients into the ischemic graft and improve follicle s survival However a study conducted by Gavish et al. (2014) showed an extensive neovascularization one-week post xenotransplantation of bovine ovarian tissue in mice. Although, no benefitial effect was found when reducing the graft thickness beyond 1 mm, including extensive primordial follicle loss and increased follicle urn-out without improving neovascularization. Moreover, the transplanted fragments of ovarian cortex contain only a fraction of an individual s ovarian reserve and as such can only provide the recipient

50 49 with a relatively brief fertile window before the supply of oocytes contained within their graft is depleted (Donnez et al., 2013; Andersen et al., 2008; Ernst et al., 2010; Silber, 2012). This limitation means that cryopreservation and autografting of pieces of cortex appears to be less effective as a means to restore the fertility of older patients in whom follicle density is already low at the time of tissue preservation and where it is associated with endocrine disturbance (Campbell et al., 2004). In this context, cryopreservation of the whole ovary (complete with vascular pedicle) for later autotransplantation provides an attractive alternative strategy for fertility preservation as it involves restoration of all of the primordial follicles within the ovary. Further, as transplantation requires vascular anastomosis rather than cortical revascularization, this intervention should result in no marked reduction of ovarian reserve due to ischemia, preventing endocrine imbalance and reducing the age constraint which limit the efficacy of this fertility preservation technology (Campbel et al., 2014). However, autotransplantation of frozen-thawed whole ovary has also some disadvantages including: 1) It has a higher risk of cryoinjury during freezing due to inadequate diffusion of cryoprotectants throughout the entire ovary and non-homogenous cooling rate between the core and the periphery of the ovary as well; 2) cryoinjury of ovarian vasculature; 3) surgical difficulty of vascular anastomosis due to the small size of ovarian artery (~0.5 mm in diameter), short ovarian vascular pedicle (~5 cm in length), discrepancy between the diameters of graft and recipient vessels, and possible failure of microvascular anastomosis; 4) higher risk of post-operative vascular complications including anastomotic bleeding, pseudoaneurysm, stenosis, or microvascular thrombosis and finally, 5) its vascular complications can severely affect the survival of the entire ovary leaving no other attempt for transplantation (Silver, 2009; Kim, 2010; Bedaiwy and Falcone 2010; Zhang et al., 2011). Ischemia Ischemia is defined as the insufficient perfusion and reduction of the arterial or venous blood flow, depletion of cellular energy storages, and the accumulation of toxic metabolites which can lead to cell death (Ingec et al., 2011). Ischemic times that extend for several days most likely induce profound and irreversible ischemia reperfusion injuries. They are responsible for follicles loss, as the graft needs 4 5 days to be reoxygenated (Van Eyck et al., 2009). A study with sheep ovarian tissue reported that

51 50 65% of the follicles are lost after grafting of fresh tissue while subjecting the tissue to cryopreservation and thawing would add another 7% of follicle loss (Baird et al., 1999). Moreover, fresh or frozen human ovarian grafts transplanted into nude mice showed similar reduction in follicular density, demonstrating that ischemia is the main factor behind follicular depletion (Demeestere et al., 2009). Thus, duration of warm ischemia before neovascularization is crucial for follicular survival and may responsible for the major loss of follicles after grafting rather, than after freezing. The mechanisms behind ischemic injury involves energy depletion and reperfusion oxidative stress (Demeestere et al., 2009) which can cause damage to lipids, DNA, enzymes and structural proteins, therefore leading to cell death (Kim et al., 2003). Gene expression of several inflammatory factors is initiated by hypoxia-sensitive response elements and nuclear factor-kappa beta, resulting in transmigration of neutrophils and macrophages into the tissue (Vollmar et al., 1995) that causes tissue destruction and fibrosis. However, primordial follicles still survive for relatively long time of ischemia after avascular transplantation due to their very low metabolic demands. Moreover, they are distributed just under the ovarian surface and they may be the first to benefit from the ingrowth of new vessels. In a study with cryopreserved bovine ovarian cortex it was demonstrated that stromal cells are more vulnerable to ischemia compared to primordial follicles (Kim et al., 2004). Due to the negative effects of ischemic time in the follicular pool, angiogenesis is the key mechanism for follicle survival. Addition of exogenous substances to improve angiogenesis and ovarian graft Many animal experiments focused on improving ovarian tissue survival improvement have been described. Transplantation of frozen/thawed ovarian tissue in animal models led to antral follicle development and live birth (Schubert et al., 2008). However, despite the successful results obtained with cryopreservation and autotransplantation of ovarian tissue, it is important to highlight the large follicle loss resulting from the latter procedure (Gavish et al.,2014). In this context, many studies have been conducted with different substances such as antioxidants agents or angiogenic factors. Local antioxidant injection of vitamin E before grafting could improve follicular survival rate (Martinez-Madrid et al., 2009). Ischemia and oxidative stress could be reduced by using drugs to stimulate revascularization of the graft, such

52 51 as vascular endothelial growth factor or sphingosine-1-phosphate (S1P), as described by Donnez & Dolmans, (2013). A study carried out by Zelinski et al. (2011) showed that S1P and its analogs, protected the primate ovary against radiation-induced damage. In addition, Scalercio et al. (2014) showed that, trolox, an analogue of vitamin E improved follicular quality and avoided apoptosis in stromal cells when ovarian tissue is pretreated with this substance. Moreover, a study showed that autografted mice ovary followed by daily administration of L-carnitine until day 7 inhibited follicle apoptosis, relieved oxidative damage, and increased follicular survival and function in ovarian graft (Zhang et al., 2015). To reduce the hypoxic period after tissue transplantation and improve follicular preservation, angiogenesis can be stimulated by vascular endothelia growth factor (VEGF), which is the main signaling protein that regulates new vessel formation from pre-existing vessels (Henry et al., 2015). Ovarian cryopreservation and transplantation procedures have so far been almost exclusively limited to avascular cortical fragments. The small cortical pieces grafted without vascular anastomosis are completely dependent on the establishment of neovascularization after grafting. Consequently, the cells in the graft undergo significant ischemic and reperfusion damage, which can induce a high rate of follicular loss (Zhang et al., 2016). Therefore, these cells remain quiescent until there is an angiogenic stimulus such as hypoxia or wounding, which then up-regulates proangiogenic factors, such as VEGF (Gerhardt and Betsholtz, 2003). Angiogenesis is regulated in the reproductive tract and elsewhere by at least 20 angiogenic growth factors and inhibitors identified to date. A key player is VEGF also known as vascular permeability factor (Ferrara and Davis-Smyth, 1997). It has been shown that VEGF acts via two tyrosine kinase family receptors, namely flt-1 (VEGF receptor; VEGFR-1) and flk-1/kdr (Ferrara and Davis-Smyth, 1997), which are expressed in granulosa cells (Greenaway et al., 2004). The effects of two VEGF-A isoforms, VEGF111 and VEGF165, have been tested in a xenograft model using SCID mice (Commin et al., 2012). VEGF111 is soluble and resistant to proteolysis, whereas VEGF165 is additionally anchored to the extracellular matrix. Both VEGF isoforms increase blood vessel recruitment and functional angiogenesis. The use of this isoform in a collagen matrix, which encapsulates the ovarian cortex at the time of transplantation was found to improve angiogenesis and decrease hypoxia, thereby enhancing the preservation of primary follicles (Labied et al., 2013). Moreover, it was demonstrated (Henry et al., 2015) that

53 52 encapsulation of ovarian tissue with VEGF165 in a collagen matrix during xenografting in mice produces a more rapid onset of functional vessel formation and earlier revascularization of the transplant. In addition, Campbell et al., 2014, used postoperative regime of anti-thrombotic (aspirin) agents to reduce post-transplant ischemia. This substance prevents clot formation in the ovarian vasculature induced by cryo- and cyto-toxic damage to the arterial endothelial cells Final Considerations This review reinforces the fact that, cryopreservation of ovarian tissue for further transplantation is helpful for prepupertal and women in reproductive age or patients for whom cancer treatment cannot be delayed to perform another assisted reproductive technique such as oocyte or embryo cryopreservation. Because preparation and stimulation for oocyte retrieval usually requires 2 to 3 weeks or longer, it is generally not feasible to freeze embryos from an adult female cancer patient for potential future use. Additionally, not all patients have partners with whom they can produce embryos to cryopreserve. Moreover, in contrast with oocytes and embryos, cryopreservation of ovarian tissue does not depend on the age and phase of the patient s estrous cycle it also involves fewer ethical and social issues especially when this process is performed in humans. Most of the experimental studies conducted with the transplant of cryopreserved ovarian tissue have the aim of reestablish the fertility. However, in special situations, when it is necessary to remove the normal ovaries due to cancer or infectious processes of the pelvic organs, the absence of ovarian hormones may lead to several endocrine and functional disorders such as osteoporosis, reduction of libido, sexual dysfunction, and enhancement of lipoprotein levels. In such condition transplantation of cryopreserved ovarian tissue is the main solution to overcome this problem. However, despite the good results obtained by ovary cryopreservation following transplantation, it appears that the main obstacle to successfully restore fertility from frozen thawed ovarian cortex are adhesions and the massive ischemic damage to follicles until neovascularization develops. Most follicles surviving cryopreservation, will undergo ischemic loss during the time required for neovascularization. Therefore, the optimization of ovary transplantation may require preparing the right thickness of tissue and finding the best site of transplantation. This could avoid

54 53 ischemia and promote rapid revascularization. Angiogenesis is a key factor for graft survival because right after transplantation the lack of connective tissue between the graft and surrounded tissue is leading to hypoxia resulting in cell death. In this context reducing the ischemia period could enhance the success of transplantation. In this case, further animal model studies are required to develop optimized cryopreservation/transplant protocols for women. Acknowledgments Nathalie Jiatsa Donfack is a recipient of a grant from Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (Brazil). Ana Paula Ribeiro Rodrigues is recipient of a grant from CNPq Brazil (473968/2013-4). Johan Smitz is Especial Visitor Researcher from CAPES. None of the authors has any conflict of interest to declare.

55 54 Table 1: Summary of some relevant results obtained after xenotransplantation of ovarian tissue in different species Pc: piece

56 Table 2: Summary of some relevant results obtained after auto/allotransplantion of ovarian tissue in different species. 55

57 56 References Agca C, Lucy MC, Agca Y. Gene expression profile of rat ovarian tissue following xenotransplantation into immune-deficient mice. Reproduction. 2009; 137: Amorim CA, David A, Dolmans MM, Camboni A, Donnez J, Langendonckt AV. Impact of freezing and thawing of human ovarian tissue on follicular growth after long-term xenotransplantation. J Assist Reprod Genet. 2011; 28: Amorim CA, Jacobs S, Devireddy RV, Langendonckt AV, Vanacker J, Jaeger J, Luyckx V, Donnez J, Dolmans MM. Successful vitrification and autografting of baboon (Papio anubis) ovarian tissue. Hum Reprod. 2013; 28: Andersen CY, Rosendahl M, Byskov AG, Loft A, Ottosen C, Dueholm M, Kirsten L.T. Schmidt KLT, Andersen AN, Ernst E. Two successful pregnancies following autotransplantation of frozen/thawed ovarian tissue. Hum Reprod. 2008; 23: Anderson RA, Wa llace WHB. Antimullerian hormone, the assessment of the ovarian reserve and the reproductive outcome of the young patient with cancer. Fertil Steril. 2013; 99: Aubard Y. Ovarian tissue xenografting. Eur. J. Obstet. Gynecol. Reprod Biol. 2003; 108: Baird DT, Webb R, Campbell BK, Harkness LM, Gosden RG. Long-term Ovarian function in sheep after ovariectomy and transplantation of autografts Stored at c. Endocrinology. 1999; 140: Bedaiwy MA, Falcone T. Whole ovary transplantation. Clinical Obstetrics and Gynecology. 2010; 53(4): Bordes A, Lornage J, Demirci B, Franck M, Courbiere B, Guerin JF, Salle B. Normal gestations and live births after orthotopic autograft of vitrified warmed hemiovaries into ewes. Hum Reprod. 2005; 20(10): Bosma GC, Custer RP, Bosma MJ. A severe combined immunodeficiency mutation in the mouse. Nature. 1983; 301: Burmeister L, Kovacs GT, Osianlis T. First australian pregnancy after ovarian tissue cryopreservation and subsequent autotransplantation. Med J Aust. 2013; 198:

58 57 Campbell BK, Telfer EE, Webb R, Baird DT. Evidence of a role for follicle-stimulating hormone in controlling the rate of preantral follicle development in sheep. Endocrinology. 2004; 145: Campbell BK,.Hernandez-Medrano J, Onions V, Pincott-Allen C, Aljaser F, Fisher J, McNeilly AS, Webb R, Picton HM. Restoration of ovarian function and natural fertility following the cryopreservation and autotransplantation of whole adult sheep ovaries. Hum Reprod. 2014; 29: Candy CJ, Wood MJ, Whittingham DG. Restoration of a normal reproductive lifespan after grafting of cryopreserved mouse ovaries. Hum reprod. 2000; 15: César JM, Petroianu A, Vasconcelos L de S, Cardoso VN, Mota LD, Barbosa AJ, Soares CD, De Oliveir AL. Preliminary study of coconut water for graft tissues preservation in transplantation. Rev Col Bras Cir. 2015; 42: Custer RP, Bosma GC, Bosma MJ. Severe combined immunodeficiency (SCID) in the mouse. Pathology, reconstitution, neoplasms. Am J Pathol. 1985; 120: Demeestere I, Simon P, Emiliani S, Delbaere A, Englert Y. orthotopic and heterotopic ovarian tissue transplantation. Hum Reprod Update. 2009; 15: Demeestere I, Simon P, Moffa F, Delbaere A, Englert Y. Birth of a second healthy girl more than 3 years after cryopreserved ovarian graft. Hum Reprod. 2010; 25: Donnez J, Dolmans MM, Demylle D, Jadoul P, Pirard C, Squifflet J, Martinez-madrid B, Van langendonckt A. Restoration of ovarian function after orthotopic (intraovarian and periovarian) transplantation of cryopreserved ovarian tissue in a woman treated by bone marrow transplantation for sickle cell anaemia: case report. Hum Reprod. 2006a; 21: Donnez J, Dolmans MM, Demylle D, Jadoul P, Pirard C, Squifflet J, Martinez-Madrid B, Van Langendonckt A. Live birth after orthotopic transplantation of cryopreserved ovarian tissue. Lancet. 2004; 364: Donnez J, Dolmans MM, Pellicer A, Diaz-garcia C, Serrano MS, Schmidt KT, Ernst E, Luyckx V, Andersen CY. Restoration of ovarian activity and pregnancy after transplantation of cryopreserved ovarian tissue: a review of 60 cases of reimplantation. Fertil and Steril. 2013; 99: Donnez J, Dolmans MM. Fertility preservation in women. Nat Rev Endocrinol. 2013; 9(12):

59 58 Donnez J, Dolmans MM. Ovarian cortex transplantation: 60 reported live births brings the success and worldwide expansion of the technique towards routine clinical practice. J Assist Reprod Genet. 2015; 32: Donnez J, Dolmans MM. Transplantation of ovarian tissue. Best Pract Res Clin Obstet Gynaecol. 2014; 28(8): Donnez J, Jadoul P, Squifflet J, Van Langendonckt A, Donnez O, Van Eyck AS, Marinescu C, Dolmans MM. Ovarian tissue cryopreservation and transplantation in cancer patients. Best Pract Res Clin Obstet Gynecol. 2010a; 24: Donnez J, Martinez-madrid B, Jadoul P, Van Langendonckt A, Demylle D, Dolmans MM. Ovarian tissue cryopreservation and transplantation: a review. Hum Reprod Update. 2006b; 12: Donnez J, Squifflet J, Pirard C, Demylle D, Delbaere A, Armenio L, Englert Y, Cheron AC, Jadoul P, Dolmans MM. Live birth after allografting of ovarian cortex between genetically non-identical sisters. Hum Reprod. 2011; 26: Donnez J, Squifflet J, Van eyck AS, Demylle D, Van langendonckt A, Dolmans MM. Restoration of ovarian function in orthotopically transplanted cryopreserved ovarian tissue: a pilot experience. Reprod Biomed Online. 2008; 16: Donnez, J, Squifflet J, Pirard C, Jadoul P, Dolmans MM. Restoration of ovarian function after allografting of ovarian cortex between genetically non-identical sisters. Hum Reprod. 2010b; 25: Ernst E, Bergholdt S, Jorgensen JS, AndersenCY. The first woman to give birth to two children following transplantation of frozen/thawed ovarian tissue. Hum Reprod 2010; 25: Fassbender M, Hildebrandt TB, Paris MCJ, Colenbrander B, Jewgenow K. High- Resolution Ultrasonography of Xenografted Domestic Cat Ovarian Cortex. J of Reprod and Develop. 2007; 53: Ferrara N, Davis-Smyth T. The biology of vascular endothelial growth factor. Endocrine Ver. 1997; 18:4-25. Filatov MA, Khramova YV, Kiseleva MV, Malinova IV, Komarova EV Semenova ML. Female fertility preservation strategies: cryopreservation and ovarian tissue in vitro culture, current state of the art and future perspectives. Zygote. 2016; 1-19.

60 59 Fransolet M, Henry L, Labied S, Masereel MC, Blacher S, Noël A, Foidart JM, Nisolle M, Munaut C. Influence of mouse strain on ovarian tissue recovery after engraftment with angiogenic factor. J Ovarian Research. 2015; 015: Fu S, Wang J, Sun W, Xu Y, Zhou X, Cheng W. Preclinical humanized mouse model with ectopic ovarian tissues. Experimental and therapeutic medicine. 2014; 8: Gavish Z, Ben-Haim M, Arav A. Cryopreservation of whole murine and porcine livers. Rejuvenation Res. 2008; 11: Gavish Z, Peer G, Hadassa R, Yoram C, Meirow D. Follicles activation and burn-out contribute to post-transplantation follicles loss in ovarian tissue grafts: the effect of graft thickness. Hum Reprod. 2014; 0:1-8. Gerhardt H, Betsholtz C. Endothelial pericyte interactions in angiogenesis. Cell tissue research. 2003; 314: Gosden RG, Baird DT, Wade JC, Webb R. Restoration of fertility to oophorectomized sheep by ovarian autografts stored at -196 degrees-c. Hum Reprod. 1994; 9: Gosden RG, Robert T, Morris MD. Appreciation of an enlightened surgeon and pioneer of ovarian transplantation. Fertil Steril. 2010; 94: Grazul-Bilska AT, Banerjee J, Yazici I, Borowczyk E, Bilski JJ, Sharma RK, Siemionov M, Falcone T. Morphology and function of cryopreserved whole ovine ovaries after heterotopic autotransplantation. Reproductive Biol and Endocrinol. 2008; 6:1-15. Greenaway J, Connor K, Hanne G, Pedersen, Brenda L, Coomber, Lamarre J, Petrik J. Vascular Endothelial Growth Factor and Its Receptor, Flk-1/KDR, Are Cytoprotective in the Extravascular Compartment of the Ovarian Follicle. Endocrinology. 2004; 145: Henry L, Labied S, Fransolet M, Kirschvink N, Blacher1 S, Noel A, Foidart JM, Nisolle M, Munaut C. Isoform 165 of vascular endothelial growth factor in collagen matrix improves ovine cryopreserved ovarian tissue revascularisation after xenotransplantation in mice. Reprod Biol Endocrinol. 2015; Igarashi S, Suzuki N, Hashimoto S, Takae S, Takenoshita M, Hosoi Y, Morimoto Y, Ishizuka B. Heterotopic autotransplantation of ovarian cortex in cynomolgus monkeys. Hum Cell. 2010; 23:26-34.

61 60 Imhof M, Bergmeister H, Lipovac M, Rudas M, Hofstetter G, Huber J. Orthotopic microvascular reanastomosis of whole cryopreserved ovine ovaries resulting in pregnancy and live birth. Fertil Steril. 2006; 85: Ingec M, Isaoglu U, Yilmaz M, Calik M, Polat B, Alp HH, Kurt A, Gundogdu C., Suleyman H. Prevention of ischemia-reperfusion injury in rat ovarian tissue with the on-off method. J Physiol Pharmacol. 2011; 62: Ishijima T, Abe Y, Suzuki H. Loss of the Cryopreserved Canine Ovary after Xenotransplantation. J Mamm. 2009; 26: Jafarabadi M, Abdollahi M, Salehnia M. Assessment of vitrification outcome by xenotransplantation of ovarian cortex pieces in γ-irradiated mice: morphological and molecular analyses of apoptosis. J Assist Reprod Genet. 2015; 32: Jemal A, Siegel R, Xu J, Ward E. Cancer statistics. CA Cancer J Clin. 2012; 60: Kenny A, Rodriguez-Wallberg. Recent advances in oocyte and ovarian tissue cryopreservation and transplantation. Best Pract Res Clin Obstet Gynaecol. 2012; 26: Kim JS, Qian T, Lemasters JJ. Mitochondrial permeability transition in the switch from necrotic to apoptotic cell death in ischemic rat hepatocytes. Gastroenterol. 2003; 124: Kim JY. Control of ovarian primordial follicle activation. Clin Exp Reprod Med. 2012; 39: Kim SS, Hwang IT, Lee HC. Heterotopic autotransplantation of cryobanked human ovarian tissue as a strategy to restore ovarian function. Fertil Steril. 2004; 82: Kim SS, Lee WS, Chung MK, Lee HC, Lee HH, Hill D. Long-term ovarian function and fertility after heterotopic autotransplantation of cryobanked human ovarian tissue: 8-year experience in cancer patients. Fertil Steril. 2009; 91: Kim SS. Revisiting the role of heterotopic ovarian transplantation: futility or fertility. Reprod BioMed. 2013; 28: Kim SS. Time to re-think: ovarian tissue transplantation versus whole ovary transplantation. Reprod Biomed Online. 2010; 20(2): Labied S, Delforge Y, Munaut C, Blacher S, Colige A, Delcombel R, Henry L, Fransolet M Jouan C D Hauterive P Noel Nisolle M Foidart JM Isoform

62 of vascular endothelial growth factor (VEGF111) improves angiogenesis of ovarian tissue xenotransplantation. Transplantation. 2013; 95: Liu LJ, Xie XY, Zhang RZ, Xu P, Bujard H, Jun M. Reproduction and fertility in wildtype and transgenic mice after orthotopic transplantation of cryopreserved ovaries from 10-d-old mice. Research note. 2008; 37(8): Lotz L, Liebenthron J, Nichols-Burns S, Montag M, Hoffmann I, Beckmann MW, van der Ven H, Töpfer D Dittrich R. Spontaneous antral follicle formation and metaphase II oocyte from a non-stimulated prepubertal ovarian tissue xenotransplant. Reprod Biol and Endocrinol. 2014; 1-5. Luyckx V, Pharm B, Soares M, Scalercio S, Jadoul P, Amorim CA, Soares M, Donnez J, Dolmans MM. Evaluation of cryopreserved ovarian tissue from prepubertal patients after long-term xenografting and exogenous stimulation. Fertil Steril. 2013; 100: Martinez-Madrid B, Donnez J, Van Eyck AS, Veiga-Lopez A, Dolmans MM, Van Langendonckt A. Chick embryo chorioallantoic membrane (CAM) model: a useful tool to study short-term transplantation of cryopreserved human ovarian tissue, Fertil Steril. 2009; 91: Meirow D, Baum M, Yaron R, Levron J, Hardan I, Schiff E, Nagler A, Yehuda DB, Raanani H, Hourvitz A. Ovarian tissue cryopreservation in hematologic malignancy: ten years experience. Leuk Lymphoma. 2007; 48: Mhatre P, Mhatre J. Orthotopic ovarian transplant-review and three surgical techniques. Pediatr Transplant. 2006; 10: Oktay K, Economos K, Kan M, Rucinski J, Veeck L, Rosenwaks Z. Endocrine function and oocyte retrieval after autologous transplantation of ovarian cortical strips to the forearm. JAMA. 2001; 286: Parrot DMV. The fertility of mice with orthotopic ovarian grafts derived from frozen tissue. J Reprod Fertil. 1960; 1: Paulini F, Vilela JMV, Chiti MC, Donnez J, Jadoul P, Dolmans MM, Amorim CA. Survival and growth of human preantral follicles after cryopreservation of ovarian tissue, follicles isolation and short-term xenografting. Reprod BioMed Online. 2016; 33:

63 62 Prochazka M, Gaskins HR, Shultz LD, Leiter EH. The non-obese diabetic scid mouse: model for spontaneous thymomagenesis associated with immunodeficiency. Immunology. 1992; 88: Revel A, Laufer N, Ben Meir A, Lebovich M, Mitrani E. Micro organ ovarian transplantation enables pregnancy: a case report. Hum Reprod. 2011; 26: Revelli A, Marchino G, Dolfin E, Molinari E, Delle Piane L, Salvagno F, Benedetto C. Live birth after orthotopic grafting of autologous cryopreserved ovarian tissue and spontaneous conception in italy. Fertil Steril. 2013; 99: Rodriguez-Wallberg KA, Karlstr PO, Rezapour M, Castellanos E, Hreinsson J, Rasmussen C, SheikhI M, Ouvrier B, Bozoky B, Olofsson JI, Lundqvist M, Hovatta O. Full-term newborn after repeated ovarian tissue trans-plants in a patient treated for Ewing sarcoma by sterilizing pelvic irradiation and chemotherapy. Acta Obstet Gynecol Scand. 2015; 94: Rodriguez-Wallberg KA, Oktay K. Recent advances in oocyte and ovarian tissue cryopreservation and transplantation. Best Pract Res Clin Obstet Gynaecol. 2012; 26: Salle B, Demirci B, Franck M, Berthollet C, Lornage J. Long-term follow-up of cryopreserved hemi-ovary autografts in ewes: pregnancies, births, and histologic assessment. Fertil and steril. 2003; 80: Salle B, Demirci B, Franck M, Rudigoz RC, Guerin JF, Lornage J. Normal pregnancies and live births after autograft of frozen-thawed hemi-ovaries into ewes. Fertil Steril. 2002; 77: Santos RR, Knijn HM, Vos PLAM, Oei CHY, Loon TV, Colenbrander B, Gadella BM, van den Hurk R, Roelen BAJ. Complete follicular development and recovery of ovarian function of frozen-thawed, autotransplanted caprine ovarian cortex. Fertil Steril. 2009; 91: Scalercio SR, Amorim CA, Brito DC, Percario S, Oskam IC, Domingues SFS, Santos RR. Trolox enhances follicular survival after ovarian tissue autograft in squirrel monkey (Saimiri collinsi). Reprod Fertil Develop. 2014; A-K. Schmidt KLT, Ernst E, Byskov AG, Nyboe Andersen A, Yding Andersen C. Survival of primordial follicles following prolonged transportation of ovarian tissue prior to cryopreservation. Hum reprod. 2003; 18:

64 63 Schnorr J, Oehninger S, Toner J, Hsiu J, Lanzendorf S, Williams R, Hodgen G. Functional studies of subcutaneous ovarian transplants in non-human primates: steroidogenesis, endometrial development, ovulation, menstrual patterns and gamete morphology. Hum Reprod. 2002; 17: Schubert B, Canis M, Darcha C, Artonne C, Smitz J, Grizard G. Follicular growth and estradiol follow-up after subcutaneous xenografting of fresh and cryopreserved human ovarian tissue. Fertil Steril. 2008; 89: Scott JR, Hendrickson M, Lash S, Shelby J. Pregnancy after tubo ovarian transplantation. Obstet and Gynecol. 1987; 70: Shultz LD, Ishikawa F, Greiner DL. Humanized mice in translational biomedical research. Nat Rev Immunol. 2007; 7: Silber S. Ovarian tissue cryopreservation and transplantation: scientific implications. J Assist Reprod Genet. 2016; 1-9. Silber SJ, De Rosa M, Pineda J, Lenahan K, Grenia D, Gorman K, Gosden RG. A series of monozygotic twins discordant for ovarian failure: ovary transplantation (cortical versus microvascular) and cryopreservation. Hum Reprod 2008; 23: Silber SJ, Lenahan KM, Levine DJ, Pineda JA, Gorman KS, Friez MJ, Crawford EC, Gosden RG. Ovarian transplantation between monozygotic twins discordant for premature ovarian failure. N Engl J Med. 2005; 353: Silber SJ. Ovary cryopreservation and transplantation for fertility preservation. Mol Hum Reprod 2012; 18: Sonmezer M, Oktay K. Orthotopic and heterotopic ovarian tissue transplantation. Best Prac Res Clin Obstet Gynaecol. 2010; 24: Stern CJ, Toledo MG, Hale LG, Gook DA, Edgar DH. The first australian experience of heterotopic grafting of cryopreserved ovarian tissue: evidence of establishment of normal ovarian function. Aust N Z J Obstet Gynecol. 2011; 51: Stern CJ, Gook D, Hale LG, Agresta F, Oldham J, Rozen G, Jobling, T. First reported clinical pregnancy following heterotopic grafting of cryopreserved ovarian tissue in a woman after a bilateral oophorectomy. Hum Reprod. 2013; 28: Suzuki N, Hashimoto S, Igarashi S, Yamanaka M, Yamochi T, Takenoshita M, Hosoi Y, Morimoto Y, Ishizuka B. Assessment of long-term function of heterotopic transplants of vitrifid ovarian tissue in cynomolgus monkeys. Hum Reprod. 2012; 27:

65 64 Van Eyck AS, Jordan BF, Gallez B, Heilier JF, Van Langendonckt A, Donnez J. Electron paramagnetic resonance as a tool to evaluate human ovarian tissue reoxygenation after xenografting. Fertil Steril. 2009; 92: Van Langendonckt A, Romeu L, Ambroise J, Amorim CA, Bearzatto B, Gala JL, Donnez J, Dolmans MM. Gene expression in human ovarian tissue after xenografting. Mol Hum Reprod. 2014; 20: Vollmar B, Glasz J, Menger MD, Messmer K. Leukocytes contribute to hepatic ischemia/ reperfusion injury via intercellular adhesion molecule-1-mediated venular adherence. Surgery. 1995; 117: Wang L, Ying YF, Ouyang YL, Wang JF, Xu J. VEGF and bfgf increase survival of xenografted human ovarian tissue in an experimental rabbit model. J Assist Reprod Genet. 2013; 30: Wang Y, Chang Q, Sun J, Dang L, Ma W, Hei C, Shen X, Zhao C, Cai Y, Pei X., Zhang X, Jiang X. Effects of HMG on revascularization and follicular survival in heterotopic autotransplants of mouse ovarian tissue. Reprod Biomed Online. 2012; 24: Yang HY, Cox SL, Jenkin G, Findlay J, Trounson, Shaw J. Graft site and gonadotrophin stimulation influences the number and quality of oocytes from murine ovarian tissue grafts. Reproduction. 2006; 131: Yi-Hsin L, Yu-Chi Y, Chii-Ruey T, Wei-Jen S, Jah-Yao L, Chi-Huang C. "Evaluating the effects of immunosuppression by in-vivo bioluminescence imaging after allotransplantation of ovarian grafts". Reprod biomed online. 2011; 22: Youm HW, Lee JR, Lee J, Jee BC, Suh CS, Kim SH. Transplantation of mouse ovarian tissue: Comparison of the transplantation sites. Theriogenology. 2015; 83: Zelinski MB, Murphy MK, Lawson MS, Jurisicova A, Pau KYF, Toscano NP, Jacob DS, Fanton JK, Casper RF, Dertinger SD, Tilly JL. In-vivo delivery of FTY720 prevents radiation-induced ovarian failure and infertility in adult female nonhuman primates. Fertil Steril. 2011; 95: Zhang H, Yang Y, Ma W, Wu H, Zheng X, Hei C, Sun M, Ma WMH, Chang Q, Wang H, Cai Y, Xie Y, Zhao C, Pei X, Wang Y. The revascularization and follicular survival of mouse ovarian grafts treated with fsh during cryopreservation by vitrification. CryoLetters. 2016; 37 (2):

66 65 Zhang JM, Sheng Y, Cao YZ, Wang HY, Chen ZJ. Cryopreservation of whole ovaries with vascular pedicles: vitrification or conventional freezing? J Assist Reprod Genet. 2011; 28(5): Zhang Q, Wang SM, Yao PB, Zhang L, Zhang YJ, Chen RX, Fu Y, Zhang JM. Effects of L-carnitine on follicular survival and graft function following autotransplantation of cryopreserved-thawed ovarian tissues. Cryobiology. 2015; 71:

67 66 7 CAPÍTULO 2 Desenvolvimento de foliculos pré-antrais caprinos após autotransplante ortotópico de tecido ovariano Development of caprine preantral follicles after orthotopic autotransplantation of ovarian tissue Periódico: Human Reproduction Archives (aceito em outubro 2017) (Qualis B4)

68 67 RESUMO O objetivo deste estudo foi avaliar a morfologia, densidade, desenvolvimento folicular e produção hormonal após o autransplante ortotópico de tecido ovariano caprino fresco ou vitrificado. O córtex ovariano fresco ou vitrificado foi autotransplantado durante seis meses em duas e três cabras adultas bilateralmente ovariectomizadas, respectivamente. Os animais foram monitorados durante 196 dias e o sangue coletado. Foi observado que a porcentagem de folículos pré-antrais morfologicamente normais após o transplante de tecido ovariano fresco foi semelhante ao controle. A densidade folicular no transplante fresco reduziu significativamente quando comparada ao controle fresco. Infelizmente, após o transplante de tecido vitrificado, não foi possível identificar folículos após a recuperação. Além disso, a proporção de folículos em desenvolvimento foi maior (P <0,05) no transplante fresco do que no controle. Os níveis plasmáticos de progesterona aumentaram do dia 179 ao dia 195 do transplante. Em conclusão, o transplante ortotópico do tecido ovariano fresco foi capaz de manter a sobrevivência dos folículos pré-antrals bem como a restauração da função endócrina de cabra. Palavras-chave: Vitrificação; Transplante ovariano; Folículos pre-antrais; Função endócrina.

69 68 Development of caprine preantral follicles after orthotopic autotransplantation of ovarian tissue: Short communication (Desenvolvimento de foliculos pré-antrais caprinos após autotransplante ortotópico de tecido ovariano: Breve comunicação) Nathalie Jiatsa Donfack 1. Kele Amaral Alves 1. Benner Geraldo Alves 1. Leonardo Tondello Martins 2. Carlos Enrique Méndez-Calderón 2. Saul Gaudencio Neto 2. Luis Henrique Aguiar 2. Regiane Rodrigues dos Santos 3. Sheyla Farhayldes Souza Domingues 3. Marcelo Bertolini 2. José Ricardo de Figueiredo 1. Johan Smitz 4. Ana Paula Ribeiro Rodrigues* 1 1 Faculty of Veterinary Medicine, Laboratory of Manipulation of Oocytes and Preantral Follicles (LAMOFOPA), State University of Ceará, Fortaleza, CE, Brazil. 2 Laboratory of Molecular Biology and development, University of Fortaleza, CE, Brazil. 3 Laboratory of Biology and Medicine of Wild Animals of Amazon, University Federal of Pará-Belem-PA, Brazil. 4 Follicle Biology Laboratory, Center for Reproductive Medicine, UZ Brussel, Laarbeeklaan 101, B-1090 Brussels, Belgium *Correspondence should be addressed to: aprrodriguespapers@gmail.com Programa de Pós-Graduação em Ciências Veterinárias (PPGCV). Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA). Universidade Estadual do Ceará (UECE). Av. Paranjana, 1700, Campus do Itaperi. Fortaleza CE Brasil. CEP: Tel.: ; Fax: address: aprrodriguespapers@gmail.com

70 69 ABSTRACT The aim of this study was to evaluate the follicle morphology, density, development and hormone production after orthotopic autransplantation of fresh or vitrified goat ovarian tissue. Fresh and vitrified ovarian cortex was orthotopically autotransplanted for six months in two and three adults bilaterally ovariectomized goats, respectively. The animals were monitored during 196 days and blood samples collected. It was observed that, the percentage of morphologically normal preantral follicles (MNPF) after grafting of fresh ovarian tissue was similar to control. The follicular density, in the fresh graft reduced significantly when compared to fresh control. Unfortunately, after transplantation of vitrified tissue it was not possible to identified any follicles after recovery. Furthermore, the proportion of developing follicles was higher (P < 0.05) in the fresh auto-grafts than in control fragments. Moreover, progesterone plasma levels increased from day 179 to day 195 of transplantation. In conclusion, orthotopic transplantation of fresh ovarian tissue was able to keep healthy the preantral follicles, as well as the restoration of goat endocrine function. Keywords: Vitrification; Ovarian transplantation; Preantral follicles; Endocrine function.

71 70 Introduction The mammalian ovarian cortex contains the preantral follicles reserve which comprises of approximately 80 90% of primordial follicles and only 10-20% constitute the primary and secondary follicles 1. However, the absence of inhibitory signal or even the presence of toxic environment such as chemotherapy can negatively affect the oocytes in the ovarian reserve, causing death or abnormal activation leading to atresia, all of which results in depletion of ovarian follicles and hormonal imbalance 2. Therefore, ovary tissue cryopreservation followed by transplantation has been extensively investigated with the aim of restoring the reproductive function in different species. In large mammals, for instance, transplantation of ovarian tissue has been shown a sign of a realistic alternative to obtain complete follicular development in goat 3. Moreover, it has been shown live-births after autotransplantation of vitrified ovine ovary tissue 4. This technique has also shown promising results in human, especially if tissue is cryopreserved applying conventional freezing instead of vitrification 5. Currently, 86 successful births have been reported from transplantation of cryopreserved ovarian tissue 6. However, despite the good results obtained after transplantation of cryopreserved ovary, this technique has still been considered as experimental 7. Due to ethical concerns and scarce availability of human ovarian tissue, as well as the need to develop alternatives to preserve endangered animal breeds and species 8, the number of investigations using different surgical approaches, transplantation sites, and several animal models is increasing 9. Nevertheless, goat ovary is a candidate for such research based on structural and functional similarities with women ovaries 10. According to the literature, to date, the only study performed with ovarian goat tissue transplantation was described by Santos et al. 3. These authors showed that, the percentage of normal preantral follicles in fresh or frozen-thawed ovarian tissue after one year of transplantation was lower than fresh or non-cryopreserved (control) ovarian tissue. In addition, the authors also reported that only primordial follicles survived after transplantation of frozen-thawed ovarian tissue. Then, the aim of this study was to verify if transplantation of fresh and vitrified goat ovarian and short time transplantation (6 months instead 1 year) of the ovarian tissue is better to preserve the morphology, density and follicular development. Additionally, the endocrine function after 6 months of ovary autotransplantation was also analyzed.

72 71 Materials and methods Sexually mature, non-pregnant and normal cycling goats (n = 5) were hemi (n = 3) or bilateral (n = 2) ovariectomized after a ventral midline skin incision and anesthesia. Immediately after ovariectomy, one fragment of each 5 animals was fixed in paraformaldehyde (PAF) 4% for classical histology and served as fresh control. Afterward, the animals submitted to bilateral ovariectomy received ovarian cortical fragments (3x3x1 mm) which were sutured together and grafted under the curvature minor region of the left uterine horn side as described by Santos et al. 3 and considered as fresh graft. Furthermore, the ovary of the animals submitted to hemilateral ovariectomy was vitrified according to Carvalho et al. 11 for 14 days and after warming, one fragment of each animal was fixed and served as vitrified control. The remaining fragments (10-12) were autotransplanted and considered as vitrified graft following a complete ovariectomy. After transplantation, all the animals were monitored during 196 days (~ 6 months). Blood samples were collected on days 48, 60, 178 and after this last day it was done four times per week during 14 days before recovery of the fragments to assess progesterone plasma levels. Concentrations of progesterone were determined using the ARCHITECT platform (Abbott Diagnostics, Abbott Park, IL, USA). Additionally, two non-sterilized healthy goats were used as reference for comparative plasma progesterone analysis. After 184 days of transplantation, the animals were treated with progesterone through intravaginal implant to regulate their estrus cycle, since no estrous behavior was observed naturally after this period. Finally, after 196 of transplantation, the goats were euthanized and the fresh and vitrified ovary fragments recovered. Fresh or vitrified controls fragments as well as the grafts (fresh or vitrified) were processed histologically and follicles were classified according to development stage (primordial, transition, primary or secondary) and morphology (normal or degenerated) as described by Carvalho et al. 11. The follicular density was also evaluated according by Santos et al. 12. The percentages of normal early stage follicles were compared y NOV and Tukey s test Mean values of follicular density per square millimeter were compared by Student s t-test and ANOVA. The follicle was the experimental unit.

73 72 Results and discussion In the current experiment, it was observed three antral follicles in fresh graft ovarian fragments. Moreover, 71% and 60% of fresh and vitrified grafts were recovered respectively after 196 days of transplantation. It is observed in Fig. 1A that the percentage of MNPF in the vitrified control (30%) or even fresh graft (66%) was not significant different from fresh control (64%). In contrast to what was observed in the present study, Santos et al. 3 using the same species, observed a significant decrease of MNPF in fresh graft in comparison with fresh control. This difference of results could be due to the fact that, in the current study, the duration of transplantation was lower (6 months) while the time used by those authors was one year. Unfortunately, in this work it was not possible to find any follicles after transplantation of vitrified ovarian fragments. This result cohoborate those reported by Donnez et al. 13 as they observed no follicles in three patients after transplantation of frozen-thawed ovarian tissue. We believe that, the absence of follicles in vitrified graft could be due to the ovary quality before the transplantation, because the fresh control already had a high percentage of degenerate follicles in comparison of what was previously established for the caprine species. According to Silva et al. 14, the acceptable percentage of degeneration in the fresh ovary is 12%, however, in the present study this percentage was three times higher (36%). Moreover, cryopreservation makes follicles more susceptible to cell death by increasing osmotic stress 15 caused by high concentration of cryoprotectants used for vitrification. This reinforces the high percentage of degenerated follicles associated with the absence of follicles in the vitrified graft observed in our study. In addition, several others factors can affect ovarian graft longevity, including: ovarian reserve (follicular density, which is age dependent); graft size and method of ovarian tissue preparation (freezing-thawing techniques); inhomogeneous distribution of follicles in grafted cortical pieces; and angiogenic potential of the graft site influencing the degree of ischemia after transplantation 13. The follicular density, in the fresh graft reduced significantly when compared to fresh control (Fig. 1B). Experimental studies have indicated that the fall in number of primordial follicles in grafted tissue is due to hypoxia and the delay before reimplanted cortical tissue becomes revascularised 16. This could explain the decrease of follicular density observed after ovary transplantation. Moreover, the proportion of developing (transition, primary and secondary) follicles was higher in the fresh grafts than in fresh control (Fig. 2A). Such an increase in the rates of developing follicles together with a

74 73 decreased density of normal follicles can be indicative of massive follicular activation. Usually, graft revascularization takes places in few days 3 and, before this, ovarian tissue will be challenged with hypoxia and consequent oxidative stress, which plays an important role in massive follicular activation and burnout of the follicular reserve 17. An increase in progesterone plasma levels was observed from day 179 to day 195. Considering that progesterone was administered day 184 only, the initial increased levels indicate that grafts were allowing the animals to recover their reproductive/endocrine function (Fig. 2B). The orthotopic transplantation of ovarian tissue was previously proved to be efficient for restoration of endocrine activity as evidenced by circulating steroid levels 70 days after grafting and it was maintained up to one year without hormonal stimulation 3. In the present study, we obtained restoration of ovarian function just after six months from bilaterally ovariectomized animals with low percentage of normal follicles. In conclusion, orthotopic transplantation of fresh ovarian tissue was able to maintain a similar percentage of morphological normal preantral follicles with fresh control as well as the restoration of goat endocrine function. Moreover, to transplant cryopreserved ovary tissue, it is recommended to analyze previously the percentage of morphological normal follicles and this percentage should be high than 30%. Moreover, vitrification protocol should be improved to minimize follicles loss. Acknowledgment Funding for this work was provided by National Counsel of Technological and Scientific Development (CNPq: ) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES: / ). Johan Smitz is Especial Visitor Researcher from CAPES. Statement of animal s rights The Ethics Commission for the Use of Animal Institutional Care and Use Committee of the State University of Ceará approved this study (number: /2015).

75 74 Conflict of interest statement The authors have declared that no competing interests exist. All authors gave their informed consent prior to their inclusion in the study.

76 75 Figures Fig. 1: Proportion of normal preantral follicles (1A) and follicle density (1B) in fresh and vitrified ovary fragments before and after transplantation. 1C and 1D histological normal secondary follicles before and after grafting, respectively. a,b Differs within the experimental group. cale ar= 5 μm Original magnification 4 X

77 76 Fig. 2 Proportion of follicular development in fresh control fragments and fresh graft (2A) and Mean progesterone concentration (± SEM) produced by animals from fresh transplanted group during the experimental period of 195 days (2B). The progesterone production from control group animals was evaluated since the insertion of hormonal implant (179 days). a,b Differs within the experimental group. * Statistical difference among treatments in the same day (P < 0, 05)

78 77 REFERENCES 1. Telfer EE, Mclaughlin M. In vitro development of ovarian follicles. Semin Reprod Med. 2011; 29: Kano M, Sosulski AE, Lihua Zhang L, Saatcioglu HD, Wang D, Nagykery N, et al. AMH/MIS as a contraceptive that protects the ovarian reserve during chemotherapy. PNAS. 2017;E1688 E Santos RR, Knijn HM, Vos PL, Oei CG, Van Loon T, Colenbrander B, et al. Complete follicular development and recovery of ovarian function of frozenthawed, autotransplanted caprine ovarian cortex. Fertil Steril. 2009; 9: Bordes A, Lornage J, Demirci B, Franck M, Courbiere B, Guerin JF, et al. Normal gestations and live births after orthotopic autograft of vitrified warmed hemi-ovaries into ewes. Hum Reprod ; 20: Donnez J, Dolmans MM. Ovarian cortex transplantation: 60 reported live births brings the success and worldwide expansion of the technique towards routine clinical practice. J Assist Reprod Genet ; 32: Jensen AK, Macklon KT, Fedder J, Ernst E, Humaidan P, Andersen CY. 86 successful births and 9 ongoing pregnancies worldwide in women transplanted with frozen-thawed ovarian tissue: focus on birth and perinatal outcome in 40 of these children. J Assist Reprod Genet. 2016; Salama M, Woodruff TK. New advances in ovarian autotransplantation to restore fertility in cancer patients. Cancer Metastasis Rev. 2015; 34: Santos RR, Amorim C, Cecconi S, Fassbender M, Imhof M, Lornage J, et al. Cryopreservation of ovarian tissue: an emerging technology for female germline preservation of endangered species and breeds. Anim Reprod Sci. 2010; 122: Telfer EE, Zelinski MB. Ovarian Follicle Culture: Advances and Challenges for Human and Non-Human Primates. Fertil Steril. 2013; 99: Figueiredo JR, Rodrigues APR, Silva JRV, Santos RR. Cryopreservation and in vitro culture of caprine preantral follicles. Reprod Fertil Dev. 2011; 23: Carvalho AA, Faustino LR, Silva CM, Castro SV, Lopes CA, Santos RR, et al. Novel wide-capacity method for vitrification of caprine ovaries: Ovarian Tissue Cryosystem (OTC). Anim Reprod Sci. 2013; 138:

79 Santos SSD, Biondi FC, Cordeiro MS, Miranda MS, Dantas JK, Figueiredo JR, et al. Isolation, follicular density, and culture of preantral follicles of buffalo fetuses of different ages. Anim Reprod Sci : Donnez J, Dolmans MM, Pellicer A, Diaz-Garcia C, Serrano MS, Schmidt KT, et al. Restoration of ovarian activity and pregnancy after transplantation of cryopreserved ovarian tissue: a review of 60 cases of reimplantation. Fertil Steril. 2013; 99: Silva JRV, Ferreira MAL, Costa SHF, Santos RR, Carvalho FCA, Rodrigues APR, et al. Degeneration rate of preantral follicles in the ovaries of goats. Small Rumin Res, 2002: Men H, Monson RL, Parrish JJ, Rutledge JJ. Degeneration of cryopreserved bovine oocytes via apoptosis during subsequent culture. Cryobiology. 2003; 47: Donnez J, Dolmans MM, Demylle D, Jadoul P, Pirard C, Squifflet J, et al. Live birth after orthotopic transplantation of cryopreserved ovarian tissue. Lancet. 2004; 364: Gavish A, Peer G, Hadassa R, Yoram C, Meirow, D. Follicle activation and urn-out contri ute to post-trasplantiation follicle loss in ovarian tissue grafts: the effect of graft thickness. Hum Reprod. 2014; 29:

80 79 8 CAPÍTULO 3 Estratégias in vivo e in vitro para manter o desenvolvimento de folículos pré-antrais após a vitrificação do tecido ovariano caprino In vivo and in vitro strategies to support caprine preantral follicle development after ovarian tissue vitrification Periódico: Reproduction Fertility and Development (Aceito em outubro 2017) (Qualis A2)

81 80 RESUMO O objetivo deste estudo foi comparar o tecido ovariano caprino fresco e vitrificado após autotransplante e cultivo in vitro. As cabras adultas foram completamente ovariectomizadas e cada par de ovários foi fragmentado e distribuído em 6 tratamentos: controle fresco, transplante fresco, cultivo fresco, controle vitrificado, transplante vitrificado e cultivo vitrificado. Os parâmetros avaliados foram a morfologia, desenvolvimento, crescimento, densidade folicular, revascularização e produção hormonal. Três folículos antrais (dois em tecido ovariano do transplante fresco e um do transplante vitrificado) foram observados na superfície do enxerto após 90 dias de transplante. O controle fresco, o transplante fresco e vitrificado apresentaram porcentagem similar de folículos morfologicamente normais. O cultivo in vitro do tecido fresco ou vitrificado mostrou maior porcentagem de folículos em desenvolvimento (transição, primário e secundário). O transplante mostrou uma menor densidade folicular. Os níveis séricos de estradiol permaneceram constantes durante todo o período de transplante. Contrariamente, a produção de progesterona diminuiu significativamente. O cultivo fresco mostrou uma menor expressão de mrna de CD31. Em conclusão, a função ovariana de cabras pode ser restaurada com sucesso após o transplante de tecido ovariano fresco e vitrificado. No entanto, o transplante induziu maior perda de folículos em relação ao cultivo in vitro. Palavras-chave: Foliculogênesis. Transplantação heterotópico. Criopreservação. Cabra.

82 81 In vivo and in vitro strategies to support caprine preantral follicle development after ovarian tissue vitrification Abridged title: Transplantation support caprine follicles growth N. J. Donfack A, K. A. Alves A, B. G. Alves A, R. M. P. Rocha A, J. B. Bruno A, L. F. Lima A, C. H. Lobo A, R. R. Santos B, S. F. S. Domingues B, M. Bertolini CD, J. Smitz E and A. P. R. Rodrigues A* A Faculty of Veterinary Medicine, Laboratory of Manipulation of Oocytes and Preantral Follicles (LAMOFOPA), State University of Ceará, Fortaleza, CE, Brazil. B Laboratory of Biology and Medicine of Wild Animals of Amazon, University Federal of Pará-Belem-PA, Brazil. C Federal University of Rio Grande do Sul, Veterinay Faculty, Porto Alegre, RS-Brazil D Laboratory of Molecular Biology and development, University of Fortaleza, CE, Brazil. E Follicle Biology Laboratory, Center for Reproductive Medicine, UZ Brussel, Laarbeeklaan 101, B-1090 Brussels, Belgium *Correspondence should be addressed to: aprrodriguespapers@gmail.com Programa de Pós-Graduação em Ciências Veterinárias (PPGCV). Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA). Universidade Estadual do Ceará (UECE). Av. Paranjana, 1700, Campus do Itaperi. Fortaleza CE Brasil. CEP: Tel.: ; Fax: address : aprrodriguespapers@gmail.com

83 82 Abstract The objective of this study was to compare fresh and vitrified goat ovarian tissue after autotransplantation and in vitro culture. Adult goats were completely ovariectomized and each ovarian pair was sliced and distributed into 6 different treatments: fresh control, fresh transplant, fresh culture, vitrified control, vitrified transplant and vitrified culture. The main points were follicular morphology, development, growth, density, revascularization and hormone production. Three antral follicles (two in fresh and one in vitrified transplant) were observed on the surface of the graft after 90 days of transplantation. Fresh control, fresh and vitrified transplant had a similar percentage of morphological normal follicles. In vitro culture of fresh or vitrified tissue showed higher percentage of developing (transition, primary and secondary) follicles. Transplantation showed a lower follicular density. Serum estradiol levels remained constant during the entire transplantation period. In contrast, progesterone production decreased significantly. Fresh culture showed a lower expression of CD31 mrna. In conclusion, restoration of goat ovarian function can successfully be achieved following transplantation of both fresh and vitrified goat ovarian tissue. However, transplantation induced higher follicles loss than in vitro culture. Additional Keywords: Folliculogenesis. Heterothopic transplantation. Cryopreservation. Goat.

84 83 Introduction Cancer survivors seek the resumption of a normal and healthy life, which often includes starting a family. Therefore, ovarian tissue (OT) cryopreservation followed by transplantation becomes the main and most viable option to preserve and consequently regenerate the fertility of women who suffer from premature ovarian failure (POF) due to chemotherapy treatments (Donnez et al. 2013). This option is also the most suitable for sexually immature women (prepubertal patients) (Schmidt et al. 2011) and those women who want to postpone the motherhood (Bernstein and Wiesemann 2014). Fortunately, the reversal of POF resulting from cancer treatments with transplantation of cryopreserved ovarian tissue has become a reality. Currently, the exact number of children born after OT cryopreservation worldwide is unknown precisely; however, as reviewed by Jensen et al. (2016), 86 children have been born from OT cryopreservation and transplantation. In human, live births have been achieved using the slow freezing process, except in reports by Kawamura et al. (2013) and Suzuki et al. (2015), which used vitrification as a method for cryopreservation of ovarian tissue. Despite the positive results achieved with slow freezing, the formation of intracellular crystals remains the major cause of cellular damage during cryopreservation and the rate of pregnancy after transplantation of cryopreserved ovarian tissue is only 20-30% (Schmidt et al. 2011). An attractive alternative method is vitrification, which prevents the ice crystals formation in the intracellular space, since the basic principle is to increase the viscosity of the cryopreservation solution and the formation of a glassy state (Kagawa et al. 2009). In support of this, live offspring from vitrified mouse (Migishima et al. 2006), sheep (Bordes et al. 2005) and human (Suzuki et al. 2015) ovaries were obtained after orthotopic transplantation. Despite the success reported after OT cryopreservation in humans, some researchers warn of the possibility of reintroduction of malignant cells after ovarian tissue transplant (Maffei et al. 2013; Nichols-Burns et al. 2014). To avoid this risk, the ovarian cortex after cryopreservation may be subjected to in vitro culture, aiming the full growth and maturation of preantral ovarian follicles (Woodruff 2007; 2010). In vitro follicle growth has great potential to provide an additional option for fertility preservation, specially for young women and girls under cancer treatment (Shea et al ). This technique does not require hormone stimulation, is available to both

85 84 reproductive-age women and prepubertal girls (Jeruss and Woodruff 2009). Once grown, these follicles may provide oocytes able to be in vitro fertilized, offering the chance of motherhood from their own genetic material. Although several in vitro follicle culture systems have successfully supported the growth and maturation of isolated preantral follicles from ovarian tissue in several especies including goat (Saraiva et al. 2010; Araújo et al. 2011), the in vitro development of these follicles included in fresh or even cryopreserved ovarian tissue is a major challenge. Therefore, more research about the ideal in vitro environment to achieve preantral follicle development is still necessary. In this context, an immediate alternative is the transplantation (in vivo culture) of these follicles included in the ovarian tissue which can provide a favorable environment for the follicular development after cryopreservation (Wang et al. 2013). Based on this, we considered to analyze preantral follicles survival and development into fresh and vitrified-warmed ovarian tissue, from the same donor, submitted to two different environments; in vitro and in vivo. To the best of our knowledge, a study comparing transplant and in vitro culture of goat ovarian tissue is still lacking. Therefore, the current study was assigned to: 1) to compare fresh and vitrified-warmed goat ovarian tissue after autotransplantation and in vitro culture in terms of follicular morphology and development, 2) to evaluate the endocrine function of goats after ovary fragments (fresh and vitrified) transplantation, and 3) to evaluate the revascularization of ovarian tissue after transplantation. Materials and methods This experiment was approved and performed under the guidelines of the Ethics Committee for Animal Use of the State University of Ceara ( /2015). The cryoprotectants (ethylene glycol and dimethyl sulfoxide) were obtained from Dinâmica (Dinâmica Química, Diadema, SP, Brazil) and the other chemicals were obtained from Sigma (Sigma Chemical Co., St. Louis, MO, USA), unless stated otherwise.

86 85 Collection and distribution of ovarian tissue This study was carried out in Fortaleza south and west Ceará, Brazil), during the rainy season. Eleven healthy adult goats, non-pregnant with normal estrous cyclicity were used. The goats were completely ovariectomized and subsequently, each ovarian pair (n = 11) was sliced into 28 cortical fragments (5x5x1 mm 3 ) and distributed into six different treatments as presented in the supplementary Fig. 1. Briefly, immediately after ovariectomy, three cortical fragments of each animals were fixed in paraformaldehyde 4 % (PAF) for classical histology and one fragment was immersed in trizol for real time polymerase chain reaction (qpcr), which served as fresh control. Afterward, the animals received back seven ovarian cortical fragments which were grafted with Prolene 6/0 to the left site of the peritoneum and considered as fresh transplant. Subsequently three fragments were transported to the laboratory in MEM-HEPES supplemented with antibiotics at 38 ºC for up to 2 hours and submited to in vitro culture, considered as fresh culture. The remaining fragments (n = 14) were vitrified by solid surface and stored in liquid nitrogen (-196 C) for one week. After warming, three fragments were fixed in 4 % PAF while 1 fragment was immersed in trizol, corresponding to the vitrified control. Others seven fragments were autotransplanted to the right side of the peritoneum after a second surgery procedure and named the vitrified transplant. Finaly, three fragments were in vitro cultured for 7 days and considered as vitrified culture treatment. Vitrification and warming procedures of ovarian tissue Vitrification was performed using the ovarian tissue cryossystem (OTC), a solid surface technique, as described by Carvalho et al. (2014). Briefly, two vitrification (VS) solutions were used. The VS1 consisted of MEM supplemented with 10 mg/ml bovine serum albumin (BSA), 20 IU catalase, 0.25 M sucrose, 10 % ethylene glycol (EG) and 10 % dimethyl sulfoxide (DMSO). The VS2 had a similar composition of VS1 but with higher concentration of cryoprotectants (20 % EG and 20 % DMSO). Initially, the fragments were exposed to VS1 during 4 min followed by 1 min into VS2. Both time exposures were performed using the OTC. After cryoprotectants exposition, the vitrification solution was then removed and the OTC containing the ovarian tissue was closed and immediately immersed vertically into liquid nitrogen at -196 C. Following

87 86 the cryostorage for up to 1 week the vitrified ovarian fragments were warmed in air at room temperature (RT 25 C) for 1 min, followed by immersion in a water bath (37 C) for 30 s. After warming, the cryoprotectants were removed by a three-step washing solutions (WS; 5 min each) in WS1: MEM + 3 mg/ml BSA M sucrose, WS2: MEM + 3 mg/ml BSA M sucrose and WS3: MEM + 3 mg/ml BSA. Autotransplant and recovery of ovarian fragments after 90 days Animals (n=11) were deprived from food for 24 hours and water for 12 hours before surgery. Goats were anesthetized by intra venous injection of 0.05 mg/kg acepromazine, 5 mg/kg Ketamine and 0.05 mg/kg Xylazine solution. Then, the animals were intubated with isoflurane to keep them in general anesthesia during surgery. In addition, local anesthesia was performed using 10 mg/kg of lidocaine. After medial ventral incision, seven pieces of fresh or vitrified/warming ovarian tissue (approximately 5x5x1mm) were sutured with one stitch (6/0) to the inner site of the peritoneum under the abdominal wall (heterotopic transplantation). The abdominal wall was then closed. After 90 days, the goats were slaughtered and the grafts were recovered and distributed to histological and molecular evaluations. In vitro culture of preantral follicles included in ovarian fragments (in situ) Non-vitrified (fresh ovary) and vitrified/warmed ovarian fragments were cultured during 7 days. The in vitro culture was performed at 39 C in 5% CO2 in a humidified incubator, and all media were incubated for 1 hour before use. The culture medium was according to Alves et al. (2012). Briefly the basic medium consisted of α- MEM (ph ) supplemented with 50 μg ml -1 ascorbic acid, 1% ITS (10 μg ml -1 insulin, 5.5 μg ml -1 transferrin and 0.5 ng ml -1 selenium), 2 mm glutamine, 2 mm hypoxanthine, and 200 ng ml -1 GDF-9 and 100 μg ml -1 penicillin-streptomycin. Total medium replacement (1 ml) was made every 48 hours. Histological and density analysis of ovarian follicles Fresh control, vitrified, in-vitro cultured (fresh or vitrified) and transplanted (fresh or vitrified) ovarian fragments were fixed in 4% paraformaldehyde (PAF) at RT for 4 h,

88 87 dehydrated in a graded series of ethanol, clarified with xylene, embedded in paraffin wax, and serially sectioned into 7 μm thickness. The sections were stained with periodic acid Schiff (PAS)-hematoxylin for histological analysis and follicular morphology was examined by light microscope (magnification 400). For each treatment, follicles were counted only in sections where the oocyte nucleus was visible. Follicles were classified as morphologically normal when they contained an intact oocyte and granulosa cells, or degenerated when they contained an oocyte with a pyknotic nucleus, ooplasma shrinkage and/or granulosa cell layers that were disorganized and detached from the basement membrane. Follicles were also classified according the development stage (Carvalho et al. 2013) as: primordial (one layer of flattened or pre-granulosa cells around the oocyte); transition (one layer of flattened and cuboidal cells around the oocyte); primary (one layer of cuboidal granulosa cells around the oocyte) and secondary follicles (two or more layers of cuboidal granulosa cells around the oocyte). Furthemore, follicular and oocyte diameter were measured only in healthy follicles with the aid of an ocular micrometer coupled to a stereomicroscope (SMZ 645 Nikon, Tokyo, Japan; 40 magnification). Two perpendicular diameters were recorded for each follicle or oocyte and the average of these two values was reported as the follicular or oocyte diameter. Follicular density was also evaluated according by Santos et al. (2006). Hormonal assay Progesterone and estradiol concentrations were measured in blood after transplantation of ovarian fragments. Blood sample were collected on Days 0 (day of ovariectomy), 7, 30, 60 and 90 after transplantation. The concentrations of estradiol (pmol L -1 ) and progesterone (nmol L -1 ) were measured by amplified chemiluminescence using an immunoassay system (Vitros Eci/EciQ Immunodiagnostic System; Johnson & Johnson Company, Ortho-Clinical Diagnostics, Buckinghamshire, UK) according to manufacturer s instructions with a sensitivity of nmol L -1 for progesterone and pmol L -1 for estradiol. Calibration was done according to the manufacturer s instructions efore each dosage

89 88 Immunohistochemical Staining Immunolocalization of cluster of differentiation 31 (CD31) and stroma cell derived-f r α (SDF- α) were carried out to evaluate the presence of blood vessels. Briefly, ovarian fragments were processed as for classical histology and serially sectioned into 5-μm thickness. Sections were mounted on positively charged slides. Immunohistochemical reactions were performed according to the protocol described by Silva et al. (2004). Briefly, epitopes were activated by incubation at room temperature (RT) in 0.01 M buffered sodium citrate (ph 6.0) supplemented with Tween 20 at C for 5 minutes. Nonspecific binding was blocked by incubation (RT) with 1.25 mg of bovine serum albumin (BSA) diluted in PBS for 30 minutes. Subsequently, the sections were incubated overnight in a humid camera at 4 C with CD31 (1/300; , ABBIOTEC) and SDF-1α 1/1 ; a 9797 BC M anti odies fterwards the slides were washed with PBS and incubated (RT) for 1 h with the biotinylated antirabbit IgG secondary antibody (AB97049, ABCAM) diluted 500 times in PBS containing 1.25 mg of BSA. Then the slides were washed in PBS followed by incubation (RT) for 30 minutes with avidin-biotin (Vector Laboratories, Burlingame, CA, USA) and the immunoreaction was visualized through the use of diaminobenzidine (DAB; - Dako, Inc., USA). Finally, the sections were counterstained with hematoxylin and Scott's solution. Negative controls were obtained by omission of the primary antibodies. Immunostaining was evaluated based on the presence or not of the positive staining. Quantitative PCR For evaluation of CD31 expression, total RNA of ovarian fragments was extracted using the Trizol reagent method (Invitrogen, Carlsbad, CA, USA) according to the recommendations of the manufacturer and further purified with PureLink RN Mini Kit (Anbion, Carlsbad, CA, USA). After extraction, RNA concentration was determined using the NanoDrop System (Thermo Scientific NanoDrop Products), performed with μl of material Before the cdn synthesis all samples were standardized with the same amount of RNA to minimize qpcr variability. cdna synthesis was performed according to the instructions of SuperScript III RT-PCR

90 89 (Invitrogen, Carlsbad, CA, USA) manual using random primers (Invitrogen, Carlsbad, CA, USA) from 1 ng of total RNA. The primers were designed using Primer 3 to perform the amplification of CD31 (Table 1). All primers set were designed to anneal at 60ºC. The qpcr reaction was performed in quadruplet always using control without cdna to avoid possible contamination. Evaluations were performed in IQ5 Real - Time PCR Detection System (Bio - Rad, Hercules, CA, USA) using analysis of relative quantification. Detection of PCR products was measured by monitoring the increase of fluorescence emitted by the marker Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA). For all amplifications, one dissociation curve (melting curve) was done for the verification of unspecific amplifications arising from contamination was held. The qpcr thermal cycle was as follow: initial denaturation and activation of the polymerase for 15 min at 94 C, followed by 40 cycles of 15 s at 94 C, 30 s at 60 C and 45 s at 72 C. the final extension was for 10 min at 72 C. Quantification of the transcripts of target genes was calculated from the difference of the values of the Cq values (threshold cycle PCR) in relation to transcripts of the endogenous gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). First, the mean Cqs of each sample, both the target gene and the endogenous gene was determined. From each sample, the subtraction of the mean value of the Cqgene-target to Cqgene-endogene provided the ΔCq u sequently one ΔCq corresponding to a cali rator was chosen normalizing all values y su tracting the resulting ΔCq chosen to o tain the ΔΔCq Finally the final value of relative quantification was given by 2 -ΔΔCq, where the calibrator or standard sample chosen was equal to one (Livak and Schmittgen 2001). Statistical analysis Statistical analyses were performed using the Sigma Plot 11.0 software (Systat Software Inc, San Jose, California, USA). Data for morphologically normal follicles, primordial and developing follicles, follicular and oocyte diameters, follicular density, and progesterone and estradiol serum concentrations were not normally distributed (Shapiro-Wilk test), even after submitted to logarithmic transformation. Therefore, variables without normal distribution were compared among treatments by Kruskal- Wallis one-way analysis followed by a post-hoc test Dunn s In vivo serum

91 90 concentrations of estradiol and progesterone were compared among days by the Wilcoxon signed rank test. In addition, the odds ratio and 95% confidence intervals (CI) were calculated to determine the effect of reproductive techniques (vitrification, in vitro culture, and transplant) on the presence of normal follicles. The mrna expression level was analyzed using the t Tests. Data were presented as mean (± SEM) and percentage, unless indicated otherwise. Statistical significance was defined as P < 0.05 (two-sided). Results Macroscopic assessment and follicular morphology Grafts (fresh or vitrified) had healthy appearance and strong adhesion to the peritoneum. Three antral follicles were macroscopically observed on the surface of the grafts in two of the 11 goats (Fig. 1a). However, only one clear, translucent and apparently normal oocyte was punctured from these follicles. Nonetheless, no specific analysis was performed in this oocyte Fig. 2A illustrates the percentage of normal preantral follicles reduced (P < 0.05) in vitrified control and vitrified culture treatments in comparison with fresh control. Moreover, vitrified transplant fragments showed greater (P < 0.05) percentage of morphological normal follicles than vitrified control and vitrified cultured fragments. On the other hand, no significant difference was observed (P > 0.05) between vitrified control and vitrified culture. A similar percentage (P > 0.05) of normal preantral follicles was found between fresh control, fresh transplant, and vitrified transplant. Follicular/oocyte development and growth after in vivo and in vitro culture Follicular development was characterized by the activation or alleviation from quiescent state as well as by the increase of the size of the oocyte and the follicle as considered morphologically normal. The proportion of developing follicles increased (P < 0.05) in fresh and vitrified cultured in comparison with controls (fresh and vitrified) and fresh transplant treatments However, no difference (P > 0.05) was observed between the vitrified transplant and the other groups (Fig. 2B). Fig. 3 shows the mean oocyte diameter of normal preantral follicles after in vitro culture and transplantation of fresh or vitrified ovarian cortex. After transplantation of

92 91 fresh or vitrified tissue, the oocyte diameter increased significantly when compared to fresh control or others treatments (vitrified control, fresh and vitrified culture). Similar results were observed to follicular diameter except between fresh control and vitrified transplant treatments. On the other hand, both follicle and oocyte diameter decreased significantly after vitrification only (vitrified control) or after in vitro culture in both situations, i.e., fresh or vitrified tissue in comparison with fresh control. Although the oocyte diameter after in vitro culture was lower in vitrified tissue (P < 0.05) than in fresh tissue, this parameter increased significantly after transplantation and was similar to fresh transplanted tissue (P > 0.05). Follicular density after in vivo and in vitro culture Fig. 4 shows the follicular density in fresh and vitrified goat ovarian tissue before and after in vitro culture or autotransplantation. In comparison with fresh control we observed that follicular density was not altered (P > 0.05) after either vitrification only or in vitro culture of fresh ovarian tissue. Furthermore, no significant difference was observed between fresh and vitrified in vitro cultured or fresh and vitrified transplanted ovarian fragments. On the other hand, after transplantation (fresh or vitrified) or after in vitro culture of vitrified tissue the follicular density decreased in comparison with both fresh and vitrified controls (P < 0.05). Association analysis between treatments The association of the percentage of normal preantral follicles between the treatments adopted was further analyzed by odds ratio (Table 2). The analysis showed that the probability to obtain morphologically normal preantral follicles after transplantation of fresh or vitrified tissue is significantly higher than after fresh or vitrified in vitro culture, ranging from 2.1 (vitrified transplant x fresh culture) to 4.9 (fresh transplant x vitrified culture) times. This probability was similar (p = 0.17) between the transplantation of fresh and vitrified tissue. However, after in vitro culture the probability to identify morphologically normal follicles was significantly higher in fresh tissue than in vitrified tissue.

93 92 Estradiol and progesterone serum concentrations after autotransplantation Estradiol serum concentration did not differ (P > 0.05) during all the transplantation period (Fig. 5A). However, progesterone production decreased (P < 0.05) from Day 0 to Day 10 of autotransplant while an increase (P < 0.05) was observed on Days 60 and 90 in comparison with Day 10 after autotransplant. Fig. 5B shows the comparison of estradiol production between the animals without antral follicles (n=9) and the animals with antral follicles (n=2) after graft recovery. However, it was not possible to make a statistical analysis because of the low number of animals with antral follicles. Graft revascularization The expression pattern of immunohistochemical staining for SDF- α and CD31 in caprine ovaries is shown in Fig. 1b. Immunostaining results were classified as weak, moderate or strong based on the staining intensity. The SDF- α in fresh control and fresh transplant shows moderate staining. A weak intensity of SDF- α staining was observed on the vitrified tissue. In contrast, the vitrified transplant tissue demonstrated a strong staining intensity. In relation to CD31 staining, all the treatments showed an intensity classified as moderate. The relative expression patterns of CD31 were evaluated using RT-qPCR (Fig. 6). After in vitro culture of fresh ovarian tissue, the expression of CD31 decreased significantly in comparison with all the other treatments, except vitrified control. Discussion Ovarian cortical tissue transplantation is an excellent technique that has contributed to assisted reproduction, especially in humans. This has been proven by the restoration of the reproductive function of women who underwent ovariectomy prior to exposure to gonadotoxic agents such as chemo/radiotherapy for the treatment of cancer or other disorders. In the case of animals, this technique may be useful to preserve the ovarian and reproductive function of valuable females (eg, transgenic, endangered, etc.)

94 93 which cannot reproduce naturally (Donnez et al. 2013). In addition, ovarian transplantation in domestic animals such as goat may be an excellent model for the investigation of folliculogenesis, factors and process involved in the reproductive function, as well as innovative assisted reproductive techniques to solve problems of human infertility. This study investigated for the first time the development of goat ovarian follicles after autotransplanatation of vitrified tissue. In the current study, spontaneous formation of antral follicles (two follicles in fresh tissue and one in vitrified tissue) was observed on the surface of the grafts after three months of ovary transplantation, confirming the survival and development of follicles present in the graft. This result is similar to those previously reported with the antral follicle formation after four (Lotz et al. 2014) or five (Luyckx et al. 2013) months of xenotransplant of cryopreserved ovarian tissue of prepubertal girls to mice. In goats, Santos et al. (2009) also reported a preovulatory follicle after three months of transplantation of fresh and frozen-thawed ovarian tissue. The results obtained by those authors are promising because even after the death of a genetically valuable animal, it is possible to cryopreserve the ovaries and subsequently transplant them to a recipient female to recover the oocytes for further in vitro fertilization and embryo production. After vitrification of goat ovarian tissue using the OTC, followed or not by in vitro culture, a reduction in the percentage of morphologically normal preantral follicles was observed in comparison with fresh control. Studies using others vitrification devices (macrotube: Lunardi et al. 2012; straw: Ting et al. 2013; conventional solid surface: Bandeira et al. 2015; Cryovial: Abdel-Ghani et al. 2016) also observed impairment of follicular morphology present in ovarian tissue. Carvalho et al. (2013) using the OTC for vitrification of caprine ovarian tissue also reported a reduction in the percentage of normal follicles. This decrease might be caused by the osmotic stress to which cells are exposed during vitrification (Vajta et al. 1998), toxicity of cryoprotectants (Aye et al. 2010), basement membrane impairment (Ghetler et al. 2005) and other alterations at ionic (Gualtieri et al. 2011) or molecular (David et al. 2011) levels. Moreover, this effect could be also due to the fact that cryopreservation makes follicles less tolerant to in vitro culture and more susceptible to cell death (Men et al. 2003). Interestingly, a similar percentage of normal preantral follicles was found among fresh control, fresh and vitrified transplant treatments. This suggests that the site (peritoneum) of transplantation provides a good blood supply for graft survival.

95 94 Our results further showed that the proportion of developing follicles increased after in vitro culture (fresh or vitrified) in comparison with controls (fresh or vitrified tissue). We believe that this could be due to the presence of GDF-9 in the culture medium. Martins et al. (2008) obtained similar results after seven days of in vitro culture of goat fresh ovarian tissue using that growth factor. GDF-9 belongs to the super family of transforming growth factors ß (TGF) and regulates the differentiation, proliferation and apoptosis of follicular cells (Almeida et al. 2011). Therefore, these effects could be explained by the ability of GDF-9 to promote follicle growth (Kobayashi et al. 2009), recruitment and differentiation of granulosa and theca cells (Wang and Roy 2004). In contrast with in-vitro culture, transplantation treatments (fresh or vitrified) showed a similar percentage of developing follicles compared to controls (fresh or vitrified tissue). This result is very interesting because the maintenance of the quiescence and survival of primordial follicles is important for the preservation of the long-term reproductive functioning of the ovary as well as the graft longevity (Kim 2012). Nevertheless, it is difficult to assess primordial follicles activation since the number of primordial follicles at the time of transplantation or culture in each piece are not really known. Moreover, because follicular activation is irreversible process, activated follicles that are not selected for further development could undergo atresia and are probably not found after transplantation or culture. Moreover, follicle diameter was greater after transplantation of fresh tissue in comparison with the others treatments except the vitrified transplant. We also observed a significant increase of oocyte diameter after transplantation (fresh or vitrified fragments) in comparison with both fresh and vitrified controls. This increase of follicular and oocyte diameter could be related to follicles activation. Adhikari and Liu (2009) have shown that follicular activation involves oocyte growth and change in the granulosa cell shape. In this study, follicular density significantly decreased after transplantation of both fresh and vitrified tissue in comparison to fresh control. Santos et al. (2009) and Gavish et al. (2014) also observed a similar result using caprine and bovine species respectively. These results could be explained by ischemia that occurs immediately after transplantation. Studies have demonstrated that reperfusion ischemia and hypoxia play a major role in follicle depletion during the first days after transplantation and continues for about a week (Newton et al. 1996; Aubard et al. 1999; Soleimani et al. 2011). Therefore, the massive recruitment and loss of primordial follicle occurred during this

96 95 period. Moreover, significant decrease in follicles density was observed after in vitro culture of vitrified tissue in comparison with fresh control whereas, no significant difference was observed between fresh control and fresh culture. We believe that in vitro culture of vitrified tissue required different medium composition from that of fresh tissue to allow follicles survival and development. Interestingly, no significant difference was observed between fresh and vitrified transplant. Based on this result, we can hypothesize that transplantation is more related to follicle loss than cryopreservation itself. The dosage of estradiol concentrations did not show a significant difference from first up to last day of ovary transplantation. It is well known that after ovariectomy, estrogen production declines to undetectable levels following a rise of FSH level (Gosden 2008). However, our result could be explained by the fact that the animals were not castrated as they received back fresh ovarian cortex immediately after ovariectomy. Therefore, we hypothesized that the follicles present in the graft were able to produce estradiol and maintain its level constant over time. In contrast with estradiol, progesterone production decreased from Day 0 to Day 10 of autotransplant while an increase was observed on Days 60 to 90 compared with Day 10. The absence of developing follicles could explain this decrease in progesterone levels since we know that progesterone is produced in high amounts in the ovaries by late antral follicles and corpus luteum (Fadhillah et al. 2017). Nevertheless, the subsequent increase in progesterone level from day 60 to 90 of transplantation could be correlated by the antral follicles found on the surface of the grafts after 90 days of transplantation. To evaluate the revascularization process, the expression of CD31 was investigated. After in vitro culture of fresh ovarian tissue, the expression of CD31 decreased significantly in comparison with all the others treatments, except in the vitrified control. During the in-vitro culture system the process of revascularization do not occur, which can induce high follicles losses due to ischemia (Demirci et al., 2002). This finding justifies the low expression of these genes (CD31) in fresh culture treatment when compared to vitrified transplant. In addition, Soleimani et al. (2011) demonstrated that the number of blood vessels was positively correlated with the graft survival.

97 96 In conclusion, we provide evidence that, restoration of goat ovarian function can successfully be achieved following transplantation of both, fresh or vitrified goat ovarian tissue using the OTC device as we observed antral follicles on the surface of the grafts after three months of transplantation and progesterone production. Although follicular development has been obtained in both situations (in vitro or in vivo), transplantation of vitrified ovarian tissue seems to be the best alternative for the restoration of ovarian function, since it offers better conditions for the preservation of follicular morphology, oocyte and follicular growth. Our study revealed that in the grafts, the primordial follicles were activated progressively suggesting their usefulness for a long-term reproductive function. However, despite the promising results obtained in the present study, we believe that choosing other transplantation site or even increasing the transplantation period can reduce the follicles loss and increase the number of antral follicles respectively following tissue removal. In this case, more studies should be carried out to improve this procedure and extrapolate to others species such at the Human, for instance. Furthermore, improving the in vitro culture system could be also helpful to increase the percentage of normal follicles under such treatment. Conflict of interest statement The authors have declared no conflicts of interest. Acknowledgments This work was provided by National Counsel of Technological and Scientific Development (CNPq: ) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES: / ). Nathalie Donfack Jiatsa is a recipient of a grant from CAPES. Johan Smitz is Especial Visitor Researcher from CAPES. The author is grateful to Leonardo Tondello Martins from the Univiversity of Fortaleza for technical support and to Leonardo Tondello Martins, Carlos Enrique Méndez-Calderón, Saul Gaudencio Neto and Luis Henrique Aguiar for the surgical process.

98 97 Figures Sepplementary Fig. 1 Experimental design exhibiting the distribution of ovarian fragments in six different treatments. n Represent the total number of fragments in each treatment group.

99 98 Fig. 1 (a) Illustration of the caprine ovarian tissue after heterotopic transplantation (A, B C and normal preantral follicles histological micrographies from fresh control (d) or transplant (F), vitrified control (E) or transplant (G) ovarian tissue. (a) Immunolocalization of anti-sdf-1α and anti-cd31 in blood vessels of caprine ovarian fragments. Original magmification 40X. Scale bar= 50µm. O, Oocyte; Nu, Nucleus; GC, Granulosa cell and Zp, Zona pellucida.

100 99 Fig. 2 Percentage (mean ± SEM) of morphologically normal preantral (Primordial, transition, primary and secondary) (A) and developing (B; transition, primary and secondary) follicles from fresh or vitrified ovarian tissue before and after in vitro culture or transplantation. a,b,c,d Uncommon lowercase letters indicate difference (P < 0.05). Number of animals= 11 animals; Number of ovarian fragments analyzed per animal= 10 to 12 Fig. 3 Mean (± SEM) follicular (A) and oocyte (B) diameter of normal preantral (primordial, transition and primary) follicles from fresh or vitrified ovarian tissue before and after in vitro culture or transplantation. a,b,c,d Uncommon lowercase letters indicate

101 100 difference (P < 0.05). Number of animals = 11; Number of ovarian fragments analyzed per animal=10 to 12. Fig. 4 Figure representing follicular density in fresh and vitrified goat ovarian tissue before and after in vitro culture or autotransplantation. a,b,c,d Uncommon lowercase letters indicate difference (P < 0.05). Number of animals = 11. Number of ovarian fragments analyzed per animal=10 to 12.

102 101 Fig. 5 Mean (± SEM) estradiol and progesterone serum concentrations in goats (n=11) subjected to autotransplantation. a,b,c Uncommon lowercase letters indicate differences among days for progesterone concentration (P < 0.05). Estradiol concentration between days (P > 0.05). Number of animals = 11. Fig. 6 Relative expression of CD31 (A; mean ± SEM) after in vitro culture and transplant of fresh and vitrified ovarian cortex. a,b Within the same follicular class

103 102 uncommon lowercase letters indicate difference (P < 0.05). Original magnification 40X. Scale bar= 50µm. Number of animals = 4. Number of ovarian fragments analyzed per animal=6.

104 103 Tables Table 1. Primers for quantitative PCR Gene name Accession Primer sequences 5-3 Amplicon Number CD31 XM_ F: CTGGAGTCTTCAGCCACACA R: TCCCACTCTGCCACTCTCTT 151 bp GAPDH XM_ F: ATGCCTCCTGCACCACCA R: AGTCCCTCCACGATGCCAA 74 bp

105 104 Table 2. Association analyses between reproductive techniques (in vitro culture, transplant and vitrification) and the presence of normal preantral follicles. Reproductive techniques comparisons Normal preantral follicles (%) Odds ratio C.I (95%) P value Fresh transplant 85.5 (136/159) Fresh culture 62.6 (528/843) Fresh transplant 85.5 (136/159) Vitrified culture 54.5 (386/707) Fresh transplant 85.5 (136/159) Vitrified transplant 78.2 (79/101) Vitrified transplant 78.2 (79/101) Fresh culture 62.6 (528/843) Vitrified transplant 78.2 (79/101) Vitrified culture 54.5 (386/707) Fresh culture 62.6 (528/843) Vitrified culture 54.5 (386/707)

106 105 References Abdel-Ghani, M. A., El-sherry, T. M., and Abdelhafeez, H. H. (2016). Effect of growth differentiation factor-9 (GDF-9) on the progression of buffalo follicles in vitrified warmed ovarian tissues. Reprod. Dom. Anim. 51, doi: /rda Adhikari, D., and Liu, K. (2009). Molecular Mechanisms Underlying the Activation of Mammalian Primordial Follicles. Endocr. Rev. 30, doi: /er Almeida, A. P., Saraiva, M. V. A., Araújo, V. R., Magalhães, D. M. Duarte, A. B. G. Frota, I. M. A. Lopes, C. A. P. Campello, C. C. Silva, J. R. V., and Figueiredo. J. R. (2011). Expression of growth and differentiation factor 9 (GDF-9) and its effect on the in vitro culture of caprine preantral ovarian follicles. Small Rumin. Res. 100, doi: /j.smallrumres Alves, A. M., Chaves, R. N., Rocha, R. M., Lima, L. F., Andrade, P. M., Lopes, C. A., Souza, C. E., Moura, A. A., Campello, C. C., Báo, S. N., Smitz, J., and Figueiredo, J. R. (2012). Dynamic medium containing growth differentiation factor-9 and FSH maintains survival and promotes in vitro growth of caprine preantral follicles after long-term in vitro culture. Reprod. Fertil. Dev. 25, doi: /RD12180 Araújo, V. R., Silva, G. M., Duarte, A. B. G., Magalhães, D. M., Almeida, A. P., Gonçalves, R. F. B., Bruno, J. B., Silva, T. F. P., Campello, C. C., Rodrigues, A. P. R., and Figueiredo, J. R. (2011). Vascular endothelial growth factor-a165 (VEGF-A165) stimulates the in vitro development and oocyte competence of goat preantral follicles. Cell. Tissue. Res. 346, doi: /s Aubard, Y., Piver, P., Cogni, Y., Fermeaux, V., Poulin, N., and Driancourt, M. A. (1999). Orthotopic and heterotopic autografts of frozen thawed ovarian cortex in sheep. Hum. Reprod. 14, doi: Aye, M., Di Giorgio, C., De Mo, M., Botta, A., Perrin, J., and Courbiere, B. (2010). Assessment of the genotoxicity of three cryoprotectans used for

107 106 human oocyte vitrification: dimethyl sulfoxide, ethylene glycol and propylene glycol. Food Chem. Toxicol. 48, doi: /j.fct Bandeira, F. T., Carvalho, A. A., Castro, S. V., Lima, L. F., Viana, D. A., Evangelista, J. S. A. M., Pereira, M. J. S., Campello, C. C., Figueiredo, J. R., and Rodrigues, A. P. R. (2015). Two Methods of Vitrification Followed by In Vitro Culture of the Ovine Ovary: Evaluation of the Follicular Development and Ovarian Extracellular Matrix. Reprod. Dom. Anim. 50, doi: /rda Bernstein and Wiesemann C 14 hould Postponing Motherhood via ocial Freezing Be Legally Banned? n Ethical nalysis Laws 3, doi: Bordes, A., Lornage, J., Demirci, B., Franck, M., Courbiere, B., Guerin, J. F., and Salle, B. (2005). Normal gestations and live births after orthotopic autograft of vitrified warmed hemi-ovaries into ewes. Hum. Reprod. 20, doi: /humrep/dei155 Carvalho, A. A. Faustino, L. R., Silva, C. M. G., Castro, S. V., Lobo, C. H., Santos, F. W. Santos, R. R., Campello, C. C., Bordignon, V., Figueiredo, J. R., and Rodrigues, A. P. R. (2014). Catalase addition to vitrification solutions maintains goat ovarian preantral follicles stability. Res. Vet. Sci. 97, doi: /j.rvsc Carvalho, A. A., Faustino, L. R., Silva, C. M., Castro, S. V., Lopes, C. A., Santos, R. R., Báo, S. N., Figueiredo, J. R., and Rodrigues, A. P. (2013). Novel wide-capacity method for vitrification of caprine ovaries: Ovarian Tissue Cryosystem (OTC). Anim. Reprod. Sci. 138, doi: /j.anireprosci David, A., Dolmans, M.M., Langendonckt, A.V., Donnez, J., and Amorim, C.A. (2011). Immunohistochemical localization of growth factors after cryopreservation and 3 weeks xenotransplantation of human ovarian tissue. Fertil. Steril. 95, doi: /j.fertnstert

108 107 Demirci, B., Salle, B., Frappart, L., Frank, M., Guerin, J. F., and Lornage, J. (2002). Morphological alterations and DNA fragmentation in oocytes from primordial and primary follicles after freezing-thawing of ovarian cortex in sheep. Fertil. Steril. 77, doi: Donnez, J., Dolmans, M. M., Pellicer. A., Diaz-garcia, C., Serrano, M. S., Schmidt, K. T., Ernst, E., Luyckx, V., and Andersen, C. Y. (2013). Restoration of ovarian activity and pregnancy after transplantation of cryopreserved ovarian tissue: a review of 60 cases of reimplantation. Fertil. Steril. 99, doi: /j.fertnstert Gavish, Z., Peer, G., Hadassa, R., Yoram, C., and Meirow, D. (2014). Follicles activation and burn-out contribute to post-transplantation follicles loss in ovarian tissue grafts: the effect of graft thickness. Hum. Reprod. 29, doi: /humrep/deu015 Ghetler, Y., Yavin, S., Shalgi, R., and Arav, A. (2005). The effect of chilling on membrane lipid phase transition in human oocytes and zygotes. Hum. Reprod. 20, doi: /humrep/dei236 Gosden, R. G. (2008). Ovary and uterus transplantation. Reproduction 136, doi: /REP Gualtieri, R., Mollo, V., Barbato, V., Fiorentino, I., Iaccarino, M., and Talevi, R. (2011). Ultrastructure and intracellular calcium response during activation in vitrified and slow-frozen human oocytes. Hum. Reprod. 26, doi: /humrep/der210 Jensen, A.K., Macklon, K.T., Fedder, J., Ernst, E., Humaidan, P., and Andersen C.Y. (2016). 86 successful births and 9 ongoing pregnancies worldwide in women transplanted with frozen-thawed ovarian tissue : focus on birth and perinatal outcome in 40 of these children. J. Assist. Reprod. Genet. 34, doi : /s

109 108 Jeruss, J. S., and Woodruff, T. K. (2009). Preservation of fertility in patients with cancer. N. Engl. J. Med. 360, doi: /NEJMc Kagawa, N., Silber, S., and Kuwayama, M. (2009). Successful vitrification of bovine and human ovarian tissue. Reprod. Biomed. Online 18, Kawamura, K., Cheng, Y., Suzuki, N., Deguchi, M., Sato, Y., Takae, S., Ho, C-H., Kawamura, N., Tamura, M., Hashimoto, S., Sugishita, Y., Morimoto, Y., Hosoi, Y., Yoshioka, N., Ishizuka, B., and Hsueh, A. J. (2013). Hippo signaling disruption and Akt stimulation of ovarian follicles for infertility treatment. PNAS 43, doi: /pnas Kim, J. Y. (2012). Control of ovarian primordial follicle activation. Clin. Exp. Reprod. Med. 39, doi: /cerm Kobayashi, N., Orisaka, M., Cao, M., Kotsuji, F., Leader, A., Sakuragi, N., and Tsang, B. K. (2009). Growth differentiation factor-9 mediates follicle-stimulating hormonethyroid hormone interaction in the regulation of rat preantral follicular development. Endocrinology. 150, doi: /en Livak, K. J., Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, doi: /meth Lotz, L., Liebenthron, J., Nichols-Burns, S., Montag, M., Hoffmann, I., Beckmann, M. W., Van der Ven, H., Töpfer, D., and Dittrich, R. (2014). Spontaneous antral follicle formation and metaphase II oocyte from a non-stimulated prepubertal ovarian tissue xenotransplant. Reprod. Biol. Endocrinol doi: / Lunardi, F. O., Araújo, V. R., Faustino, L. R., Carvalho, A. A., Gonçalves, R. F. B., Bass, C. S., Báo, S. N., Name, K. P. O., Campello, C. C., Figueiredo, J. R., and Rodrigues, A. P. R. (2012). Morphologic, viability and ultrastructural analysis of vitrified sheep preantral follicles enclosed in ovarian tissue. Small Rumin. Res. 107, doi: /j.smallrumres

110 109 Luyckx, V., Scalercio, S., Jadoul, P., Amorim, C. A., Soares, M., Donnez, J., and Dolmans, M. M. (2013). Evaluation of cryopreserved ovarian tissue from prepubertal patients after long-term xenografting and exogenous stimulation. Fertil. Steril. 100, doi: /j.fertnstert Maffei, S., Hanenberg, M., Pennarossa, G., Silva, J. R., Brevini, T. A., Arav, A., and Gandolfi, F. (2013). Direct comparative analysis of conventional and directional freezing for the cryopreservation of whole ovaries. Fertil. Steril. 100, doi: /j.fertnstert Martins, F. S., Celestino, J. J. H., Saraiva, M. V. A., Matos, M. H. T., Bruno, J. B., Rocha-Junior, C. M. C., Lima-Verde, I. B., Lucci, C. M., Báo, S. N., and Figueiredo, J. R. (2008). Growth and differentiation factor-9 stimulates activation of goat primordial follicles in vitro and their progression to secondary follicles. Reprod. Fertil. Dev. 20, doi.org/ /rd08108 Men, H., Monson, R.L., Parrish, J.J., and Rutledge, J.J. (2003). Degeneration of cryopreserved bovine oocytes via apoptosis during subsequent culture. Cryobiology 47, doi: /s (03) Migishima, F., Migishima, R. S., Quintero, R. B., Yokoyama, M., and Behr, B. R. (2006). Successful pregnancies after transplantation of frozen-thawed mouse ovaries into chimeric mice that received lethal-dose radiation. Fertil. Steril. 86, doi: /j.fertnstert Newton, H., Aubard, Y., Rutherford, A., Sharma, V., and Gosden, R. (1996). Low temperature storage and grafting of human ovarian tissue. Hum. Reprod. 11, Nichols-Burns, S. M., Lotz, L., Schneider, H., Adamek, E., Daniel, C., Stief, A., Grigo, C., Klump, D., Hoffmann, I., Beckmann, M. W., and Dittrich, R. (2014). Preliminary

111 110 observations on whole-ovary xenotransplantation as an experimental model for fertility preservation. Reprod. Biomed. Online 29, doi: /j.rbmo Santos, R. R., Knijn, H. M., Vos, P.L., Oei, C. G., Vvan Loon, T., Colenbrander, B., Gadella, B. M., Vvan Dden Hurk, R., and Roelen, B. A. (2009). Complete follicular development and recovery of ovarian function of frozen-thawed, autotransplanted caprine ovarian cortex. Fertil. Steril. 91, doi: /j.fertnstert Santos, S. S. D., Biondi, F. C., Cordeiro, M. S., Miranda, M. S., Dantas. J. K., Figueiredo, J. R. and Ohashi O.M. (2006). Isolation, follicular density, and culture of preantral follicles of buffalo fetuses of different ages. Anim. Reprod. Sci. 95, doi: /j.anireprosci Saraiva, M. V. A., Rossetto, R., Brito, I. R., Celestino, J. J. H., Silva, C. M. G., Faustino, L. R., Almeida, A. Bruno, J. B., Magalhães, D. M., Matos, M. H. T., Campello, C. C., and Figueiredo J. R. (2010). Dynamic Medium Produces Caprine Embryo From Preantral Follicles Grown In Vitro. Reprod. Sci. 17, doi: / Schmidt, K. T., Rosendahl, M., Ernst, E., Loft, A., Andersen, A. N., Dueholm, M., Ottosen, C., and Andersen, C. Y. (2011). Autotransplantation of cryopreserved ovarian tissue in 12 women with chemotherapy-induced premature ovarian failure: the Danish experience. Fertil. Steril. 95, doi: /j.fertnstert Shea, L. D., Woodruff, T. K., and Shikanov, A. (2014). Bioengineering the ovarian follicle microenvironment. Annu. Rev. Biomed. Eng. 16, doi: /annurevbioeng Silva, J.R.V., Van den Hurk, R., Van Tol, H. T. A., Roelen, B. A. J., and Figueiredo, J. R. (2004). Expression of growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15) and BMP receptors in the ovaries of goats. Mol. Reprod. Dev. 70, doi: /mrd.20127

112 111 Soleimani, R., Heytens, E., and Oktay, K. (2011). Enhancement of neoangiogenesis and follicle survival by sphingosine-1-phosphate in human ovarian tissue xenotransplants, PLoS One 6, e doi: /journal.pone Suzuki, N., Yoshioka, N., Takae, S., Sugishita, Y., Tamura, M., Hashimoto, S., Morimoto, Y., and Kawamura, K. (2015). Successful fertility preservation following ovarian tissue vitrification in patients with primary ovarian insufficiency. Hum. Reprod. 30, doi: /humrep/deu353 Ting, A. Y., Yeoman, R. R., Campos, J. R., Lawson, M. S., Mullen, S. F., Fahy, G. M., and Zelinski. M. B. (2013). Morphological and functional preservation of pre-antral follicles after vitrification of macaque ovarian tissue in a closed system. Hum. Reprod. 28, doi: /humrep/det032 Vajta, G., Holm, P., Kuwayama, M., Booth, P. J., Jacobsen, H., Greve, T., and Callesen, H. (1998). Open pulled straw (OPS) vitrification: a new way to reduce cryoinjuries of bovine ova and embryos. Mol. Reprod. Dev. 51, doi: /(SICI) (199809)51:1<53::AID-MRD6>3.0.CO;2-V Wang, J., and Roy, S. K. (2004). Growth differentiation factor-9 and stem cell factor promote primordial follicle formation in the hamster: modulation by follicle-stimulating hormone. Biol. Reprod. 70, doi: Wang, S., Yang, S., Lai, Z., Ding, T., Shen, W., Shi, L., Jiang, J., Ma, L., Tian, Y., Du, X., Luo, A., and Wang, S. (2013). Effects of culture and transplantation on follicle activation and early follicular growth in neonatal mouse ovaries. Cell. Tissue. Res. 354, doi : /s Woodruff, T. K. (2007). The emergence of a new interdiscipline: Oncofertility. Cancer Treat. Res. 138, 3 11.

113 112 Woodruff, T. K. (2010). The Oncofertility Consortium addressing fertility in young people with cancer. Nat. Rev. Clin. Oncol. 7, doi: /nrclinonc

114 113 9 CAPÍTULO 4 Fator derivado das células do estroma 1 e as conexinas (37 e 43) são preservadas após a vitrificação e o cultivo in vitro de córtex ovariano caprino Stroma cell-derived factor 1 and connexins (37 and 43) are preserved after vitrification and in vitro culture of goat ovarian cortex Periódico: Reproduction in Domestic Animals (submetido em outubro 2017) (Qualis A2)

115 114 RESUMO Este estudo teve como objetivo avaliar a morfologia folicular e o desenvolvimento (ativação folicular, proliferação celular e produção hormonal), bem como o padrão de distribuição das conexinas 37 e 43 (Cx 37 e 43) e do fator derivado das células do estroma 1 (SDF-1α) após vitrificação e cultivo in vitro de tecido ovariano caprino. O estudo envolveu quatro grupos experimentais: controle fresco, controle vitrificado, cultivo fresco e cultivo vitrificado. Os fragmentos ovarianos foram vitrificados pela técnica de superf cie s lida usando o ovarian tissue criosystem e, posteriormente, cultivados in vitro durante 7 dias. A porcentagem de folículos pré-antrais normais foi semelhante entre o controle vitrificado e o cultivo vitrificado. No entanto, tanto o controle vitrificado quanto o cultivo vitrificado mostraram uma redução significativa do percentual de folículos normais em comparação ao controle fresco. Uma maior percentagem de folículos em desenvolvimento (transição, primário e secundário) foi observada no cultivo fresco e vitrificado (P <0,05). Além disso, a produção de progesterona e estradiol diminuiu (P <0,05) durante o cultivo in vitro. As proteínas SDF-1α e Cx37 foram detectadas em o citos e c lulas da granulosa em todos os tratamentos. No entanto, no tecido vitrificado e cultivado, apenas as células da granulosa foram marcadas com Cx37. A Cx43 foi detectada nas células da granulosa, da teca e na zona pelúcida em todos os tratamentos. Em conclusão, o cultivo in vitro de córtex ovariano caprino vitrificado foi capaz de promover a ativação de folículos préantrais e não alterou a expressão de SDF-1α e 43 No entanto a express o de Cx 37 foi modificada após cultivo in vitro de tecido vitrificado. Palavras-chave: Vitrificação, Proliferação celular, Folículos pré-antrais, Junções gap, Ativação folicular.

116 115 Stroma cell-derived factor 1 and connexins (37 and 43) are preserved after vitrification and in vitro culture of goat ovarian cortex Running title: Preservation of proteins in vitrified goat ovarian tissue Nathalie Jiatsa Donfack a, Kele Amaral Alves a, Benner Geraldo Alves a, Rebeca Magalhães Pedrosa Rocha a, Jamily Bezzera Bruno a, Marcelo Bertolini bc Regiane Santos d, Sheyla Farhaydes Souza Domingues d, José Ricardo De Figueiredo a, Johan Smitz e, Ana Paula Ribeiro Rodrigues a* a Faculty of Veterinary Medicine, Laboratory of Manipulation of Oocytes and Preantral Follicles (LAMOFOPA), State University of Ceará, Fortaleza, CE, Brazil. b Laboratory of Molecular Biology and development, University of Fortaleza (UNIFOR), CE, Brazil. c Federal University of Rio Grande do Sul, Veterinay Faculty, Porto Alegre, RS-Brazil d Laboratory of Biology and Medicine of Wild Animals of Amazon, University Federal of Pará-Belem-PA, Brazil. e Follicle Biology Laboratory, Center for Reproductive Medicine, UZ Brussel, Laarbeeklaan 101, B-1090 Brussels, Belgium *Correspondence should be addressed to: aprrodriguespapers@gmail.com Programa de Pós-Graduação em Ciências Veterinárias (PPGCV). Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA). Universidade Estadual do Ceará (UECE). Av. Paranjana, 1700, Campus do Itaperi. Fortaleza CE Brasil. CEP: Tel.: ; Fax: address: aprrodriguespapers@gmail.com

117 116 Abstract This study aimed to evaluate the follicular morphology and development (follicular activation, cell proliferation and hormone production), as well as the distribution pattern of Connexins 37 and 43 and SDF-1α after vitrification and in vitro culture of goat ovarian tissue. The study involved four experimental groups: fresh control, vitrified control, fresh culture and vitrified culture. The ovarian fragments were vitrified by solid surface technique using the Ovarian Tissue Cryosystem and subsequently in vitro cultured for 7 days. The percentage of normal preantral follicles was similar between vitrified control and vitrified culture. However, both vitrified control and vitrified culture treatments showed a significant reduction of morphological normal follicles in comparison to fresh control. A higher percentage of developing follicles (transition, primary and secondary) was observed in both fresh culture and vitrified culture treatments. Progesterone and estradiol production decreased (P<0.05) during in vitro culture. SDF-1α and Cx37 proteins were detected in oocytes and granulosa cells from all the treatments. However, in vitrified cultured tissue, only granulosa cells were labelled with Cx37. Connexin 43 was detected in the granulosa, theca cells and zona pellucida in all the treatments. In conclusion, in vitro culture of vitrified goat ovarian cortex was able to promote follicle activation and did not alter the expression of SDF-1α and 43. However, the expression of Cx 37 was modified after in vitro culture of vitrified tissue. Keywords: Vitrification, Cell proliferation, Preantral follicles, Gap junctions, Follicular activation.

118 INTRODUCTION The opportunity to preserve and regenerate fertility of women who will undergo cancer treatment can be achieved by reproductive applied technologies as ovarian cryopreservation followed by in vitro culture or transplantation. To date 86 live births have been reported after transplantation of cryopreserved ovarian tissue (Jensen et al., 2016). However, almost all of them were originated from slow freezing and only two births were reported after ovarian tissue vitrification (Kawamura et al., 2013 and Suzuki et al., 2015). Despite the positive results obtained with slow freezing, this method suffers from drawbacks such as formation of intracellular ice crystals, cell damage and the need for expensive equipment (Wang, Xiao, Li, Fan, & Li, 2008). Otherwise, vitrification method is mentioned as a rapid, simple and economic, associated with less cell damage than slow-freezing and no ice crystal formation (Choi et al., 2008). Therefore, this type of cryopreservation may represent an alternative to minimize the damage on cell connections, which are fundamental for development and function of ovarian follicles, either in vivo or in vitro. Due to the risk of reintroduction of cancerous cells into the host after transplantation (Vanacker et al., 2012), researchers have proposed the combination of cryopreservation with in vitro culture of ovarian cortex. This technique aims the full growth and maturation of preantral ovarian follicles to obtain fertilizable oocytes and further in vitro embryo production (Woodruff, 2007; 2010). It was reported that cryopreservation and/or in vitro culture can cause damage to membrane proteins such as connexins (Cx). These proteins form the intercellular channels known as Gap junctions allowing the movement of ions, metabolites, and signaling molecules from cell to cell (Carabatsos, Sellitto, Goodenough, & Albertini, 2000). Although several connexins (Cx26, Cx30, Cx32, Cx37, Cx40, Cx43 and Cx45) have been detected in the ovary, Cx37 and Cx43 have a major influence on folliculogenesis (Granot, Bechor, Barash, & Dekel, 2002). Lee et al. (2008) also showed a reduction of Cxs 37 and 43 after transplantation of cryopreserved mouse ovarian tissue. A recent study showed that the pattern of Cx43 gene expression was reduced after both slow freezing and vitrification of enclosed preantral follicles in cat ovarian tissue (Tanpradit, Comizzoli, Srisuwatanasagul, & Chatdarong, 2015). A study conducted by Silva et al. (2016) showed a reduction of Cx43 after vitrification and culture of preantral follicles in sheep as well as a different distribution pattern of Cxs 37

119 118 and 43 in comparison to those obtain in the other species. These results could be related to the toxicity of cryoprotectants used. Therefore, we believe that the combination of cryoprotectants with other substances such as antioxidant could minimize the resulting toxicity. Likewise, in our knowledge, these proteins have not yet been study in goat ovary neither after vitrification or in vitro culture. It is well known that the follicular in vitro development is regulated by stimulatory and inhibitory factors that act locally in a paracrine/autocrine manner. According to Holt et al. (2006), Stroma Cell Derived Factor (SDF-1) is a possible inhibitory factor identified in mice ovary. Those authors have shown that the interaction of SDF-1 and its receptor inhibits the primordial to primary follicle transition in the neonatal mouse ovary. In addition, some others studies show that, the deletion of SDF-1 genes results in embryonic lethality (Tachibana et al., 1998; Zou, Kottmann, Kuroda, Taniuchi, & Littman, 1998). SDF1 exists in three transcript variant forms, SDF1α, β, and γ. However, SDF-1α is the est characterized DF-1 transcript variant in the literature (Holt et al., 2006). It has been reported that SDF-1α is involved in ovarian function by improving the survival of granulosa cells and oocyte quality (Zhou, Borillo, Wu, Torres, & Lou, 2004; Kryczek et al., 2005). This protein was identified in mouse ovary and it was observed that its expression increased with follicular developmental stage (Holt et al. (2006). Nonetheless, in our knowledge, this protein has not yet been identified in goat ovarian tissue as well as the effect of vitrification procedure followed or not by a subsequent in vitro culture on their distribution pattern. Hence this study was designed to evaluate the follicle morphology and development after vitrification and in vitro culture of goat ovarian tissue. Additionally, to evaluate the distribution of Cxs 37 and 43 and SDF-1 proteins within goat ovarian follicles as well as to determine their follicular distribution pattern after vitrification and in vitro culture. 2. MATERIAL AND METHODS This experiment was approved and performed under the guidelines of Ethics Committee for Animal Use of the State University of Ceará. The cryoprotectants (ethylene glycol and dimethyl sulfoxide) were obtained from Dinâmica (Dinâmica Química, Diadema, SP, Brazil) and the other chemicals were obtained from Sigma (Sigma Chemical Co., St. Louis, MO, USA), unless otherwise stated.

120 Ovary Collection Ovaries were collected at a slaughterhouse from adult goats (n = 11). Immediately postmortem, ovaries were washed in 70% alcohol, followed by two washes in HEPESbuffered minimum essential medium (MEM) supplemented with antibiotics (100 µg/ml penicillin and 100 µg/ml streptomycin) Experimental design Each ovarian pair was fragmented into 12 slices (5x5x1mm). Subsequently, 3 fresh fragments were immediately fixed in 4% paraformaldehyde (PAF) for classical histology and immunohistochemistry named as fresh control. The remaining fragments were transported to the laboratory (38ºC) within 2 h and submitted randomly to vitrification and/or in vitro cultured for 7 days generating the following treatments named as: fresh culture; vitrified control and vitrified culture according to our previous experiment (Donfack et al., unpublished data) Vitrification and warming of ovarian tissue The vitrification was performed using Ovarian Tissue Cryosystem (OTC) technique, as described by Carvalho et al. (2014). Briefly, the fragments were exposed to two vitrification solutions (VS). The VS1 consisted of MEM supplemented with 10 mg/ml bovine serum albumin (BSA), 20 IU catalase, 0.25 M sucrose, 10% ethylene glycol (EG) and 10% dimethyl sulfoxide (DMSO). VS2 had a similar composition of VS1 but with higher concentration of cryoprotectants (20% EG and 20% DMSO). The fragments were initially exposed to VS1 for 4 min followed by VS2 for 1 min. Both exposures were performed using the OTC. The vitrification solution was then removed and the OTC containing the ovarian tissue was closed and immediately immersed vertically into liquid nitrogen. After cryostorage for up to 1 week, OTCs containing the vitrified ovarian fragments were warmed in air at room temperature (RT 25 C) for 1 min, followed by immersion in a water bath (37 C) for 30 s. After warming, the cryoprotectants were removed by a three-step washing solutions (WS; 5 min each) in WS1: MEM + 3 mg/ml BSA M sucrose, WS2: MEM + 3 mg/ml BSA M sucrose and WS3: MEM + 3 mg/ml BSA.

121 In vitro Culture of ovarian fragments Non-vitrified and vitrified/warmed ovarian tissues were cultured during 7 days. The in vitro culture was performed at 39 C in 5% CO 2 in a humidified incubator, and all media were incubated for 1 hour before use. The culture medium was according to Alves et al 1 Briefly the asic medium consisted of α-mem (ph ) supplemented with 50 μg/ml ascorbic acid, 1% ITS (10 μg/ml insulin, 5.5 μg/ml transferrin and 0.5 ng/ml selenium), 2 mm glutamine, 2 mm hypoxanthine, 200 ng/ml GDF-9 and 100 μg/ml penicillin-streptomycin. The total exchange of medium (1 ml) was made every 48 hours Morphological analysis of pre-antral follicles by histology Regardless the treatments, the ovarian fragments were fixed in 4% PAF and prepared for classic histology and serially sectioned into 7 μm thickness. The sections were stained with periodic acid Schiff (PAS)-hematoxylin and follicular morphology was examined by light microscope (magnification 400). For each treatment, follicles were counted only in sections where the oocyte nucleus was visible. The follicles were classified as morphologically normal when they contained an intact oocyte and granulosa cells, or degenerated when they contained an oocyte with a pyknotic nucleus, ooplasma shrinkage and/or granulosa cell layers that had disorganized and detached from the basement membrane. According to Carvalho et al. (2013), the follicles were also classified according the development stage as: primordial (one layer of flattened or pre-granulosa cells around the oocyte); transition (one layer of flattened and cuboidal cells around the oocyte); primary (one layer of cuboidal granulosa cells around the oocyte) and secondary follicles (two or more layers of cuboidal granulosa cells around the oocyte). The analyses were made by the same operator Hormonal assay Progesterone and estradiol concentrations were measured in the spent medium collected on Days 2, 4, 6 and 7. The concentrations of estradiol (pmol.l -1 ) and progesterone (nmol.l -1 ) were measured by amplified chemiluminescence using an immunoassay system (Vitros Eci/EciQ Immunodiagnostic System; Johnson & Johnson Company, Ortho-Clinical Diagnostics Buckinghamshire K according to manufacturer s

122 121 instructions with a sensitivity of 0, nmol.l -1 for progesterone and pmol.l -1 for estradiol Immunohistochemestry staining of SDF-1α and PPH3 Ovarian fragments were proceeded as for classical histology and serially sectioned into 5-μm thickness. The sections were mounted on positively charged slides. The slides were deparaffinized by heat at 60 ºC for 45 minutes. The immunohistochemical reactions were performed according to the protocol described by Silva et al. (2004). Briefly, epitopes were activated by incubation in 0.01 M buffered sodium citrate (ph 6.0) supplemented with Tween C for 5 minutes. Moreover, the nonspecific binding was blocked by incubation with 1.25 mg of bovine serum albumin (BSA) diluted in PBS for 30 minutes. Subsequently, the sections were incubated overnight in a humid camera at 4 C with SDF-1 (1/1000; ab9797, ABCAM, USA) and PPH3 (1/1500; ab32388, ABCAM, USA) antibodies. Afterwards, the slides were washed with PBS and incubated for 1 h with the biotinylated anti- rabbit IgG secondary antibody (AB97049, ABCAM, USA) diluted 500 times in PBS containing 1.25 mg of BSA. Then the slides were washed in PBS followed by incubation for 30 minutes with avidin-biotin (Vector Laboratories, Burlingame, CA, USA) and the location of the proteins was demonstrated with diaminobenzidine (DAB; - Dako, Inc., USA). Finally, the sections were counterstained with hematoxylin and Scott's solution. The negative controls were obtained by omission of the primary antibodies. Immunostaining was evaluated based on the presence or not of the positive staining on the follicle compartments (granulosa cells and oocyte) Immunofluorescence staining Cx37 and Cx43 As for immunohistochemistry, ovarian fragments were proceeded as for classical histology and serially sectioned into 5-μm thickness. The slides were deparaffinized by heat at 60ºC for 45 minutes followed by two washes in Citrisolve (Fisher Scientific, Ottawa, Ontario, Canada) solution for a total time of 10 minutes. The sections were then rehydrated by washing in decreasing concentrations of ethanol and distilled water. Antigen retrieval was performed by incubating tissue sections in 0.01-M sodium citrate buffer (ph 6.0) for 5 minutes, in a pressure cooker. For unspecific blockage, the slides

123 122 were incubated with 1% BSA diluted in PBS for 1 hour at RT. After antigen retrieval, slides were incubated overnight at 4 º C with primary rabit polyclonal antibodies to Cx37 (1/1000; ab181701, ABCAM) and Cx43 (1/1500; ab11370, ABCAM). Then, the slides were incubated with secondary antibody Alexa Fluor 488 anti-rabbit IgG Conjugate (1:500; ab150113, Abcam Inc., Cambridge, MA, USA) for 1 hour at RT and counterstained with Evans Blue (1:10.000). The slides were mounted with fluoroshield mounting medium with DAPI (ab104139, Abcam Inc., Cambridge, MA, USA). The negative controls were obtained by omission of the primary antibodies. Immunofluorescence was evaluated based on the presence or not of the green fluorescence Statistical analysis Statistical analyses were performed using the Sigma Plot 11.0 software (Systat Software Inc, San Jose, California, USA). Data that were not normally distributed (Shapiro-Wilk test) were submitted to logarithmic transformation. Comparison of means (normal, primordial, and developing follicles (transition, primary and secondary) was performed among treatments by Kruskal-Wallis test. The fisher exact test was used to analyze the cell proliferation by PPH3. The Mann-Whitney test was used to assess the in vitro concentration of estradiol and progesterone, while the Wilcoxon signed rank test analyzed the effect of treatment within days of culture. Data were presented as mean (± SEM) and percentage, unless otherwise indicated. Statistical significance was defined as P < 5 and pro a ility values > 5 and 1 indicated that a difference approached significance. 3. RESULTS 3.1. Follicular morphology and development Percentage of morphological normal follicle before and after in vitro culture is depicted in Figure 1A. The percentage of morphologically normal follicles in vitrified tissue were similar (P > 0.05) before (vitrified control) and after in vitro culture (vitrified culture) being both lower (P < 0.05) than fresh control. In addition, after in vitro culture, a lower (P < 0.05) percentage of normal follicles was observed in the vitrified (vitrified culture) than non-vitrified tissues (fresh culture). As shown in Figure 1B, the percentage of developing (transition, primary and secondary) follicles increased (P <

124 ) after in vitro culture (fresh culture and vitrified culture) in comparison with both fresh and vitrified control. However, no significant difference was observed between fresh culture and vitrified culture (P > 0.05). Figure 2 shows representative images of morphological normal follicles from each treatment PPH3 staining for granulosa cell proliferation The expression of PPH3 was found in the nucleus of the majority of granulosa cells from healthy developing follicles (transition, primary, secondary) as well as in the nucleus of oocyte (Figure 2). The percentage of positive follicles was 33.3% (7/21), 59.1% (13/22), 25.0 % (1/4) and 30.0% (3/10) respectively to fresh control, vitrified control, fresh culture and vitrified culture. No significant difference was observed between the treatments Immunohistochemical detection of SDF-1α SDF-1α protein was found in the oocytes and granulosa cells of all follicle categories and the distribution pattern of this protein was similar between fresh control and the other treatment groups (Figure 2) Hormone production Progesterone and estradiol production is shown in Figure 3. For both treatment groups (fresh culture and vitrified culture) the concentration of estradiol (Figure 4A) decreased (P < 0.05) from day 2 to day 4 and remained unchanged (P > 0.05) until the end of the culture period. Similar results were observed for the progesterone levels except that in the fresh culture treatment, the hormone decrease (P < 0.05) was observed on day 6 onwards. Regardless the hormone and culture times no difference was observed between the tested treatments (P > 0.05).

125 Immunofluorescence detection of Cx37 and Cx43 Immunofluorescence detection for Cx37 and Cx43 is shown in Figure 4. Connexin 37 was uniformly distributed on oocyte and granulosa cells from primordial to antral follicles in fresh control. Moreover, vitrified control and fresh culture showed a similar distribution pattern of this protein. In contrast, in the vitrified cultured tissue the expression of Cx37 was found only in the granulosa cells of one follicle. Unlike to Cx37, Cx43 was found in granulosa cells, theca cells and zona pellucida from primordial to antral follicles. All treatments depicted the same distribution pattern of Cx DISCUSSION This study reports for the first time the expression of SDF-1α and Connexins 37 and 43) proteins within goat follicles in fresh or vitrified ovarian tissue before and after in vitro culture. The exposure of ovarian tissue to a vitrification procedure followed or not by a subsequent in vitro culture for 7 days reduced the percentage of normal follicle when compared to fresh control. This reduction after vitrification may be related to the osmotic stress to which the cells are subjected during this procedure (Vajta et al., 1998), or to the cryoprotectants toxicity (Aye et al., 2010). We observed an increase of developing follicles after in vitro culture of fresh or vitrified tissue (fresh culture and vitrified culture) in comparison with both fresh and vitrified non-culture tissue (fresh control and vitrified control). Similar results from our team in this specie have been reported using fresh ovarian fragments (Martins et al., 2008). Moreover, others studies have shown an increase of developing follicles after in vitro culture of both frozen (Castro et al., 2014) or vitrified (Ackermann et al., 2017) bovine and dog ovarian tissue respectively. According to Silva et al. (2006) in vitro conditions improve the development of follicles, resulting in the release of stimulatory factors or the cessation of production of inhibitory factors by stromal, granulosa or prethecal cells. The present study showed for the first time the cell proliferation rate in goat ovarian tissue using PPH3. Histone H3 is a nuclear core histone protein of DNA

126 125 chromatin, with an important role in chromosome condensation and cell-cycle progression during mitosis and meiosis after phosphorylation of serine-10 and serine-28 residues. Phosphorylation occurs during late G2 to early prophase, with its dephosphorylation occurring during anaphase (Preuss, Landsberg, & Scheidtmann, 2003). It was shown that this protein is more reproducible and better represent proliferation than Ki67 (Kim et al., 2017). This approach had been successfully reported in previous work to measure cell proliferation rates in macaque ovarian tissue (Ting, Yeoman, Lawson, & Zelinski, 2011). In the present study, PPH3 were well distributed in granulosa cell and oocyte nuclei of developing follicles. The expression of PPH3 was similar in all treatments, suggesting intact mitotic functions. However, the presence of this protein in the nucleus of the oocyte could be related to its function in the checkpoint recovery subsequent to DNA double-strand breaks repair (Keogh et al 6; O Neill et al., 2007). The expression of SDF-1α protein was found in the oocytes and granulosa cells of all follicle categories. As SDF-1α is the est characterized DF-1 transcript variant in the literature (Holt et al., 2006), it was selected as the isoform for localization study. Holt et al. (2006) also found a similar distribution in mouse ovary. Moreover, a study showed that this protein is mainly produce in ovary by the granulosa cells (Skinner, Schmidt, Savenkova, Sadler-Riggleman, & Nilsson, 2008). Furthermore, in the present study the distribution pattern of SDF-1α was not affected with vitrification and/or in vitro culture. This reveals that our vitrification protocol and culture system did not affect the granulosa cells function and consequently the SDF-1α production The production of estradiol and progesterone decreased during in vitro culture of both fresh and vitrified ovarian cortex fragments. Alves et al. (2012) also observed a similar result after in vitro culture of goat fresh ovarian tissue. In addition, Lunardi et al. (2016) also observed a decrease of estradiol production after in vitro culture of sheep preantral follicles. It is known that progesterone is produced in high amounts in the ovaries by late antral follicles and corpus luteum (Fadhillah et al., 2017). Moreover, it has been shown that stroma cells are able to produced steroid hormone (McNatty, Makris, Camillo, Osathanondh, & Ryan, 1979). Therefore, the low progesterone level in this study could be related to the low percentage of antral follicles found after in vitro culture or either by the possible degeneration of some stromal cells during the culture period.

127 126 Our results indicated that Cx37 was found in oocyte and granulosa cells as early as the primordial stage. This result is in agreement with the Cx37 distribution pattern previously observed in mice (Yang et al., 2015), sheep (Grazul-Bilska et al., 2011) and bovine (Nuttinck et al., 2000). Moreover, the expression of Cx37 in both vitrified control and fresh cultured tissues was similar to fresh control. In contrast to our data, previous study showed that the expression of Cx37 was poorly expressed in freezing/thawed mouse ovaries in comparison with fresh ovary (Lee et al., 2008). According some authors the loss of Cx37 interferes with the development of antral follicles (Carabatsos, Sellitto, Goodenough, & Albertini, 2000). In the present study, the expression of Cx37 in the vitrified cultured tissue was found only in the granulosa cells. However, we cannot confirm that this protein was not present in other follicular compartments, since this data came from only one follicle found in this treatment. We believe that the low number of follicles found in the vitrified cultured tissue is due to the fact that the culture medium was not appropriated for cryopreserved tissue. Leal et al. (2017) have shown that cryopreserved ovarian tissue requires a specific culture medium to ensure its survival and appropriate follicular development. Connexin 43 was expressed in granulosa cells, theca cells and zona pellucida in all the follicle types. All the treatments depicted the same distribution pattern. Similar pattern of Cx43 expression was observed for adult ovaries in several species (sheep: Grazul-Bilska et al., 1998; cow: Nuttinck et al., 2000 and mice: Yang et al., 2015). The importance of Cx43 for follicular development was emphasized in a mouse knockout model showing a lack of development beyond primary follicles (Gershon, Plaks, & Dekel 8; ckert Gittens O Brien Eppig & Kidder 1). Moreover, antisense knockdown of Cx43 expression in bovine oocyte-cumulus cell complexes has demonstrated a role for Cx43 in meiotic maturation (Vozzi et al., 2001). Thus, the Cx43 expression pattern suggests that this protein is involved in the regulation of folliculogenesis in goat. In conclusion, in vitro culture of vitrified goat ovarian cortex was able to promote follicle activation and did not alter the expression of SDF-1α and 43 However, the fact that the expression of Cx 37 was modified after in vitro culture of vitrified ovary suggest that current culture medium need improvements for vitrified tissue.

128 127 ACKNOWLEDGMENTS Funding for this work was provided by National Counsel of Technological and Scientific Development (CNPq: ) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES: / ). Johan Smitz is Especial Visitor Researcher from CAPES. AUTHOR CONTRIBUTIONS NJD performed the laboratory work and write the first draft of the manuscript. KAA coordinated and help in the execution of the experiment. BGA performed the statistical analysis. RMPR and JBB helped in the histological analysis and revised the manuscript. MB provided the animals. JRF provided the technical support and revised the manuscript. RRS and JS revised the manuscript. SFSD performed the hormonal assay. APRR designed the experiment, provided the funding and helped with the drafting of the manuscript. All authors read the final draft and agreed to its submission. CONFLICT OF INTEREST The authors have declared no conflicts of interest

129 128 Figures Figure 1: (A) Percentage (mean ± SEM) of morphologically normal preantral (primordial, transition, primary and secondary) follicles and (B) percentage of developing (transition, primary and secondary) follicles (mean ± SEM) from nonculture control and culture of ovarian cortex for seven days. a,b,c Uncommon lowercase letters indicate significant difference (P < 0.05). Figure 2. Representative images of morphological normal follicles (A, Primordial; B, C and D, transitional follicles), PPH3 (E, primary; F, transitional follicles) and SDF-1α (H, antral; and I,primordial follicles) respectively. Scale bar = 50µm.

130 129 Figure 3. Mean concentration (± SEM) of (A) estradiol and (B) progesterone during in vitro culture of caprine ovarian tissue. * Differ from Day 2 of in vitro culture (P < 0.05). Figure 4. Immunolocalization of Cx37 and Cx43 (green bright fluorescent) in goat ovarian tissue in uncultured (fresh control and vitrification) ovarian fragments and ovarian fragments cultured for 7 days. Fresh control (A: Antral follicle; F: Secondary follicle); Vitrification (B and G transition follicles); In vitro culture (C and H: Antral follicles); Vitrification plus in vitro culture (D: Antral follicle; I: Transition follicle). Scale bar = 50µm

131 130 REFERENCES Ackermann, C. L., Asa, C. S., Krisher, R., Bauman, K., Casey, S., & Lopes, M. D. (2017). Evaluation of follicular growth and tissue viability in vitrified/ warmed domestic dog ovaries after in vitro culture. Reproduction in Domestic Animal, 52, Doi: /rda ckert C L Gittens J E O Brien M J Eppig J J & Kidder G M 1 Intercellular communication via connexin43 gap junctions is required for ovarian folliculogenesis in the mouse. Developmental Biology, 233, Doi: /dbio Alves, A. M., Chaves, R. N., Rocha, R. M., Lima, L. F., Andrade, P. M., Lopes, C. A., Souza, C. E., Moura, A. A., Campello, C. C., Báo, S. N., Smitz, J., & Figueiredo, J. R. (2012). Dynamic medium containing growth differentiation factor-9 and FSH maintains survival and promotes in vitro growth of caprine preantral follicles after long-term in vitro culture. Reproduction Fertilility and Development, 25, Doi: /RD Aye, M., Giorgio, C., De Mo, M., Botta, A, Perrin, J., & Courbiere, B. (2010). Assessment of the genotoxicity of three cryoprotectans used for human oocyte vitrification: dimethyl sulfoxide, ethylene glycol and propylene glycol. Food Chemestry and Toxicology, 48, Doi: /j.fct Carabatsos, M. J., Sellitto, C., Goodenough, D. A., & Albertini, D. F. (2000). Oocytegranulosa cell heterologous gap junctions are required for the coordination of nuclear and cytoplasmic meiotic competence. Developmental Biology, 226, Doi: /dbio Carvalho, A. A. Faustino, L. R., Silva, C. M. G., Castro, S. V., Lobo, C. H., Santos, F. W. Santos, R. R., Campello, C. C., Bordignon, V., Figueiredo, J. R., & Rodrigues, A. P.

132 131 R. (2014). Catalase addition to vitrification solutions maintains goat ovarian preantral follicles stability. Research and Veterinary Science, 97, Doi: /j.rvsc Carvalho, A. A., Faustino, L. R., Silva, C. M., Castro, S. V., Lopes, C. A., Santos, R. R., Báo, S. N., Figueiredo, J. R., & Rodrigues, A. P. (2013). Novel wide-capacity method for vitrification of caprine ovaries: Ovarian Tissue Cryosystem (OTC). Animal Reproduction science, 138, Doi: /j.anireprosci Castro, S. V., Carvalho, A. A., Silva, C. M., Santos, F. W., Campello, C. C., De Figueiredo, J. R. & Rodrigues, A. P., (2014). Frozen and fresh ovarian tissue require different culture media to promote in vitro developmentof bovine preantral follicles. Biopreservation and Biobanking, 12, Doi: /bio Choi, J., Lee, B., Lee, E., Yoon B. K., Bae D., & Choi D. (2008). Cryopreservation of ovarian tissues temporarily suppress the proliferation of granulosa cells in mouse preantral follicles. Cryobiology, 56, Doi: /j.cryobiol Fadhillah, Yoshioka, S., Nishimura, R., Yamamoto, Y., Kimura, K., & Okuda, K. (2017). Hypoxia-inducible factor 1 mediates hypoxia-enhanced synthesis of progesterone during luteinization of granulosa cells. Journal of Reproduction and Development, 63, Doi: /jrd Gershon, E., Plaks, V., & Dekel, N. (2008). Gap junctions in the ovary: expression, localization and function. Molecular and Cellular Endocrinology, 28, Doi: /j.mce Granot, I., Bechor, E., Barash, A., & Dekel, N. (2002). Connexin43 in rat oocytes: Developmental modulation of its phosphorylation. Biology of Reproduction, 66, Grazul-Bilska, A. T., Redmer, D. A., Bilski, J. J., Jablonka-Shariff, A., Doraiswamy, V., & Reynolds, L. P. (1998). Gap junctional proteins, connexin 26, 32 and 43 in sheep

133 132 ovaries throughout the estrous cycle. Endocrine, 8, Doi: /ENDO:8:3:269. Grazul-Bilska, A. T., Vonnahme, K. A., Bilski, J. J., Borowczyk, E., Soni, D., Mikkelson, B., Johnson, M. L., Reynolds, L. P., Redmer, D. A., & Caton J. S. (2011). Expression of gap junctional connexin proteins in ovine fetal ovaries: Effects of maternal diet. Domestic Animal Endocrinology, 41, Doi: /j.domaniend Holt, J. E., Jackson A., Roman S. D., Aitken, R. J., Koopman, P., & McLaughlin, E. A. (2006). CXCR4/SDF1 interaction inhibits the primordial to primary follicle transition in the neonatal mouse ovary. Developmental Biology, 293, Doi: /j.ydbio Jensen, A. K., Macklon, K. T., Fedder, J., Ernst, E., Humaidan, P., & Andersen C.Y. (2016). 86 successful births and 9 ongoing pregnancies worldwide in women transplanted with frozen-thawed ovarian tissue: focus on birth and perinatal outcome in 40 of these children. Journal of Assisted Reproduction and Genetics, doi: /s y. Kawamura, K., Cheng, Y., Suzuki, N., Deguchi, M., SATO, Y., Takae, S., Ho, C. H., Kawamura, N., Tamura, M., Hashimoto, S., Sugishita, S., Morimoto, Y., Hosoi, Y., Yoshioka, N., Ishizuka, B. & Hsueh, A. J., (2013). Hippo signaling disruption and Akt stimulation of ovarian follicles for infertility treatment. Proceedings of the National Academy of Sciences, 43, Keogh, M. C., Jung-Ae Kim, J., Downey, M., Fillingham, J., Chowdhury, D., Harrison, J. C., Onishi, M., Datta, N., Galicia, S., Emili, A., Lieberman, J., Shen, X., Buratowski, S., Haber, J. E., Durocher, D., Greenblatt, J. F., & Krogan, N. J. (2006). A phosphatase complex that dephosphorylates gammah2ax regulates DNA damage checkpoint recovery. Nature, 439, Doi: /nature Kim J. Y., Jeong, H. S., Chung, T., Kim, M., Lee, J. H., Jung, W. H., & Koo, J. S. (2017). The value of Phosphohistone H3 as a proliferation marker for evaluating

134 133 invasive breast cancers: A comparative study with Ki67. Oncotarget, Advance Publications, Doi: /oncotarget Kryczek, I., Frydman, N., Gaudin, F., Krzysiek, R., Fanchin, R., Emilie, D., Chouaib, S., Zou, W., & Machelon, V. (2005). The chemokine SDF-1/CXCL12 contributes to T lymphocyte recruitment in human pre-ovulatory follicles and coordinates with lymphocytes to increase granulosa cell survival and embryo quality. American Journal of Reproductive Immunology, 54, Doi: /j x. Leal, É. S. S., Vieira, L. A., Sá, N. A. R., Silva, G. M., Lunardi, F. O., Ferreira, A. C. A., Campello, C. C., Alves, B. G, Cibin, F. W. S., Smitz, J., Figueiredo, J. R., Rodrigues, A. P. R. (2017). In vitro growth and development of isolated secondary follicles form vitrified caprine ovarian cortex. Reproduction Fertility and Development, Doi: /RD Lee, R. K., Li, S. H., Lu, C. H., Ho, H. Y., Chen, Y. J., & Yeh, H. I. (2008). Abnormally low expression of connexin 37 and connexin 43 in subcutaneously transplanted cryopreserved mouse ovarian tissue. Journal of Assisted Reproduction and Genetics, 25, Doi: /s Lunardi, F. O., De Aguiar, F. L., Duarte, A. B., Araújo, V. R., De Lima, L. F., Ribeiro De Sá, N. A., Vieira Correia, H. H., Domingues, S. F., Campello, C. C., Smitz, J., De Figueiredo, J. R., & Ribeiro Rodrigues, A. P. (2016). Ovine secondary follicles vitrified out the ovarian tissue grow and develop in vitro better than those vitrified into the ovarian fragments. Theriogenology, 85, Doi: /j.theriogenology Martins, F. S., Celestino, J. J. H., Saraiva, M. V. A., Matos, M. H. T., Bruno, J. B., Rocha-Junior, C. M. C., Lima-Verde, I. B., Lucci, C. M., Báo, S. N., & Figueiredo, J. R. (2008). Growth and differentiation factor-9 stimulates activation of goat primordial follicles in vitro and their progression to secondary follicles. Reproduction Fertility and Development, 20,

135 134 McNatty, K. P, Makris, A., Camillo, D. E., Osathanondh, R., & Ryan, K. J. (1979). The production of progesterone, androgens, and estrogens by granulosa cells, thecal tissue, and stromal tissue from human ovaries in vitro. Journal of Clinical Endocrinology and Metabolism, 49, Doi: /jcem Nuttinck, F., Peynot, N., Humblot, P., Massip, A., Dessy, F., & Flechon, J. E. (2000). Comparative immunohistochemical distribution of connexin 37 and connexin 43 throughout folliculogenesis in the bovine ovary. Molecular Reproduction and Development, 57, Doi: / (200009)57:1<60::AID MRD9>3.0.CO;2-6. O Neill B M Szyjka, S. J., Lis, E. T, Bailey, A. O., Yates, J. R., Aparicio, O. M., & Romesberg, F. E. (2007). Pph3-Psy2 is a phosphatase complex required for Rad53 dephosphorylation and replication fork restart during recovery from DNA damage. Proceedings of the National Academy of Sciences, 104, Doi: /pnas Preuss, U., Landsberg, G., & Scheidtmann, K. H. (2003). Novel mitosis-specific phosphorylation of histone H3 at Thr11 mediated by Dlk/ZIP kinase. Nucleic Acids Research, 31, Doi: /nar/gkg176. Silva, A. M. S., Bruno, J. B., Lima, L. F., Sá NAR, Lunardi, F. O, Ferreira, A. C. A., Correia, H. H. V., Aguiar, F. L. N., Araújo, V. R., Lobo, C. H., Moura, A. A. A., Campello, C. C., Smitz, J., Figueiredo, J. R., & Rodrigues, A. P. R. (2016). Connexin 37 and 43 gene and protein expression and developmental competence of isolated ovine secondary follicles cultured in vitro after vitrification of ovarian tissue. Theriogenology, 85, Doi: /j.theriogenology Silva, J. R. V., Tharasanit, T., Taverne, M. A. M., Van der Weijden, G. C., Santos, R. R., Figueiredo, J. R., & Van den Hurk, R. (2006). The activin follistatin system and in vitro early development in goats. Journal of Endocrinology, 189, Doi: /joe

136 135 Silva, J. R. V., Van den Hurk, R., Van Tol, H. T. A., Roelen, B. A. J., & Figueiredo, J. R. (2004). Expression of growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15) and BMP receptors in the ovaries of goats. Molecular Reproduction and Development, 70, Doi: /mrd Skinner, M. K., Schmidt, M., Savenkova, M. I., Sadler-Riggleman, I., & Nilsson, E. E. (2008). Regulation of granulosa and theca cell transcriptomes during ovarian antral follicle development. Molecular Reproduction and Development, 75, Doi: /mrd Suzuki, N., Yoshioka, N., Takae, S., Sugishita, Y., Tamura, M., Hashimoto, S., Morimoto, & Y., Kawamura, K. (2015). Successful fertility preservation following ovarian tissue vitrification in patients with primary ovarian insufficiency. Human Reproduction, 30, Doi: /humrep/deu353. Tachibana, K., Hirota, S., Iizasa, H., Yoshida, H., Kawabata, K., Kataoka, Y., Kitamura, Y., Matsushima, K., Yoshida, N., Nishikawa, S., Kishimoto, T., & Nagasawa, T. (1998). The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature 393, Doi: / Tanpradit, N., Comizzoli, P., Srisuwatanasagul, S., & Chatdarong, K. (2015). Positive impact of sucrose supplementation during slow freezing of cat ovarian tissues on cellular viability, follicle morphology, and DNA integrity. Theriogenology, 83, Doi: /j.theriogenology Ting, A. Y., Yeoman, R. R., Lawson, M. S., & Zelinski, M. B. (2011). In vitro development of secondary follicles from cryopreserved rhesus macaque ovarian tissue after slow-rate freeze or vitrification. Human Reproduction, 26, Doi: /humrep/der196. Vajta, G., Holm, P., Kuwayama, M., Booth, P. J., Jacobsen, H., Greve, T., & Callesen H. (1998). Open pulled straw (OPS) vitrification: a new way to reduce cryoinjuries of

137 136 bovine ova and embryos. Molecular Reproduction and Development, 51, Doi: /(SICI) (199809)51:1<53::AID-MRD6>3.0.CO;2-V. Vanacker J., Luyckx V., Dolmans M, M., Des Rieux A., Jaeger J., Van Langendonckt A., Donnez J., & Amorim C. A. (2012). Transplantation of an alginate-matrigel matrix containing isolated ovarian cells: first step in developing a biodegradable scaffold to transplant isolated preantral follicles and ovarian cells. Biomaterials 33, Doi: /j.biomaterials Vozzi, C., Formenton, A., Chanson, A., Senn, A., Sahli, R., Shaw, P., Nicod, P., Germond, M., & Haefliger J. A. (2001). Involvement of connexin 43 in meiotic maturation of bovine oocytes. Reproduction, 122, Wang, Y., Xiao, Z., Li, L., Fan, W., & Li, S. W. (2008). Novel needle immersed vitrification: a practical and convenient method with potential advantages in mouse and human ovarian tissue cryopreservation. Human Reproduction, 23, Doi: /humrep/den255. Woodruff, T. K. (2007). The emergence of a new interdiscipline: Oncofertility. Cancer Treatment Research, 38, Woodruff, T. K. (2010). The Oncofertility Consortium addressing fertility in young people with cancer. Nature Reviews Clinical Oncology, 7, Doi: /nrclinonc Yang, Y., Chen, J., Wu, H., Pei, X., Chang, Q., Ma, W., Huiming Ma, Changchun Hei, Zheng, X., Cai, Y., Zhao, C., Yu, J., Wang, Y. (2015). The Increased Expression of Connexin and VEGF in Mouse Ovarian Tissue Vitrification by Follicle Stimulating Hormone. BioMedecine Research International, 2015, Doi: /2015/ Zhou, C., Borillo, J., Wu, J., Torres, L., & Lou, Y. H. (2004). Ovarian expression of chemokines and their receptors. Journal of Reproductive Immunology, 63, 1-9. Doi: /j.jri

138 137 Zou, Y. R., Kottmann, A. H., Kuroda, M., Taniuchi, I., & Littman, D. R. (1998). Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature, 393, Doi: /31269.

139 CAPÍTULO 5 Xenotransplante de ovario de cabra como alternativa para analisar os folículos após vitrificação Xenotransplantation of goat ovary as an alternative to analyse follicles after vitrification Periódico: A ser submetido

140 139 RESUMO: O objetivo deste estudo foi avaliar o desenvolvimento folicular após um mês de xenotransplante do córtex ovariano caprino para camundongos nude BALB. O córtex ovariano foi fragmentado (3 3 0,5 mm) e dividido em quatro grupos: controle fresco, controle vitrificado, transplante fresco e transplante vitrificado. Foram avaliados os parâmetros de desenvolvimento e densidade folicular, fibrose, apoptose e revascularização. Observou-se também uma diminuição significativa dos folículos morfologicamente normais tanto no controle vitrificado e no transplante vitrificado quando comparados com o controle fresco e o transplante fresco. A densidade folicular reduziu significativamente em todos os tratamentos em comparação com o controle fresco. O controle fresco e o transplante fresco exibiram uma porcentagem semelhante de folículos em desenvolvimento (P > 0,05). No entanto, o controle vitrificado mostrou um aumento significativo de folículos em desenvolvimento em comparação ao controle fresco e ao transplante fresco. Foi observado um aumento da fibrose no transplante fresco e vitrificado. Adicionalmente, a expressão de RNAm da caspase 3 foi menor no transplante fresco e vitrificado em comparação com o controle vitrificado. Em conclusão, O xenotransplante é uma excelente estratégia para manter os folículos préantrais morfologicamente normais após a vitrificação do tecido ovariano de cabra. No entanto, para garantir a sobrevivência e o desenvolvimento desses folículos, é essencial melhorar a revascularização do enxerto. Palavras-chave: Criopreservação ovariana. Enxerto. Restauração da função ovariana. Foliculogênese.

141 140 Xenotransplantation of goat ovary as an alternative to analyse follicles after vitrification Abridged title: Xenotransplantation to analyse vitrified ovary N.J. Donfack 1, K.A. Alves 1, B.G. Alves 1, R.M.P. Rocha 1, J.B. Bruno 1, C. H. Lobo 1, M. Bertolini 2 R. Santos 3, M.O. Taumaturgo 4, R.S. Raposo 4, J.R. Figueiredo 1, J. Smitz 5, A.P.R. Rodrigues 1* 1 Faculty of Veterinary Medicine, Laboratory of Manipulation of Oocytes and Preantral Follicles (LAMOFOPA), State University of Ceará, Fortaleza, CE, Brazil, 2 Federal University of Rio Grande do Sul, Veterinay Faculty, Porto Alegre, RS-Brazil, 3 Laboratory of Biology and Medicine of Wild Animals of Amazon, University Federal of Pará-Belem-PA, Brazil, 4 Nucleus of Experimental Biology, University of Fortaleza, CE, Brazil and 5 Follicle Biology Laboratory, Center for Reproductive Medicine, UZ Brussel, Laarbeeklaan 101, B-1090 Brussels, Belgium *Correspondence should be addressed to: aprrodriguespapers@gmail.com Programa de Pós-Graduação em Ciências Veterinárias (PPGCV). Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA). Universidade Estadual do Ceará (UECE). Av. Paranjana, 1700, Campus do Itaperi. Fortaleza CE Brasil. CEP: Tel.: ; Fax: address: aprrodriguespapers@gmail.com

142 141 Abstract The aim of this study was to evaluate the caprine preantral follicles enclosed on vitrified/warmed ovarian cortex grafted to nude BALB/ mice during one month. The ovarian cortex from goats was fragmented ( mm) and divided into four groups: fresh control, vitrified control, fresh transplant and vitrified transplant. Follicular morphology, development and density, Fibrosis as well as apoptosis, and tissue revascularization were evaluated. It was also observed a significant decrease of morphologically normal preantral (primordial, transition, primary and secondary) follicles in both vitrified control and vitrified transplant treatments when compared with both fresh control and fresh transplant. However, fresh control and fresh transplant exhibited a similar percentage of developing follicles. Additionally, Vitrified control showed a significant increase of developing follicles in comparison with both fresh control and fresh transplant. Follicular density significantly decreased in all the treatments in comparison with fresh control. We observed high fibrosis in both fresh and vitrified transplant. The mrna expression of caspase 3 was lower in both fresh and vitrified transplant in comparison with vitrified control. In conclusion, xenotransplantation is an excellent strategy to maintain normal preantral follicles morphology after vitrification/warming of goat ovarian tissue. However, in order to ensure the survival and development of these follicles, it is essential to improve the revascularization of the graft. Keywords: Ovarian cryopreservation, Graft, Ovarian function restoration, Folliculogenesis.

143 142 Introduction Ovarian tissue cryopreservation and autotransplantation (OTC-AT) is a promising technique for the restoration of endocrine function and fertility of cancer patient (Qiao & Li 2014) and can be offered to women without delay in cancer therapy (Winkler-Crepaz et al. 2015). Data from three fertility preservation centers (Belgium, Denmark and Spain) showed that endocrine ovarian function could be restored in 93% of patients after autotransplantation (Donnez et al. 2013). Moreover, pregnancy rates after 111 cases of ovarian tissue autotransplantation in five fertility preservation centers were 29% (Donnez et al. 2015). This low percentage may be related not only to the cryopreservation procedure but also to the revascularization process after transplantation, which influences tissue survival and follicular development. All these aspects still characterize OTC-AT as an experimental technique. Therefore, ovarian tissue cryopreservation and xenotransplantation (OTC-XT) it is an alternative approach for studying mechanisms of follicular development in different animal species (Oktay et al. 1998) and for improving cryopreservation and grafting protocols (Lotz et al. 2014, 2016). In human, xenotransplantation of ovarian tissue may be a valuable alternative to guarantee the growth and development of preantral follicles. Subsequently, the oocyte could be recovered for further in vitro maturation and in vitro fertilization, when autotransplantation is not possible. Xenotransplantation between close species can also be used to seek the perpetuation of animals with acquired infertility or after death, or for the germplasm conservation of wild species and breeds of domestic animal that are in the process of extinction (Kikuchi et al. 2011). Follicular development in fresh or cryopreserved ovarian tissue xenotransplants has been documented in woman (Luyckx et al. 2013), cow (Semple et al. 2000), sheep, cat (Gosden et al. 1994), marmoset monkey (Candy et al. 1995), elephant (Gunasena et al. 1998), and marsupials (Mattiske et al. 2002). However, it is currently unknown whether xenotransplantation of fresh or cryopreserved goat ovarian tissue into immunodeficient mice can allow follicle survival and development. Therefore, the aim of this study was to evaluate after one month of xenotransplantation, several functional aspects of the grafts, such as (1) follicular

144 143 morphology, (2) development, (3) density, (4) graft fibrosis, (5) apoptosis, (6) and revascularization. Material and method This experiment was approved and performed under the guidelines of the Ethics Committee for Animal Use of the State University of Ceará ( /2015). The cryoprotectants (ethylene glycol and dimethyl sulfoxide) were obtained from Dinâmica (Dinâmica Química, Diadema, SP, Brazil) and other chemicals were obtained from Sigma (Sigma Chemical Co., St. Louis, MO, USA) unless otherwise stated. Collection and preparation of goat ovarian tissue Ovaries were collected at slaughterhouse from eight adult mixed-breed goats. Immediately postmortem, the ovaries were washed once in 70% ethanol and twice in HEPES-buffered minimum essential medium (MEM) supplemented with 100 μg/ml penicillin and 100 μg/ml streptomycin. Therefore, the ovaries were transported to the laboratory (20 ºC) within 1 h. Experimental design Each ovarian pair was fragmented into 12 slices ( mm) using a tissue slicer (Thomas Scientific, Swedesboro, NJ, USA). The ovarian cortex was analyzed using a light microscope (magnification 400) and only the fragments with visible follicles were selected and distributed to the different treatments. Subsequently, two fresh fragments were immediately fixed in 4% paraformaldehyde (PAF) and one in Trizol for classical histology and PCR, respectively and named as the fresh control. The remaining fragments were randomly assigned to vitrification and/or xenotransplantation corresponding to the following treatments, vitrified control, vitrified transplant and fresh transplant. Vitrification and warming procedures of ovarian tissue The vitrification was performed using the Ovarian Tissue Cryosystem (OTC), a solid surface technique, as described by Carvalho et al. (2014) for caprine ovary. Briefly, two vitrification (VS) solutions were used. The VS1 consisted of MEM-HEPES supplemented with 10 mg/ml bovine serum albumin (BSA), 20 IU catalase, 0.25 M

145 144 sucrose, 10% ethylene glycol (EG) and 10% dimethyl sulfoxide (DMSO). The VS2 had a similar composition of VS1, except for the concentration of penetrating cryoprotectants (20% EG and 20% DMSO). Initially, the fragments were exposed to VS1 during 4 min followed by 1 min into VS2. Both time exposures were performed using the OTC at room temperature (RT). After cryoprotectants exposition, the vitrification solution was then removed and the OTC containing the ovarian tissue was closed and immediately immersed vertically into liquid nitrogen at -196 C. Following the cryostorage, the vitrified ovarian fragments were warmed in the air at RT ( 25 C) for 1 min, followed by immersion in a water bath (37 C) for 30 s. After warming, the cryoprotectants were removed by a three-step washing solutions (WS; 5 min each) in WS1: MEM + 3 mg/ml BSA M sucrose, WS2: MEM + 3 mg/ ml BSA M sucrose and WS3: MEM + 3 mg/ ml BSA. Xenotransplantation Twenty-five female nude BALB/mice of 6-8 weeks were used in all the experiment. From these animals, 13 received fresh fragments (fresh transplant) and 12 vitrified fragments (vitrified transplant). The mice were anesthetized by intraperitoneal injection of 80 mg/kg Ketamine 5% and 10 mg/kg Xylazine 2% solution. The dorsal skin over the flank was sterilized using 70% v/v ethanol and a 1cm dorsal incision was made through the skin of abdominal wall to expose the ovarian fat pad and bilateral ovariectomy was performed. The transplantation procedure was done according to the protocol described by Amorim et al. (2013). Briefly, two ovarian cortex were stitched to each side of the peritoneal wall (Figure 1). The abdominal wall was then closed and the animals were kept in sterile conditions for 1 month. After surgical procedure each, each animal received 1 µl of tramadol. The ovarian fragments were then recovery and fixed in 4% PAF and trizol for posterior analyses. Follicular morphology, density, and development assessment Ovarian fragments from the treatments control fresh or vitrified, and transplanted fresh or vitrified were fixed in 4% PAF at RT for 4 h, dehydrated in a graded series of ethanol, clarified with xylene, embedded in paraffin wax, and serially sectioned into 7 μm thickness The sections were stained with periodic acid chiff (PAS)-hematoxylin for histological analysis and follicular morphology was examined by a light microscope (magnification 400). For each treatment, follicles were counted

146 145 only in sections where the oocyte nucleus was visible. Follicles were classified as morphologically normal when they contained an intact oocyte and granulosa cells or degenerated when they contained an oocyte with a pyknotic nucleus, ooplasma shrinkage and/or granulosa cell layers that were disorganized and detached from the basement membrane. Follicles were also classified according to the development stage (Carvalho et al. 2013) as primordial (one layer of flattened pre-granulosa cells around the oocyte); transition (one layer of flattened and cuboidal cells around the oocyte); primary (one layer of cuboidal granulosa cells around the oocyte) and secondary follicles (two or more layers of cuboidal granulosa cells around the oocyte). The follicular density (number of follicles /mm2) was also evaluated according to by Santos et al. (2006). Assessment of fibrosis To investigate the structure of the ovarian tissue, relative areas of fibrosis were evaluated by Picrosirius red staining combined with polarization light microscopy. Fibrotic areas were characterized by rich collagen deposits. Picrosirius red is a strong anionic dye that attaches to collagen fibers and turns the tissue green, yellow, orange or red according to the thickness of the fibers (colors of collagen fibers in order of increasing thickness) (Rich & Whittaker 2005). This classification was applied based on the study with Picrosirius analysis (Lattouf et al. 2014). When evaluated by light microscopy, collagen is stained red, while cytoplasm is stained in yellow. Under polarized light microscopy, it is possible to differentiate collagen fibers by different birefringent colors (Scalercio et al. 2016). Quantitative PCR For evaluation of Bax, BCL2, Caspase 3 and CD31 gene expression, total RNA of ovarian fragments was extracted using the Trizol reagent method (Invitrogen, Carlsbad, CA, USA) according to the recommendations of the manufacturer and further purified with PureLink RN Mini Kit n ion Carls ad C fter the extraction, the RNA concentration was determined using the NanoDrop System Thermo cientific NanoDrop Products performed with μl of material Before the cdna synthesis, all samples were standardized with the same amount of RNA to minimize qpcr variability. cdna synthesis was performed according to the

147 146 instructions of SuperScript III RT-PCR (Invitrogen, Carlsbad, CA, USA) manual using random primers (Invitrogen, Carlsbad, CA, USA) from 1 ng of total RNA. The primers were designed using Primer 3 to perform the amplification of Bax, BCL2, Caspase 3 and CD31 (Table 1). All primers set were designed to anneal at 60ºC. The reactions were performed in quadruplet always using control without cdna to avoid possible contamination. Evaluations were performed in IQ5 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) using analysis of relative quantification. Detection of PCR products was measured by monitoring the increase in fluorescence emitted by the marker Power SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA, USA). For all amplifications, one dissociation curve (melting curve) was done for the verification of unspecific amplifications arising from contamination was held. The qpcr thermal cycle was as follow: initial denaturation and activation of the polymerase for 15 min at 94 C, followed by 40 cycles of 15 s at 94 C, 30 s at 60 C and 45 s at 72 C. the final extension was for 10 min at 72 C. Quantification of the transcripts of target genes was calculated from the difference of the values of the Cq values (threshold cycle PCR) in relation to transcripts of the endogenous gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). First, the mean Cqs of the three readings for each sample, both the target gene and the endogenous gene was determined. From each sample, the subtraction of the mean value of the Cqgene-target to Cqgene-endogene provided the ΔCq u sequently one ΔCq corresponding to a calibrator was chosen, normalizing all values by subtracting the resulting ΔCq chosen to o tain the ΔΔCq Finally the final value of relative quantification was given by 2 ΔΔCq, where the calibrator or standard sample chosen was equal to one (Livak & Schmittgen 2001). Statistical analysis Statistical analyses were performed using the Sigma Plot 11.0 software (Systat Software Inc, San Jose, California, USA). Data that were not normally distributed (Shapiro-Wilk test) were submitted to logarithmic transformation. Comparison of means (normal, primordial, and activated follicles) was performed among treatments by the Kruskal-Wallis test. The ANOVA and Tukey test were used to analyze the mean values of follicular density per square millimeter. The mrna expression level was analyzed using the t-tests. Data were presented as mean (± SEM) and percentage unless indicated otherwise. Statistical significance was defined as P < 0.05.

148 147 Results Follicular morphology, density, and development before and after xenotransplantation The percentage of morphologically normal preantral (primordial, transition, primary and secondary) follicles (Fig. 1) before and after xenotransplantation of both fresh and vitrified goat ovarian cortex is shown in table 2. No significant difference was observed between fresh control and fresh transplant. However, there was a significant decrease in both vitrified control and vitrified transplant treatments when compared with both fresh control and fresh transplant. Additionally, vitrified transplant showed a lower (p<0.05) percentage of morphologically normal follicles in comparison with vitrified control. In table 2 we can observe a significant decrease in follicular density in all treatments (vitrified control, fresh transplant, vitrified transplant) when compared to fresh control. Moreover, vitrified transplanted ovarian cortex showed a significant decrease in follicular density in comparison with the fresh transplant. Regarding the percentage of developing (transition, primary and secondary) follicles, both fresh control and fresh transplant exhibited a similar percentage of developing (transition, primary and secondary) follicles. In contrast, vitrified control showed a significant increase in developing follicles in comparison with both fresh control and fresh transplant. Unfortunately, in vitrified transplant treatment, it was not possible to make a statistical analysis due to the insufficient number of follicles (Table 2). Evaluation of fibrosis after ovary xenotransplant Collagen type I and type III were analyzed using picrosirius staining (Fig. 2). The red color indicates the presence of type I collagen and the green color denotes type III collagen. We observed that collagen type I was predominantly observed in fresh control. However, in the other treatments (vitrified control, fresh and vitrified transplant) it was observed a high intensity of type III collagen.

149 148 Relative mrna expression of genes associated with apoptosis (BAX, BCL2 and active Caspase 3) and angiogenesis (CD31) The relative expression patterns of BAX and BCL2 were evaluated using qpcr (Fig. 3a and 3b, respectively). The relative mrna expression of BAX was similar in all the treatments. However, the mrna expression of BLC2 was only detected in fresh transplant and vitrified transplant and no difference (P>0.05) between these treatments were observed. The mrna expression of active caspase 3 was lower in both fresh transplant and vitrified transplant in comparison to vitrified control (Fig. 3c). Moreover, no significant difference was observed between fresh control and vitrified control. Revascularization after xenotransplantation The revascularization of goat ovarian tissue after xenotransplantation was assessed using the mrna expression of CD31 (Fig. 3d). Only fresh and vitrified control showed a detectable level of mrna expression of CD31, however without a significant difference between these treatments. Discussion Xenotransplantation of ovarian tissue it is an alternative approach for studying mechanisms of follicular development in different animal species and for improving cryopreservation and grafting protocols. However, several aspects of this procedure remained to be more accurately investigated (Lotz et al. 2016). We performed for the first time the xenotransplantation of goat ovarian tissue to nude BALB/mice to analyze the preantral follicles after vitrification of ovarian tissue. We also evaluated the ovarian tissue fibrosis, apoptosis, and revascularization. The histological analysis showed a significant decrease in the percentage of morphologically normal follicles in vitrified control in comparison with fresh control. This result is similar to those obtained by Abdel-Ghani et al. (2016) after vitrification of uffalo s ovaries and could e an effect resulting of the osmotic stress to which the cells are subjected during vitrification (Vajta et al. 1998), or to the cryoprotectants toxicity (Aye et al. 2010). Additionally, the follicular density was lower in both fresh and vitrified transplant treatments when compared to fresh control. A similar result was obtained by

150 149 Gavish et al. (2014) after xenotransplantation of the bovine ovarian cortex to mice. This result could be related to the ischemic injury. Previous studies suggested that the ischemic condition that occurs just after ovarian transplantation is the main factor that contributes to follicular atresia (Yan et al. 2008, Van Eyck et al. 2010, Onions et al. 2013). Moreover, the reduction of follicular density was more pronounced after transplantation of vitrified tissue. The combined effect of cryoinjury and ischemia could explain this result. It has been shown by Candy et al. (1997) has shown that cryopreservation is responsible for additional reductions in follicular numbers per graft. We further obtained a similar percentage of developing follicles between fresh control and fresh transplant. In contrast to fresh transplant, we obtained a higher percentage of growing follicles after vitrification. However, it is difficult to assess primordial follicles activation since the number of primordial follicles at the time of vitrification or transplantation in each piece is not really known. In addition, because follicular activation is an irreversible process, activated follicles that are not selected for further development could undergo atresia and are probably not found after transplantation. In the present study, collagen type I was predominantly in fresh control, however in vitrified control, fresh and vitrified transplant treatments it was observed a high area of collagen type III. In routine histopathological analyses, Picrosirius Red staining combined with polarization light microscopy is one of the most selective histological methods used to analyze the co-distribution of type I and III collagens in the same tissue section. This staining assay has been used also to evaluate fibrosis within the ovarian tissue (Montes & Junqueira 1991, Huang et al. 2013). The high expression of collagen III in this study could be related to damage caused by vitrification process or fibrosis after transplantation. It has been shown that, in pathological situations, the expression of collagen can be altered with a persisting low collagen I/III ratio (Campos et al. 2008). Moreover, Wynn & Ramalingam (2012) have shown that fibrosis occurs when normal tissue remodeling and wound-healing responses are not properly regulated. Regarding the analysis of cell apoptosis, all the treatments showed a similar expression of BAX. However, only fresh and vitrified transplant showed detectable mrna expression of BLC2. In contrast to our study, Campos-Junior et al. (2016) showed a significant increase of BAX and a decrease of BCL2 after xenotransplantation

151 150 of the bovine ovary to mice. The increase of BCL2 in our study after xenotransplantation can be a cell response in an attempt to overcome the apoptosis process (Lunardi et al. 2017), showing that the living cells present in the tissue could resume their function. We further observed a lower expression of caspase 3 in both fresh and vitrified transplant in comparison to the vitrified control which may suggest that the cells escaped the apoptosis process. Nonetheless, in the literature, three distinct modes of cell death are recognized: physical cell rupture, necrosis, and apoptosis (Baust et al. 2000, Villalba et al. 2001). Induction of necrotic cascades can occur following severe cellular stress such as ischemia, hypothermia, freezing, ionic dysregulation, cytotoxic chemical exposure, etc. (Emery et al. 1998, Kroemer et al. 1998). Therefore, we hypothesize that the mechanism of cell death in our study could be also related to necrosis. The evaluation of revascularization after xenotransplantation was done through the relative mrna expression of CD31. Only fresh and vitrified control showed a detectable level of CD31. On the contrary, Wang et al. (2013) showed a similar expression of CD31 between fresh human ovarian cortex grafted into the back muscle of rabbit and ungrafted ovary. We suggest that the transplantation site used in our study was not suitable for a good revascularization, resulting in a low expression of this gene. In conclusion, xenotransplantation is an excellent strategy to maintain normal preantral follicle morphology after vitrification/warming of goat ovarian tissue. However, in order to ensure the survival and development of these follicles, it is essential to improve the transplantation protocol in order to obtain a better revascularization of the graft. Therefore, the addition of angiogenic factors to stimulate the revascularization or antioxidants to inhibit the apoptosis process after xenotransplantation could reduce the follicular loss. Moreover, reducing the inflammatory process of the recipients or choosing another site of transplantation could reduce the necrosis and improve the graft survival. Conflict of interest statement The authors have declared no conflicts of interest.

152 151 Funding This work was supported by National Counsel of Technological and Scientific Development (CNPq: ) and Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES: / ). Nathalie Jiatsa Donfack and Ana Paula Ribeiro Rodrigues are recipient of a grant from CAPES and CNPq, respectively. Johan Smitz is Especial Visitor Researcher from CAPES. Acknowledgments We thank Dr. Mary Zelinsky from Division of Reproductive Primate Research Center, Oregon health and sciences University Beaverton for the technical guidance during the execution of this experiment, especially, the xenotransplantation procedures.

153 152 Figures Figure 1 Steps of ovary xenotransplantation. (A) preparation of ovarian fragments, (B) transplantation of the donor cortical tissue to recipient mice, (C) recovery of the graft after 1 month of transplant. Histological examination of fresh, vitrified and fresh transplanted ovarian tissue showing normal primordial (D, E) and primary (F) follicles. O: Oocyte, Nu: Nucleus, GC: Granulosa cells.

154 153 Figure 2 Picrosirius staining (red color: type I collagen and green color: type III collagen) in the goat ovarian cortex before and after xenotransplantation of fresh or vitrified goat ovarian tissue.