Introdução à Bioinformática. Prof.

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Introdução à Bioinformática. Prof. IVAné@"

Transcrição

1 Introdução à Bioinformática Prof.

2 Bioinformática União da ciência da computação com a biologia molecular É uma área nova Há 10 anos atrás o termo nem existia Depois da descoberta de Watson e Crick (1953) de que o DNA é estruturado como uma hélice dupla; a Bioinformática passa a ser um dos instrumentos mais importante e fundamental para o estudo da Biologia Molecular.

3 A história começa na década de 1940 com a invenção do moderno computador digital Ele se chama digital, pois os dados são armazenados com um alfabeto binário Dígitos binários 0 e 1 A operação também é digital, baseada na lógica liga/desliga A descoberta da hélice dupla, em 1953, mostrou que a informação genética também é armazenada de forma digital Mas diferente do alfabeto binário dos computadores, os dados genéticos são armazenados com um alfabeto quaternário A, C, G e T Mais tarde se descobriu que a forma dos genes operarem também é digital Até certo ponto, os genes podem ser ligados ou desligados Apenas estas observações já seria suficiente para prever, na década de 1950, que um dia informática e biologia molecular iriam juntas fazer nascer uma nova área de conhecimento

4 Quase que em sintonia desembocamos em 1995 A bioinformática passou a ser reconhecida como importante pelo mundo científico por volta de 1995 Ano que o primeiro genoma de uma bactéria foi publicado Os computadores já estavam suficientemente poderosos para poder processar os milhões e A Biologia Molecular Apesar da estrutura do DNA ter sido desvendada em 1953, a informação nela contida não podia ser lida milhões de letrinhas. Foi como tivéssemos descoberto o alfabeto utilizado para escrever o livro da vida, mas as palavras desse livro estavam com letrinhas tão pequenas que não conseguíamos lê-las Foi preciso esperar até fins da década de 1980 para que aparecesse uma lente de aumento suficientemente boa que permitisse a leitura dessas letrinhas em grande quantidade E assim nasceu a bioinformática, A computação Computadores sendo capazes de armazenar cada vez mais informação, de processá-la de modo cada vez mais rápido, a um custo cada vez menor Na década de 1970 a unidade básica de armazenamento de informação era o kilobyte bytes, aproximadamente 1000 letras Um computador de grande porte daquela época tinha alguns kbytes de memória Com tal memória um computador desses não seria capaz de processar nem sequer o genoma de um vírus, que pode chegar a 20 kilobases, ou 20 mil letrinhas; que dirá o genoma humano, com seus 3 bilhões de letrinhas

5 Primeiro _ problema é chamado de problema biotecnológico Montagem do DNA Segunda _ diz respeito à natureza da biologia molecular Saber que informação está contida nos genomas

6 Montagem de DNA Montagem de DNA Um genoma de bactéria tem em geral 3 ou 4 milhões de letrinhas ou bases As máquinas seqüenciadoras conseguem ler apenas pedaços de cerca de 1000 bases Então como é possível ler um livro de 3 ou 4 milhões de letras se só conseguimos ler fragmentos de 1000 letras? A solução é gerar uma enorme quantidade de fragmentos que tenham sobreposição entre si Para ler 3 ou 4 milhões são necessários cerca de 100 mil desses fragmentos É necessário um programa de computador para montar esse quebra cabeça Limitação tecnológica atual É necessario um computador que consiga ler diretamente as 3 ou 4 milhões de bases Existem dezenas ou centenas de outros problemas na bioinformática, cada um deles motivado por uma particular tecnologia

7 Que problemas são esses? São basicamente de dois tipos Primeiro- temos a interpretação do DNA como uma linguagem, a linguagem dos genes Segundo- entender os efeitos da informação genética Os genomas contém informação Por exemplo: Para diferentes espécies de organismos e para diferentes indivíduos de uma espécie, particularmente a nossa. Essa interpretação requer métodos, técnicas, algoritmos que vêm principalmente da informática, pois afinal ela é a ciência da informação Dar sentido a essa sopa é tarefa dos bioinformatas

8 Algumas Definições Pesquisa e desenvolvimento de ferramentas computacionais, matemáticas e estatísticas para a resolução de problemas da Biologia Biologia Molecular Número de definições Número de bioinformatas Muitos tem sua própria definição de Bioinformática, com detalhes sutis para refletir seu interesse em Ciências Biológicas A Computação está para a Biologia da mesma forma que a matemática está para física Harold Morowitz Uma combinação de Ciência da Computação, Tecnologia da Informação e Genética para determinar e analisar informação genética Bits Journal - Bioinformatics: Information Technology & Systems

9 Ênfase está se deslocando progressivamente do acúmulo de dados para a sua interpretação Com os sequenciamentos realizados, um grande volume de dados tem sido gerado Esses dados precisam agora ser analisados Análise laboratorial é difícil e cara Ferramentas computacionais sofisticadas são necessárias para a análise dos dados obtidos

10 Para muitas dessas análises, as ferramentas computacionais precisam lidar com dados imprecisos e ruidosos Técnicas de laboratório de Biologia Molecular quase sempre geram dados com erros ou imprecisões Erros na coleta de dados Erros na construção de bases de dados Aprendizado de Máquina Fornece técnicas para lidar com os problemas acima

11

12 ATCTCGTAGCTA A ATCTCGTAGCTAG G ATCTCGTAGCTAGC C ATCTCGTAGCTAGCT T ATCTCGTAGCTAGCTA A ATCTCGTAGCTAGCTAC C ATCTCGTAGCTAGCTACG G ATCTCGTAGCTAGCTACGA A ATCTCGTAGCTAGCTACGAC C ATCTCGTAGCTAGCTACGACG G ATCTCGTAGCTAGCTACGACGT T ATCTCGTAGCTAGCTACGACGTC C ATCTCGTAGCTAGCTACGACGTCT T ATCTCGTAGCTAGCTACGACGTCTA A TAGAGCATCGATCGATGCTGCAGATGATGCTAGCATCGGCTAGGCGACG

13 15 milhões Europeu Japonês

14

Bioinformática Histórico e conceitos básicos

Bioinformática Histórico e conceitos básicos Bioinformática Histórico e conceitos básicos Raimundo Lima da S. Júnior M.Sc. Departamento de Biologia Núcleo de Pesquisas Replicon PUC-GO Silva Jr., RL Casamento entre a ciência da computação e a biologia

Leia mais

O surgimento da Bioinformática Banco de Dados Biológicos

O surgimento da Bioinformática Banco de Dados Biológicos Rede de Biodiversidade e Biotecnologia da Amazônia Legal Programa de Pós-Graduação da Bionorte FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE DEPARTAMENTO DE MEDICINA PROGRAMA DE PÓS-GRADUAÇÃO

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

1. NÍVEL CONVENCIONAL DE MÁQUINA

1. NÍVEL CONVENCIONAL DE MÁQUINA 1. NÍVEL CONVENCIONAL DE MÁQUINA Relembrando a nossa matéria de Arquitetura de Computadores, a arquitetura de Computadores se divide em vários níveis como já estudamos anteriormente. Ou seja: o Nível 0

Leia mais

INTRODUÇÃO ÀS LINGUAGENS DE PROGRAMAÇÃO

INTRODUÇÃO ÀS LINGUAGENS DE PROGRAMAÇÃO Capítulo 1 INTRODUÇÃO ÀS LINGUAGENS DE PROGRAMAÇÃO 1.1 Histórico de Linguagens de Programação Para um computador executar uma dada tarefa é necessário que se informe a ele, de uma maneira clara, como ele

Leia mais

Algoritmos e Programação I

Algoritmos e Programação I Algoritmos e Programação I Introdução a Computação Prof. Fernando Maia da Mota mota.fernandomaia@gmail.com CPCX/UFMS Fernando Maia da Mota 1 Computadores são dispositivos que só sabem fazer um tipo de

Leia mais

Introdução à Programação 2006/07. Computadores e Programação

Introdução à Programação 2006/07. Computadores e Programação Introdução à Programação 2006/07 Computadores e Programação Objectivos da Aula Noção de computador. Organização Interna de um Computador Noção de Sistema Operativo. Representação digital de informação

Leia mais

Computador. Algumas definições

Computador. Algumas definições Algumas definições Os computadores são ferramentas que nos permitem fazer cálculos rápida e comodamente (1982). Calculador electrónico usado na investigação espacial e actualmente já noutros campos da

Leia mais

Contextualização: Sistemas de Computação

Contextualização: Sistemas de Computação Contextualização: Sistemas de Computação Professor: Santiago Viertel dcc2sv@joinville.udesc.br Modelo de Computador Modelo de Computador: Informática Origem e Definição; Elementos Fundamentais; Hardware;

Leia mais

LÓGICA DE PROGRAMAÇÃO

LÓGICA DE PROGRAMAÇÃO Todos direitos reservados. Proibida a reprodução, mesmo parcial, por qualquer processo mecânico, eletrônico, reprográfico, etc., sem a autorização, por escrito, do(s) autor(es) e da editora. LÓGICA DE

Leia mais

Curso: Técnico de Informática Disciplina: Redes de Computadores. 1- Apresentação Binária

Curso: Técnico de Informática Disciplina: Redes de Computadores. 1- Apresentação Binária 1- Apresentação Binária Os computadores funcionam e armazenam dados mediante a utilização de chaves eletrônicas que são LIGADAS ou DESLIGADAS. Os computadores só entendem e utilizam dados existentes neste

Leia mais

Informática e informação 2

Informática e informação 2 Introdução à Informática Informática e informação Escola Superior de Tecnologia e Gestão Instituto Politécnico de Bragança Outubro de 2006 Conceito de Informática Informação + Automática Informática Tratamento

Leia mais

DNA: Passado, Presente e Futuro

DNA: Passado, Presente e Futuro DNA: Passado, Presente e Futuro O passado O modelo do DNA que hoje nos é tão familiar foi divulgado em abril de 1953 na revista científica Nature pelos cientistas James Watson e Francis Crick. Eles afirmaram

Leia mais

Prof.Msc Jocênio Marquios Epaminondas. http://www.twitter.com/jocenio

Prof.Msc Jocênio Marquios Epaminondas. http://www.twitter.com/jocenio Prof.Msc Jocênio Marquios Epaminondas http://www.jocenio.pro.br email:prof.jocenio@jocenio.pro.br http://www.twitter.com/jocenio A escrita, os primeiros registos: Os primeiros registos gráficos feitos

Leia mais

for Information Interchange.

for Information Interchange. 6 Memória: 6.1 Representação de Memória: Toda a informação com a qual um sistema computacional trabalha está, em algum nível, armazenada em um sistema de memória, guardando os dados em caráter temporário

Leia mais

PRIMEIRO BIMESTRE MATERIAL PARA ESTUDO. Universidade Tuiuti do Paraná Faculdade de Ciências Exatas Introdução a Computação - CSTA.

PRIMEIRO BIMESTRE MATERIAL PARA ESTUDO. Universidade Tuiuti do Paraná Faculdade de Ciências Exatas Introdução a Computação - CSTA. Universidade Tuiuti do Paraná Faculdade de Ciências Exatas Introdução a Computação - CSTA Sistema Binário MATERIAL PARA ESTUDO PRIMEIRO BIMESTRE Para o leigo um computador, a primeira vista, pode parecer

Leia mais

Organização de Computadores

Organização de Computadores Organização de Computadores Registro aqui o agradecimento ao professor Osvaldo (DCC-UFMG) e a vários professores do DECOM (Marcelo, Sabir, José Maria, Andrea, David) por ceder material que foi usado na

Leia mais

1.1. Organização de um Sistema Computacional

1.1. Organização de um Sistema Computacional 1. INTRODUÇÃO 1.1. Organização de um Sistema Computacional Desde a antiguidade, o homem vem desenvolvendo dispositivos elétricoeletrônicos (hardware) que funciona com base em instruções e que são capazes

Leia mais

O que é um programa? Programa é uma lista de instruções que descrevem uma tarefa a ser realizada pelo computador.

O que é um programa? Programa é uma lista de instruções que descrevem uma tarefa a ser realizada pelo computador. O que é um programa? Programa é uma lista de instruções que descrevem uma tarefa a ser realizada pelo computador. Linguagem de Programação Uma linguagem de programação é um método padronizado para expressar

Leia mais

Aula 01 Introdução à Informática. Prof. Bruno Gomes bruno.gomes@ifrn.edu.br www.profbrunogomes.com.br

Aula 01 Introdução à Informática. Prof. Bruno Gomes bruno.gomes@ifrn.edu.br www.profbrunogomes.com.br Aula 01 Introdução à Informática Prof. Bruno Gomes bruno.gomes@ifrn.edu.br www.profbrunogomes.com.br Agenda da Aula Introdução à Informática; Dados x Informação; O Computador (Hardware); Unidades de medida.

Leia mais

INTRODUÇÃO À PROGRAMAÇÃO BCC 201 TURMAS 31, 32 E 33 2015-2 AULA TEÓRICA 2 PROF. MARCELO LUIZ SILVA (R E D)

INTRODUÇÃO À PROGRAMAÇÃO BCC 201 TURMAS 31, 32 E 33 2015-2 AULA TEÓRICA 2 PROF. MARCELO LUIZ SILVA (R E D) Universidade Federal de Ouro Preto - UFOP Instituto de Ciências Exatas e Biológicas - ICEB Departamento de Computação - DECOM INTRODUÇÃO À PROGRAMAÇÃO BCC 201 TURMAS 31, 32 E 33 2015-2 1 AULA TEÓRICA 2

Leia mais

COMPILADORES E INTERPRETADORES

COMPILADORES E INTERPRETADORES Aula 16 Arquitetura de Computadores 12/11/2007 Universidade do Contestado UnC/Mafra Curso Sistemas de Informação Prof. Carlos Guerber COMPILADORES E INTERPRETADORES Um compilador transforma o código fonte

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Organização de Computadores Hardware

Organização de Computadores Hardware Organização de Computadores Hardware Professor Marcus Vinícius Midena Ramos Colegiado de Engenharia de Computação (74)3614.1936 marcus.ramos@univasf.edu.br www.univasf.edu.br/~marcus.ramos Computador Ferramenta

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

A lógica de programação ajuda a facilitar o desenvolvimento dos futuros programas que você desenvolverá.

A lógica de programação ajuda a facilitar o desenvolvimento dos futuros programas que você desenvolverá. INTRODUÇÃO A lógica de programação é extremamente necessária para as pessoas que queiram trabalhar na área de programação, seja em qualquer linguagem de programação, como por exemplo: Pascal, Visual Basic,

Leia mais

ALP Algoritmos e Programação. . Linguagens para Computadores

ALP Algoritmos e Programação. . Linguagens para Computadores ALP Algoritmos e Programação Iniciação aos computadores. Linguagens para Computadores. Compiladores, Interpretadores. Ambientes de Programação 1 Linguagens para Computadores. Linguagem binária: Dispositivos

Leia mais

Sistema de Numeração e Conversão entre Sistemas. Prof. Rômulo Calado Pantaleão Camara. Carga Horária: 60h

Sistema de Numeração e Conversão entre Sistemas. Prof. Rômulo Calado Pantaleão Camara. Carga Horária: 60h Sistema de Numeração e Conversão entre Sistemas. Prof. Rômulo Calado Pantaleão Camara Carga Horária: 60h Representação da Informação Um dispositivo eletrônico, armazena e movimenta as informações internamente

Leia mais

INFORMÁTICA BÁSICA. Prof. Rafael Zimmermann

INFORMÁTICA BÁSICA. Prof. Rafael Zimmermann INFORMÁTICA BÁSICA Prof. Rafael Zimmermann 1. INFORMÁTICA É a ciência que estuda o processamento de informações. Nasceu da necessidade do homem processar informações cada vez mais complexas e com maior

Leia mais

Tecnologia da Informação. Prof Odilon Zappe Jr

Tecnologia da Informação. Prof Odilon Zappe Jr Tecnologia da Informação Prof Odilon Zappe Jr Antivírus Os antivírus são programas de computador concebidos para prevenir, detectar e eliminar pragas digitais. Existe uma grande variedade de produtos com

Leia mais

centena dezena unidade 10 2 10 1 10 0 275 2 7 5 200 + 70 + 5 275

centena dezena unidade 10 2 10 1 10 0 275 2 7 5 200 + 70 + 5 275 A. Sistemas de Numeração. Para se entender a linguagem do computador (o Código de Máquina), é necessário conhecer um pouco da teoria dos números. Não é uma tarefa tão difícil quanto pode parecer. Sabendo-se

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Montagem e Manutenção. Luís Guilherme A. Pontes

Montagem e Manutenção. Luís Guilherme A. Pontes Montagem e Manutenção Luís Guilherme A. Pontes Introdução Qual é a importância da Montagem e Manutenção de Computadores? Sistema Binário Sistema Binário Existem duas maneiras de se trabalhar e armazenar

Leia mais

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal Fepagro em foco Samuel Mazzinghy Alvarenga Histórico recente da Agropecuária Era científica: a partir de ~ 1.700 Rotação de culturas e métodos de cultivo intensivo Drenagem Utilização de arado, máquinas

Leia mais

Programação de Computadores

Programação de Computadores Aula 01 Introdução Departamento de Computação Universidade Federal de Ouro Preto 2011.1 1 Processamento de dados 2 Organização de Computadores 3 Sistemas de Numeração Processamento de dados Processamento

Leia mais

Algoritmos e Programação _ Departamento de Informática

Algoritmos e Programação _ Departamento de Informática 5 TIPOS DE DADOS Todo o trabalho realizado por um computador é baseado na manipulação das informações contidas em sua memória. De um modo geral estas informações podem ser classificadas em dois tipos:

Leia mais

Aula 3 - Sistemas de Numeração

Aula 3 - Sistemas de Numeração UEM Universidade Estadual de Maringá DIN - Departamento de Informática Disciplina: Fundamentos da Computação Profª Thelma Elita Colanzi Lopes thelma@din.uem.br Aula 3 - Sistemas de Numeração O ser humano,

Leia mais

Tecnologia - Conjunto de instrumentos, métodos e processos específicos de qualquer arte, ofício ou técnica.

Tecnologia - Conjunto de instrumentos, métodos e processos específicos de qualquer arte, ofício ou técnica. Técnica - Conjunto de processos que constituem uma arte ou um ofício. Aplicação prática do conhecimento científico. Tecnologia - Conjunto de instrumentos, métodos e processos específicos de qualquer arte,

Leia mais

Prof. Dr. Charlie Antoni Miquelin BÁSICO DE COMPUTAÇÃO EM TC

Prof. Dr. Charlie Antoni Miquelin BÁSICO DE COMPUTAÇÃO EM TC BÁSICO DE COMPUTAÇÃO EM TC Definições O computador digital é uma máquina capaz de receber informações, processá-las e devolver resultados. Estes resultados podem ser mostrados em um monitor, armazenados,

Leia mais

ARQUITETURA DE COMPUTADORES - 1866

ARQUITETURA DE COMPUTADORES - 1866 1 Introdução: Um computador é uma máquina (conjunto de partes eletrônicas e eletromecânicas) capaz de sistematicamente coletar, manipular e fornecer resultados da manipulação de dados para um ou mais objetivos.

Leia mais

FUNDAMENTOS DE HARDWARE COMO FUNCIONA UM PC? Professor Carlos Muniz

FUNDAMENTOS DE HARDWARE COMO FUNCIONA UM PC? Professor Carlos Muniz FUNDAMENTOS DE HARDWARE COMO FUNCIONA UM PC? A arquitetura básica de qualquer computador completo, seja um PC, um Machintosh ou um computador de grande porte, é formada por apenas 5 componentes básicos:

Leia mais

Limitações dos Computadores

Limitações dos Computadores Limitações dos Computadores Baseado em Computers Ltd. What they really can t do, David Harel. Oxford University Press, 2000. Computadores e Redes de Comunicação Mestrado em Gestão de Informação, FEUP 2004/07

Leia mais

2 Editoração Eletrônica

2 Editoração Eletrônica 8 2 Editoração Eletrônica A década de 80 foi um marco na história da computação. Foi quando a maioria dos esforços dos desenvolvedores, tanto de equipamentos, quanto de programas, foram direcionados para

Leia mais

Conexões entre matemática e biologia

Conexões entre matemática e biologia EB-207 Matemática Biológica 1 Conexões entre matemática e biologia Prof. Rodrigo Sávio Pessoa Sumário 2 1. Introdução 2. A nanotecnologia aplicada as ciências biológicas 3. Algumas questões biológicas

Leia mais

Cálculo Numérico Aula 1: Computação numérica. Tipos de Erros. Aritmética de ponto flutuante

Cálculo Numérico Aula 1: Computação numérica. Tipos de Erros. Aritmética de ponto flutuante Cálculo Numérico Aula : Computação numérica. Tipos de Erros. Aritmética de ponto flutuante Computação Numérica - O que é Cálculo Numérico? Cálculo numérico é uma metodologia para resolver problemas matemáticos

Leia mais

Introdução à Programação de Computadores

Introdução à Programação de Computadores 1. Objetivos Introdução à Programação de Computadores Nesta seção, vamos discutir os componentes básicos de um computador, tanto em relação a hardware como a software. Também veremos uma pequena introdução

Leia mais

3 Revisão de Software

3 Revisão de Software 1 3 Revisão de Software O software é indispensável para a utilização do hardware. Sem o software para utilizar o computador precisaríamos ter um profundo conhecimento do hardware. Alguns softwares são

Leia mais

Introdução às Linguagens de Programação

Introdução às Linguagens de Programação Introdução às Linguagens de Programação Histórico de Linguagens de Programação O computador não faz nada sozinho Precisamos informar, de forma clara, como ele deve executar as tarefas Ou seja, o computador

Leia mais

Computador Máquina que processa uma grande quantidade de dados com rapidez e precisão.

Computador Máquina que processa uma grande quantidade de dados com rapidez e precisão. Introdução à informática - Noções Básicas de Informática; - O que é software / hardware; - Como funciona um computador; - Componentes de um computador; - Tipos de computador; - Periféricos; - Ligar e desligar

Leia mais

Simulação Computacional de Sistemas, ou simplesmente Simulação

Simulação Computacional de Sistemas, ou simplesmente Simulação Simulação Computacional de Sistemas, ou simplesmente Simulação Utilização de métodos matemáticos & estatísticos em programas computacionais visando imitar o comportamento de algum processo do mundo real.

Leia mais

Sistemas de Numeração

Sistemas de Numeração Sistemas de Numeração Um numeral é um símbolo ou grupo de símbolos que representa um número em um determinado instante da evolução do homem. Tem-se que, numa determinada escrita ou época, os numerais diferenciaram-se

Leia mais

Introdução à Informática

Introdução à Informática Introdução à Informática Aula 1 http://www.ic.uff.br/~bianca/introinfo/ Aula 1-31/08/2007 1 Objetivo da disciplina O objetivo dessa disciplina é dar ao aluno noções básicas de computação. Serão apresentados

Leia mais

O protocolo MODBUS define também o tipo diálogo entre os equipamentos, define por exemplo quem pode enviar dados e em que altura.

O protocolo MODBUS define também o tipo diálogo entre os equipamentos, define por exemplo quem pode enviar dados e em que altura. Universidade de Aveiro Departamento de Engenharia Mecânica Informática Industrial 2010/2011 5 PROTOCOLO DE COMUNICAÇÃO MODBUS 5.1 Protocolo de comunicação MODBUS Este protocolo foi proposto em 1979 pela

Leia mais

Introdução. INF1005 Programação I 33K Prof. Gustavo Moreira gmoreira@inf.puc-rio.br

Introdução. INF1005 Programação I 33K Prof. Gustavo Moreira gmoreira@inf.puc-rio.br Introdução INF1005 Programação I 33K Prof. Gustavo Moreira gmoreira@inf.puc-rio.br introdução Tópicos conceitos básicos o que é um programa um programa na memória decifrando um código referência Capítulo

Leia mais

ADMINISTRAÇÃO DOS RECURSOS DE HARDWARE E SOFTWARE

ADMINISTRAÇÃO DOS RECURSOS DE HARDWARE E SOFTWARE ADMINISTRAÇÃO DOS RECURSOS DE HARDWARE E SOFTWARE 1 OBJETIVOS 1. Qual é a capacidade de processamento e armazenagem que sua organização precisa para administrar suas informações e transações empresariais?

Leia mais

PARANÁ GOVERNO DO ESTADO

PARANÁ GOVERNO DO ESTADO PARANÁ GOVERNO DO ESTADO COLÉGIO ESTADUAL DE PARANAVAÍ ENSINO FUNDAMENTAL, MÉDIO, NORMAL E PROFISSIONAL CURSO TÉCNICO EM INFORMÁTICA DISCIPLINA: INTERNET E PROGRAMAÇÃO WEB 1º MÓDULO SUBSEQUENTE MECANISMOS

Leia mais

Hit dos Bits. Série Matemática na Escola

Hit dos Bits. Série Matemática na Escola Hit dos Bits Série Matemática na Escola Objetivos 1. Apresentar o sistema de numeração binário; 2. Mostrar aplicações de sistemas de numeração diferentes do decimal; Hit dos Bits Série Matemática na Escola

Leia mais

Fundamentos em Informática (Sistemas de Numeração e Representação de Dados)

Fundamentos em Informática (Sistemas de Numeração e Representação de Dados) 1 UNIVERSIDADE DO CONTESTADO / UnC CAMPUS CONCÓRDIA/SC CURSO DE SISTEMAS DE INFORMAÇÃO Fundamentos em Informática (Sistemas de Numeração e Representação de Dados) (Apostila da disciplina elaborada pelo

Leia mais

Tecnologia da Informação. Prof Odilon Zappe Jr

Tecnologia da Informação. Prof Odilon Zappe Jr Tecnologia da Informação Prof Odilon Zappe Jr Antivírus Os antivírus são programas de computador concebidos para prevenir, detectar e eliminar pragas digitais. Existe uma grande variedade de produtos com

Leia mais

Memórias Prof. Galvez Gonçalves

Memórias Prof. Galvez Gonçalves Arquitetura e Organização de Computadores 1 s Prof. Galvez Gonçalves Objetivo: Compreender os tipos de memória e como elas são acionadas nos sistemas computacionais modernos. INTRODUÇÃO Nas aulas anteriores

Leia mais

2. Representação Numérica

2. Representação Numérica 2. Representação Numérica 2.1 Introdução A fim se realizarmos de maneira prática qualquer operação com números, nós precisamos representa-los em uma determinada base numérica. O que isso significa? Vamos

Leia mais

UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA

UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA Projeto Gene: Ambiente de Apoio à Aprendizagem de Genética Baseado em Tamagotchi

Leia mais

1 - Processamento de dados

1 - Processamento de dados Conceitos básicos sobre organização de computadores 2 1 - Processamento de dados O que é processamento? O que é dado? Dado é informação? Processamento é a manipulação das informações coletadas (dados).

Leia mais

Figura 1 - O computador

Figura 1 - O computador Organização e arquitectura dum computador Índice Índice... 2 1. Introdução... 3 2. Representação da informação no computador... 4 3. Funcionamento básico dum computador... 5 4. Estrutura do processador...

Leia mais

Dia da Propriedade Industrial. Patentes de Genes. Vanessa Fatal Examinadora de Patentes. Universidade de Évora 21.09.2010

Dia da Propriedade Industrial. Patentes de Genes. Vanessa Fatal Examinadora de Patentes. Universidade de Évora 21.09.2010 Dia da Propriedade Industrial Patentes de Genes Vanessa Fatal Examinadora de Patentes Universidade de Évora 21.09.2010 Europa 1973 EPC define que processos essencialmente biológicos não são patenteáveis

Leia mais

Visão geral do sistema de armazenamento e hierarquia de memória

Visão geral do sistema de armazenamento e hierarquia de memória Visão geral do sistema de armazenamento e hierarquia de memória Conhecer os dispositivos de armazenamento por meio do conceito e dos tipos de memórias utilizadas no computador. Subsistemas de memória Memória

Leia mais

O que é a ciência de dados (data science). Discussão do conceito. Luís Borges Gouveia Universidade Fernando Pessoa Versão 1.

O que é a ciência de dados (data science). Discussão do conceito. Luís Borges Gouveia Universidade Fernando Pessoa Versão 1. O que é a ciência de dados (data science). Discussão do conceito Luís Borges Gouveia Universidade Fernando Pessoa Versão 1.3, Outubro, 2015 Nota prévia Esta apresentação tem por objetivo, proporcionar

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

ARQUITETURA DE COMPUTADORES. Rogério Spindula Rosa

ARQUITETURA DE COMPUTADORES. Rogério Spindula Rosa ARQUITETURA DE COMPUTADORES 1 Rogério Spindula Rosa 2 EXECUÇÃO DE PROGRAMAS PROGRAMA 3 4 INTRODUÇÃO Hoje é raro escrever um programa diretamente em linguagem de computador em virtude da enorme dificuldade

Leia mais

FACULDADE PITÁGORAS DISCIPLINA: ARQUITETURA DE COMPUTADORES

FACULDADE PITÁGORAS DISCIPLINA: ARQUITETURA DE COMPUTADORES FACULDADE PITÁGORAS DISCIPLINA: ARQUITETURA DE COMPUTADORES Prof. Ms. Carlos José Giudice dos Santos cpgcarlos@yahoo.com.br www.oficinadapesquisa.com.br Conceito de Computador Um computador digital é

Leia mais

LISTA DE EXERCÍCIOS. 1. Binário: Bit: Menor unidade de dados; dígito binário (0,1) Byte: Grupo de bits que representa um único caractere

LISTA DE EXERCÍCIOS. 1. Binário: Bit: Menor unidade de dados; dígito binário (0,1) Byte: Grupo de bits que representa um único caractere 1. Binário: LISTA DE EXERCÍCIOS Bit: Menor unidade de dados; dígito binário (0,1) Byte: Grupo de bits que representa um único caractere Campo: Grupo de palavras ou um número completo Registro: Grupo de

Leia mais

Informática. Prof. Macêdo Firmino. Macêdo Firmino (IFRN) Informática Setembro de 2011 1 / 16

Informática. Prof. Macêdo Firmino. Macêdo Firmino (IFRN) Informática Setembro de 2011 1 / 16 Informática Prof. Macêdo Firmino Representação da Informação Macêdo Firmino (IFRN) Informática Setembro de 2011 1 / 16 Introdução Estamos acostumados a pensar nos computadores como mecanismos complexos,

Leia mais

Computação L2. Arquivos. Observação: Material da Disciplina Computação Eletrônica CIN/UFPE.

Computação L2. Arquivos. Observação: Material da Disciplina Computação Eletrônica CIN/UFPE. Computação L2 Arquivos Observação: Material da Disciplina Computação Eletrônica CIN/UFPE. Memórias do Computador HD: permanente (pode desligar o computador), barato e lento; O HD é representado por um

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

Segue-se o estudo da forma como os computadores armazenam e acedem às informações contidas na sua memória.

Segue-se o estudo da forma como os computadores armazenam e acedem às informações contidas na sua memória. 4. Variáveis Para a execução de qualquer tipo de programa o computador necessita de ter guardados os diferentes tipos de dados, já estudados. Esses dados estão guardados na sua memória. Segue-se o estudo

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

PRINCÍPIOS DA INSTRUÇÃO PROGRAMADA 1. Se você ler cada um dos quadros cuidadosamente, provavelmente cometerá muito poucos erros.

PRINCÍPIOS DA INSTRUÇÃO PROGRAMADA 1. Se você ler cada um dos quadros cuidadosamente, provavelmente cometerá muito poucos erros. PRINCÍPIOS DA INSTRUÇÃO PROGRAMADA 1 INSTRUÇÕES Existem diferenças entre um Curso Programado ou Programa em Instrução Programada e um livro - texto comum. A primeira diferença é que o material se apresenta

Leia mais

SHELL SCRIPT P R O F I S S I O N A L

SHELL SCRIPT P R O F I S S I O N A L SHELL SCRIPT P R O F I S S I O N A L Aurélio Marinho Jargas Novatec Capítulo 1 Programas sim, scripts não Este livro ensina a fazer programas e não scripts. Seu objetivo é transformar scripteiros em programadores,

Leia mais

Linguagens Formais e Autômatos

Linguagens Formais e Autômatos Linguagens Formais e Autômatos SLIDE 1 Professor Júlio Cesar da Silva juliocesar@eloquium.com.br site: http://eloquium.com.br/ twitter: @profjuliocsilva facebook: https://www.facebook.com/paginaeloquium

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Unidade 10: A Unidade Lógica Aritmética e as Instruções em Linguagem de Máquina Prof. Daniel Caetano

Unidade 10: A Unidade Lógica Aritmética e as Instruções em Linguagem de Máquina Prof. Daniel Caetano Arquitetura e Organização de Computadores 1 Unidade 10: A Unidade Lógica Aritmética e as Instruções em Linguagem de Máquina Prof. Daniel Caetano Objetivo: Apresentar as funções o mecanismo de atuação da

Leia mais

Fundamentos de Microinformática. Ricardo José Cabeça de Souza 2010 Fundamentos 3

Fundamentos de Microinformática. Ricardo José Cabeça de Souza 2010 Fundamentos 3 Fundamentos de Microinformática Ricardo José Cabeça de Souza 2010 Fundamentos 3 Outros Componentes Porta Paralela Porta Serial Porta PS/2 (Personal System 2) Porta USB (Universal Serial Bus) Porta S-Vídeo

Leia mais

Informática Sistemas de Numeração. Profª. Me. Valéria Espíndola Lessa lessavaleria@gmail.com Valeria-lessa@uergs.edu.br

Informática Sistemas de Numeração. Profª. Me. Valéria Espíndola Lessa lessavaleria@gmail.com Valeria-lessa@uergs.edu.br Sistemas de Numeração Profª. Me. Valéria Espíndola Lessa lessavaleria@gmail.com Valeria-lessa@uergs.edu.br Outros Sistemas de Numeração Já sabemos que existem outros tipos de sistemas de numeração, além

Leia mais

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg.

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg. Bioinformática Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica João Varela jvarela@ualg.pt Docentes Paulo Martel (alinhamentos, pesquisas de sequências em

Leia mais

SISTEMAS DIGITAIS Prof. Ricardo Rodrigues Barcelar http://www.ricardobarcelar.com

SISTEMAS DIGITAIS Prof. Ricardo Rodrigues Barcelar http://www.ricardobarcelar.com - Aula 1 - SISTEMA DE NUMERAÇÃO BINÁRIA E DECIMAL Todos os computadores são formados por circuitos digitais, onde as informações e os dados são codificados com dois níveis de tensão, pelo que o seu sistema

Leia mais

2. NÍVEL DE SISTEMA OPERACIONAL

2. NÍVEL DE SISTEMA OPERACIONAL 2. NÍVEL DE SISTEMA OPERACIONAL Nos períodos anteriores foram mostrados os níveis iniciais da organização de um computador, quando vimos em Circuitos Digitais os detalhes do Nível 0 (zero) de Lógica Digital.

Leia mais

Introdução. Software (Parte III)

Introdução. Software (Parte III) Universidade Federal de Campina Grande Centro de Engenharia Elétrica e Informática Unidade Acadêmica de Sistemas e Computação Introdução à Computação Software (Parte III) Prof. a Joseana Macêdo Fechine

Leia mais

Armazenamento Secundário. SCE-183 Algoritmos e Estruturas de Dados II

Armazenamento Secundário. SCE-183 Algoritmos e Estruturas de Dados II Armazenamento Secundário SCE-183 Algoritmos e Estruturas de Dados II 1 Armazenamento secundário Primeiro tipo de armazenamento secundário: papel! Cartões perfurados HDs, CD-ROM, floppy disks, memórias

Leia mais

1 O que é um computador? Definição uma máquina que lê dados, efectua cálculos e fornece resultados.

1 O que é um computador? Definição uma máquina que lê dados, efectua cálculos e fornece resultados. 1 O que é um computador? Definição uma máquina que lê dados, efectua cálculos e fornece resultados. 1.1 - Processos básicos do computador Entrada de dados ler ou receber os valores iniciais ou constantes

Leia mais

Campus Capivari Análise e Desenvolvimento de Sistemas (ADS) Prof. André Luís Belini E-mail: prof.andre.luis.belini@gmail.com /

Campus Capivari Análise e Desenvolvimento de Sistemas (ADS) Prof. André Luís Belini E-mail: prof.andre.luis.belini@gmail.com / Campus Capivari Análise e Desenvolvimento de Sistemas (ADS) Prof. André Luís Belini E-mail: prof.andre.luis.belini@gmail.com / andre.belini@ifsp.edu.br MATÉRIA: ICO Aula N : 09 Tema: Unidade Central de

Leia mais

Introdução à Lógica de Programação

Introdução à Lógica de Programação Introdução à Lógica de Programação Sistemas Numéricos As informações inseridas em um computador são traduzidos em dados, ou seja, em sinais que podem ser manipulados pelo computador. O computador trabalha

Leia mais

HABILITAÇÃO COMPONENTE TITULAÇÃO

HABILITAÇÃO COMPONENTE TITULAÇÃO Operação de Software Aplicativo Científica Engenharia da Produção Engenharia de Engenharia de Produção Matemática Aplicada às Matemática Aplicada e Científica Matemática com Tecnologia em - Ênfase em Gestão

Leia mais

Introdução à Computação: Sistemas de Computação

Introdução à Computação: Sistemas de Computação Introdução à Computação: Sistemas de Computação Beatriz F. M. Souza (bfmartins@inf.ufes.br) http://inf.ufes.br/~bfmartins/ Computer Science Department Federal University of Espírito Santo (Ufes), Vitória,

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Unidade 1 - Objectivos das Tecnologias Informáticas

Unidade 1 - Objectivos das Tecnologias Informáticas Unidade 1 - Objectivos das Tecnologias Informáticas Reconhecer conceitos básicosb Utilizar os conceitos básicos, b aplicando-os os a problemas concretos Compreender a evolução desses conceitos Conhecer

Leia mais

PROGRAMADOR JAVA. Aula 0 20 semanas. Instrutor : Léo Billi Email : leo.billi@gmail.com

PROGRAMADOR JAVA. Aula 0 20 semanas. Instrutor : Léo Billi Email : leo.billi@gmail.com Aula 0 20 semanas Instrutor : Léo Billi Email : leo.billi@gmail.com Bem-vindos Para que não sabe, quer dizer iniciantes. Noobs Informática A arte de processar dados A História A História A arte de processar

Leia mais

Apostila de Fundamentos de Programação I. Prof.: André Luiz Montevecchi

Apostila de Fundamentos de Programação I. Prof.: André Luiz Montevecchi Apostila de Fundamentos de Programação I Prof: André Luiz Montevecchi Introdução O mundo atual é dependente da tecnologia O uso intenso de diversos aparatos tecnológicos é parte integrante do nosso dia-a-dia

Leia mais

Contando os Pontos Números Binários

Contando os Pontos Números Binários Atividade 1 Contando os Pontos Números Binários Sumário Os dados são armazenados em computadores e transmitidos como uma série de zeros e uns. Como podemos representar palavras e números usando apenas

Leia mais

ADMINISTRAÇÃO DOS RECURSOS DE HARDWARE E SOFTWARE

ADMINISTRAÇÃO DOS RECURSOS DE HARDWARE E SOFTWARE 6 ADMINISTRAÇÃO DOS RECURSOS DE HARDWARE E SOFTWARE OBJETIVOS Qual é a capacidade de processamento e armazenagem que sua organização precisa para administrar suas informações e transações empresariais?

Leia mais

RESUMO DO LIVRO. A linguagem de máquinas e o custo são analisados antes do computador ser projetado. LINGUAGEM, NÍVEIS E MÁQUINA REAIS

RESUMO DO LIVRO. A linguagem de máquinas e o custo são analisados antes do computador ser projetado. LINGUAGEM, NÍVEIS E MÁQUINA REAIS RESUMO DO LIVRO Um computador digital é uma máquina com programas que, convertidos em instruções, podem facilitar a vida das pessoas. As instruções são simples, como some dois números. As instruções são

Leia mais