UNIVERSIDADE ESTADUAL DO CEARÁ PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS VETERINÁRIAS

Transcrição

1 UNIVERSIDADE ESTADUAL DO CEARÁ PRÓ-REITORIA DE PÓS-GRADUAÇÃO E PESQUISA FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS VETERINÁRIAS JOHANNA LEIVA REVILLA Teste de toxicidade da fração da Auxemma oncocalyx e onconcalyxona A sobre o desenvolvimento folicular e embrionário in vitro FORTALEZA CEARÁ 2016

2 JOHANNA LEIVA REVILLA TESTE DE TOXICIDADE DA FRAÇÃO DA AUXEMMA ONCOCALYX E ONCONCALYXONA A SOBRE O DESENVOLVIMENTO FOLICULAR E EMBRIONÁRIO IN VITRO Tese apresentada ao Curso de Doutorado em Ciências Veterinárias do programa de Pósgraduação em Ciências Veterinárias da Faculdade de Veterinária da Universidade Estadual do Ceará, como requisito parcial à obtenção do título de doutor em Ciências Veterinárias. Área de Concentração: Reprodução e Sanidade Animal. Orientador: Prof. Dr. José Ricardo de Figueiredo FORTALEZA CEARÁ 2016

3

4

5 Dedico, A minha família, Jorge e Patricia, porque eles me deram o seu amor e apoio incondicional e constante durante toda a minha vida. Aos meus amigos, por seu inabalável apoio, amizade e amor.

6 AGRADECIMENTOS À Universidade Estadual do Ceará (UECE), ao Programa de Pós-Graduação em Ciências Veterinárias (PPGCV), aos professores e aos funcionários por esses anos colaborando com minha formação profissional. Ao Laboratório de Manipulação de Oócitos inclusos em Folículos Pré-Antrais (LAMOFOPA) da UECE, por dar-me todo o suporte para a realização dessa tese. À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) pelo incentivo financeiro, através da bolsa de doutorado concedida. Ao meu orientador, professor Dr. José Ricardo de Figueiredo, pela oportunidade de ingressar em sua equipe, pela confiança depositada, por todos os ensinamentos, por me orientar na execução desta tese e por me incentivar cada vez mais no exercício das minhas capacidades, e por acreditar no meu trabalho. À Profa. Dra. Ana Paula Ribeiro Rodrigues, pela confiança concedida e orientação durante meu doutorado, que através do seu exemplo profissional foi de grande importância no meu crescimento professional. Aos membros da banca, Profa. Dra. Juliana Jales de Hollanda Celestino, Prof. Dr. Dárcio Ítalo Alves Teixeira, Dr. Luis Alberto Vieira, Prof. Dr. José Roberto Viana da Silva e a Dra. Ticiana Franco Pereira da Silva pelas correções desta tese, contribuindo para tornala ainda melhor. À Carolina Maside Mielgo e Luis Alberto Vieira, por me co-orientar e pelo exemplo como profissionais e amigos, sempre com a maior e melhor vontade de me ajudar em tudo. Obrigada por ser parte da minha família, vocês são pessoas incríveis! À Profa. Dra. Juliana Jales de Hollanda Celestino, pela constante assessoria, ajuda e correções de todos meus artigos. À minhas bruxas queridas, Anna Clara Accioly Ferreira (Chats) e Denise Damasceno Guerreiro (Denaise), obrigada por tanta amizade, força, motivação e tantos momentos cheios de alegrias, eu vou levar vocês sempre no meu coração.

7 A Jesús de los Reyes Cadenas Moreno, por ter sido meu irmão e braço direito durante meus experimentos, por ter tido tanta paciência comigo, por todas as receitas de cozinha, muito obrigada. Você sempre vai ser uma parte da minha família. À Giovanna e à minha Família brasileira, os Quintino, Camila, Michelle, Lourdes e Antonio Airton. Obrigada por ter me recebido de braços abertos e como se fosse uma filha. Serei eternamente grata por ter ganho uma família cheia de tanto amor. À Laritza Ferreira Lima e Simone Vieira Castro, pela ajuda e orientação durante meu início no LAMOFOPA. A Renato Felix da Silva, pelos milhões de capilares e pela amizade. Obrigada filho. À Francisco Leo Nascimento de Aguiar (Pequeño Leo), pelas palavras de motivação, incentivo, ajuda, amizade e pela grata companhia durante as viagens a Mossoró. A Victor Macêdo Paes (Estrela) e Hudson Henrique Vieira Correia (Huds), pelos debates no horário de almoço, o companheirismo, a ajuda e amizade. Prof. Claudio Cabral e Benner Geraldo Alves, pelas mil e uma análises de estatística. Obrigada pela paciência. A toda equipe do LAMOFOPA que me auxiliou de alguma forma e as pessoas que fizeram meus dias mais felizes: Rita Kelly, Lidiane Sales, Seu João, César Camelo, Gildas Mbemya Tetaping, Juliana Zani, Naiza Arcângela Ribeiro de Sá, Nathalie Jiatsa, Yago Pinto, Andreza de Sá Nunes, Gerlane Modesto, Gabriel da Silva, Leticia Ferreira, Deysi Dipaz Berrocal, Diego Montano, Kayse Najara, Luana Gaudencio, Luciana Mascena Silva, Marcela Pinheiro Paz, Geovania Canafístula, Rebeca Rocha, Kele Amaral Alves, Jamily Bruno, Valdevane Araujo e Carlos Lobo. E, por fim um agradecimento especial à minha família, Jorge e Patricia, vocês são minha razão de viver, sem vocês eu não teria conseguido. Muito obrigada por todo o amor e apoio que sempre me deram. Amo muito vocês!

8 RESUMO O objetivo foi avaliar o efeito da Auxemma oncocalyx (A. oncocalyx) e seu composto ativo oncocalyxona A (onco A) sobre os folículos pré-antrais, a maturação oocitária e a qualidade embrionária in vitro. Para a Fase I, fragmentos ovarianos caprinos foram cultivados por 1-7 dias nos tratamentos: controle cultivado sozinho ou suplementado com DMSO, BMP-15, doxorubicina (DXR), A. oncocalyx (1.2, 12 ou 34 µg/ml) ou onco A (1, 10 ou 30 µg/ml). Foram avaliados: sobrevivência, crescimento, apoptose e proliferação. Na fase II, folículos secundários isolados caprinos foram cultivados nos grupos; controle não-cultivado, controle cultivado, DMSO, DXR, A. oncocalyx ou onco A. Além disso, complexo culmulus oócito (CCOs) caprinos foram maturados in vitro (MIV) nos grupos: controle-cultivados sozinho; ou suplementado com DMSO; DXR; A. oncocalyx ou onco A, e foram avaliados a morfologia, sobrevivência, apoptose e configuração da cromatina. Finalmente, para a fase III, CCOs porcinos foram MIV na presença de DXR; A. oncocalyx ou onco A e a competência oocitária foi avaliada (experimento 1). Também, embriões porcinos foram cultivados in vitro nos mesmos tratamentos e o desenvolvimento embrionário foi avaliado (experimento 2). Na fase I, a DXR reduziu o percentual de viabilidade folicular sendo que para a A. oncocalyx e onco A esta redução ocorreu de forma concentração-dependente (P <0,05). DXR, A. oncocalyx 1.2 e onco A 1 aumentaram (P <0,05) a apoptose. A DXR diminuiu (P<0,05) a proliferação celular. Porém, na fase II, houve uma redução no percentual de folículos intactos, formação antro, taxa de crescimento e proliferação celular (P <0,05) comparado ao controle. A DXR apresentou indicadores de apoptose maiores (P <0,05). Após a MIV de CCOs caprinos, DXR, A. oncocalyx e onco A aumentaram (P <0,05) os oócitos anormais e diminuíram a viabilidade em comparação com o controle (P <0,05). Finalmente, na fase III, no experimento 1, a DXR, A. oncocalyx e onco A reduziram (P <0,05) a viabilidade oocitária e a eficiência da MIV (P <0,05). Após a FIV, todas as drogas reduziram (P <0,05) a eficiência da FIV e o percentual de embriões clivados, no entanto, apenas a DXR diminuiu o percentual de blastocistos. No experimento 2, a DXR e A. oncocalyx diminuíram (P <0,05) o percentual de embriões clivados, mas não teve nenhum efeito sobre a formação de blastocisto. Em conclusão, A. oncocalyx e onco A afetam a foliculogênese in vitro em caprinos de forma concentração-dependente. A Onco A tem um efeito menos prejudicial do que a DXR na sobrevivência de folículos pré-

9 antrais. Também, A. oncocalyx e onco A não apresentam um efeito tóxico sobre folículos secundários isolados caprinos nas taxas de maturação de CCOs. Porém, estas substâncias afetam negativamente a viabilidade oocitária. Além disso, em suínos, a adição de DXR durante MIV ou cultivo embrionário in vitro afeta negativamente a eficiência da FIV e a taxa de clivagem. Além disso, a exposição de CCOs suínos à DXR, apenas durante a MIV, foi mais prejudicial à manutenção da viabilidade oocitária e à formação de blastocistos, quando comparado à A. oncocalyx e onco A. Palavras-chave: Auxemma oncocalyx. Oncocalyxona A. Cultivo in vitro. Maturação in vitro. Embriões.

10 ABSTRACT The goal was to evaluate the effect of Auxemma oncocalyx (A. oncocalyx) and its active compound oncocalyxone A (onco A) on the in vitro culture of preantral follicles, oocyte maturation and embryo quality. For phase I, caprine ovarian fragments were cultured for 1 and 7 days in different conditions: cultured control alone or supplemented with DMSO, BMP-15, doxorubicin (DXR), A. oncocalyx (1.2, 12 or 34 µg/ml) or onco A (1, 10 or 30 µg/ml). The following endpoints were evaluated: survival, growth, apoptosis and proliferation. For phase II, isolated secondary caprine follicles were cultured in groups; non-cultured control, control group, DMSO, DXR, A. oncocalyx or onco A. Additionally, caprine cumulus-oocyte-complex (COCs) were in vitro maturated (IVM) in the groups: control alone or supplemented with DMSO; DXR; A. oncocalyx or onco A. Morphology, survival, apoptosis and chromatin configuration were assessed. Finally, for phase III, porcine COCs were IVM in the presence of DXR; A. oncocalyx or onco A and oocyte competence was analyzed (experiment 1). Also, porcine embryos were in vitro cultured in the same treatments and embryo development was evaluated (experiment 2). In phase I, A. oncocalyx and onco A, in a concentration-dependent manner, and DXR decreased (P<0.05) the percentage of morphologically normal follicles. DXR, A. oncocalyx 1.2 and onco A 1 increased (P<0.05) the percentage of apoptosis. DXR decreased (P<0.05) the cellular proliferation. On the other hand, in phase II, DXR showed a reduction in the percentage of intact follicles, antrum formation, growth rate and proliferation (P < 0.05) compared to control. DXR showed higher apoptosis indicators (P < 0.05). After IVM of caprine COCs, DXR, A. oncocalyx and onco A treatments had a greater percentage (P < 0.05) of abnormal oocytes and a lower percentage of viable oocytes as compared with the control (P < 0.05). Finally, in the phase III, in experiment 1; DXR, A. oncocalyx and onco A reduced (P<0.05) oocyte viability and IVM efficiency. After IVF, all the drugs reduced (P<0.05) the IVF efficiency and percentage of cleaved embryos, nevertheless, only DXR decreased the percentage of blastocyst. In experiment 2; DXR and A. oncocalyx decreased (P<0.05) the percentage of cleaved embryo, but had no effect on blastocyst formation. In conclusion, A. oncocalyx and onco A affected in vitro caprine folliculogenesis in a concentration-dependent manner. Onco A has a less harmful effect than DXR on goat preantral follicle survival. Furthermore, A. oncocalyx and onco A do not exhibit a toxic effect on caprine isolated secondary follicles and on maturation rates of COCs recovered

11 from caprine antral follicles. However, these substances negatively affected the oocyte viability. Moreover, in the porcine model, the addition of DXR during IVM or IVC negatively affected the IVF efficiency and cleavage rate. Additionally, the exposure of porcine COCs to DXR only during IVM was more detrimental to oocyte viability and blastocyst formation than A. oncocalyx and onco A. Keywords: Auxemma oncocalyx. Oncocalyxone A. In vitro culture. In vitro maturation. Embryos.

12 LISTA DE FIGURAS FRAÇÃO DE AUXEMMA ONCOCALYX E ONCOCALYXONA A AFETAM A SOBREVIVÊNCIA IN VITRO E O DESENVOLVIMENTO DE FOLÍCULOS PRÉ-ANTRAIS CAPRINOS INCLUSOS EM TECIDO CORTICAL OVARIANO Figure 1 - TUNEL assay of caprine preantral follicles before (non-cultured control) and after in vitro culture for 7 days in α-mem + alone or α- MEM + supplemented with DMSO, BMP-15, DXR, A. oncocalyx (1.2 µg/ml) or onco A (1 µg/ml). 77 Figure 2 - AgNOR silver staining of caprine preantral follicles before (noncultured control) and after in vitro culture for 7 days in α-mem + alone or α-mem + supplemented with DMSO, BMP-15, DXR, A. oncocalyx (1.2 µg/ml) or onco A (1 µg/ml) 77 Figure 3 - PCNA test of caprine preantral follicles before (non-cultured control) and after in vitro culture for 7 days in α-mem + alone or α- MEM + supplemented with DMSO, BMP-15, DXR, A. oncocalyx (1.2 µg/ml) or onco A (1 µg/ml) 78 EFEITO DA TOXICIDADE DA FRAÇÃO DA AUXEMMA ONCOCALYX E DO PRINCÍPIO ATIVO ONCOCALYXONA A NO CULTIVO IN VITRO DE FOLÍCULOS SECUNDÁRIOS E NA MATURAÇÃO IN VITRO DE OÓCITOS CAPRINOS Figure 1 - Isolated secondary follicles before (a) and after 7 days of culture in α-mem + alone (cultured-control) (b) or supplemented with DMSO (c), DXR (d), A. oncocalyx (e) and onco A (f). Oocytes after in vitro maturation in TCM199 + (control) (g) or supplemented with DMSO (h), DXR (i), A. oncocalyx (j) or onco A (k). 104 Figure 2 - Relative mean (± SEM) of BAX:BCL2 mrna ratio in cultured isolated secondary follicles for 7 days in α-mem + alone (culturedcontrol) or supplemented with DMSO, DXR, A. oncocalyx and onco A. Different letters denote significant differences (P < 0.05).. 104

13 AUXEMMA ONCOCALYX E SEU COMPOSTO ATIVO ONCOCALYXONA A PREJUDICAM A COMPETÊNCIA DE DESENVOLVIMENTO OOCITÁRIO IN VITRO EM SUÍNOS, MAS SÃO MENOS PREJUDICIAIS DO QUE A DOXORRUBICINA Figure 1 - Experimental design and endpoints of experiment 1 and 2. In vitro maturation (IVM), in vitro fertilization (IVF), in vitro embryo culture (IVC), hours post insemination (hpi) 123 Figure 2 - Percentage of cleaved (A) and blastocyst/cleaved (B) after previous exposure (only during in vitro maturation) to DXR, A. oncocalyx or onco A, only. a,b,c Distinct letters represent significant differences among treatments (P < 0.05) (experiment 1) 126 Figure 3 - Percentage of cleaved (A) and blastocyst / cleaved (B) after exposure (only during in vitro embryo culture) to DXR, A. oncocalyx or onco A. a,b Distinct letters represent significant differences among treatments (P < 0.05) (experiment 2).. 128

14 LISTA DE TABELAS PROPRIEDADES DA PLANTA AUXEMMA ONCOCALYX E SEU PRINCÍPIO ATIVO ONCOCALYXONA A Table 1 - Main results of the use of A. oncocalyx and Onco A in several species and cell types 57 FRAÇÃO DE AUXEMMA ONCOCALYX E ONCOCALYXONA A AFETAM A SOBREVIVÊNCIA IN VITRO E O DESENVOLVIMENTO DE FOLÍCULOS PRÉ-ANTRAIS CAPRINOS INCLUSOS EM TECIDO CORTICAL OVARIANO Table 1 - Percentage (mean ± SEM) of morphologically normal caprine preantral follicles before (non-cultured control) and after in vitro culture for 1 or 7 days in α-mem+ alone or α-mem+ supplemented with DMSO, BMP15, DXR, A. oncocalyx (1.2; 12 and 34 µg/ml) or onco A (1, 10 and 30 µg/ml). 79 Table 2 - Percentage (mean ± SEM) of primordial and growing caprine preantral follicles before (non-cultured control) and after in vitro culture for 1 or 7 days in α-mem+ alone or α-mem+ supplemented with DMSO, BMP15, DXR, A. oncocalyx (1.2; 12 and 34 µg/ml) or onco A (1, 10 and 30 µg/ml). 80 EFEITO DA TOXICIDADE DA FRAÇÃO DA AUXEMMA ONCOCALYX E DO PRINCÍPIO ATIVO ONCOCALYXONA A NO CULTIVO IN VITRO DE FOLÍCULOS SECUNDÁRIOS E NA MATURAÇÃO IN VITRO DE OÓCITOS CAPRINOS Table 1 - Oligonucleotide primers used for PCR analysis of goat secondary follicles. 103 Table 2 - Percentage of morphologically intact secondary follicles, and antrum formation after in vitro culture for 7 days in α-mem + (control) or supplemented with DMSO, DXR, A. oncocalyx or onco A.. 105

15 Table 3 - Table 4 - Table 5 - Follicular diameter (on day 0 and 7) and growth rate (mean ± SEM) of isolated secondary follicles after in vitro culture in α-mem + (control) or supplemented with DMSO, DXR, A. oncocalyx or onco A PCNA test and TUNEL assay of non-cultured or in vitro cultured isolated secondary follicles for 7 days in α-mem + (control) or supplemented with DMSO, DXR, A. oncocalyx or onco A. 106 Viable and non-viable oocytes rates, germinal vesicle (GV), meiotic resumption and metaphase II (MII) rates, after in vitro maturation in TCM199 + (control) or supplemented with DMSO, DXR, A. oncocalyx or onco A of COCs recovered from antral follicles. 107 AUXEMMA ONCOCALYX E SEU COMPOSTO ATIVO ONCOCALYXONA A PREJUDICAM A COMPETÊNCIA DE DESENVOLVIMENTO OOCITÁRIO IN VITRO EM SUÍNOS, MAS SÃO MENOS PREJUDICIAIS DO QUE A DOXORRUBICINA Table 1 - Rates of viable oocytes, germinal vesicle (GV), meiotic resumption and metaphase II (MII) rates, after in vitro maturation of porcine oocytes in control medium alone or supplemented with DXR, A. oncocalyx or onco A (experiment 1) Table 2 - Rates of viable oocytes, matured, penetrated, monospermy and efficiency rates and number of spermatozoa per oocyte after previous exposure (only during in vitro maturation) to DXR, A. oncocalyx or onco A (experiment 1) 125 Table 3 Rates of viable oocytes, matured, penetrated, monospermy and efficiency rates and number of spermatozoa per oocyte after 18hpi exposure (only during in vitro embryo culture) to DXR, A. oncocalyx or onco A (experiment 2). 127

16 LISTA DE ABREVIATURAS E SIGLAS A. oncocalyx Auxemma oncocalyx Argyrophilic proteins related to nucleolar organizer regions AgNOR (proteínas argirofílicas relacionadas com regiões organizadoras de nucléolos) ANOVA Analysis of variance (Análise de variância) ANP Atrial natriuretic peptide BAX BCL2 Associated X Protein BCL2 B-cell lymphoma 2 BMP-15 Bone morphogenetic protein 15 (proteína morfogenética óssea 15) BMPs Bone morphogenetic proteins BSA Bovine serum albumin CaCl2 2H2O Calcium chloride dehydrate Calcein-AM Calcein acetoximetil CAPES Coordenação de aperfeiçoamento de pessoal de nivel superior Casp3 Caspase 3 cdna Complementary DNA cgmp Cyclic guanosine monophosphate CH2Cl2 Dichloromethane CNPq Conselho Nacional de Desenvolvimento Científico e Tecnológico COCs / CCOs Cumulus oocyte complex (complexos cumulus-oócitos) DAB 3,39-diaminobenzidine tetrahydrochloride DMSO Dimethyl sulfoxide (dimetilsulfóxido) DNA Deoxyribonucleic acid (ácido desoxirribonucléico) DPBS Dulbecco s phosphate-buffered saline DSBs Double-strand breaks dutp Terminal deoxynucleotidyl transferase-mediated DXR Doxorubicin (Doxorrubicina) EGF Epidermal growth factor EtOAc Ethyl acetate EtOH Ethyl alcohol

17 FSH Follicle stimulating hormone FUNCAP Fundação Cearense de Apoio ao Desenvolvimento Científico e Tecnológico GAPDH Glyceraldehyde-3-phosphate-dehydrogenase GV Germinal vesicle GVBD (RVG) Germinal vesicle break down (ruptura da vesícula germinativa) H2O2 HEPES HL-60 hpi IGF-I IVF / FIV IVM / MIV IVP KCl LH mdpbs MEM MeOH Hydrogen peroxide (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) Human promyelocytic leukemia line Hours post insemination Insulin growth factor I In vitro fertilization (fertilização in vitro) In vitro maturation (maturação in vitro) In vitro production Potassium chloride Luteinizing hormone Modified DPBS Minimal essential medium (meio essencial mínimo) Methanol MI Metaphase 1 MII Metaphase 2 Na2HPO4 Sodium hydrogen phosphate NaCl Sodium chloride NCSU-23 North Carolina State University Medium-23 NMR Nuclear magnetic resonance NOR Nucleolar organizer regions Onco A Oncocalyxone A (oncocalyxona A) PAF Paraformaldehyde PAR Poly (ADP-ribose) chain PARP Poly (ADP-ribose) polymerase PCNA Proliferating cell nuclear antigen PKG cgmp-dependent protein kinase PPIA Peptidylprolyl Isomerase A

18 qpcr Quantitative PCR rfsh Recombinant FSH RNA Ribonucleic acid RNAm Messenger RNA S phase Synthesis SEM Standard error of the mean TCM Tissue culture medium 199 Topo II Topoisomerase II TOPOs Topoisomerases TPF TUNEL positive follicles TUNEL Terminal deoxynucleotidil transferase-mediated deoxyuridine Triphosphate biotin nick end-labeling α-mem Alpha minimal essential medium (meio essencial mínimo alfa)

19 SUMÁRIO 1 INTRODUÇÃO REVISÃO DE LITERATURA FOLICULOGÊNESE E CARATERIZAÇÃO FOLICULAR ATRESIA FOLICULAR TOXICIDADE E FUNÇÃO REPRODUTIVA FEMININA SISTEMAS DE CULTIVO IN VITRO Cultivo in situ e isolado de folículos pré-antrais Técnicas de avaliação do cultivo in vitro DOENÇAS TUMORAIS NEOPLÁSICAS Terapêutica do câncer FITOTERAPIA JUSTIFICATIVA HIPÓTESES CIENTÍFICA OBJETIVOS OBJETIVO GERAL OBJETIVOS ESPECÍFICOS PROPRIEDADES DA PLANTA AUXEMMA ONCOCALYX E SEU PRINCÍPIO ATIVO ONCOCALYXONA A FRAÇÃO DE AUXEMMA ONCOCALYX E ONCOCALYXONA A AFETAM A SOBREVIVÊNCIA IN VITRO E O DESENVOLVIMENTO DE FOLÍCULOS PRÉ-ANTRAIS 7 CAPRINOS INCLUSOS EM TECIDO CORTICAL OVARIANO EFEITO DA TOXICIDADE DA FRAÇÃO DA AUXEMMA ONCOCALYX E DO PRINCÍPIO ATIVO ONCOCALYXONA A NO CULTIVO IN VITRO DE FOLÍCULOS SECUNDÁRIOS E NA MATURAÇÃO IN VITRO DE OÓCITOS CAPRINOS AUXEMMA ONCOCALYX E SEU COMPOSTO ATIVO ONCOCALYXONA A PREJUDICAM A COMPETÊNCIA DE DESENVOLVIMENTO OOCITÁRIO IN VITRO EM SUÍNOS, MAS 9 SÃO MENOS PREJUDICIAIS DO QUE A DOXORRUBICINA

20 10 CONCLUSÕES PERSPECTIVAS REFERÊNCIAS

21 20 1 INTRODUÇÃO As plantas são reconhecidas pelo seu potencial terapêutico e representam uma excelente fonte de matéria-prima para a produção de novas drogas (Bahmani et al., 2016). Assim, o estudo das atividades farmacológicas das plantas é de grande importância a fim de provar sua eficiência e, em muitos casos, validar as suas utilizações populares (Schmitt et al., 2003). Dentre os diferentes tipos de plantas existentes, A Auxemma oncocalyx (A. oncocalyx) tem sido amplamente utilizada na medicina popular no tratamento adjuvante para ferimentos (Braga, 1976). Diversos estudos sugerem algumas atividades biológicas desta planta, tais como atividade analgésica, antioxidante, anti-inflamatória e anti-tumoral (Ferreira et al., 2004; Pessoa et al., 1992). O extrato da A. oncocalyx pode ser obtida a oncocalyxona A (rel-8a-hydroxy-5-hydroxy-methyl-8ab-methyl-2-methoxy-7,8,8a,9- tetrahydro-1,4 anthracenediona, onco A) que é o princípio ativo possuindo alta atividade antioxidante (Ferreira et al., 2003) e antiproliferativa contra as células tumorais (Costa- Lotufo et al., 2002a). A onco A tem sido sugerida como uma droga alternativa para o tratamento do câncer (Barreto et al., 2013). No entanto, a maioria dos medicamentos utilizados para a terapia de câncer tende a ser tóxico para a saúde reprodutiva feminina, acarretando falha ovariana prematura (Turan et al., 2013). Entretanto, ainda não é conhecido o efeito da Auxemma oncocalyx e do seu princípio ativo sobre a fertilidade feminina, incluindo os seus possíveis efeitos sobre a sobrevivência e o desenvolvimento dos folículos ovarianos. Uma forma de investigar este parâmetro é a utilização da técnica de cultivo folicular in vitro. O cultivo in vitro de folículos pré-antrais, também conhecido como "Ovário artificial", é uma etapa importante na biotecnologia de manipulação in vitro de oócitos inclusos em folículos pré-antrais (MOIFOPA). Esta biotecnologia é uma importante ferramenta para a elucidação dos mecanismos básicos envolvidos na foliculogênese ovariana (Arunakumari et al., 2010). Além disso, permite a realização de ensaios in vitro para investigar os efeitos benéficos/tóxicos de drogas sobre os folículos ovarianos, antes de sua utilização efetiva em experimentos com humanos e/ou animais. Vale salientar que a utilização de material humano para experimentação laboratorial envolve várias questões éticas. Neste sentido, alguns autores utilizam modelos animais para a pesquisa. Um exemplo é o uso do tecido ovariano de cabra, a fim de verificar o efeito de diversas

22 21 substâncias sobre o desenvolvimento folicular, devido às semelhanças entre os ovários dessa espécie com a humana (Faustino et al., 2011). Os suínos, são também modelos animais muito utilizados para estudos de toxicidade sobre a maturação, fertilização e o cultivo embrionário (Santos et al., 2014). Para uma melhor compreensão da importância desta tese, na revisão de literatura a seguir será realizada uma breve abordagem da foliculogênese e caracterização dos folículos ovarianos, população e atresia folicular, cultivo in vitro de folículos pré-antrais (ovário artificial), estado atual da técnica de MOIFOPA, diferentes aplicações do ovário artificial, com ênfase na sua importância para o teste da eficiência/toxicidade de drogas e, finalmente, a importância dos fitoterápicos utilizados no tratamento do câncer, com ênfase na planta Auxemma oncocalyx e seu princípio ativo, onco A.

23 22 2 REVISÃO DE LITERATURA 2.1 FOLICULOGÊNESE E CARACTERIZAÇÃO FOLICULAR Na maioria das espécies, a foliculogênese é um evento iniciado ainda na vida prénatal e é definida como o processo de formação, crescimento e maturação folicular, obedecendo à uma sequência de eventos característicos, que começam com o estabelecimento da população folicular no ovário e termina com a ovulação. Durante esse processo há uma intensa proliferação das células da granulosa e um aumento do volume e diâmetro folicular, como resultado do acúmulo de água, íons, carboidratos e lipídios (Amsterdam et al., 1989). O folículo é considerado a unidade morfológica e funcional do ovário mamífero, e tem duas funções principais: endócrina e gametogênica. A unidade folicular é composta por um oócito circundado por células da granulosa e/ou tecais, sendo um elemento essencial na promoção de um ambiente ideal para maturação, viabilidade, crescimento e liberação de um oócito maduro no processo de ovulação (Cortvrindt and Smitz, 2001). De acordo com o seu estágio de desenvolvimento, os folículos podem ser classificados em pré-antrais (primordial, transição, primário e secundário) e antral (terciário e préovulatório) (Silva et al., 2004). Os folículos primordiais são constituídos por um oócito primário (núcleo no estágio de prófase da primeira divisão meiótica) circundados por uma camada de células da pré-granulosa planas e uma membrana. Os folículos primordiais são os folículos de menor tamanho e os mais numerosos no ovário mamífero (90% dos folículos) e constituem a reserva de folículos quiescentes (Beckers et al., 1996). Eles podem ser eliminados pelo processo de atresia ou continuar seu crescimento até ovulação (McLaughlin and McIver, 2009). Durante a fase inicial do crescimento dos folículos primordiais os folículos que apresentam células da granulosa pavimentadas e cubicas são denominados de folículo de transição (Silva et al., 2004). Aqueles que mantém seu crescimento ativo, se tornam folículos primários, caracterizado por possuir um oócito circundado por uma camada de células da granulosa cubóides (Picton, 2001).

24 23 As células da granulosa cubicas continuam a dividir-se e formam camadas concêntricas. Com duas ou mais camadas de células ao redor do oócito, os folículos são denominados de folículos secundários. Próximo à parte externa da membrana basal, proliferam as células da teca que darão origem à teca interna e externa que são responsáveis, juntamente como oócito, pelo funcionamento do folículo (Young and McNeilly, 2010). Quando os folículos secundários crescem, inicia-se na sequência a formação de uma cavidade antral dando origem aos folículos terciários, que após um período de desenvolvimento, caso escapem da atresia, poderão dar origem aos folículos maduros préovulatórios ou folículos de Graaf (Picton, 2001). A formação do antro faz com que as células da granulosa se diferenciem em dois grupos: as células da granulosa murais, que estão em contato com a membrana basal e têm uma função endócrina, e as células do cumulus, que estão intimamente relacionadas com o oócito, e formam o complexocumulus-oócito (CCO), que auxiliam no metabolismo e na maturação oocitária (Gonçalves et al., 2008). Nos folículos antrais, o antro é repleto com fluido folicular que atua como fonte de oxigênio, tampão ácido-básico, hidratos de carbono, fatores de crescimento, hormônios e outras substâncias (Sutton et al., 2003). O oócito completa o seu crescimento quando o folículo que o contém entra na fase antral avançada, mas continua a maturar (maturação nuclear e citoplasmática) até o final da foliculogênese. No citoplasma, as alterações que ocorrem são destinadas à aquisição da capacidade de ser fertilizado pelo espermatozoide, bloquear a polispermia, descondensar a cromatina do espermatozoide e permitir a formação dos pró-núcleos masculinos e femininos, bem como as primeiras divisões embrionárias (Ferreira et al., 2009). A nível nuclear, uma série de eventos moleculares associados ocorrem em cascata com a retomada da meiose I: ruptura da vesícula germinativa (RVG), a progressão na divisão meiótica, extrusão do primeiro corpo polar e metáfase II (MII) (Tripathi et al., 2010). Além disso, ocorre a expansão das células do culmulus. Finalmente, o processo de foliculogênese termina quando o CCO é liberado de um folículo maduro por ocasião da ovulação. Após a ovulação, a parede folicular remanescente o sofre um processo de luteinização formando corpo lúteo.

25 ATRESIA FOLICULAR O processo de atresia usualmente ocorre de forma diferenciada nos folículos préantrais e antrais. Em folículos pré-antrais, os primeiros sinais de morte folicular surgem no oócito, em que pode-se observar a retração da cromatina nuclear e a fragmentação oocitária (Morita and Tilly, 1999). Após a formação do folículo antral ocorre uma alteração na sensibilidade do oócito e das células da granulosa. A partir deste estágio, o oócito torna-se mais resistente à atresia e as primeiras alterações indicativas de atresia são observadas nas células da granulosa. A atresia pode ocorrer por necrose e/ou apoptose (Saumande, 1981). A necrose é iniciada por mecanismos não-celulares, tais como a isquemia, depleção de ATP (Bhatia, 2004) e fatores traumáticos ocasionados por alterações no fornecimento de oxigênio e nutrientes para o ovário, que resultam em danos celulares irreversíveis (Mccully et al., 2004). Já a apoptose é um processo de morte celular ativo, que ocorre de forma ordenada e demanda energia para a sua execução. Além disso, a ativação deste processo é geneticamente determinada, ou seja, é regulada pela expressão de genes específicos (Mccully et al., 2004), em que, provavelmente o desbalanço entre os fatores que promovem a sobrevivência e aqueles que induzem a apoptose irá determinar quais os folículos que continuarão o seu desenvolvimento ou sofrerão atresia (Bhatia, 2004). A apoptose é mediada por mecanismos intrínsecos ou extrínsecos (Johnson, 2003), como estresse oxidativo, irradiação, ativação de genes promotores da apoptose, danos no DNA, citocinas, ou ausência de fatores de crescimento (Johnson, 2003). Outros fatores que levam a apoptose folicular são os agentes quimioterápicos. 2.3 TOXICIDADE E FUNÇÃO REPRODUTIVA FEMININA Empresas farmacêuticas e químicas produzem novos químicos na forma de novas drogas para o tratamento de pacientes com câncer. Essas drogas podem interferir com a síntese, secreção, transporte, ligação ou eliminação de hormônios naturais, e tem o potencial para alterar o desenvolvimento reprodutivo e a fertilidade, levando a desordens reprodutivas (Kort et al., 2014). Qualquer droga que atue como um agente tóxico reprodutivo, tem um efeito direto no ovário e deve também ser capaz de alterar

26 25 mecanismos epigenéticos no oócito, resultando em efeitos epigenéticos ao longo das gerações (Kang and Roh, 2010). O ovário mamífero contém folículos em diferentes estágios de desenvolvimento, que variam sua susceptibilidade a diferentes compostos (Stefansdottir et al., 2014). Durante a foliculogênese, os folículos ovarianos entram em um período de crescimento contínuo até eles entrarem em atresia ou desenvolverem até o estágio de folículos maduros, acompanhados por uma rápida proliferação das células da granulosa. O estado de crescimento contínuo, acompanhado pela parada meiótica do oócito durante a vida reprodutiva feminina, faz dos folículos alvos vulneráveis para tóxicos reprodutivos (Stefansdottir et al., 2014). Embora a estrutura folicular atue como uma barreira protetora envolvendo o oócito, ela não protege necessariamente dos efeitos mutagênicos diretos ou indiretos (Rekhadevi et al., 2014). Alguns compostos tóxicos são capazes de passar através da membrana basal e têm o potencial de afetar o oócito, direta ou indiretamente, ao afetar as células somáticas. Se essas drogas são capazes de afetar o pool de folículos primordiais, elas podem causar a falência ovariana pré-matura, levando à infertilidade pela depleção da reserva ovariana de folículos primordiais (De Vos et al., 2010). Por outro lado, se o alvo dessas drogas é folículos em crescimento, isso pode resultar em atresia folicular com subsequentes distúrbios cíclicos, causando a depleção do pool de folículos primordiais (Meirow et al., 2010). Existem diferentes rotas pelas quais os químicos podem interferir no desenvolvimento do oócito. Agentes quimioterápicos podem afetar o fuso do oócito durante a divisão meiótica, causando alteração no cromossomo (Fragouli et al., 2011). Também, eles podem causar erros nos checkpoints meióticos, resultando em mutações que têm potencial para a formação de embriões com aneuploidia e provalmente aborto (Barekati et al., 2008), ou em outros casos, passam para as gerações subsequentes (Stefansdottir et al., 2014). Compostos tóxicos podem tanto atuar especificamente no oócito, ou ter impactos mais amplos sobre as células somáticas (Orisaka et al., 2009). Qualquer efeito sobre as células da granulosa e da teca pode alterar a produção de hormônios, perturbando o eixo hipotalâmico-hipofisário-gonadal e o desenvolvimento folicular normal, afetando a maturação do oócito (Canipari, 2000).

27 SISTEMAS DE CULTIVO IN VITRO Diferentes sistemas de cultivo in vitro têm sido desenvolvidos com o objetivo de promover o crescimento de folículos pré-antrais ou antrais até seu completo desenvolvimento, originando oócitos fertilizáveis ( Jin et al., 2010; Eppig and O Brien, 1996; Eppig and Schroeder, 1989). Esses cultivos têm se tornado de grande importância para o estudo e compreensão da foliculogênese, bem como para avaliar o efeito de diferentes substâncias. Essa biotecnologia tem sido estabelecida com sucesso em vários modelos animais (camundongo, rato, vaca, ovelha, cabra, porca e primatas) ( Xuying et al., 2011; McLaughlin and Telfer, 2010; Telfer et al., 2008; Hirao et al., 1994). Modelos de cultivo in vitro de folículos pré-antrais na forma isolada ou inclusos em fragmentos de tecido ovariano, ou mesmo no ovário inteiro, permitem controlar de forma mais precisa do que os testes in vivo, o efeito de diferentes drogas sobre a foliculogênese. Potenciais aplicações incluem o estudo dos mecanismos de ação das substâncias tóxicas e como elas levam a danos no oócito e células somáticas, interferem na qualidade do oócito, no estabelecimento do pool de folículos primordiais e nas interações parácrinas (Sun et al., 2004). O cultivo também pode revelar o alvo de um determinado composto sobre um estágio específico de desenvolvimento folicular, permitindo avaliar se o referido composto afeta a integridade cromossômica do oócito, ou se ele tem a capacidade de alterar a sinalização hormonal dentro e/ou entre os folículos (Stefansdottir et al., 2014). Os métodos de cultivo disponíveis para pesquisa toxicológica variam de acordo com a espécie, estágio folicular, período e composição do meio de cultivo. Cada sistema de cultivo tem suas vantagens e desvantagens, exigindo uma análise cuidadosa antes de escolher o melhor método para um estudo de toxicologia (Stefansdottir et al., 2014) Cultivo in situ e isolado de folículos pré-antrais Os folículos podem ser cultivados in situ, ou seja, inseridos no córtex ovariano, ou isolados. Em adição, o cultivo pode ser realizado em dois passos, podendo ser iniciado com o cultivo de folículos in situ, seguido de uma etapa de cultivo de folículos isolados (Brien et al., 2003; Telfer et al., 2008). O cultivo de pequenos fragmentos de córtex ovariano tem sido realizado para o estudo da ativação e crescimento de folículos

28 27 em diferentes espécies, como caprinos (Silva et al., 2004), bovinos (Braw-Tal and Yossefi, 1997), babuínos (Wandji et al., 1997) e humanos (Zhang et al., 2004). Além da praticidade, o cultivo in situ apresenta também como vantagem a manutenção do contato celular (Abir et al., 2006) e da integridade tridimensional dos folículos. No entanto, neste tipo de modelo, embora haja uma expressiva ativação folicular, poucos folículos primários cultivados progridem até o estágio de folículo secundário (Fortune, 2003). O cultivo de folículos isolados apresenta como vantagens a possibilidade do acompanhamento individual dos folículos durante o cultivo, além de favorecer melhor a perfusão do meio para o folículo (Abir et al., 2006). Uma vez isolados, os folículos podem ser cultivados em sistema bidimensional ou tridimensional. No sistema bidimensional, o folículo é colocado diretamente sobre uma placa de cultivo (exemplo superfície plástica) (Gonçalves et al., 2008), ou sobre uma camada de células somáticas ou de matriz extracelular (exemplo o alginato). Já na forma tridimensional, os folículos são cultivados inseridos em uma matriz extracelular, como por exemplo, o colágeno ( Hirao et al., 1994; Carroll et al., 1991) ou gel de alginato (Xu et al., 2009; West et al., 2007), mantendo a morfologia folicular intacta. O fato do folículo permanecer com a morfologia intacta é muito importante, uma vez que existe uma comunicação entre o oócito e as células somáticas que o circundam (Spears et al., 1994), através das junções do tipo gap, pelas quais circulam fatores parácrinos essenciais para proporcionarem crescimento e maturação do oócito (Carabatsos et al., 2000). A perda desse contato causa ovulação pré-matura e liberação de oócito degenerado (Eppig et al., 2005) Técnicas de avaliação da eficiência do cultivo in vitro Há um grande interesse no desenvolvimento de tecnologias que permitam o crescimento e maturação in vitro de oócitos inclusos em folículos pré-antrais (maior população de folículos presentes no ovário), devido às muitas aplicações que podem ter tanto na reprodução assistida em humanos, como na produção animal. Para a avaliação da eficiência do cultivo in situ pode ser utilizada a histologia clássica para a análise quantitativa de folículos inclusos em tecido ovariano, com a finalidade de verificar modificações na morfologia das células da granulosa, de

29 28 pavimentosa para cúbica. Assim, a histologia clássica permite classificar os folículos préantrais quanto ao seu estágio de desenvolvimento (primordial, transição, primário ou secundário), e ainda, quanto às suas características morfológicas (normais ou atrésicos). Outras técnicas, tais como imunohistoquímica, também são amplamente utilizadas na análise do cultivo in situ. Estas técnicas possibilitam analisar a proliferação celular, apoptose e a expressão de moléculas de interesse (Gonçalves et al., 2008). O PCNA e o AgNOR são marcadores apropriados para estudar a proliferação das células da granulosa. Uma técnica empregada para avaliar a viabilidade de folículos pré-antrais isolados e oócitos após o cultivo in vitro é a microscopia de fluorescência (Silva et al., 2011; Bruno et al., 2010), a qual utiliza marcadores fluorescentes, que quando excitados com radiação de baixo comprimento de onda, absorvem energia e emitem luz de comprimento de onda maior (Gonçalves et al., 2008). Os marcadores comumente utilizados são o etídio homodímero-1 e calceína-am, que permitem a detecção simultânea de células mortas e vivas, respectivamente. O etídio homodímero-1 marca ácidos nucléicos em células não viáveis, indicando a perda da integridade da membrana plasmática das células (Gonçalves et al., 2008), enquanto a atividade enzimática (esterases) no citoplasma é detectada nas células foliculares através do composto calceína-am, que é clivado por enzimas esterases em células vivas, resultando em um produto fluorescente (De Clerck et al., 1994). A microscopia de fluorescência é empregada ainda no intuito de avaliar a configuração da cromatina de oócitos oriundos de folículos pré-antrais, indicando assim o estágio meiótico alcançado após terem sido cultivados e maturados in vitro (Saraiva et al., 2010)G. Para tal finalidade, utiliza-se o Hoescht 33342, que penetra em células vivas e se intercala entre as bases nitrogenadas do DNA. A quantificação dos níveis de RNAm para as diferentes substâncias (ligantes e receptores) que atuam durante a foliculogênese, também é considerada uma importante ferramenta para auxiliar na compreensão desse processo, uma vez que permite detectar alterações nos padrões de expressão gênica que ocorrem em resposta à fenômenos relacionados à sobrevivência, ao crescimento e à diferenciação celular (Zamorano et al., 1996). Dentre as técnicas comumente utilizadas para esta finalidade, pode-se destacar a qpcr. Outras ferramentas para a análise da eficiência do cultivo e da competência oocitária são a fertilização in vitro (FIV) e a produção in vitro de embriões (PIV). A PIV

30 29 é uma excelente ferramenta para pesquisa de fenômenos biológicos que ocorrem durante a maturação, fecundação e cultivo in vitro de oócitos, capacitação espermática e eventos relacionados ao início do desenvolvimento embrionário na fase de pré-implantação. Devido à sua capacidade de produzir um grande número de embriões, a PIV se tornou um instrumento indispensável para outras biotécnicas como a clonagem, a manipulação de genes e a transferência de núcleos (Gonçalves et al., 2007). 2.5 DOENÇAS TUMORAIS NEOPLÁSICAS As doenças tumorais neoplásicas vêm sendo indicadas como a terceira causa de morte mais frequente no Brasil (Machado and Melo-junior, 2009). No mundo, o câncer é responsável por mais de 12 % de todos os óbitos, e é alvo de pesquisas para o desenvolvimento ou descoberta de novas formas de tratamento (Saúde, 2008), uma vez que a resistência adquirida aos medicamentos anticancerígenos já existentes é encontrada em grande parte dos pacientes, além da ocorrência de inúmeros efeitos adversos que limitam a eficácia do tratamento Terapêutica do câncer Atualmente, o tratamento dos cânceres, em sua grande maioria, é considerado como um dos problemas mais desafiadores da medicina. A partir do momento que a neoplasia primária causa metástase pelo corpo do hospedeiro, o prognóstico se torna ruim, sendo a quimioterapia antineoplásica a principal forma de tratamento neste estágio. Uma vantagem deste tratamento é a de atingir igualmente as metástases disseminadas pelo corpo. Entretanto, há desvantagens importantes a serem consideradas, principalmente aquelas relacionadas aos seus efeitos colaterais, pois em sua grande maioria, estes medicamentos apresentam baixo índice terapêutico, ou seja, dose terapêutica muito próxima à dose tóxica (Chabner and Roberts, 2005). Desta maneira, a pesquisa, tanto básica como aplicada, é fundamental e deve ser estimulada, para que medicamentos antineoplásicos mais eficazes e seguros sejam descobertos, incluindo drogas que não afetem a função reprodutiva, ou seja, não sejam tóxicas aos ovários. Com o objetivo de tratar o câncer com maior eficácia, esquemas terapêuticos utilizando cirurgia, radioterapia e quimioterapia têm sido cada vez mais prevalentes

31 30 (Reiner et al., 2009). Cada um destes tratamentos visa erradicar o câncer, normalmente por meio da terapia combinada, em que é associado mais de um tipo de tratamento. Através da cirurgia ou radioterapia, um terço dos pacientes consegue ser curado através de medidas locais, que são eficazes quando o tumor ainda não sofreu metástase por ocasião do tratamento. Todavia, nos demais casos, a neoplasia caracteriza-se pelo desenvolvimento precoce de micrometástases, indicando a necessidade de uma abordagem sistêmica, que pode ser efetuada, em cerca de 60-70% dos casos, com a quimioterapia (Almeida et al., 2005). Esta medida terapêutica consiste na utilização de medicamentos a fim de destruir as células cancerosas, bloqueando o seu desenvolvimento. Entretanto, a maioria dos agentes quimioterápicos atua de forma não específica, lesando tanto células malignas quanto normais (Almeida et al., 2005). Porém, o corpo recupera-se destes inconvenientes após o tratamento, e o uso clínico desses fármacos exige que os benefícios sejam confrontados com a toxicidade, na procura de um índice terapêutico favorável (Almeida et al., 2005). Muitas drogas usadas na quimioterapia do câncer, além de possuir toxicidade contra células tumorais, exibem efeitos genotóxicos, carcinogênicos e teratogênicos sobre células normais, revelando uma baixa especificidade dessas drogas contra os tecidos tumorais, resultando em efeitos não desejáveis no tratamento. A Doxorrubicina (DXR) é um fármaco amplamente utilizado em pacientes com câncer (Oktem and Oktay, 2007). Estudos recentes revelam que a DXR induz toxicidade ovariana, que é observada pela redução da taxa de ovulação, juntamente com uma redução no tamanho do ovário (Ben- Aharon et al., 2010; Oktem and Oktay, 2007). Neste contexto, os compostos derivados de plantas (fitoterápicos) também têm sido uma fonte alternativa de moléculas clinicamente úteis no tratamento do câncer (Cragg and Newman, 2005). 2.6 FITOTERAPIA A expressão fitoterapia é atribuída aos medicamentos originados exclusivamente de material botânico integral ou seus extratos utilizados com o propósito de tratamento médico (Dewick, 2009). Antes a fitoterapia era utilizada principalmente por populações carentes, isso pelo fato da boa disponibilidade e menor custo. A fitoterapia e predominante em países

32 31 emergentes, sendo bem estabelecida em culturas e tradições, especialmente na Ásia, América Latina e África (Shale et al., 1999). Existe um interesse crescente no uso de produtos naturais, principalmente os derivados de plantas. De acordo com Gurib-Fakim (2006), os produtos naturais e seus derivados representam mais de 50% de todas as drogas utilizadas no mundo, e as plantas medicinais contribuem com 25% deste total. Alguns exemplos de drogas obtidas a partir de plantas são a Digoxina da Digitalis spp., Quinina e Quinidina obtidas da Cinchona spp., Vincristina e Vinblastina oriundas da Catharanthus roseus, Atropina procedente de Atropa belladona e Morfina e Codeína provenientes de Papaver somniferum (Rates, 2001). A possibilidade de utilizar as plantas medicinais como fonte de substâncias medicamentosas reside na capacidade de produzirem, a partir de seu metabolismo, substâncias químicas que exercem alguma atividade sobre outros organismos vivos. Baseado nessas atividades e que se procuram os efeitos terapêuticos para o tratamento de doenças tanto em animais como em humanos (Boukandou et al., 2015). As plantas podem sintetizar dois tipos de metabólitos: primários e secundários. A extensa e diversificada flora do Brasil e um recurso natural de imenso potencial para a obtenção de metabólitos secundários, muitos dos quais podem ser utilizados com finalidade terapêutica (da Silva et al., 2016). De acordo com Gurib-Fakim (2006), as atividades biológicas das plantas são atribuídas a esses metabólitos. As propriedades antifúngica, antibacteriana, antineopla sica, imunomoduladora e antiparasita ria das plantas têm sido bastante exploradas (Silva et al., 2016). Algumas dessas plantas têm uma longa história de uso no tratamento de câncer. O maior impacto recente de drogas derivadas de plantas foi provavelmente nesta área, em que Taxol, Vinblastina, Vincristina e Camptotecina melhoraram drasticamente a eficácia da quimioterapia contra alguns dos piores cânceres. Na verdade, mais de 60% dos agentes anticancerígenos utilizados são derivados da natureza (Cragg and Newman, 2005). Apesar deste vasto conhecimento, ainda são limitadas as investigações cientificas visando determinar o potencial terapêutico das plantas (Duarte, 2006). Estudos têm demonstrado que as populações locais da região do semiárido brasileiro possuem um vasto conhecimento sobre a utilidade medicinal de determinadas espécies de plantas, como por exemplo, a Auxemma oncocalyx (A. oncocalyx), também

33 32 conhecida como Pau-Branco, o que pode contribuir para a conservação da biodiversidade e sua função dentro do ecossistema (Albuquerque and Oliveira, 2007). A Auxemma oncocalyx é uma planta nativa da caatinga do Nordeste brasileiro, e vem sendo bastante utilizada pela medicina popular. Seu composto ativo oncocalyxona A (onco A) é conhecida por ter diversas propriedades bioquímicas, como antioxidante, anti-inflamatório, anti-plaquetário e anti-cancerígeno. Mais informações sobre a planta e seu composto ativo encontrasse no artigo de revisão (Capítulo 1).

34 33 3 JUSTIFICATIVA Os fitoterápicos sofrem uma grande restrição quanto ao seu uso e aceitação, devido ao reduzido número de estudos que comprovam sua ação biológica e segurança quanto a efeitos tóxicos agudos, crônicos ou sobre a reprodução (Sharapin, 1999). Dentre os critérios de segurança necessários, estão os estudos sobre a toxicidade reprodutiva dos produtos fitoterápicos, que incluem uma avaliação das ações sobre a fertilidade e a performance reprodutiva para os produtos administrados, durante a gametogênese e fecundação. Vários métodos in vitro para avaliar a toxicidade de substâncias foram padronizados utilizando-se cultivos celulares. Um dos modelos experimentais utilizados para avaliação da toxicidade in vitro, que surge como alternativa previa aos estudos in vivo, é a biotécnica de Manipulação de Oócitos Inclusos em Folículos Pré-Antrais (MOIFOPA/ Ovário artificial). A MOIFOPA consiste no isolamento, conservação (resfriamento e criopreservação) e/ ou cultivo in vitro de folículos pré-antrais, visando a ativação, crescimento e maturação in vitro dos folículos primordiais até o estágio préovulatório. Além de ter importantes aplicações para a pesquisa fundamental e reprodução assistida animal e humana, esta biotécnica também representa uma excelente alternativa para incrementar e auxiliar no desenvolvimento de pesquisas relacionadas à indústria farmacêutica (Figueiredo, 2008). Portanto, a importância do presente trabalho visa dar continuidade às pesquisas relacionadas ao ovário artificial, testando a sua aplicação no teste de toxicidade de substâncias de interesse terapêutico empregadas em humanos. O uso de material humano é bastante problemático na pesquisa, devido a dificuldades éticas, e até mesmo de obtenção de material de pesquisa. Assim, diversos autores têm utilizado animais em suas pesquisas antes de sua aplicação em humanos. Um exemplo disto é a utilização de tecido ovariano de cabras com objetivo de verificar o efeito de diferentes substâncias no desenvolvimento folicular. Isso seria possível devido ao fato desse animal ter uma foliculogênese semelhante à humana, além da própria estrutura ovariana que também é semelhante (Amorim et al., 2004) Por outro lado, a espécie suína representa um modelo ideal para o teste de toxicidade de competência oocitária e qualidade embrionária. Em comparação com as outras espécies, a espécie suína é um modelo animal bastante utilizado como um modelo para oócitos humanos em

35 34 testes de toxicidade (Gerritse et al., 2008; Munn et al., 1986). Além disso, a vantagem de utilizar ovários de porcas é que os ovários são obtidos a partir de animais em idade semelhante, raça e nutrição controlada. Uma das principais vantagens da utilização de modelos animais in vitro e possibilidade de testar substâncias como novos antibióticos, hormônios, fatores de crescimento e quimio e fitoterápicos poderão ter seus efeitos testados (benéfico ou tóxico) sobre os oócitos in vitro. A utilização desta biotécnica como método laboratorial para testes de drogas traz importantes consequências para o bem-estar animal, uma vez que milhares de animais serão poupados de serem utilizados em experimentos/ testes no que concerne aos testes in vivo (Figueiredo, 2008). Dentre as plantas medicinais estudas por diversos autores, podemos destacar a Auxemma oncocalyx (Pau-Branco-do-Sertão). Conforme já descrito anteriormente, esta planta possui diversas atividades biológicas. O extrato hidroalcoólico dessa planta mostrou ação antitumoral, analge sica e antinflamatória (Ferreira et al., 2004; Lino et al., 1996; Pessoa et al., 1992). Estudos de quinonas isoladas, como o caso da oncocalyxona A, observaram fortes atividades como antiagregante plaqueta ria, antioxidante, antinflamatória, analge sica, antitumoral e antifu ngica (Sun et al., 2016; Lee et al., 2015; Ferreira et al., 2003; Leyva et al., 2000). Além disso, essa planta vem sendo utilizada pela medicina popular por possuir diversas propriedades medicinais. A casca, por exemplo, e muito utilizada para auxiliar na cicatrização de ferimentos (Pessoa, 1994; Braga, 1976). Entretanto, apesar desses vários estudos, ainda não é conhecido o efeito dessa planta sobre a fertilidade feminina.

36 35 4 HIPÓTESE CIENTÍFICA Diante do exposto, foi formulada a seguinte hipótese científica: Auxemma oncocalyx e onco A apresentam um efeito menos tóxico do que o controle (tóxico) positivo DXR sobre a sobrevivência e crescimento folicular (espécie caprina), maturação oocitária (espécies caprina e suína) e desenvolvimento embrionário inicial in vitro (espécie suína).

37 36 5 OBJETIVOS 5.1 OBJETIVO GERAL Avaliar o efeito da Auxemma oncocalyx e seu composto ativo a oncocalyxona A sobre o cultivo in vitro de folículos pré-antrais, maturação oocitária e qualidade embrionária. 5.2 OBJETIVOS ESPECÍFICOS Avaliar o efeito da concentração-resposta da A. oncocalyx (1,2; 12 ou 34 μg/ml) e onco A (1; 10 ou 30 μg/ml) sobre a sobrevivência, ativação, crescimento folicular e oocitário após o cultivo in vitro de folículos pré-antrais caprinos inclusos em fragmentos de tecido ovariano (Fase I); Investigar o efeito da A. oncocalyx e onco A, utilizando as concentrações definidas na Fase I, sobre a sobrevivência folicular, formação de antro e o crescimento de folículos secundários isolados caprinos cultivados in vitro, bem como sobre a viabilidade e a maturação nuclear de oócitos recuperados de folículos antrais caprinos (Fase II); Avaliar o efeito da exposição da A. oncocalyx e onco A durante a maturação in vitro de oócitos (Experimento 1) ou durante o cultivo in vitro de embriões (Experimento 2) sobre a maturação oocitária desenvolvimento embrionário inicial na espécie suína (Fase III).

38 37 6 PROPRIEDADES DA PLANTA AUXEMMA ONCOCALYX E SEU PRINCÍPIO ATIVO ONCOCALYXONA A Properties of the plant Auxemma oncocalyx and its active principle oncocalyxone A Periódico: Phytotherapy research (submetido) (ISSN: ) Factor de impacto: 2.694

39 38 RESUMO Atualmente, existe uma constante necessidade de pesquisar novas drogas, sendo as plantas cada vez mais reconhecidas por seu potencial terapeutico. Assim, o estudo das atividades farmacológicas de plantas é crucial para identificar sua eficácia, e em muitos casos, validar a utilização popular de plantas medicinais. Auxemma oncocalyx (A. oncocalyx) é uma árvore pertencente à família Boraginaceae, endêmica do nordeste do Brasil. Esta planta vem sendo amplamente utilizada na medicina popular, e seus extratos hidroalcóolicos contém principalmente a Oncocalixona A (Onco A). Nesta revisão, serão abordadas a ecologia e biologia de A. oncocalyx. Adicionalmente, as propriedades biológicas de A. oncocalyx e Onco A, como ação anti-inflamatória e analgésica, efeito antiplaquetário e antioxidante, toxicidade e potencial anticancerígeno também serão discutidas. Palavras-chave: Auxemma oncocalyx. Oncocalyxona A. toxicidade. Terapia de câncer. Propriedades biológicas.

40 39 Title: Properties of the plant Auxemma oncocalyx and its active principle Oncocalyxone A Leiva-Revilla J. * 1, Lunardi F. O. 1, Araújo V. R. 1, Celestino J. J. H. 2, Rodrigues A. P. R. 1, Figueiredo J.R 1. 1 Faculty of Veterinary Medicine, LAMOFOPA, PPGCV, Universidade Estadual do Ceará, Fortaleza-CE, Brazil. Av. Paranjana, Itaperi Fortaleza, CE Brasil. Telephone: (+55 85) Institute of Health Sciences, Universidade da Integração Internacional da Lusofonia Afro-Brasileira. Acarape-CE, Brazil. Rodovia CE 060 Km Acarape, CE Brasil. Telephone: (+55 85) * Corresponding author; Av. Paranjana, Itaperi Fortaleza, CE Brasil. Telephone: (+55 85) Fax: (+55 85) address: johileiva@gmail.com

41 40 ABSTRACT Nowadays, there is a constant need to search for new drugs, and plants have become increasingly recognized for their therapeutic potential. Thus, the study of the pharmacological activities of plants is crucial to verify the effectiveness and, in many cases, to validate the popular uses of these medicinal plants. Auxemma oncocalyx (A. oncocalyx), is a tree that belongs to the Boraginaceae family, and it is native of the northeast of Brazil. This plant has been widely used in folk medicine and the hydroalcoholic extract contains its principal component, the Oncocalyxone A (Onco A). In this review, the ecology and biology of the A. oncocalyx is evaluated. In addition, the biological properties of A. oncocalyx and Onco A, such as their anti-inflammatory and analgesic action, antiplatelet and antioxidant effect, toxicity and anticancer potential are also discussed. Keywords: Auxemma oncocalyx, Oncocalyxone A, toxicity, cancer therapy, biological proprieties

42 41 1. Introduction Plants have become increasingly recognized for their therapeutic potential, representing an excellent source of raw material in the production of new drugs (Gossell- Williams et al., 2006). Thus, the study of the pharmacological activities of plants is of paramount importance in order to prove the effectiveness, and in many cases to validate the popular uses of these medicinal plants (Schmitt et al., 2003). Among these plants we can quote Auxemma oncocalyx, popularly known as "Pau- Branco", which is a tree that belongs to the Boraginaceae family. It is a plant native of the Caatinga (semi-arid forest occurring only in Brazil) (Maia, 2004), and it is mainly found in the state of Ceará and Rio Grande do Norte (Braga, 1976). This plant has been widely used in folk medicine. The shell, for example, is widely used in the adjunctive treatment of injuries such as wound healing (Braga, 1976; Pessoa, 1994). Moreover, it has a forage value as food for vertebrates (caprine, murine and birds) and invertebrates (Coleoptera, Diptera, Lepidoptera and Hemiptera), mainly due to the high protein and lipid content of its fruits (Tigre, 1970). Additionally, this plant has a high ornamental value, particularly in afforestation, and agroforestry, being used as a windbreak crop. It is also used in reforestation of degraded areas (Maia, 2004), besides being used in woodworking. The hydroalcoholic extract of the stem has shown an antitumoral, analgesic, antioxidant and anti-inflammatory action (Ferreira et al., 2004, 2003; Lino et al., 1996). On the other hand, the branches have presented properties against Trypanosoma spp. (Braga, 1976). Pharmacological studies have shown an antiplatelet action and vasoconstriction in conductance vessels from the methanolic extract of the heartwood of the stem. This

43 42 action is attributed to its active principle, the Oncocalyxone A (Onco A) (Sousa et al., 2002). Pessoa and Lemos (Pessoa and Lemos, 1997) isolated allantoin from the hydroalcoholic extract of the A. oncocalyx. Furthermore, the rel-hydroxy-8a-hydroxy-5- methyl-8ab-methyl-7-methoxy-2, tetrahydro-1,4-anthracenedione, also known as Onco A, which represents 80% of the A. oncocalyx fraction (Pessoa et al., 1995, 1993), was also isolated from the same extract. Other components and derivatives such as 6- chloro-oncocalixona A, 11-O-acetyl-oncocalyxone A, and 8,11-O-diacetyl-oncocalyxone have been isolated from the ethanol extract (Pessoa et al., 2004). Several studies have shown that Onco A and these derivatives have a cytotoxicity against tumor cells (Pessoa et al., 2004, 2003). After the increasing rate of studies about the A. oncocalyx and its isolated compounds, it becomes necessary to know more about the biological properties of this plant. Given the importance of this plant as a possible chemotherapeutic drug, in the present work we review the most relevant outcomes obtained to date, with an overview of the biology of the plant and its biological properties. 2. Ecology and biology of Auxemma oncocalyx A. oncocalyx (Boraginaceae) is a common tree found in the state of Ceará and Rio Grande do Norte, Northeast of Brazil (Braga, 1976). This tree has between 6 to 8 meters tall whereas the diameter of the trunk is 30 to 40 cm. It is characterized by small, dense and white flowers, being this a peculiarity that attributes to its popular name (Maia, 2004). The leaves are simple, alternate, elliptic, serrated from the middle to the apex and with membranous consistency. Its fruits are glabrous drupes of 2.5 cm (Lima, 1989). Nozella

44 43 (Nozella, 2006) studied the nutritional value of native tree-shrub species of the semi-arid region of northeast of Brazil, which are considered an important source of proteins for the animals of this region, mainly during the dry season. Among these species, he evaluated the A. oncocalyx, and according to the results of tannin concentrations, it has been considered safe for animal nutrition (Nozella, 2006). Previous investigations of Auxemma species resulted in isolation of eight compounds classified as cordiachromes (Pessoa et al., 1995) and hydroquinones (da Costa et al., 1999; Pessoa et al., 1995, 1993). The cordiachromes are a class of meroterpenoids present in A. oncocalyx and other plants such as Auxemma glazioviana (da Costa et al., 1999). Some authors suggest that this cordiachromes have antimycobacterial activity (Dettrakul et al., 2009), which helps the tree against fungi and termite infestation (da Costa et al., 1999). On the other hand, hydroquinones play an important role in electron transport, photosynthesis, and also, they act as antioxidants (Dewick, 2009). Marques et al. (Marques et al., 2000) reported the isolation and structural elucidation based on spectral analysis of three anthracene derivatives such as auxenone, oncocalyxonol and auxemim. The quinone fraction (QF) is prepared from the ground heartwood methanolic extract through exhaustive aqueous extraction followed by lyophilization. The hydrosoluble fraction contained around 80% of Onco A (Ferreira et al., 2004; Pessoa et al., 1993), which was previously characterized in another study (Pessoa et al., 1993). Allantoin is isolated from the hydroalcoholic extract of the stem (Pessoa et al., 1995) Allantoin is a compound that has various pharmacological activities, like wound healing, and stimulating cellular mitosis and promoter of epithelial stimulation. Allantoin is very used in cosmetic and pharmaceutical preparations (Qunaibi et al., 2009). Araújo et al., (Araújo et al., 2010) suggested that the mechanism induced by allantoin in the wound

45 44 healing process occurs via the regulation of inflammatory response and stimulus of fibroblastic proliferation and extracellular matrix synthesis. Many biological effects have been attributed to this plant, and most of them relates to the Onco A. So far, studies have presented various properties of Onco A, such as antiinflammatory, antiplatelet, antioxidant and anti-carcinogenic as described in Table 1. These properties will be better described below. 3. Biological proprieties of Auxemma oncocalyx and Oncocalyxone A 3.1 Anti-inflammatory and analgesic Although widely used by the population as an anti-inflammatory and analgesic drug, few scientific reports exist testing the action of A. oncocalyx for these purposes. The quinones present in the fraction of A. oncocalyx, which contains 80% of Onco A (Pessoa et al., 1993), are possibly responsible for the analgesic and anti-inflammatory activity. The reduction of induced paw edema and inhibition of induced abdominal contractions in mice was observed in a dose dependent-manner (1 and 5 mg/kg body) of QF, indicating an action on the inflammatory process, possibly due to the blockade of prostaglandin synthesis (Ferreira et al., 2004). In the same experiment, the analgesic ability of the QF was evaluated by an induction of acetic acid in mice and through the use of the formalin test, which is considered as a good model for chronic pain (Dubuisson and Dennis, 1977). It was observed that the acetic acid produced a painful reaction with an acute inflammation in the peritoneal area. This study showed that, when these animals were treated with the QF of A. oncocalyx, there was a dose-dependent inhibition of

46 45 abdominal contractions induced by acetic acid, and a positive response to formalin, thus, showing the analgesic properties of the QF of A. oncocalyx. 3.2 Antiplatelet and antioxidant The antiplatelet effect of Onco A has been previously described (Ferreira et al., 2008, 1999). Ferreira et al. (Ferreira et al., 2008) tested the effect of Onco A in human platelet cells, and showed that there was a reversal inhibitory effect concentrationdependent. According to these authors, Onco A inhibits ATP liberation, and increase cgmp levels without affecting camp and nitric oxide (NO) levels, causing the inhibition of platelet aggregation. Onco A inhibited induced-aggregation probably by interfering with a similar step of platelet activation (Haslam et al., 1999). However, Onco A had no effect in NO production in human platelets, suggesting that the increase in cgmp levels observed in this study was not dependent on a NO mechanism. This information suggests that Onco A might by acting in two ways, downstream of the activation of soluble guanylate cyclase (sgc) or, in a similar way of NO-independent activators of sgc, which act by a synergistic mechanism that combine an increased production and reduced degradation of cgmp (Ferreira et al., 2008). Another reported action of Onco A, although with fewer studies, is its antioxidant activity. Recently, interest in antioxidants action in biological systems has grown steadily, possibly because it is associated with preventing tissue damage and release of free radicals (Saeidnia and Abdollahi, 2013). In general, antioxidants are substances that prevent deleterious damage from oxidation by inhibiting lipid peroxidation, or by sequestering free radicals and chelating metal ions (Ferreira et al., 2003). Toxicological studies have shown that synthetic antioxidants are capable of causing harmful effects in animals and humans (Bouayed and Bohn, 2010). Thus, this

47 46 indicates the importance of studying the use of natural antioxidants, such as Onco A, in biological systems. The QF hepatotoxicity in rats was evaluated by induction with Carbon tetrachloride (CCl4). CCl4 is known to induce intoxication through the production of free radicals and lipid peroxidation. Mice treated with the QF showed a higher hepatoprotective activity, possibly because of its antioxidant activity (Ferreira et al., 2003). Onco A caused an inhibition of the cytochrome P-450 activity. Moreover, it was able to stop the lipid peroxidation process, stabilized the hepatocellular membrane, and improve protein synthesis (Ferreira et al., 2003). From all these data, Ferreira et al. (Ferreira et al., 2008) suggested that Onco A could be a promising component for the development of anti-thrombotic drugs. 3.3 Toxicity Several authors reported the toxic effect of A. oncocalyx and Onco A. The effect of different concentrations (1 100 µg/ml) of the quinone fraction of A. oncocalyx (containing 80% of Onco A) on sea urchin eggs demonstrated that QF was capable of inhibiting the cleavage of these eggs in a concentration-dependent manner. The beginning of the destruction of the embryos started at the blastocyst stage with a concentration of 10 µg/ml, and there was a total destruction of the embryos (100%) with a concentration of 30 µg/ml (Costa-Lotufo et al., 2002b). In another study, the cytotoxicity of Onco A and other compounds in CEM leukemia cells and SW1573 lung tumor cells using concentrations between 1 and 18 µg/ml was verified, demonstrating that all the compounds caused cell death and inhibition of cell growth at concentration above 5 µg/ml in CEM cells. DNA damage of CEM cells was seen at concentrations of 5 µg/ml for all four compounds, and a significant deleterious effect on DNA was observed as from

48 47 a concentration of 2 mg/ml of Onco A (Pessoa et al., 2004). Another study evaluated the effect of different substances, among them Onco A and Onco C, in different concentrations (0.4; 0.8; 1.6; 3.1; 6.2; 12.5 e 25 µg/ml) on human cells lines (CEM leukemia, SW1573 lung tumor and CCD922 normal skin fibroblasts). This study showed that both of them produced cytotoxicity with mean half maximal inhibitory concentration (IC50) values of 0.8 2, 7 8 and mg/ml against CEM, SW1573 and CCD922 respectively (Pessoa et al., 2000). Leyva et al. (Leyva et al., 2000) showed that oncocalyxones A and C, both isolated from A. oncocalyx, were also cytotoxic to multidrug resistant lung tumor cell lines (SW 1573, SW1573-S1, SW R160), which were moderately or even highly resistant to the conventional anticancer drugs doxorubicin (DXR) and mitoxantrone. The cytotoxicity associated with these compounds can be attributed to redox cycling and subsequent development of oxidative stress (Monks and Lau, 1992). Thus, the cellular damage can occur by DNA alkylation (Bolton et al., 2000). Consequently, quinones have a high toxicity related to their antimitotic properties. Pessoa et al. (Pessoa et al., 2003) showed that the Onco A at the concentration of 0.5 g/ml was similar to 0.01 µg/ml DXR with regard to cytotoxicity in lymphocytes. Lima (Lima, 2008) studied the effect of an aqueous extract of the leaves of A. oncocalyx on the growth of bacterial culture. The study showed that this extract inhibited the growth of gram-positive microorganisms, such as Bacillus subtilis and Staphylococcus aureus. This antibacterial effect showed another toxic capacity of the A. oncocalyx (Lima, 2008). 3.4 Anticancer Several studies have reported the antitumoral activity of A. oncocalyx fraction and Onco A. Moraes et al. (Moraes et al., 1997) was the first one to report the antitumoral

49 48 activity of the hidroalcoholic extract of A. oncocalyx. The study evaluated the anticancerigenous effect of the extracts of 72 samples of plant species from northeastern Brazil. Among many of the studied plants, A. oncocalyx showed an inhibitory activity against Walker malignant tumor cells. Other studies compared the cytotoxicity of Onco A with two conventional anticancer agents, DXR and mitoxantrone, in a panel of human tumor cell lines. They found that the IC50 was between and µg/ml depending on the cultured cell line, and when multidrug resistant cell type were tested, Onco A showed a very high potency when compared with DXR and Mitoxantrone (Leyva et al., 2000). Pessoa et al. (Pessoa et al., 2000) showed that Onco A had an antitumoral activity at a concentration between µg/ml in leukemia cells. The antitumoral activity was verified as the ability of Onco A to inhibit tumor cell line proliferation in the MTT [3- (4-5 - dimethylthiazol-2 -yl)-2.5-diphenyl-tetrazolium bromide] assay and this cytotoxicity was related to the induction of DNA damage and the inhibition of DNA synthesis. Finally, these authors suggested that this compound had moderate anticancer potential. There are several methods for testing genotoxic and cytotoxic potential. The cytogenetic analysis represents an ideal tool to determine the DNA damage induced by interaction of cells with exogenous substances. DNA damage can induce chromosomal aberrations that can be used as mutagenic markers (Bahia et al., 1999). Most anticancer compounds act at lower concentrations i.e., 1 µg/ml or 1 µm, depending on the cultured cell line (Pessoa et al., 2000). Onco A can act between 0.8 and 18 µg/ml (Leyva et al., 2000; Pessoa et al., 2004, 2000). However, in cytotoxicity level, derivatives from A. oncocalyx fraction can be less cytotoxic and less reactive against

50 49 leukemia cell DNA (Pessoa et al., 2004) than DRX, which is a widely used drug in cancer treatment (Minotti et al., 2004). To try to explain the effect of Onco A on cell growth, Pessoa et al. 15 evaluated this effect in different phases of lymphocyte cell division (G1, G1/S and S). Onco A showed similar cytotoxic results in G, G1/S and S phases when compared with DXR, but only DXR showed genotoxicity. Genotoxicity can cause the occurrence of DNA alterations leading to the possible formation of other tumors. The effect of Onco A was seen in the DNA synthesis, in the transition G1/S. These results suggest that Onco A possible interfere in the mechanisms involved in cell division and in the formation of the spindle (Pessoa et al., 2003). Many drugs used in cancer chemotherapy, in addition to having toxicity against tumor cells, exhibit genotoxic, carcinogenic and teratogenic effects on normal cells, showing a low specificity of these drugs against tumor tissue resulting in undesirable effects of the treatments. For example, recent studies reveal that DXR induced ovarian toxicity, which is observed by the reducing of the ovulation rate, together with a reduction in the size of the ovary (Bar-Joseph et al., 2010; Ben-Aharon et al., 2010; Oktem and Oktay, 2007). It its known that DXR elicits apoptosis by various mechanisms in a variety of cells. It can be accumulated in both nucleus and mitochondria and induce chromosomal obliteration by inhibiting topoisomerase-ii. DXR can also interfere with mitochondrial function and initiate an intrinsic pathway of apoptosis via the mitochondria by reducing the mitochondrial membrane potential (MMP) and releasing cytochrome C (Bar-Joseph et al., 2010) on cytoplasmic space. A oncocalyx and Onco A can be acting in a similar pathway of DXR, but without causing genotoxicity (Pessoa et al., 2003), which may lead to a more effective anticancer drug.

51 50 Barreto et al. (Barreto et al., 2013) described a new magnetic nano-system for cancer therapy (MO-20), which facilitates the release of drugs at specific sites. This system uses Onco A as a possible anticancer drug. The results showed potential future applications of this technology (MO-20) with Onco A for cancer treatments. 4. Final Considerations There are several properties of A. oncocalyx and Onco A, like anti-inflammatory, analgesic, antiplatelet, antioxidant, cytotoxic and antitumor. It is important to emphasize that Onco A has a cytotoxic effect on cancer cells in vitro without causing genotoxicity. However, a study showed that Onco A caused embryo destruction and inhibition of proliferation of tumor cells. Thus, further studies are needed to better understand the mechanisms of A. oncocalyx and Onco A, especially in the field of anticancer activity and toxic effect on organs and cells. 5. Conflicts of Interest We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. 6. Bibliography Araújo, L.U., Grabe-guimarães, A., Furtado, C.V., Martins, C., Silva-Barcellos, M., Profile of Wound Healing induced by allantoin. Acta cirúrgica Bras. 25,

52 Bahia, M.O., Estefhane, B., Burbano, R.R., Amorim, M.I.M., Dubeauo, H., Genotoxic effects of mercury on in vitro cultures of human cells. An. Acad Bras. Cienc 71, Bar-Joseph, H., Ben-Aharon, I., Rizel, S., Stemmer, S.M., Tzabari, M., Shalgi, R., Doxorubicin-induced apoptosis in germinal vesicle (GV) oocytes. Reprod. Toxicol. 30, Barreto, A.C.H., Santiago, V.R., Freire, R.M., Mazzetto, S.E., Denardin, J.C., Mele, G., Cavalcante, I.M., Ribeiro, M.E.N.P., Ricardo, N.M.P.S., Gonçalves, T., Carbone, L., Lemos, T.L.G., Pessoa, O.D.L., Fechine, P.B.A., Magnetic nanosystem for cancer therapy using oncocalyxone A, an antitomour secondary metabolite isolated from a Brazilian plant. Int. J. Mol. Sci. 14, Ben-Aharon, I., Bar-Joseph, H., Tzarfaty, G., Kuchinsky, L., Rizel, S., Stemmer, S.M., Shalgi, R., Doxorubicin-induced ovarian toxicity. Reprod. Biol. Endocrinol. 8, 20. Bolton, J.L., Trush, M.A., Penning, T.M., Dryhurst, G., Monks, T.J., Role of Quinones in Toxicology. Chem. Res. Toxicol. 13, Bouayed, J., Bohn, T., Exogenous Antioxidants Double-Edged Swords in Cellular Redox State: Health Beneficial Effects at Physiologic Doses versus Deleterious Effects at High Doses. Oxid. Med. Cell. Longev. 3, Braga, R., Plantas do Nordeste, especialmente do Ceará, 3rd ed. Mossoró.

53 52 Costa-Lotufo, L.V., Ferreira, M.A.D., Lemos, T.L.G., Pessoa, O.D.L., Viana, G.S.B., Cunha, G.M.., Toxicity to sea urchin egg development of the quinone fraction obtained from Auxemma oncocalyx. Brazilian J. Med. Biol. Res. 35, da Costa, G.M., Lemos, T.L.G., Pessoa, D.L., Monte, F.J.Q., Braz-filho, R., Glaziovianol, a New Terpenoid Hydroquinone from Auxemma glazioviana. J. Nat. Prod. 62, Dettrakul, S., Surerum, S., Rajviroongit, S., Kittakoop, P., Biomimetic Transformation and Biological Activities of Globiferin, a Terpenoid Benzoquinone from Cordia globifera. J. Nat. Prod. 72, Dewick, P.M., Medicinal Natural Products A Biosynthetic Approach. Dubuisson, D., Dennis, S.G., The formalin test: A quantitative study of the analgesic effects of morphine, meperidine, and brain stem stimulation in rats and cats. Pain 4, Ferreira, M.A.D., do Nascimento, N.R.F., de Sousa, C.M., Pessoa, O.D.L., de Lemos, T.L.G., Ventura, J.S., Schattner, M., Chudzinski-Tavassi, A.M., Oncocalyxone A inhibits human platelet aggregation by increasing cgmp and by binding to GP Ib-alpha glycoprotein. Br. J. Pharmacol. 154, Ferreira, M.A.D., Nunes, O.D.R.H., Fontenele, J.B., Pessoa, O.D.L., Lemos, T.L.G., Viana, G.S.., Analgesic and anti-inflammatory activities of a fraction rich in oncocalyxone A isolated from Auxemma oncocalyx. Phytomedicine 11,

54 53 Ferreira, M.A.D., Nunes, O.D.R.H., Fujimura, A.H.Y., Pessoa, O.D.L., Lemos, T.L.G., Viana, G.S.B., Inhibition of platelet activation by quinones isolated from Auxemma oncocalyx Taub. Res Commun Mol Pathol Pharmacol 106, Ferreira, M.A.D., Nunes, O.D.R.H., Leal, L.K.A.M., Pessoa, O.D.L., de Lemos, T.L.G., Viana, G.S.D.B., Antioxidant effects in the quinone fraction from Auxemma oncocalyx TAUB. Biol. Pharm. Bull. 26, Gossell-Williams, M., Simon, O.R., West, M.E., The Past and Present Use of Plants for Medicines. West Indian Med J 55, Haslam, R.J., Dickinson, N.T., Jang, E.K., Cyclic nucleotides and phosphodiesterases in platelets. Thromb Haemost 82, Leyva, A., Pessoa, O., Boogaerdt, F., Sokaroski, R., Lemos, T.G., Wetmore, L.A., Huruta, R.R., Moraes, M.O., Oncocalyxones A and C, 1,4-Antracenediones from Auxemma oncocalyx: Comparison with Anticancer 1,9-Anthracenediones. Anticancer Res. 20, Lima, D.A., Plantas da caatinga. Lima, P.M., Avaliação da atividade de extratos de folhas de Momordica charantia, Auxemma oncocalyx e Ziziphus joazeiro sobre bactérias e lavras de Culex quinquefasciatus. Lino, C.S., Pessoa, O.D.L., Lemos, T.L.C., Viana, G.S.B., Estudo da atividade analgésica e antiedematogênica do extrato hidroalcoólico de Auxemma oncocalyx e oncocalyxona A, in: Simpósio De Plantas Medicinais Do Brasil. p. 95. Maia, G.M., Caatinga: árvores e arbustos e suas utilidades. D Z 413.

55 54 Marques, W.B., dos Santos, H.S., Pessoa, O.D.L., Braz-Filho, R., Lemos, T.L.G., Anthracene derivatives from Auxemma oncocalyx. Phytochemistry 55, Minotti, G., Menna, P., Salvatorelli, E., Cairo, G., Gianni, L., Anthracyclines : Molecular Advances and Pharmacologic Developments in Antitumor Activity and Cardiotoxicity. Pharmacol. Rev. 56, Monks, T.J., Lau, S.S., Toxicology of quinone-thioethers. Crit. Rev. Toxicol. 22, Moraes, M.O., Fonteles, M.C., Moraes, M.E.A., Machado, M.I.L., Matos, F.J.A., Screening for anticancer activity of plants from the Northeast of Brazil. Fitoterapia 68, Nozella, E.F., Valor nutricional de espécies arbóreo-arbustivas nativas da caatinga e utilização de tratamentos físico-químicos para redução do teor de taninos. Tese (Doutorado Programa Pós-graduação em Ciéncias. Área Conc. Energ. Nucl. na Agric. Cent. Energ. Nucl. na Agric. da Univ. São Paulo. Oktem, O., Oktay, K., Quantitative assessment of the impact of chemotherapy on ovarian follicle reserve and stromal function. Cancer 110, Pessoa, C., Lemos, T.L.G., Pessoa, O.D.L., Moraes, M.O., Costa-lotufo, L.V., Leyva, A., Cytotoxicity of derivatives of oncocalyxone A from Auxemma oncocalyx Taub. ARKIVOC vi, Pessoa, C., Silveira, E.R., Lemos, T.L.G., Wetmore, L.A., Moraes, M.O., Leyva, A., Antiproliferative Effects of Compounds Derived from Plants of Northeast Brazil. Phyther. Res. 14,

56 55 Pessoa, C., Vieira, F.M.A.C., Lemos, T.G., Moraes, M.O., Lima, P.D.L., Rabenhorst, S.H.B., Leyva, A., Burbano, R.R., Oncocalyxone A from Auxemma oncocalyx lacks genotoxic activity in phytohemagglutinin-stimulated lymphocytes. Teratog. Carcinog. Mutagen. Suppl 1, Pessoa, O.D., Lemos, T.L.G., Allantoin and fatty acid composition in Auxemma oncocalyx. Rev. Bras. Farmácia 78, Pessoa, O.D., Contribuição ao conhecimento químico de plantas nativas do nordeste: Auxemma oncocalyx Taub. Pessoa, O.D., Lemos, T.L.G., Carvalho, M.G., Braz-Filho, R., Cordiachromes from Auxemma oncocalyx. Phytochemistry 40, Pessoa, O.D.L., Lemos, T.L.G., Silveira, E.R., Braz-Filho, R., Novel cordiachromes isolated from Auxemma oncocalyx. Nat. Prod. Res. 2, Qunaibi, E.A., Disi, A.M., Taha, M.O., Phenytoin enhances collagenization in excision wounds and tensile strength in incision wounds. Pharmazie 64, Saeidnia, S., Abdollahi, M., Toxicological and pharmacological concerns on oxidative stress and related diseases. Toxicol. Appl. Pharmacol. 273, Schmitt, A.C., Almeida, A.B.P.., Silveira, T.A., Iwakura, C.T., Mendes, K.F., Silva, M.., Avaliação da atividade antimicrobiana in vitro da planta Bryophyllum pinnatum Kurz ( Folha-da-fortuna ) colhida em Va rzea Grande, Mato Grosso/Brazil. Acta Sci. Vet. 31,

57 56 Sousa, C.M., Nascimento, N.R.F., Lemos, T.L.G., Pessoa, O.D.L., Ferreira, M.A.D., Avaliação da Atividade Antiagregante Plaquetária da oncocalixona A (Onco a) e vasoconstritora da Fração quinona da Auxemma oncocalyx, in: Reunião Anual Da Sociedade Brasileira De Química. p. 24. Tigre, C.B., Silvicultura para as matas xerófilas: defesa dos recursos naturais renováveis, DNOCS. Fortale.

58 57 Table 1. Main results of the use of A. oncocalyx and Onco A in several species and cell types Substance Researched form Tested species A. oncocalyx In vivo Rat Animal A. oncocalyx In vitro Human Cell type Main result Reference Walker malignant tumor cells A. oncocalyx In vitro Rat Hepatocytes analgesic and antiinflammatory activity Anti-tumor activity Decrease in serum GOT and GPT levels (hepatoprotective effect) and Inhibition of platelet activation Onco A In vitro Human Tumor cells Cytotoxic activity Onco A In vitro Human CEM leukemia, SW1573 lung tumour and CCD922 normal skin fibroblasts. Onco A In vivo Rat Brain A. oncocalyx In vivo Sea urchin Eggs Onco A In vitro Human Platelet cells Onco A In vitro Human lymphocytes A. oncocalyx In vivo Mice and rats Animal A. oncocalyx In vivo Mice Animal Antiproliferative activity Inhibiting lipoperoxidation Concentrationdependent inhibition of sea urchin eggs development Inhibits human platelet aggregation Cytotoxic but not genotoxic activity Antioxidant activity Antiinflammatory and antinociceptive activity Lino et al., 1996 Moraes et al., 1997 Ferreira et al., 1999 Leyva et al., 2000 Pessoa et al., 2000 Ferreira et al., 2001 Costa-Lotufo et al., 2002 Sousa et al., 2002 Pessoa et al., 2003 Ferreira et al., 2003 Ferreira et al., 2004 Onco A In vitro Human Leukaemia cells Cytotoxicity Pessoa et al., 2004

59 58 A. oncocalyx In vitro Bacteria Bacillus subtilis, Enterobacter aerogenes, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Salmonella cholerasuis and Staphylococcus aureus Onco A In vitro Human Platelet cells Inhibition of gram-positive bacteria Inhibits human platelet aggregation by increasing cgmp and by binding to GP Ibα glycoprotein Lima., 2008 Ferreira et al., 2008

60 59 7 FRAÇÃO DE AUXEMMA ONCOCALYX E ONCOCALYXONA A AFETAM A SOBREVIVÊNCIA IN VITRO E O DESENVOLVIMENTO DE FOLÍCULOS PRÉ-ANTRAIS CAPRINOS INCLUSOS EM TECIDO CORTICAL OVARIANO Fraction of Auxemma oncocalyx and Oncocalyxone A affects the in vitro survival and development of caprine preantral follicles enclosed in ovarian cortical tissue Periódico: Forschende Komplementärmedizin (aceito) (ISSN: ) Qualis B2

61 60 RESUMO Introdução: A. oncocalyx e seu componente principal (Onco A) possuem fortes ações antioxidantes e antitumorais, entretanto, não existem estudos a respeito da ação de ambas as substâncias durante a foliculogênese. Materiais e Métodos: Fragmentos de tecido ovariano caprino foram fixados (controle fresco não cutivado) ou cultivados por 1 ou 7 dias em α-mem+ isolado (controle cultivado) ou supementado com DMSO (0.5% v/v), BMP-15 (100 ng/ml), doxorrubicina (DXR; 0.3 ug/ml) ou diferentes concentrações de A. oncocalyx (1.2, 12 ou 34 µg/ml) ou Onco A (1, 10 ou 30 µg/ml). Foi avaliada a morfologia e crescimento folicular, apoptose (ensaio de TUNEL), proliferação celular (AgNOR e PCNA). Resultados: A. oncocalyx e Onco A (de modo concentração-dependente) e DXR reduziram (P<0,05) a quantidade de folículos morfologicamente normais, sem efeito (P>005) sob o crescimento folicular. A. oncocalyx reduziu o percentual de folículos normais quando comparado ao grupo onco A (P<0,05). DXR, A. oncocalyx 1,2 e Onco A 1 aumentaram (P<0,05) o percentual de folículos marcados positivamente para TUNEL. DXR reduziu significativamente (P>0,05) o número de regiões organizadoras de nucléolos. Conclusão: A. oncocalyx e onco A afetaram o desenvolvimento folicular in vitro no modelo caprino de modo dose-dependente. Onco A (1 µg/ml) possuem menor efeito nocivo quando comparado a DXR na sobrevivência de folículos pré-antrais caprinos. Palavras-chave: Auxemma oncocalyx. Boraginaceae. Cultivo in vitro. Oncocalyxona A; Folliculogenesis. Tecido cortical.

62 61 Title: Fraction of Auxemma oncocalyx and Oncocalyxone A affects the in vitro survival and development of caprine preantral follicles enclosed in ovarian cortical tissue Short title: Effect of Auxemma oncocalyx and Oncocalyxone A on preantral follicles Leiva-Revilla J. 1, *, Lima L.F. 1, Castro S.V. 1, Campello C.C. 1, Araújo V.R. 1, Celestino J.J.H. 2, Pessoa O.D.L. 3, Silveira E.R. 3, Rodrigues A.P.R. 1, Figueiredo J.R. 1 1 Faculty of Veterinary Medicine, LAMOFOPA, PPGCV, Universidade Estadual do Ceará, Fortaleza-CE, Brazil. Av. Paranjana, Itaperi Fortaleza, CE Brasil. Telephone: (+55 85) Institute of Health Sciences, Universidade da Integração Internacional da Lusofonia Afro-Brasileira. Acarape-CE, Brazil. Rodovia CE 060 Km Acarape, CE Brasil. Telephone: (+55 85) Departamento de Química Orgânica e Inorgânica. Universidade Federal do Ceará, Centro de Ciências, Av. Mister Hull S/N Pici Fortaleza, CE - Brasil - Caixapostal: Telephone: (+55 85) * Corresponding author; Av. Paranjana, Itaperi Fortaleza, CE Brasil. Telephone: (+55 85) Fax: (+55 85) address: johileiva@gmail.com

63 62 ABSTRACT Background: Auxemma oncocalyx (A. oncocalyx) and its main component Oncocalyxone A (onco A), have a high level of antioxidant and anti-tumoral activity, but there are no studies on the action of both of these drugs regarding folliculogenesis. Materials and methods: Caprine ovarian tissue fragments were fixed (non-cultured control) or cultured for 1 or 7 days in α-mem + alone (cultured control) or supplemented with DMSO (20% v/v), BMP-15 (100 ng/ml), doxorrubicin (DXR; 0.3 g/ml) or different concentrations of A. oncocalyx (1.2, 12 or 34 µg/ml) or onco A (1, 10 or 30 µg/ml). We analyzed follicular morphology and growth, apoptosis (TUNEL assay), cell proliferation (AgNOR and PCNA) Results: A. oncocalyx and onco A (concentration-dependent manner) and DXR decreased (P<0.05) morphologically normal follicles, with no effect (P>005) over follicular growth. A. oncocalyx reduced (P<0.05) the percentage of normal follicles compared to the onco A., DXR, A. oncocalyx 1.2 and onco A 1 increased (P<0.05) the percentage of TUNEL positive follicles. DXR decreased (P<0.05) the number of nucleolar organizer regions. Conclusion: A. oncocalyx and onco A affected in vitro caprine folliculogenesis in a concentration-dependent manner. Onco A (1 µg/ml) has a less harmful effect than DXR on goat preantral follicle survival. Keywords: Auxemma oncocalyx; Boraginaceae; in vitro culture; Oncocalyxone A; Folliculogenesis; Cortical tissue.

64 63 1. Introduction Cancer is a target of research for the development or discovery of new forms of treatments [1]. Many drugs used in cancer chemotherapy, in addition to showing toxicity against tumor cells, exhibit genotoxic, carcinogenic and teratogenic effects on normal cells. The low specificity of these drugs against tumor tissue results in undesirable effects. Doxorubicin (DXR) is a widely used drug for cancer patients [2]. It induces ovarian toxicity by reducing the ovulation rate, along with a reduction in the size of the ovary and other side effects [2 4]. Plants are excellent sources of raw material when searching for new drugs. Moreover, plants have a long history of use in the treatment of cancer [5]. Over 60% of currently used anti-cancer agents are derived from natural sources, including plants, marine organisms and micro-organisms [6,7]. AuxemmA. oncocalyx (A. oncocalyx) is a common tree found in the state of Ceará in Northeast Brazil [8]. It has been widely used in folk medicine as an adjunctive treatment of injuries such as wounds and cuts [8,9]. Some studies have suggested that this plant has biological activities such as analgesic, anti-oxidant, anti-tumor and antiinflammatory effects [9 12]. Oncocalyxone A (onco A) has been isolated from the stem heartwood of the plant, which has a high antioxidant activity [9] and an antiproliferative effect in tumor cell cultures [13]. In other studies, onco A has been suggested as a possible anticancer compound since it has presented antitumor and cytotoxic activity in human leukemia cells, and other cell cancer lines, without causing genotoxicity [14]. Therefore, this compound may be presented as a possible therapeutic agent [15,16]. On the other hand, a study conducted with sea urchin embryos observed a fraction of onco A induced destruction of the

65 64 embryos at the same concentrations (1 to 30 µg/ml) which inhibited tumor cell proliferation, indicating that this compound could be very toxic [13]. However, the effect of the use of these substances with antitumoral potential on fertility and ovarian follicle function, for example, is still unknown. Toxicity can be evaluated both in vivo and in vitro. In vitro studies permit testing drug toxicity while avoiding the ethical concerns and restrictions of in vivo experiments. Within the criteria required to safely study the effects of phytotherapeutics on reproductive toxicity, one way to evaluate this parameter is by the utilization of in vitro preantral follicle culture. This method enables the testing of the beneficial or toxic effects of drugs on ovarian follicles in vitro before their use in experiments involving live humans or animals [17]. Thus, the aim of this study was to evaluate the effect of the concentration-response curve of the A. oncocalyx and onco A and determine the minimum toxic concentration on the survival, growth and development of goat preantral follicles in vitro cultured (Experiment 1), and to evaluate the effects of the minimum toxic concentration of A. oncocalyx and onco a on apoptosis and proliferation of goat pre-antral follicles in vitro cultured (Experiment 2). 2. Materials and Methods 2.1. Source of ovaries Ovaries (n = 10: Experiment 1; n = 6: Experiment 2) from eight adult mixed breed goats were obtained at a local slaughterhouse. The ovaries were washed in 70% alcohol for approximately 10 s then twice in minimal essential medium (MEM) supplemented with 100 µg/ml penicillin and 100 µg/ml streptomycin plus HEPES (MEM-HEPES). The ovaries were transported to the laboratory in thermo flasks at 4 ºC within 1 h [18].

66 Isolation of onco A from A. oncocalyx Auxemma oncocalyx was collected in August 2012 at Acarape, state of Ceará, which is located in Northeast Brazil. The plant was identified by Dr. Maria Iracema B. Loiola of the Department of Biology of the Universidade Federal do Ceará. A voucher specimen (No ) has been deposited in the Herbarium Prisco Bezerra (EAC), Universidade Federal do Ceará. The air-dried and powdered heartwood (2.5 kg) of A. oncocalyx was extracted with EtOH (2 x each) at room temperature. The combined extracts were evaporated under reduced pressure to yield the crude extract (100 g), which was fractionated over silica gel and eluted with CH2Cl2, CH2Cl2/ EtOAc (7:3 and 1:1), EtOAc, EtOAc/ MeOH (9.5:0,5 and 1:1) to yield after solvent evaporation the correspondent fractions: 6.60, 5.99, 8.01, 3.36, and g, respectively. The fraction EtOAc/MeOH 9.5:0.5 (50.0 g) was subjected to a silica gel (200 g) chromatography column using CH2Cl2/ EtOAc 1:1 (200 ml), 7:3 (500 ml), EtOAc (1000 ml) and EtOAc/ MeOH 9.5:0.5 (400 ml) to afford 60 fractions of approximately 30 ml. After comparative analysis by TLC, these fractions were pooled into 3 main fractions: F1(1-20; 8.2 g), F2(21-54; 25.2 g) and F3(55-60; 16.7 g). F2(21-54; 25.2 g) was subjected twice to chromatography over silica gel eluted with CH2Cl2/EtOAc 1:1, 7:3, EtOAc, EtOAc/MeOH 9.5:0.5 and MeOH. Fractions CH2Cl2/EtOAc 7:3 and EtOAc furnished a dark solid which was purified by addition of acetone followed by filtration. This material (5.5 g), a deep red powder, mp o was identified as rel-8a-hydroxy-5-hydroxymethyl-2-methoxy-8ab-methyl-7,8,8a,9- tetrahydro-1,4-anthracenedione), named oncocalyxone A, as previously described by Pessoa et al., 1993.

67 66 1 H NMR (200 MHz, DMSO-d6): 6.00 (s, H-3), 6.03 (br d, H-6), 2.52 (br d, J 17.2 Hz, H- 7eq), 2.60 (dd, J 17.2, 3.9 Hz, H-7ax), 3.57 (br s, H-8), 2.90 (d, J 18.4 Hz, H-9ax), 2.34 (d, J 18.4 Hz, H-9eq), 6.50 (s, H-10), 4.16 (br s, 2H-11), 0.74 (s, 3H-12), 3.78 (s, OMe). 13 C NMR (50.3 MHz, DMSO-d6): (C-1), (C-2), (C-3), (C-4), (C-4a), (C-5), (C-6), 32.0 (C-7), 70.1 (C-8), 38.9 (C-8a), 29.2 (C-9), (C-9a), (C-10), (C-10a), 61.6 (C-11), 21.3 (C-12), 56.7 (OMe) In vitro culture of goat ovarian tissue Ovarian tissue samples from each ovarian pair were cut into fragments approximately 3 x 3 x 1 mm using a needle and scalpel under sterile conditions. One fragment (non-cultured control) was immediately fixed in Carnoy s solution for 12 h for histological studies. The other fragments of ovarian cortex were transferred to 24-well culture dishes containing 1 ml of culture medium. In vitro culture was performed at 39 C in 5% CO2 in a humidified incubator and all media were incubated for 2 h prior to use. The basic culture medium (cultured control) consisted of α-mem (ph ) supplemented with 10 ng/ml of insulin, 5.5 µg/ml transferrin, 5 ng/ml selenium, 2 mm glutamine, 2 mm hipoxanthine and 1.25 mg/ml bovine serum albumin (BSA) and was called α-mem +. The culture medium was replaced every 2 days with fresh medium. All chemicals used in the present study were purchased from Sigma Chemical Co. (St. Louis, MO, USA) unless otherwise indicated Experimental design For Experiment 1, the fragments were randomly divided into 11 groups according to the following treatments: non-cultured control, α-mem + alone (cultured control) or supplemented with: human recombinant bone morphogenetic protein 15 (BMP-15) at 100

68 67 ng/ml (R&D Systems; Minneapolis, MN, USA); Dimethyl sulfoxide (DMSO) at 20% v/v; Doxorubicin (DXR) at 0.3 g/ml; Auxemma oncocalyx (A. oncocalyx) at 1.2, 12 or 34 g/ml; or Oncocalixone A (onco A) at 1, 10 or 30 g/ml. The fraction of A. oncocalyx contains 80% of onco A [12], therefore in each concentration of A. oncocalyx there was an equal proportion of onco A. A. oncocalyx and onco A were diluted with DMSO as a vehicle. Each treatment was repeated five times using the ovaries of five different animals. The BMP-15 concentration was chosen based on previous studies conducted in our laboratory [19]. Based on the results from Experiment 1, immunohistochemistry and cell proliferation analysis were performed in Experiment 2. The ovarian fragments were randomly divided into 7 groups according to the following treatments: non-cultured control, α-mem + alone (cultured control) or supplemented with BMP-15 (100 ng/ml), DMSO (20% v/v), DXR (0.3 g/ml), A. oncocalyx (1.2 g/ml) or onco A (1 g/ml). Each treatment was repeated three times Morphological analysis and assessment of in vitro follicular growth To evaluate the morphology of caprine follicles in the non-cultured control or after one or seven days of culture, the tissue fragments were fixated and dehydrated in a graded series of ethanol, clarified with xylene and embedded in paraffin wax. For each piece of ovarian cortex, 7 µm sections were mounted on slides, stained with periodic acid Schiff and hematoxylin, and examined by light microscopy at 400 magnification (Nikon Eclipse E200). The follicles were classified as primordial (one layer of flattened granulosa cells around the oocyte) and growing, i.e. transitional (one layer of flattened granulosa cells and at least 3 cuboidal granulosa cells around the oocyte), primary (a complete layer of

69 68 cuboidal granulosa cells around the oocyte) or secondary (oocyte surrounded by two or more layers of cuboidal granulosa cells). Degenerated follicles were defined as those with a retracted oocyte pyknotic nucleus and/or were surrounded by disorganized granulosa cells which were detached from the basement membrane. To evaluate follicular activation and growth, only intact follicles with a visible oocyte nucleus were recorded and the proportion of primordial and growing follicles were calculated on day 0 (noncultured control) and after one or seven days of culture in all tested treatments. Follicle and oocyte diameter were recorded. Two perpendicular diameters were recorded from edge to edge, of the follicle or oocyte, and the average of these two values was reported as follicle and oocyte diameter, respectively. Each follicle was examined in every section in which it appeared and matched with the same follicle on adjacent sections to avoid double counting, thus ensuring that each follicle was only counted once, regardless of its size Assessment of apoptosis by TUNEL assay For determination of DNA fragmentation, a terminal deoxynucleotidyl transferase-mediated dutp biotin nick end labeling (TUNEL) in situ detection kit (R&D Systems, Minneapolis, MN, USA) was applied. The fragments were fixed in 4% paraformaldehyde buffered with PBS. Subsequently, the blocks were sectioned at a thickness of 5 µm following de-paraffinization and boiled for antigen retrieval in 0.01 M citric acid. The blockade of exogenous peroxidase and nonspecific blocking were performed in a humid chamber. The TUNEL kit was prepared following the guidelines given by the manufacturer. The incubation of TUNEL consisted of the addition of a TUNEL mixture for 1 h at 37 C (moist chamber) and, after washing, 50 ml Convert POD was added for 30 min at 37 C (moist chamber). The staining of the nucleus of apoptotic

70 69 cells appeared brown whereas normal cells were lighter in color. At least 30 follicles per treatment were evaluated Assessment of cell proliferation AgNOR silver staining To estimate the cell proliferation index AgNOR staining was performed to quantify the number of argyrophilic nucleolar organizer regions (NOR). For this purpose, ovarian tissue fixed in 4% paraformaldehyde solution was sectioned at 5 µm. After reduction with 1% potassium iodide, slides were stained with 50% silver nitrate solution in a colloid solution (2:1) in a darkroom and counterstained with 0.1% safranin. For quantification, the follicles were visualized under a light microscope (1000X magnification; Nikon Eclipse E200) and the NOR of all the nuclei of all the visible granulosa cells were counted. In the non-cultured group and groups after 7 days of culture, granulosa cells from 30 growing preantral follicles were evaluated per group Proliferating cell nuclear antigen (PCNA) Ovarian fragments were fixed in 4% paraformaldehyde and 5 µm paraffin sections were mounted to microscope slides. Paraffin sections were heated at 65 C for 45 min. Following de-paraffinization, sections were rehydrated in a series of graded ethanol/water solutions then boiled in 0.01 M citric acid (ph 6.0) at C for 5 min followed by incubation in 3% hydrogen peroxide (H2O2) for 10 min. The tissues were blocked with avidin and biotin and incubated with a Rb Pab-PCNA ab 2426 (abcam) overnight at 4 C. After rinsing thoroughly with PBS, the sections were incubated with goat pab-rb IgG antibody (Biotin) for 30 min at room temperature. PCNA expression in sections was detected by the reaction of peroxidase with 3,39-diaminobenzidine tetrahydrochloride

71 70 (DAB) and analyzed using a light microscope (400X maginification, Nikon Eclipse E200). When at least one granullosa cell was marked in brown, it was considered as a positive PCNA follicle. At least 20 follicles per treatment were evaluated Statistical analyses Data were initially evaluated for homocedasticity and normal distribution of the residues by Bartlett s and Shapiro-Wilk tests, respectively. Confirmed both requirements underlying analysis of variance, the effects of medium, time and medium by time interaction were analyzed using PROC MIXED of SAS (2002), including repeated statement to account for autocorrelation between sequential measurements. The model was Yij=µ+Mi+Tj+(R*T)ij+eij, where Yij is the observation of the ith medium at the jth time of culture, µ is the overall mean, Ri is the ith medium, Tj is the jth time of culture, (R*T)ij is the medium by time interaction term and eij is the random residual effect. Comparisons amongst media or times were further analyzed by Student-Newman-Keuls test, being the results expressed as mean ± standard deviation. TUNEL and PCNA data were analyzed by chi-square test and the results were expressed as percentages. A probability of P<0.05 indicated a significant difference. 3. Results 3.1. Morphologically normal preantral follicles and follicle and oocyte diameter before and after in vitro culture A total of 3,150 preantral follicles were analyzed by classical histology. The percentage of morphologically normal preantral follicles in the non-cultured control treatment and after 1 or 7 days of in vitro culture is shown (Table 1). After 1 and 7 days

72 71 of culture there was a reduction (P<0.05) in the percentage of normal follicles in all treatments compared to the non-cultured control. When compared to α-mem +, the percentage of morphological normal follicles was higher (P<0.05) on days 1 and 7 in the BMP-15 treatment. However, the percentage of morphological normal follicles was similar (P>0.05) between the DMSO and α-mem + treatments. On the other hand, the treatments with DXR, A. oncocalyx and onco A at all concentrations were lower (P<0.05) than α-mem + on days 1 and 7. The A. oncocalyx 1.2 (day 1), onco A 1 (days 1 and 7) and onco A 10 (day 1) treatments showed a higher (P<0.05) percentage of morphologically normal follicles than DXR. On day 1, the treatments with A. oncocalyx 12 and 34, and on day 7, those with A. oncocalyx 12 and 34 and onco A 30 showed a lower (P<0.05) percentage of morphologically normal follicles compared to the DXR treatment. Comparing the concentration of A. oncocalyx with its equivalent of onco A, there was a lower percentage of normal follicles in the A. oncocalyx treatments. Among the different concentrations of A. oncocalyx and onco A, it was observed that after 1 and 7 days of culture there was a concentration-dependent effect with a decrease in the percentage of normal follicles along with an increase in A. oncocalyx or onco A concentrations. Also, with the progression of the culture from day 1 to day 7, there was a reduction (P<0.05) in the percentage of normal follicles in all treatments. Finally, there was no difference (P>0.05) in follicle and oocyte diameter among treatments (data not shown) Activation of caprine primordial follicles after in vitro culture The percentages of preantral follicle activation in the non-cultured control and after 1 or 7 days of in vitro culture are shown (Table 2). After 7 days of culture, a lower (P<0.05) percentage of primordial follicles and an increase (P<0.05) in the percentage of growing follicles was observed in all treatments compared to the non-cultured control,

73 72 except the DMSO treatment. From day 1 to day 7, a significant reduction in the percentage of primordial follicles and a significant increase in the percentage of growing follicles were observed in all treatments. Overall, irrespective of culture period, the supplementation of α-mem + with DMSO, BMP-15, DXR, A. oncocalyx and onco A did not significantly affect either the percentage of primordial or growing follicles. 3.3 TUNEL assay The percentage of TUNEL positive follicles (TPF; Fig. 1) was similar (P>0.05) in the α-mem +, DMSO and BMP-15 treatments compared to the non-cultured control. In contrast, DXR, A. oncocalyx 1.2 and onco A 1 showed a higher (P<0.05) percentage of TPF compared to the non-cultured control, DMSO and BMP-15 treatments. Moreover, the addition of onco A 1 did not increase (P>0.05) the percentage of TPF compared to the α-mem + treatment Assessment of proliferation with AgNOR and PCNA The mean number of nucleolar organizer regions (NOR) per treatment is shown (Fig. 2). DXR was the only treatment that had a lower (P<0.05) number of NOR than the non-cultured control, α-mem +, BMP-15 and onco A 1 treatments. It is important to emphasize that BMP-15 was the only treatment that increased (P<0.05) the percentage of NOR compared to the α-mem + treatment. On the other hand, the PCNA test showed no statistical difference (P>0.05) among all treatments (Fig. 3).

74 73 4. Discussion The present study demonstrated for the first time the effect of A. oncocalyx and its isolated compound, onco A, on ovarian preantral folicles. After 7 days of culture, a concentration-dependent effect was observed of both A. oncocalyx and onco A, of which a higher concentration was related to a smaller percentage of morphologically normal follicles when compared to the α-mem + cultured control. However, both compounds did not affect either the percentage of primordial or growing follicles, showing that the effect of this drugs is not stage-specific, and they cause the degeneration of both categories equally, as it has been seen with other toxic compounds such as Areca catechu [20]. In a study testing different concentrations (1 to 100 µg/ml) of a quinone fraction of A. oncocalyx (containing 80% of onco A) in sea urchin eggs, it was found that the cleavage of eggs was inhibited in a concentration-dependent manner. The early destruction of embryos at the blastula stage occurred when a concentration of 10 µg/ml was used, and a total destruction (100%) of embryos occurred with a concentration of 30 µg/ml, associated with a rupture of the embryo membranes [21]. The cytotoxicity of onco A was also observed on human tumor cell lines [15,16,22] and normal skin fibroblasts [22] at concentrations varying from 0.4 to 25 µg/ml. In addition, onco A inhibited leukemia cell line CEM growth at concentrations greater than 2 µg/ml and showed a significant deleterious effect on DNA [15,16,22]. The cytotoxicity associated with these compounds can be attributed to redox cycling and subsequent development of oxidative stress [23]. Thus, cellular damage can occur by DNA alkylation [24]. Consequently, quinones might have a high toxicity related to their antimitotic properties [15]. In the present study, the fraction of A. oncocalyx had a higher toxicity than onco A on folliculogenesis. Several studies [14 16,21,22] have already shown in vitro

75 74 cytotoxic effects of the quinone fraction of A. oncocalyx, represented mainly by onco A. However, Ferreira et al. [9] showed an antioxidant effect of the fraction of A. oncocalyx on mice in vivo. It is believed that this effect can be due to prevention of the process of lipid peroxidation and enhancement of protein synthesis [9]. Moreover, the fraction of A. oncocalyx contains 80% of onco A [12], leaving the other 20% of other substances that can be more toxic than onco A alone. Pessoa et al. [25] listed some compounds of this fraction, such as cordiachromes, allantoin, sitosterol, 3b-O-b-D-glucopyranosylsitosterol and acetyl derivative. It is known that the cordiachromes are an unusual class of meroterpenoids that have been isolated from a quinone [26]. Cordiachromes were also isolated from the trunk heartwood of another Northeastern Brazilian tree (Auxemma glazioviana; [27]). The wood of this tree, as is that of A. oncocalyx, is resistant to fungi and termite attacks, and thus is often used for civil construction [25,27]. In folk medicine, cuts and wounds were treated with the trunk bark [8,25]. It has been suggested that this property can be related to the cordiachromes present in the quinone fraction [26]. These properties can influence the toxicity of the plant and may explain the difference between the fraction of A. oncocalyx and onco A. The results showed that onco A was less harmful than DXR on follicle survival as well as the proliferation of granulosa cells. It is known that onco A and DXR both have anti-carcinogenic effects. The fraction of A. oncocalyx and onco A in different lineages of cells, especially in tumor cell lines [14,16,22], showed a similar effect when compared to DXR. It was shown that both DXR and onco A present cytotoxicity in the G, G1/S and S phases of cell division, with the only difference being that DXR presents genotoxicity in these cells [14]. In this study, DXR caused a decrease in both the percentage of morphologically normal follicles and the proliferation of granulosa cells and also increased follicular DNA fragmentation. Likewise, the TUNEL assay showed an increase

76 75 in apoptotic cells in the groups treated with the A. oncocalyx 1.2 and onco A 1 treatments when compared to the non-cultured control. Only the onco A 1 treatment was able to maintain a percentage of TUNEL positive follicles similar to the α-mem + cultured control. A study conducted by Pessoa et al. [14] showed that onco A at a concentration of 0.5 g/ml had a similar effect as 0.1 mg/ml DXR with regard to cytotoxicity in lymphocytes. Many drugs used in cancer chemotherapy, in addition to having toxicity against tumor cells, exhibit genotoxic, carcinogenic and teratogenic effects on normal cells, showing a low specificity of these drugs against tumor tissue, resulting in undesirable side effects. Nevertheless, DXR is a widely used drug in cancer treatment [28]. Recent studies revealed that DXR induced ovarian toxicity, which was observed by a reduction in ovulation rate and the size of the ovary [2 4]. DXR elicits apoptosis by various mechanisms in a variety of cells. It can be accumulated in both the nucleus and mitochondria and induces chromosomal destruction by inhibiting topoisomerase-ii [29]. DXR can also interfere with mitochondrial function and initiate an intrinsic pathway of apoptosis by reducing the mitochondrial membrane potential and releasing cytochrome C [3]. It is important to highlight that the DMSO treatment (i.e., the vehicle used for the dilution of DXR, A. oncocalyx and onco A) was similar to the α-mem + cultured control. This result shows that DMSO by itself was not responsible for the negative effect of the tested drugs. On the other hand, in this study BMP-15 served as a positive control for its ability to maintain follicular viability, increase granulosa cell proliferation and prevent DNA fragmentation. Celestino et al. [19] showed that BMP-15 (100 ng/ml) maintained the integrity and promoted the growth of caprine preantral follicles cultured in vitro for 7 days. It is known that BMP-15, along with the other BMPs (2 and 5), acts in granulosa

77 76 cells, promoting follicle survival through maintenance of cell proliferation and prevention of precocious luteinization and/or atresia [30]. In conclusion, A. oncocalyx and onco A affected caprine folliculogenesis in vitro in a concentration-dependent manner. In addition, the less harmful effect of onco A (1 µg/ml) than DXR on goat preantral follicle survival may encourage future studies involving the use of this drug for cancer treatment in women. 5. Conflict of interest We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome. 6. Acknowledgments This research was financially supported by CNPq, CAPES and FUNCAP. The authors thank Denise Damasceno Guerreiro, Naiza de Sá Arcangela, Renato Felix da Silva, Francisco Léo Nascimento de Aguiar and Keith Haag for assistance with this study.

78 77

79 78

80 79 Table 1. Percentage (mean ± SEM) of morphologically normal caprine preantral follicles before (non-cultured control) and after in vitro culture for 1 or 7 days in α-mem + alone or α-mem + supplemented with DMSO, BMP15, DXR, A. oncocalyx (1.2; 12 and 34 µg/ml) or onco A (1, 10 and 30 µg/ml). Treatments Culture time Non-cultured control ± 1.83 D1 D7 α-mem + cultured control ± 2.98 *A ± 1.83 *B BMP ± 5.06 * Aa ± 2.40 * Ba DMSO ± 3.80 *Ab ± 4.35 *Bb DXR ± 5.06 * Ae ± 5.48 * Bd A oncocalyx ± 1.83 * Ad ± 4.35 * Bde A oncocalyx ± 3.80 * Af ± 3.65 * Bf A oncocalyx ± 1.49 * Ag ± 2.79 * Bg Onco A ± 4.35 * Ac ± 5.06 * Bc Onco A ± 6.06 * Ad ± 6.41* Bd Onco A ± 5.48 * Ae ± 3.80 * Bef * Differs significantly from non-cultured control. Differs significantly from α-mem +. Distinct capital letters represent significant differences between columns (days of culture). Different lowercase letters represent significant differences between lines (experimental treatments).

81 80 Table 2. Percentage (mean ± SEM) of primordial and growing caprine preantral follicles before (non-cultured control) and after in vitro culture for 1 or 7 days in α-mem + alone or α-mem + supplemented with DMSO, BMP15, DXR, A. oncocalyx (1.2; 12 and 34 µg/ml) or onco A (1, 10 and 30 µg/ml). Treatments Primordial follicles Growing follicles Culture Time Non-cultured control ± ± 4.92 D1 D7 D1 D7 α-mem + cultured ± 4.64 A ± 5.18*B ± 4.64 B ± 5.18*A control BMP ± 7.86*Ab 9.10 ± 3.80*Bb ± 7.86*Ba ± 3.80*Aa DMSO ± 8.78 Aa ± 10.67*Bab ± 8.78Bb ± 10.67*Aab DXR ± 18.95*Ab ± 7.63*Bab ± 18.95*Ba ± 7.63*Aab A oncocalyx ± 5.06 *Aab ± 3.38*Bab ± 5.06*Bab ± 3.38*Aab A oncocalyx ± 6.80* Aab ± 6.19*Bab ± 6.80* Ba ± 6.19*Aab A oncocalyx ± 6.39*Aab ± 7.94*Ba ± 6.39*Bab ± 7.94*Ab Onco A ± 5.63*Aab ± 9.85*Bab ± 5.63*Bab ± 9.85*Aab Onco A ± 6.07*Aab ± 8.78*Bab ± 6.07*Bab ± 8.78*Aab Onco A ± 4.59* Ab ± 10.52*Bab ± 4.59* Ba ± 10.52*Aab * Differs significantly from non-cultured control. Differs significantly from α-mem + cultured control. Distinct capital letters represent significant differences between columns (days of culture). Different lowercase letters represent significant differences between lines (experimental treatments).

82 81 7. References 1. Cragg GM, Grothaus PG, Newman DJ: New Horizons for Old Drugs and Drug Leads. J Nat Prod 2014;77: Oktem O, Oktay K: Quantitative assessment of the impact of chemotherapy on ovarian follicle reserve and stromal function. Cancer 2007 Nov 15;110: Bar-Joseph H, Ben-Aharon I, Rizel S, Stemmer SM, Tzabari M, Shalgi R: Doxorubicin-induced apoptosis in germinal vesicle (GV) oocytes. Reprod Toxicol 2010 Dec;30: Ben-Aharon I, Bar-Joseph H, Tzarfaty G, Kuchinsky L, Rizel S, Stemmer SM, et al.: Doxorubicin-induced ovarian toxicity. Reprod Biol Endocrinol 2010 Jan;8: Graham JG, Quinn ML, Fabricant DS, Farnsworth NR: Plants used against cancer an extension of the work of Jonathan Hartwell. J Ethnopharmacol 2000;73: Newman DJ, Cragg GM, Snader KM: Natural Products as Sources of New Drugs over the Period J Nat Prod 2003;66: Cragg GM, Newman DJ: Plants as a source of anti-cancer agents. J Ethnopharmacol 2005 Aug 22;100: Braga R: Plantas do Nordeste, especialmente do Ceará. ed 3rd Mossoró, Ferreira MAD, Nunes ODRH, Leal LKAM, Pessoa ODL, de Lemos TLG, Viana GSDB: Antioxidant effects in the quinone fraction from Auxemma oncocalyx TAUB. Biol Pharm Bull 2003;26: Pessoa C, Mendes CS, Pessoa LO, Sabino SH, Lemos T., Moraes MO: Avaliação da atividade antitumoral de Auxemma oncocalyx Taub. (Pau Branco).; in : VII Annual Meeting of the Federação de Sociedades de Biologia Experimental, Caxambu, MG, Brazil. 1992, pp Lino CS, Pessoa ODL, Lemos TLC, Viana GSB: Estudo da atividade analgésica e antiedematogênica do extrato hidroalcoólico de Auxemma oncocalyx e oncocalyxona A; in : Simpósio De Plantas Medicinais Do Brasil. 1996, p Ferreira MAD, Nunes ODRH, Fontenele JB, Pessoa ODL, Lemos TLG, Viana GS.: Analgesic and anti-inflammatory activities of a fraction rich in oncocalyxone A isolated from Auxemma oncocalyx. Phytomedicine 2004;11: Costa-lotufo LV, Cunha GMA, Farias PAM, Viana GSB, Cunha KMA, Pessoa C,

83 82 et al.: The cytotoxic and embryotoxic effects of kaurenoic acid, a diterpene isolated from Copaifera langsdorffii oleo-resin. Toxicon 2002;40: Pessoa C, Vieira FMAC, Lemos TG, Moraes MO, Lima PDL, Rabenhorst SHB, et al.: Oncocalyxone A from Auxemma oncocalyx lacks genotoxic activity in phytohemagglutinin-stimulated lymphocytes. Teratog Carcinog Mutagen 2003 Jan;Suppl 1: Leyva A, Pessoa O, Boogaerdt F, Sokaroski R, Lemos TG, Wetmore LA, et al.: Oncocalyxones A and C, 1,4-Antracenediones from Auxemma oncocalyx: Comparison with Anticancer 1,9-Anthracenediones. Anticancer Res 2000;20: Pessoa C, Lemos TLG, Pessoa ODL, Moraes MO, Costa-lotufo LV, Leyva A: Cytotoxicity of derivatives of oncocalyxone A from Auxemma oncocalyx Taub. ARKIVOC 2004;vi: Figueiredo JR, Rodrigues APR, Silva JRV, Santos RR: Cryopreservation and in vitro culture of caprine preantral follicles. Reprod Fertil Dev 2011 Jan;23: Chaves RN, Duarte ABG, Matos MHT, Figueiredo JR: Sistemas de cultivo in vitro para o desenvolvimento de oócitos imaturos de mamíferos. Rev Bras Reprod Anim 2010;34: Celestino JJH, Lima-Verde IB, Bruno JB, Matos MHT, Chaves RN, Saraiva MV a, et al.: Steady-state level of bone morphogenetic protein-15 in goat ovaries and its influence on in vitro development and survival of preantral follicles. Mol Cell Endocrinol 2011 May 16;338: Shrestha J, Shanbhag T, Shenoy S, Amuthan A, Prabhu K, Sharma S, et al.: Antiovulatory and abortifacient effects of Areca catechu (betel nut) in female rats. Indian J Pharmacol 2010;42: Costa-Lotufo LV, Ferreira MAD, Lemos TLG, Pessoa ODL, Viana GSB, Cunha GM.: Toxicity to sea urchin egg development of the quinone fraction obtained from Auxemma oncocalyx. Brazilian J Med Biol Res 2002;35: Pessoa C, Silveira ER, Lemos TLG, Wetmore LA, Moraes MO, Leyva A: Antiproliferative Effects of Compounds Derived from Plants of Northeast Brazil. Phyther Res 2000;14: Monks TJ, Lau SS: Toxicology of quinone-thioethers. Crit Rev Toxicol 1992;22:

84 Bolton JL, Trush MA, Penning TM, Dryhurst G, Monks TJ: Role of Quinones in Toxicology. Chem Res Toxicol 2000 Mar;13: Pessoa OD., Lemos TLG, Carvalho MG, Braz-Filho R: Cordiachromes from Auxemma oncocalyx. Phytochemistry 1995;40: Löbermann F, Weisheit L, Trauner D: Intramolecular Vinyl Quinone Diels-Alder Reactions: Asymmetric Entry to the Cordiachrome Core and Synthesis of d Synthesis of (-) - Isoglaziovianol. Org Lett 2013;15: da Costa GM, Lemos TLG, Pessoa DL, Monte FJQ, Braz-filho R: Glaziovianol, a New Terpenoid Hydroquinone from Auxemma glazioviana. J Nat Prod 1999;62: Minotti G, Menna P, Salvatorelli E, Cairo G, Gianni L: Anthracyclines : Molecular Advances and Pharmacologic Developments in Antitumor Activity and Cardiotoxicity. Pharmacol Rev 2004;56: Tokarska-schlattner M, Zaugg M, Zuppinger C, Wallimann T, Schlattner U: New insights into doxorubicin-induced cardiotoxicity : The critical role of cellular energetics. J Mol Cell Cardiol 2006;41: Knight PG, Glister C: Focus on TGF- b Signalling TGF- b superfamily members and ovarian follicle development. Reproduction 2006;132:

85 84 8 EFEITO DA TOXICIDADE DA FRAÇÃO DA AUXEMMA ONCOCALYX E DO PRINCÍPIO ATIVO ONCOCALYXONE A NO CULTIVO IN VITRO DE FOLÍCULOS SECUNDÁRIOS E NA MATURAÇÃO IN VITRO DE OÓCITOS DE CAPRINOS Toxicity effect of the Auxemma oncocalyx fraction and its active principle oncocalyxone A on in vitro culture of caprine secondary follicles and in vitro oocyte maturation. Periódico: Semina: Ciências Agrárias (aceito) (ISSN: ) Qualis B1

86 85 RESUMO O extrato da Auxemma oncocalyx (A. oncocalyx) e seu componente, oncocalyxona A (onco A), possui atividade antitumoral, podendo afetar a fertilidade. Entretanto, estudos sobre a ação dessas substâncias em relação à foliculogênese caprina são desconhecidos. O objetivo desse estudo foi avaliar o efeito da A. oncocalyx e onco A no cultivo in vitro de folículos secundários isolados (Experimento 1) e na maturação in vitro (MIV) de oócitos de folículos antrais caprinos crescidos in vivo (Experimento 2). Folículos secundários isolados foram distribuídos em seis grupos, em que o controle não-cultivado foi imediatamente fixado em paraformaldeído 4%. Os folículos restantes foram cultivados durante 7 dias em α-mem + sozinho (controle) ou suplementado com DMSO, doxorrubicina (DXR), A. oncocalyx ou onco A. Após o cultivo, os folículos foram avaliados quanto à formação de antro, taxa de crescimento, apoptose (TUNEL) e proliferação celular (PCNA), bem como a expressão dos genes BCL2 e BAX. Além disso, os complexos cumulus-oócitos (CCOs) foram aspirados e distribuídos em cinco tratamentos para MIV: o controle em meio de maturação (TCM 199+), e os demais tratamentos suplementados com DMSO, DXR, A. oncocalyx ou onco A. Depois da MIV, a configuração da cromatina e viabilidade oocitária foram avaliadas. Após 7 dias de cultivo, observou-se redução na percentagem de folículos morfologicamente intactos, na formação de antro, na taxa de crescimento e no número de células PCNA positivas (P<0,05). Depois do cultivo, no tratamento DXR foi observada maior percentagem de folículos TUNEL positivos (P<0,05) e também aumento na taxa de RNAm BAX: BCL2 (P<0,05). Após MIV dos CCOs, nos tratamentos com DXR, A. oncocalyx e onco A, observou-se maior (P<0,05) percentagem de oócitos anormais e menor de oócitos viáveis quando comparados ao grupo controle (P<0,05). No entanto, apenas nos tratamentos DXR e onco A aumentou a percentagem de oócitos viáveis com configuração da cromatina anormais (P<0,05). Não houve diferenças nas taxas de maturação entre o grupo controle e os tratamentos DXR, A. oncocalyx e onco A. De acordo com nossas condições de cultivo, pode-se concluir que a A. oncocalyx e onco A não apresentaram efeitos tóxicos sobre folículos secundários isolados e as taxas de maturação dos CCOs recuperados a partir de folículos antrais. No entanto, estas substâncias afetam negativamente a viabilidade oocitária. Assim, o uso de biotecnologias como o cultivo de folículos

87 86 secundários in vitro e MIV de oócitos para testes de toxicidade são métodos apropriados para avaliar possíveis efeitos das drogas na foliculogênese. Palavras-chave: Auxemma oncocalyx. Doxorrubicina. Oncocalyxona A. Foliculogênese. Ovócitos

88 87 Efeito da toxicidade da fração da Auxemma oncocalyx e do princípio ativo oncalyxone A no cultivo in vitro de folículos secundários e na maturação in vitro de oócitos de caprinos. Toxicity effect of the Auxemma oncocalyx fraction and active principle oncalyxone A on in vitro culture of caprine secondary follicles and in vitro oocyte maturation. Leiva-Revilla J. a,, Cadenas J. a, Vieira L. a, Macedo V. a, Campello C.C. a, Aguiar F.L. a, Celestino J.J.H. b, Pessoa O.D.L. c, Apgar G.A. d, Rodrigues A.P.R. a, Figueiredo J.R. a*, Maside C. a. a Laboratory of Manipulation of Oocytes and Preantral Follicles (LAMOFOPA), Universidade Estadual do Ceará, Fortaleza-CE, Brazil. b Institute of Health Sciences, Universidade da Integração Internacional da Lusofonia Afro-Brasileira. Acarape-CE, Brazil. c Departamento de Química Orgânica e Inorgânica. Universidade Federal do Ceará, Centro de Ciências. Fortaleza-CE, Brazil d Professor of Department of Animal Science, Food and Nutrition, Southern Illinois University-Carbondale, USA * Correspondence should be addressed to: Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA). Universidade Estadual do Ceará (UECE). Av. Silas Munguba, 1700, Campus do Itaperi. Fortaleza CE Brasil. CEP: Tel.: ; Fax: address: jrf.lamofopapapers@gmail.com

89 88 ABSTRACT The extract of Auxemma oncocalyx (A. oncocalyx) and its main component i.e., oncocalyxone A (onco A), have anti-tumoral activity, and might affect fertility. Studies on the action of these substances regarding caprine folliculogenesis are lacking. The aim of this study was to evaluate the effect of A. oncocalyx and onco A on the in vitro culture of isolated secondary follicles (Experiment 1) and on the in vitro maturation (IVM) (Experiment 2) of oocytes from caprine antral follicles grown in vivo. Isolated secondary follicles were distributed in six groups; the non-cultured control was immediately fixed in Paraformaldehyde 4%. The remaining follicles were cultured for 7 days in α- MEM + alone (control) or supplemented with DMSO, doxorubicin (DXR), A. oncocalyx or onco A. After culture, follicles were evaluated for antrum formation, growth rate, apoptosis (TUNEL) and cellular proliferation (PCNA), as well as gene expression of BCL2 and BAX. Additionally, cumulus oocyte complexes (COCs) were aspirated and allocated into five treatments for IVM: control, cultured only in maturation base medium (TCM ); or supplemented with DMSO; DXR; A. oncocalyx or onco A. After IVM, oocyte chromatin configuration and viability were assessed. After 7 days of culture, there was a reduction in the percentage of morphologically intact follicles, antrum formation, growth rate and number of PCNA positive granulosa cells (P < 0.05). After culture, the DXR treatment had a higher percentage of TUNEL positive follicles and relative BAX:BCL2 mrna ratio s (P < 0.05). After IVM of the COCs, DXR, A. oncocalyx and onco A treatments had a greater percentage (P < 0.05) of abnormal oocytes and a lower percentage of viable oocytes as compared with the control group (P < 0.05). However, only DXR and onco A treatments increased the percentage of alive oocytes with abnormal chromatin configuration (P < 0.05). There were no differences in maturation rates between the control group and DXR, A. oncocalyx and onco A treatments. In conclusion, under our culture conditions, A. oncocalyx and onco A do not exhibit a toxic effect on isolated secondary follicles and on maturation rates of COCs recovered from antral follicles. However, these substances negatively affected the oocyte viability. Thus, the use of culture biotechnologies as an in vitro secondary follicle culture and in vitro oocyte maturation toxicity testing are appropriated methods to evaluate the possible effects of drugs in folliculogenesis.

90 89 Keywords: Auxemma oncocalyx; Doxorubicin; Oncocalyxone A; Folliculogenesis; Oocytes.

91 90 1. Introduction In vitro manipulation of oocytes enclosed in preantral follicles allows drug toxicity testing, by avoiding the ethical concerns and restrictions of in vivo experiments. Therefore, one way to safely study the effects of drugs on reproduction, is by the utilization of in vitro preantral follicle culture. This technique enables the testing of beneficial or toxic effects on ovarian follicles in vitro before their use in experiments involving live subjects (FIGUEIREDO et al., 2011). Cancer research is continuously seeking to develop or discover new treatments (CRAGG et al., 2014). Many drugs used in cancer chemotherapy, in addition to showing toxicity against tumor cells, exhibit genotoxic, carcinogenic and teratogenic effects on normal cells. One of the most commonly used is Doxorubicin (DXR) (OKTEM; OKTAY, 2007). Normally used in treatment against bladder, breast, lung, ovary cancer and others (CHOW et al., 2010), it transgresses the cell membrane and accumulates in both the nucleus mitochondria, by inducing oxidative stress and chromosomal obliteration through inhibition of topoisomerase II (MAILER; PETIRING, 1976). However, DXR induces ovarian toxicity by reducing the ovulation rate, along with a reduction in the size of the ovary and other side effects (OKTEM; OKTAY, 2007; BAR-JOSEPH et al., 2010; BEN- AHARON et al., 2010). The poor specificity of these drugs against tumor tissue highlights the need of developing new drugs with fewer side effects (OKTEM; OKTAY, 2007) and more specificity. Plants are excellent sources of raw material when searching for new drugs, and commonly used in the treatment of cancer (GRAHAM et al., 2000). In addition, over 60% of currently anti-cancer agents are derived from natural sources, including plants, marine organisms and micro-organisms (NEWMAN et. al., 2003; CRAGG; NEWMAN, 2005). Auxemma oncocalyx (A. oncocalyx) is a common tree found in the state of Ceará in Northeast Brazil (BRAGA, 1976). It has been widely used in folk medicine as an adjunctive treatment for injuries (BRAGA, 1976; FERREIRA et al., 2003). Some studies have suggested that this plant has biological activities such as analgesic, anti-oxidant, anti-tumor and anti-inflammatory effects (PESSOA et al., 1992; LINO et al., 1996; FERREIRA et al., 2003, 2004). Oncocalyxone A (onco A) has been isolated from the stem heartwood of the plant, which has a high antioxidant activity (FERREIRA et al.,

92 ) and an antiproliferative effects in tumor cell cultures (COSTA-LOTUFO et al., 2002). In previous studies, onco A has been suggested as a possible anticancer compound since it has presented antitumor and cytotoxic activity in human leukemia cells, and other cell cancer lines, without causing genotoxicity (LEYVA et al., 2000; PESSOA et al., 2003, 2004). However, the effect of A. oncocalyx and onco A on in vitro folliculogenesis is not known. Hence, the aim of this study was to investigate the effect of A. oncocalyx and onco A on the in vitro survival and growth of isolated goat secondary follicles (Experiment 1) as well as on the viability and nuclear maturation of oocytes recovered from antral follicles (Experiment 2). 2. Materials and methods 2.1. Source of ovaries Ovaries (n =130) from 65 cycled mixed breed adult goats, with body condition score 3 (30 and 35 for experiment 1 and 2, respectively) were obtained at a local slaughterhouse located in Mossoro, Rio Grande do Norte state, northeast region, with latitude: 05º 11' 15" S and longitude 37º 20' 39" W. The ovaries were washed in 70% alcohol for approximately 10 s and then twice in minimal essential medium (MEM) supplemented with 100 µg/ml penicillin and 100 µg/ml streptomycin plus HEPES (MEM-HEPES). The ovaries were transported to the laboratory at 4 or 33 C (experiment 1 or 2, respectively) in a thermal container, within 4 h. All chemicals used in the present study were purchased from Sigma Chemical Co. (St. Louis, MO, USA), unless otherwise indicated Obtainment of onco A from A. oncocalyx Auxemma oncocalyx was collected in August 2012 at Acarape, state of Ceará, which is located in Northeast Brazil. The plant was identified by Dr. Maria Iracema B. Loiola of the Department of Biology of Federal University of Ceará. A voucher specimen (No ) has been deposited in the Herbarium Prisco Bezerra (EAC), Federal University of Ceará.

93 92 The air-dried and powdered heartwood (2.5 kg) of A. oncocalyx was extracted with EtOH (2 x each) at room temperature. The combined extracts were evaporated under reduced pressure to yield the crude extract (100 g), which was fractionated over silica gel and eluted with CH2Cl2, CH2Cl2/ EtOAc (7:3 and 1:1), EtOAc, EtOAc/ MeOH (9.5:0.5 and 1:1) to yield after solvent evaporation the correspondent fractions: 6.60, 5.99, 8.01, 3.36, and g, respectively. The fraction EtOAc/MeOH 9.5:0.5 (50.0 g) was subjected to a silica gel (200 g) chromatography column using CH2Cl2/ EtOAc 1:1 (200 ml), 7:3 (500 ml), EtOAc (1000 ml) and EtOAc/ MeOH 9.5:0.5 (400 ml) to afford 60 fractions of approximately 30 ml. After comparative analysis by TLC, these fractions were pooled into 3 main fractions: F1 (1-20; 8.2 g), F2 (21-54; 25.2 g) and F3 (55-60; 16.7 g). F2 (21-54; 25.2 g) was subjected twice to chromatography over silica gel eluted with CH2Cl2/EtOAc 1:1, 7:3, EtOAc, EtOAc/MeOH 9.5:0.5 and MeOH. Fractions CH2Cl2/EtOAc 7:3 and EtOAc furnished a dark solid, which was purified by addition of acetone followed by filtration. This material (5.5 g), a deep red powder, mp o was identified as rel-8a-hydroxy-5-hydroxymethyl-2-methoxy-8ab-methyl-7,8,8a,9- tetrahydro-1,4-anthracenedione), named onco A, as previously described by PESSOA et al., H NMR (200 MHz, DMSO-d6): 6.00 (s, H-3), 6.03 (br d, H-6), 2.52 (br d, J 17.2 Hz, H-7eq), 2.60 (dd, J 17.2, 3.9 Hz, H-7ax), 3.57 (br s, H-8), 2.90 (d, J 18.4 Hz, H-9ax), 2.34 (d, J 18.4 Hz, H-9eq), 6.50 (s, H-10), 4.16 (br s, 2H-11), 0.74 (s, 3H-12), 3.78 (s, OMe). 13 C NMR (50.3 MHz, DMSO-d6): (C-1), (C-2), (C-3), (C-4), (C-4a), (C-5), (C-6), 32.0 (C-7), 70.1 (C-8), 38.9 (C-8a), 29.2 (C-9), (C-9a), (C-10), (C-10a), 61.6 (C-11), 21.3 (C-12), 56.7 (OMe). It is noteworthy that the fraction of A. oncocalyx contains 80 % of onco A (FERREIRA et al., 2004), therefore the concentration of A. oncocalyx was in equal proportion of onco A. A. oncocalyx and onco A were diluted with DMSO as a vehicle. The concentrations of A. oncocalyx and onco A were chosen based on previous studies performed in our laboratory (unpublished data) Experimental design For Experiment 1, isolated secondary follicles were randomly distributed in the following six treatments: I) non-cultured control; II) cultured in α-mem + (control); III)

94 93 α-mem + supplemented with 20% v/v dimethyl sulfoxide (DMSO); IV) α-mem + supplemented with 0.3 g/ml DXR (positive toxicity control); V) α-mem + supplemented with 1.2 g/ml A. oncocalyx or VI) α-mem + supplemented with 1 g/ml onco A. The culture was replicated seven times, and a total of 60 follicles (at least) were used in each treatment. Cultured follicles were evaluated for antrum formation capacity, growth rate, apoptosis (TUNEL) and cellular proliferation (PCNA). In addition, both noncultured and cultured isolated secondary follicles from the five treatments after culture were selected for Bcl2 and Bax gene expression. For experiment 2, COCs were allocated into five treatments to perform in vitro maturation: I) TCM (control) II) TCM supplemented with 20% v/v DMSO; III) TCM supplemented with 0.3 g/ml DXR; IV) TCM supplemented with 1.2 g/ml A. oncocalyx or V) TCM supplemented with 1 g/ml onco A. The culture (maturation) was replicated three times, and a total of 75 (at least) COCs were used in each treatment. After 24 h of in vitro maturation, oocyte chromatin configuration and viability were assessed by fluorescence microscopy Isolation, selection and culture of secondary follicles After transportation, fat and connective tissue surrounding the ovaries were removed. Cortical slices (1 to 2 mm thick) were cut with a surgical blade (under sterile conditions) and placed in a holding medium consisting of HEPES-MEM. Secondary follicles that were approximately 200 µm in diameter were visualized using a stereomicroscope (SMZ 645, Nikon, Tokyo, Japan) with ocular micrometer (100 X magnification) and manually dissected from strips of ovarian cortex using 26-gauge (26 G) needles. After isolation, follicles were transferred to 100 µl drops containing fresh culture medium under mineral oil for further evaluation of follicular quality. Follicles with a visible and centrally located oocyte that were surrounded by granulosa cells and had an intact basement membrane and no antrum formation were selected as secondary follicles for culture. After selection, follicles were individually cultured in 100 µl drops of culture media and allocated into different treatments (67, 58, 59, 59 and 58 respectively for control, DMSO, DXR, A. oncocalyx and onco A treatments) described further in the experimental design (item 2.5). The base culture media consisted in α-mem

95 94 supplemented with 3 mg/ml bovine serum albumin (BSA), 10 ng/ml insulin, 5.5 µg/ml transferrin and 5 ng/ml selenium, 2 mm glutamine, 2 mm hypoxanthine, 50 µg/ml ascorbic acid and 100 ng/ml FSH (α-mem + ). The culture was carried out at 39 C, in 5% CO2 in air for 7 days. Fresh media were prepared and pre-equilibrated for 2 h prior to use. Every other day, 60 µl of medium were replenished in each drop Assessment of follicle development During culture, follicles were classified according to their morphology. Follicles showing darkness of the oocytes and surrounding cumulus cells or those with misshapen oocytes were classified as degenerated. At day 7 of culture, follicular diameter and antrum formation were evaluated only in healthy follicles. The follicular diameter was determined as the mean of two perpendicular measures of each follicle, using an ocular micrometer (100 X magnification) inserted into a stereomicroscope (SMZ 645, Nikon, Tokyo, Japan). Antrum formation was defined as a visible translucent cavity within the granulosa cell layers Assessment of apoptosis by TUNEL assay For determination of DNA fragmentation, a terminal deoxynucleotidyl transferase-mediated dutp biotin nick end labeling (TUNEL) detection kit (R&D Systems, Minneapolis, MN, USA) was utilized. The follicles were fixed in 4% paraformaldehyde buffered with PBS. Subsequently, the blocks were sectioned at a thickness of 5 µm following de-paraffinization and boiled for antigen retrieval in 0.01 M citric acid. The blockade of exogenous peroxidase and nonspecific blocking were performed in a humid chamber. The TUNEL kit was prepared following the guidelines provided by the manufacturer. The incubation of TUNEL consisted of the addition of a TUNEL mixture for 1 h at 37 C (moist chamber) and, after washing, 50 ml Convert POD was added for 30 min at 37 C (moist chamber). Follicles were considered TUNEL positive when oocyte nucleus was stained brown Proliferating cell nuclear antigen (PCNA) assessment Follicles were fixed in 4% paraformaldehyde and 5 µm paraffin sections were mounted to microscope slides. Paraffin sections were heated at 65 C for 45 min.

96 95 Following de-paraffinization, sections were rehydrated in a series of graded ethanol/water solutions then boiled in 0.01 M citric acid (ph 6.0) at C for 5 min followed by incubation in 3% hydrogen peroxide (H2O2) for 10 min. The tissues were blocked with avidin and biotin and incubated with a Rb Pab-PCNA (1: Abcam) overnight at 4 C. After rinsing thoroughly with PBS, the sections were incubated with caprine pab-rb IgG antibody (Biotin) for 30 min at room temperature. PCNA expression was detected by the reaction of peroxidase with 3,39-diaminobenzidine tetrahydrochloride (DAB) and analyzed using a light microscope (400X maginification, Nikon Eclipse E200). PCNA assessment was evaluated by counting positive cells/total cells for each follicle to obtain an index of positive cells. Between 34 and 427 granulosa cells per follicle were evaluated Quantitative real-time PCR analysis for BAX, BCL2 in isolated secondary follicles For RNA isolation, three pools of 10 isolated secondary follicles were collected from each experimental group after 7 days of culture (Exp.1). The samples were stored in microcentrifuge tubes (1.5 ml) with 100 µl Trizol at -80 ºC. Total RNA from follicles were isolated and purified with Trizol Plus Purification kit (Invitrogen, São Paulo, Brazil). The RNA preparations were treated with DNase I and Pure Link RNA Mini Kit (Invitrogen, São Paulo, Brazil). Complementary DNA (cdna) was synthesized from the isolated RNA using Superscript II RNase H-Reverse Transcriptase (Invitrogen, São Paulo, Brazil). The qpcr reaction was performed in a final volume of 20 µl, containing 1 µl of each cdna, 1 x Power SYBR Green PCR Master Mix (10 µl) (PE Applied Biosystems, Foster City, CA, USA), 5.5 µl of ultrapure water, and 0.5 µm of both sense and anti-sense primers. The gene-specific primers used for the amplification of different transcripts are shown in Table 1. Transcript levels in follicular cells were normalized to the content of peptidylprolyl Isomerase A (PPIA) and glyceraldehyde-3-phosphatedehydrogenase (GAPDH). Primer specificity and amplification efficiency were verified for each gene. The qpcr cycling conditions consisted of an initial denaturation and polymerase activation step at 94 ºC for 15 min, followed by 40 cycles of 15 s at 94 ºC, 30 s at 60 ºC, and 45 s at 72 ºC, and then a final extension for 10 min at 72 ºC. After amplification, melting curve analysis was performed between 60 ºC and 95 ºC for all genes. All amplifications were carried out in a Bio-Rad iq5 (Hercules, CA, USA). The

97 96 delta-delta-ct method was used to transform threshold cycle values into normalized relative expression levels (LIVAK; SCHMITTGEN, 2001) In vitro maturation of caprine oocytes recovered from antral follicles In the laboratory, approximately 399 cumulus oocytes complexes (COCs) from 70 ovaries were collected by slicing of ovaries. Oocytes with a compact cumulus mass and a dark, evenly granulated cytoplasm were selected for IVM and washed three times in base maturation medium (TCM ), consisting of TCM-199 supplemented with 1 µg/ml 17β- estradiol, 5 µg/ml LH, 0.5 µg/ml rfsh, 10 ng/ml EGF, 1 mg/ml BSA, 22 µg/ml pyruvate, 50 ng/ml IGF-I, and 100 µmol/l cysteamine, previously preequilibrated at 39 C and 5% CO2.in air. Groups of COCs were cultured in 500 µl of designed media into each well of a 4-well multidish (Nunc, Roskilde, Denmark) for 24 h at 39 C, in 5% CO Assessment of oocyte chromatin configuration and viability Following maturation, the COCs were denuded mechanically and oocytes were washed in PBS, then incubated in 100 µl droplets containing 4 µm calcein-am, 2 µm ethidium homodimer-1 (Molecular Probes, Invitrogen, Karlsruhe, Germany), 0.5% of glutaraldehyde and 10 µm Hoechst for 30 min. The chromatin configuration was assessed by fluorescence microscopy (Nikon, Eclipse 80i, Tokyo, Japan), and classified as abnormal chromatin configuration, when the nucleus was pyknotic, compact or in a strange configuration; and normal chromatin configuration was considered when the nucleus was in germinal vesicle (GV) or meiotic resumption. Meiotic resumption was defined when the nucleus was in germinal vesicle break down (GVBD), metaphase I (MI) or in metaphase II (MII) stages. Thereafter, oocytes were also examined under a fluorescence microscope (Nikon, Eclipse 80i, Tokyo, Japan) for evaluation of live/dead fluorescent staining. The emitted fluorescent signals of calcein-am and ethidium homodimer-1 were collected at 488 and 568 nm, respectively. Oocytes were considered alive when the cytoplasm was stained positively with calcein- AM (green) and chromatin was not labeled with ethidium homodimer-1 (red). Also, oocytes were classified as viable when the cytoplasm was stained positively with calcein- AM and they showed a normal chromatin configuration, as mentioned above. Moreover,

98 97 abnormal oocytes were divided in three categories: oocytes stained positively with calcein-am with abnormal chromatin were considered as alive with abnormal chromatin configuration, or oocytes non stained with calcein-am and stained with ethidium homodimer were considered as non-alive; and finally non-alive plus alive with abnormal chromatin configuration which formed the total number of abnormal oocytes Statistical analyses For both experiments, data referring to continuous variables were initially evaluated for homocedasticity and normal distribution of the residues by Bartlett s and Shapiro-Wilk tests, respectively. Confirmed both requirements underlying analysis of variance, it was carried out considering a completely randomized design in a factorial arrangement 5 x 2 (five treatments and two times of culture). When any main effect or their interactions were significant, comparisons were further analyzed by Student- Newman-Keuls test, being the results expressed as mean ± standard deviation. When heterocedasticity was observed, even after transformation of data, non-parametric Kruskal-Wallis test was applied. Data for discrete variables were analyzed by chi-square test (or Fisher Exact Test when n<5) and results were expressed as percentages. In all cases, a probability of P<0.05 indicated a significant difference. 3. Results and discussion The present study utilized for the first time reproductive toxicity of in vitro cultured isolated follicles and in vitro matured COC s to assess the toxicity of A. oncocalyx and its isolated compound onco A. In order to investigate the effects of different drugs over folliculogenesis, there are various toxicological tests. In vitro cultures have become a tool to analyze the effects of several components on the survival, growth and maturation of follicles in many animal models (STEFANSDOTTIR et al., 2014). In vitro experiments are of great importance as they provided appropriated information about the effect of different compounds before in vivo testing. The in vitro culture of caprine preantral follicles and the in vitro maturation of COCs showed to be appropriated techniques to analyze the drugs effect over folliculogenesis.

99 98 A total of 301 secondary follicles were analyzed before and after in vitro culture in different treatments (Figure 1). The effects of the treatments on the percentage of morphologically intact follicles and antrum formation are shown (Table 2). After 7 days of culture there was a lower (P < 0.05) percentage of morphologically intact follicles and antrum formation in DXR treatment compared to the other treatments (control, DMSO, A. oncocalyx and onco A). Follicular diameter and growth rate of follicles after 7 days of in vitro culture are shown (Table 3). There was a significant increase in follicular diameter from D0 to D7 in all treatments except for onco A and DXR. In addition, we observed that DXR significantly reduced the growth rate when compared to the other treatments (control, DMSO, A. oncocalyx and onco A). The in vitro follicle culture system used in the present study was effective to investigate the impact of the studied drugs (DXR, A. oncocalyx and onco A) on in vitro folliculogenesis. The control medium used ensured the maintenance of appropriate rates of follicle survival (92.54 %), growth (4.19 ± 6.12) and antrum formation (59.70 %). These data are in agreement with previous studies reporting the in vitro culture of caprine preantral follicles for 6 days, using the same culture medium (ARAÚJO et al., 2011; DUARTE et al., 2013). In this study, A. oncocalyx and onco A did not alter the folliculogenesis parameters such as survival, antrum formation and growth rate. On the contrary, DXR caused a toxic effect on all these folliculogenesis end points. A. oncocalyx and onco A were less harmful to in vitro secondary follicles than DXR, although both drugs were able to maintain follicular morphology, without affecting neither antrum formation, nor follicular growth. It is known that onco A and DXR both have anti-carcinogenic effects (PESSOA et al., 2004). The fraction of A. oncocalyx and onco A in different lineages of cells, especially in tumor cell lines, had a similar effect when compared to DXR (PESSOA et al., 2000, 2003, 2004). DXR and onco A have been shown to exhibit cytotoxicity in the G, G1/S and S phases of cell division, however, only DXR exhibited genotoxicity in these cells (PESSOA et al., 2003). This genotoxicity, caused by DXR, could explain the decrease in the percentage of morphologically intact follicles and antrum formation found in this study. The percentage of TUNEL positive follicles (TPF) was higher (P < 0.05) for the DXR treatment when compared to non-cultured control. There was no difference (P > 0.05) in the percentage of TPF among the other treatments. The number of PCNA positive granulosa cells were lower (P <0.05) for the DXR treatment when compared to the other treatments (control, DMSO, A. oncocalyx and onco A) (Table 4). Additionally, DXR was

100 99 the only treatment to cause a decrease (P < 0.05) in the relative BAX:BCL2 mrna ratio (Figure 2). More studies are needed to discern the mechanism of action of both drugs. Recent studies revealed that DXR induced ovarian toxicity, which was observed by a reduction in ovulation rate and the size of the ovary (OKTEM; OKTAY, 2007; BAR- JOSEPH et al., 2010; BEN-AHARON et al., 2010). DXR elicits apoptosis by various mechanisms in a variety of cells. It can be accumulated in both the nucleus and mitochondria, and induces chromosomal destruction by inhibiting topoisomerase-ii (TOKARSKA-SCHLATTNER et al., 2006). DXR can also interfere with mitochondrial function and initiate an intrinsic pathway of apoptosis by reducing the mitochondrial membrane potential and releasing cytochrome C (BAR-JOSEPH et al., 2010). In this study, there was a decrease (P < 0.05) in the percentage of viable oocytes when they were treated with DXR, A. oncocalyx and onco A. The percentage of non-alive oocytes was significantly higher (P < 0.05) in the onco A treatment than DXR and A. oncocalyx treatments. The opposite was observed for the percentage of alive oocytes with abnormal chromatin configuration. Compared to its vehicle (DMSO), onco A and DXR treatments reduced (P < 0.05) the percentage of oocyte meiotic resumption, but they were similar (P > 0.05) to the control treatment. In addition, the MII rates were similar (P > 0.05) among the treatments (Table 05). The in vitro maturation culture system used in the present study was adequate to investigate the impact of the studied drugs (DXR, A. oncocalyx and onco A) on in vitro maturation. The control medium used ensured the maintenance of appropriate rates of viability (90.67 %) and meiotic resumption (92.65 %). These data are in agreement with previous studies made by our group, reporting the in vitro maturation of caprine COCs, using the same culture medium. In this study, DXR, A. oncocalyx and onco A negatively affected the oocyte viability (Figure 1). It is known that DXR can induce cellular apoptosis. Moreover, a study evaluating different concentrations (1 to 100 µg/ml) of a quinone fraction of A. oncocalyx (containing 80% of onco A) in sea urchin eggs reported that the cleavage of eggs was inhibited in a concentration-dependent manner, and when a concentration of 30 µg/ml was used it caused a total destruction (100%) of embryos (COSTA-LOTUFO et al., 2002). Only DXR and onco A caused a harmful effect on meiotic resumption. This finding may be due to the higher sensitivity of the COCs to a toxic compound. The presence of alive oocytes with abnormal chromatin configuration implies the occurrence of apoptosis (BAR-JOSEPH et al., 2010). Moreover, only DXR and A. oncocalyx

101 100 exhibited an increase in oocytes with abnormal chromatin configuration, showing a less harmful effect of onco A. This result may be due to the impurity of the fraction of A. oncocalyx which contains 80% of onco A (FERREIRA et al., 2004), and 20% of other substances that may be more toxic than onco A alone. Also, Pessoa et al. (PESSOA et al., 2003), showed that even though onco A and DXR have cytotoxicity in lymphocytes, only DXR present genotoxicity, proving to be more toxic. It is important to highlight that the DMSO treatment (i.e., the vehicle used for the dilution of DXR, A. oncocalyx and onco A) was similar to the α-mem+ cultured control. This result shows that DMSO by itself was not responsible for the negative effect of the tested drugs in any of the studied end points. 4. Conclusions In conclusion, under our culture conditions, A. oncocalyx and onco A do not have a toxic effect on isolated secondary follicles and maturation rates on in vitro matured COCs, however, these drugs affect the oocyte viability after in vitro maturation. In addition, the less harmful effect of onco A than DXR on caprine secondary follicle survival and oocytes with normal chromatin configuration may encourage future studies involving the use of this drug for cancer treatment in women. 5. Acknowledgments This research was financially supported by CNPq, CAPES and FUNCAP. The authors thank Francisco Leo Aguiar, Victor Macedo Paes, Denise Damasceno Guerreiro, Renato Félix da Silva and Naiza Arcângela Ribeiro de Sá for assistance with this study. 6. References ARAÚJO, V. R.; SILVA, G. M.; DUARTE, A. B. G.; MAGALHÃES, D. M.; ALMEIDA, A. P. Vascular endothelial growth factor-a165 (VEGF-A165) stimulates the in vitro development and oocyte competence of goat preantral follicles. Cell Tissue Res, v. 165, p , 2011.

102 101 BAR-JOSEPH, H.; BEN-AHARON, I.; RIZEL, S.; STEMMER, S. M.; TZABARI, M.; SHALGI, R. Doxorubicin-induced apoptosis in germinal vesicle (GV) oocytes. Reproductive toxicology (Elmsford, N.Y.), v. 30, n. 4, p , dez BEN-AHARON, I.; BAR-JOSEPH, H.; TZARFATY, G.; KUCHINSKY, L.; RIZEL, S.; STEMMER, S. M.; SHALGI, R. Doxorubicin-induced ovarian toxicity. Reproductive biology and endocrinology : RB&E, v. 8, p. 20, jan BRAGA, R. Plantas do nordeste, especialmente do ceará. 3rd. ed. [s.l: s.n.] CHOW, W.-H.; DONG, L. M.; DEVESA, S. S. Epidemiology and risk factors for kidney cancer. Nature Reviews Urology, v. 7, n. 5, p , COSTA-LOTUFO, L. V.; FERREIRA, M. A. D.; LEMOS, T. L. G.; PESSOA, O. D. L.; VIANA, G. S. B.; CUNHA, G. M.. Toxicity to sea urchin egg development of the quinone fraction obtained from Auxemma oncocalyx. Brazilian Journal of Medical and Biological Research, v. 35, n. 8, p , CRAGG, G. M.; GROTHAUS, P. G.; NEWMAN, D. J. New Horizons for Old Drugs and Drug Leads. Journal of natural products, v. 77, p , CRAGG, G. M.; NEWMAN, D. J. Plants as a source of anti-cancer agents. Journal of ethnopharmacology, v. 100, n. 1 2, p. 72 9, 22 ago DUARTE, A. B. G.; ARAÚJO, V. R.; CHAVES, R. N.; DA SILVA, G. M.; LUZ, V. B.; THOMAS, K. H.; MAGALHÃES-PADILHA, D. M.; ALMEIDA, A. P.; LOBO, C. H.; CAMPELLO, C. C.; FIGUEIREDO, J. R. Insulin-like growth factor II ( IGF-II ) and follicle stimulating hormone ( FSH ) combinations can improve the in vitro development of grown oocytes enclosed in caprine preantral follicles. Growth Hormone & IGF Research, v. 23, n. 1 2, p , FERREIRA, M. A. D.; NUNES, O. D. R. H.; FONTENELE, J. B.; PESSOA, O. D. L.; LEMOS, T. L. G.; VIANA, G. S.. Analgesic and anti-inflammatory activities of a fraction rich in oncocalyxone A isolated from Auxemma oncocalyx. Phytomedicine : international journal of phytotherapy and phytopharmacology, v. 11, n. 4, p , FERREIRA, M. A. D.; NUNES, O. D. R. H.; LEAL, L. K. A. M.; PESSOA, O. D. L.; DE LEMOS, T. L. G.; VIANA, G. S. D. B. Antioxidant effects in the quinone fraction from Auxemma oncocalyx TAUB. Biological & pharmaceutical bulletin, v. 26, n. 5, p , FIGUEIREDO, J. R. De; CELESTINO, J. J. D. H.; FAUSTINO, L. R.; RODRIGUES, A. P. R. In vitro culture of caprine preantral follicles: Advances, limitations and prospects. Small Ruminant Research, v. 98, n. 1 3, p , jun GRAHAM, J. G.; QUINN, M. L.; FABRICANT, D. S.; FARNSWORTH, N. R. Plants used against cancer an extension of the work of Jonathan Hartwell. Journal of ethnopharmacology, v. 73, p , LEYVA, A.; PESSOA, O.; BOOGAERDT, F.; SOKAROSKI, R.; LEMOS, T. G.; WETMORE, L. A.; HURUTA, R. R.; MORAES, M. O. Oncocalyxones A and C, 1,4- Antracenediones from Auxemma oncocalyx: Comparison with Anticancer 1,9- Anthracenediones. Anticancer Research, v. 20, n. 2A, p , LINO, C. S.; PESSOA, O. D. L.; LEMOS, T. L. C.; VIANA, G. S. B. Estudo da atividade analgésica e antiedematogênica do extrato hidroalcoólico de Auxemma oncocalyx e oncocalyxona A. In: Simpósio De Plantas Medicinais Do Brasil, Anais

103 102 LIVAK, K. J.; SCHMITTGEN, T. D. Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 2 -DDCT Method. Methods, v. 408, n. 25, p , MAILER, K.; PETIRING, D. H. Inhibition of oxidative phosphorylation in tumor cells and mitochondria by daunomycin and adriamycin. Biochemical Pharmacology, v. 25, p. 6 10, NEWMAN, D. J.; CRAGG, G. M.; SNADER, K. M. Natural Products as Sources of New Drugs over the Period Journal of natural products, v. 66, p , OKTEM, O.; OKTAY, K. Quantitative assessment of the impact of chemotherapy on ovarian follicle reserve and stromal function. Cancer, v. 110, n. 10, p , 15 nov PESSOA, C.; LEMOS, T. L. G.; PESSOA, O. D. L.; MORAES, M. O.; COSTA- LOTUFO, L. V.;LEYVA, A. Cytotoxicity of derivatives of oncocalyxone A from Auxemma oncocalyx Taub. ARKIVOC, v. vi, p , PESSOA, C.; MENDES, C. S.; PESSOA, L. O.; SABINO, S. H.; LEMOS, T..; MORAES, M. O. Avaliação da atividade antitumoral de Auxemma oncocalyx Taub. (Pau Branco). In: VII Annual Meeting of the Federação de Sociedades de Biologia Experimental, Caxambu, MG, Brazil., Anais PESSOA, C.; SILVEIRA, E. R.; LEMOS, T. L. G.; WETMORE, L. A.; MORAES, M. O.; LEYVA, A. Antiproliferative Effects of Compounds Derived from Plants of Northeast Brazil. Phytotherapy research, v. 14, p , PESSOA, C.; VIEIRA, F. M. A. C.; LEMOS, T. G.; MORAES, M. O.; LIMA, P. D. L.; RABENHORST, S. H. B.; LEYVA, A.; BURBANO, R. R. Oncocalyxone A from Auxemma oncocalyx lacks genotoxic activity in phytohemagglutinin-stimulated lymphocytes. Teratogenesis, carcinogenesis, and mutagenesis, v. Suppl 1, p , jan PESSOA, O. D. L.; LEMOS, T. L. G.; SILVEIRA, E. R.; BRAZ-FILHO, R. Novel cordiachromes isolated from Auxemma oncocalyx. Natural Product Research, v. 2, p , STEFANSDOTTIR, A.; FOWLER, P. A.; POWLES-GLOVER, N.; ANDERSON, R. A.; SPEARS, N. Use of ovary culture techniques in reproductive toxicology. Reproductive Toxicology, v. 49, p , TOKARSKA-SCHLATTNER, M.; ZAUGG, M.; ZUPPINGER, C.; WALLIMANN, T.; SCHLATTNER, U. New insights into doxorubicin-induced cardiotoxicity : The critical role of cellular energetics. Journal of molecular and cellular cardiology, v. 41, p , 2006.

104 Figures and tables Table 1. Oligonucleotide primers used for PCR analysis of goat secondary follicles Target gene Primer sequence (5' 3') Sense (S) Antisense (AS) Genbank accession nos. GAPDH PPIA BAX ATGCCTCCTGCACCACCA S GI: AGTCCCTCCACGATGCCAA AS (Ovis aries) TCATTTGCACTGCCAAGACTG S GI: TCATGCCCTCTTTCACTTTGC AS (Capra hircus) TTTTGCTTCAGGGTTTCATCCAGGA S GI: CAGCTGCGATCATCCTCTGCAG AS (Capra hircus) BCL2 GTTTTCCGACGGCAACTTC S GI: (Capra hircus)

105 104 Figure 1. Isolated secondary follicles before (a) and after 7 days of culture in α-mem + alone (cultured-control) (b) or supplemented with DMSO (c), DXR (d), A. oncocalyx (e) and onco A (f). Oocytes after in vitro maturation in TCM199 + (control) (g) or supplemented with DMSO (h), DXR (i), A. oncocalyx (j) or onco A (k). Figure 2. Relative mean (± SEM) of BAX:BCL2 mrna ratio in cultured isolated secondary follicles for 7 days in α-mem + alone (cultured-control) or supplemented with DMSO, DXR, A. oncocalyx and onco A. Different letters denote significant differences (P < 0.05).

106 105 Table 2. Percentage of morphologically intact secondary follicles, and antrum formation after in vitro culture for 7 days in α-mem + (control) or supplemented with DMSO, DXR, A. oncocalyx or onco A. Treatments (n) % Morphologically intact follicles % Antrum formation Control (n = 67) (62/67) A (40/67) A DMSO (n = 58) (52/58) A (29/58) A DXR (n = 59) (33/59) B (10/59) B A. oncocalyx (n = 59) (51/59) A (34/59) A Onco A (n = 58) (49/58) A (32/58) A A,B Distinct capital letters represent significant differences among experimental treatments (P < 0.05). n Total number of analyzed follicles per treatment Table 3. Follicular diameter (on day 0 and 7) and growth rate (mean ± SEM) of isolated secondary follicles after in vitro culture in α-mem + (control) or supplemented with DMSO, DXR, A. oncocalyx or onco A Treatments D0 D7 Growth rate Control ± Ab ± Aa 4.19 ± 6.12 A DMSO ± Ab ± Aa 2.96 ± 6.87 A DXR ± Aa ± Ba ± 3.80 B A. oncocalyx ± Ab ± Aa 4.03 ± 6.62 A Onco A ± Aa ± Aa 1.85 ± 6.79 A A,B Distinct capital letters represent significant differences among treatments within the same day of culture. a,b Different lowercase letters represent significant differences between days of culture within the same treatment. (P < 0.05).

107 106 Table 4. PCNA test and TUNEL assay of non-cultured or in vitro cultured isolated secondary follicles for 7 days in α-mem + (control) or supplemented with DMSO, DXR, A. oncocalyx or onco A. Treatments PCNA TUNEL Non-cultured control ± 7.32 A % (1/6) B Control ± 8.83 A % (2/6) AB DMSO ± 6.00 A % (2/6) AB DXR ± 9.70 B % (4/4) A A. oncocalyx ± 4.51 A % (3/5) AB Onco A ± 6.71 A % (3/6) AB Distinct capital letters represent significant differences among experimental treatments (P < 0.05).

108 107 Table 5. Viable and non-viable oocytes rates, germinal vesicle (GV), meiotic resumption and metaphase II (MII) rates, after in vitro maturation in TCM199 + (control) or supplemented with DMSO, DXR, A. oncocalyx or onco A of COCs recovered from antral follicles. Treatments NON-VIABLE OOCYTES MATURATION RATES OF VIABLE OOCYTES TOTAL Non-alive Alive # TOTAL VIABLE OOCYTES GV Meiotic Resumption* GVBD MI MII (n) % % % % % % % % % Control AB AB 9.33 B A 7.35 AB AB 5.88 A A A (4/7) (3/7) (7/75) (68/75) (5/68) (63/68) (4/68) (20/68) (39/68) DMSO AB AB B A 4.23 B A 8.45 A A A (9/13) (4/13) (13/84) (71/84) (3/71) (68/71) (6/71) (22/71) (40/71) DXR B A A B A B 2.04 A A A (13/28) (15/28) (28/77) (49/77) (7/49) (42/49) (1/49) (18/49) (23/49) A. oncocalyx B A A B AB AB 2.33 A A A (15/34) (19/34) (34/77) (43/77) (6/43) (37/43) (1/43) (15/43) (21/43) Onco A A B A B A B 4.26 A A A (28/39) (11/39) (39/86) (47/86) (8/47) (39/47) (2/47) (15/47) (22/47) A,B Distinct capital letters represent significant differences among treatments (P < 0.05) n Total number of analyzed oocytes per treatment * Includes GVBD, MI and MII oocytes # Oocytes stained positively with calcein-am (green) that presented an abnormal chromatin configuration (marked with Hoechst).

109 108 9 AUXEMMA ONCOCALYX E SEU COMPOSTO ATIVO ONCOCALYXONA A PREJUDICAM A COMPETÊNCIA DE DESENVOLVIMENTO OOCITÁRIO IN VITRO EM SUÍNOS, MAS SÃO MENOS PREJUDICIAIS DO QUE A DOXORRUBICINA Auxemma oncocalyx and its active compound oncocalyxone A impair in vitro porcine oocyte developmental competence but are less detrimental than Doxorubicin. Periódico: Planta medica (submetido) (ISSN: ) Qualis A2

110 109 RESUMO Diversas drogas anticancerígenas, como a doxorrubicina (DXR), possuem menor especificidade de ação, resultando em efeitos indesejáveis. Plantas são uma excelente fonte de substâncias na pesquisa de novas drogas. Auxemma oncocalyx (A. oncocalyx) e o seu componente, a oncocalixona A (Onco A) possuem atividade antitumoral e são menos tóxicos em relação à DXR no que se refere aos parâmetros reprodutivos. Entretanto, não existem estudos a respeito da ação dessas drogas no âmbito da competência oocitária in vitro e desenvolvimento embrionário no modelo suíno. Com isso, o objetivo deste estudo consistiu em avaliar os efeitos da adição de A. oncocalyx e Onco A durante a maturação in vitro (MIV) de oócitos (Experimento 1) ou cultivo in vitro de embriões (Experimento 2) no modelo suíno. Para o experimento 1, complexoscumulus-oócitos (CCOs) foram distribuídos no meio de MIV de modo isolado (controle) ou suplementado com DXR (0,3 ug/ml), A. oncocalyx (1,2 ug/ml) e Onco A (1 ug/ml). Em seguida, oócitos foram submetidos à fertilização in vitro (FIV) e posterior cultivo in vitro de embriões. Para o segundo experimento, CCOs foram submetidos à MIV e FIV, onde seus presumíveis zigotos foram cultivados com DXR, A. oncocalyx ou Onco A por 7 dias. A Viabilidade, maturação, fertilização e desenvolvimento embrionário foram parâmetros avaliados em ambos os experimentos. No experimento 1, DXR, A. oncocalyx e Onco A reduziram de modo significativo (P<0,05) a viabilidade oocitária e eficácia da MIV. Onco A aumentou de modo significativo (P<0,05) a retomada da meiose. Entretanto, os oócitos ficaram bloqueados no estágio de MII. Após a FIV, todas as drogas reduziram de modo significativo (P<0,05) a viabilidade, eficiência da FIV e percentual de zigotos clivados. No entanto, apenas DXR reduziu a percentagem de blastocistos. No experimento 2, todas as drogas reduziram de modo significativo (P<0,05) a percentagem de penetração, mas apenas DXR e Onco A reduziram (P<0,05) a eficiência da FIV. DXR e A. oncocalyx reduziram de modo significativo (P<0,05) o percentual de zigotos clivados, mas não afetaram a formação de blastocistos. Em conclusão, a adição de DXR durante a MIV ou CIV afetam negativamente a eficácia da FIV e taxa de clivagem. Em adição, a exposição dos CCOs à DXR somente durante a MIV foi mais prejudicial à viabilidade oociátia e formação de blastocisto quando comparado à A. oncocalyx e Onco A. Palavras-chave: Auxemma oncocalyx. Oncocalyxone A. Doxorrubicina. Maduração in vitro. Fertilização in vitro. Desenvolvimento embrionário.

111 110 Auxemma oncocalyx and its active compound oncocalyxone A impair in vitro porcine oocyte developmental competence but are less detrimental than Doxorubicin Leiva-Revilla J. 1, Maside C. 1, Vieira L. 1, Cadenas J. 1, Ferreira A.A. 1, Paes V.M. 1, Agiar F.L. 1, Celestino J.J.H. 2, Alves B. 1, Pessoa O.D.L. 3, Apgar G.A. 4, Toniolli R. 5, Rodrigues A.P.R. 1, Figueiredo J.R. 1*. 1 Laboratory of Manipulation of Oocytes and Preantral Follicles (LAMOFOPA). Universidade Estadual do Ceará, Fortaleza-CE, Brazil. 2 Institute of Health Sciences. Universidade da Integração Internacional da Lusofonia Afro-Brasileira. Acarape-CE, Brazil. 3 Department of Organic and Inorganic Chemistry. Universidade Federal do Ceará, Centro de Ciências. Fortaleza-CE, Brazil 4 Professor of Department of Animal Science, Food and Nutrition, Southern Illinois University-Carbondale, USA 5 Laboratory of Swine Reproduction and Semen Technology. Universidade Estadual do Ceará, Fortaleza-CE, Brazil. * Corresponding address: Laboratório de Manipulação de Oócitos e Folículos Pré-Antrais (LAMOFOPA). Universidade Estadual do Ceará (UECE). Av. Silas Munguba, 1700, Campus do Itaperi. Fortaleza CE Brasil. CEP: Tel.: ; Fax: address: jrf.lamofopapapers@gmail.com

112 111 ABSTRACT Most anticancer drugs like doxorubicin (DXR) have low specificity that results in undesirable effects. Plants are excellent sources when searching for new drugs. Auxemma oncocalyx (A. oncocalyx) and its main component oncocalyxone A (onco A) have antitumoral activity and are less toxic than DXR in reproductive parameters. However, there are no studies on the action of these drugs regarding the porcine in vitro oocyte competence and embryo development. The aim of this study was to evaluate the effect of A. oncocalyx and onco A exposure during in vitro maturation (IVM) of oocytes (Experiment 1) or in vitro embryo culture (IVC) (Experiment 2) on the oocyte developmental competence. For experiment 1, COCs were distributed in IVM medium alone (control) or supplemented with DXR (0.3 g/ml), A. oncocalyx (1.2 g/ml) and onco A (1 g/ml). Then, oocytes were submitted to in vitro fertilization (IVF) and in vitro embryo culture. For experiment 2, COCs were submitted to IVM and IVF and the presumptive zygotes were cultured with DXR, A. oncocalyx and onco A for 7 days. Viability, maturation, fertilization and embryo developmental parameters were evaluated in both experiments. In experiment 1; DXR, A. oncocalyx and onco A reduced (P<0.05) oocyte viability and IVM efficiency. Onco A increased (P<0.05) the meiotic resumption, however, oocytes were arrested at MI. After IVF, all the drugs reduced (P<0.05) viability, IVF efficiency and percentage of cleaved embryos, nevertheless, only DXR decreased the percentage of blastocyst. In experiment 2; all drugs reduced (P<0.05) the percentage of penetration, but only DXR and onco A decreased (P<0.05) IVF efficiency. DXR and A. oncocalyx decreased (P<0.05) the percentage of cleaved embryo, but had no effect on blastocyst formation. In conclusion, the addition of DXR during IVM or IVC negatively affected the IVF efficiency and cleavage rate. In addition, the exposure of COCs to DXR only during IVM was more detrimental to oocyte viability and blastocyst formation than A. oncocalyx and onco A. Keywords: Auxemma oncocalyx; Oncocalyxone A; Doxorubicin; in vitro maturation; in vitro fertilization; embryo development

113 112 Abbreviations Auxemma oncocalyx cgmp-dependent protein kinase Cumulus oocyte complexes Cyclic guanosine monophosphate Double-strand breaks Doxorubicin Germinal vesicle Germinal vesicle break down Hours post insemination In vitro embryo culture In vitro fertilization In vitro maturation Metaphase 1 Metaphase 2 Oncocalyxone A Poly (AND-ribose) polymerase Topoisomerase II Topoisomerases A. oncocalyx PKG COCs cgmp DSBs DXR GV GVBD hpi IVC IVF IVM MI MII Onco A PARP TOPO II TOPOs

114 Introduction Cancer is a target of research for the development or discovery of new forms of treatments [1]. Many drugs used in cancer chemotherapy, like doxorubicin (DXR), a widely used drug for different cancer types[2], have low specificity that results in undesirable effects. Studies show that DXR cause toxicity in both primordial follicles and growing ovarian follicles, triggering follicular and oocyte apoptosis [3], and eventually affect human fertility. Therefore, plants are excellent sources of raw material when searching for new anticancer drugs [4]. AuxemmA. oncocalyx (A. oncocalyx) is a common tree found in the state of Ceará in Northeast Brazil [5]. It has been widely used in folk medicine as an adjunctive treatment of injuries such as wounds and cuts [5,6]. Some studies have suggested that this plant has biological activities such as analgesic, antioxidant, antitumor and antiinflammatory effects [6 9].Oncocalyxone A (onco A) is A. oncocalyx s active compound. Onco A has high antioxidant activity [6] and an anti-proliferative effect on tumor cell cultures [10]. Studies have suggested onco A as a possible anticancer compound since it presents antitumor and cytotoxic activity in human leukemia cells, and other cell cancer lines, without causing genotoxicity [11] as most anticancer drugs. Little is known about reproductive toxicity of A. oncocalyx and onco A in mammals. In recent pioneer studies conducted by our group with caprine preantral follicles cultured in vitro enclosed in ovarian cortical tissue, A. oncocalyx and onco A affected in vitro caprine early folliculogenesis in a concentration-dependent manner [12]. However, no toxic effect of A. oncocalyx and onco A was observed on in vitro development of late caprine isolated secondary follicles. In contrast, these drugs affected the cumulus-oocyte complexes (COCs) viability after in vitro maturation but not the metaphase II rates (Leiva-Revilla et al., 2016 b under review). In both studies, DXR was used as positive (toxic) control and presented a more toxic effect than A. oncocalyx and onco A. These results suggest that A. oncocalyx and onco A despite of having anticancer effects they are, apparently, less harmful to reproductive parameters than commercial drugs, such as DXR. Normal embryonic development is preceded by a sequence of coordinate events during maturation and fertilization. The mechanism of oocyte maturation encompasses interactions between the oocyte and its surrounding cumulus cells, which synchronizes

115 114 meiosis with structural and molecular changes in the ooplasm, enabling the oocyte to support proper fertilization and subsequent embryo development [13]. Consequently, it is of high significance to study the toxic effect of new drugs over in vitro maturation, fertilization and embryo development. To the best our knowledge, there is no information about the influence of A. oncocalyx and onco A on the in vitro embryo development in mammals, including pigs. Compared to the other species, the porcine seems to be a suitable animal model for humans, due to the ovarian similarities [14].In addition, the advantage of using pig ovaries is that the ovaries are from animals at similar age, breed and controlled nutrition. Thus, the porcine specie has been quite used as a model for human oocytes in toxicity tests [14]. Therefore, the aim of this study was to evaluate the effect of A. oncocalyx and onco A exposure during in vitro maturation of oocytes (Experiment 1) or in vitro embryo culture (Experiment 2) on the oocyte developmental competence, investigating the following end points: oocyte viability, maturation rates and efficiency, in vitro fertilization parameters and percentage of cleaved embryos and blastocyst formation. 2. Results 2.1. Experiment 1. Effect of A. oncocalyx and onco A on IVM of porcine COCs and subsequent embryo development. The rates of oocyte viability and maturation after exposure to DXR, A. oncocalyx and onco A are shown (Table 01). Take into account the total number of COCs submitted to IVM, the DXR, A. oncocalyx and onco A treatments showed a significant lower percentage of oocyte viability and maturation than control. Except for oocyte viability, A. oncocalyx and onco A showed similar results for the aforementioned endpoints being both higher (P < 0.05) than DXR. However, when only viable oocytes were considered to calculate the maturation rate no differences were observed among treated groups (DXR, A. oncocalyx and onco A). To determine the meiotic resumption and MI rates only viable oocytes were used. The percentage of meiotic resumption in the onco A treatment and rate of MI in the A. oncocalyx and onco A treatments were similar to DXR but higher (P < 0.05) than control.

116 115 The exposure of COCs to DXR, A. oncocaly and onco A during IVM reduced significantly the IVF efficiency when compared to the control treatment (Table 2). However, when only matured oocytes were taken into account the penetration and monospermy rates as well as the number of spermatozoa/oocyte were similar (P > 0.05) among the treatments. When the COCs were exposed to the three tested drugs during IVM (Figure 2), DXR, A. oncocalyx and onco A treatments showed lower (P < 0.05) cleaved rates compared to control. This endpoint was higher in the onco A treatment than DXR and A. oncocalyx treatments. With regard to blastocyst rate, lower (P < 0.05) values were observed in the DXR treatment Experiment 2. Effect of A. oncocalyx and onco A on the in vitro culture of porcine embryos. Contrary to the experiment 1, where the COCs were exposed to the tested drugs during IVM, in the experiment 2, only the in vitro presumptive zygotes were exposed to DXR, A. oncocalyx and onco A for 18 hpi (Table 3). There was no difference (P > 0.05) between control group and other treatments regarding to viability and maturation rates. However, DXR and onco A showed a lower percentage (P <0.05) of viability than A. oncocalyx. All the tested treatments reduced (P < 0.05) the penetration rate compared to control treatment. Onco A, but not A. oncocalyx reduced significantly the monospermy and IVF efficiency, and increased (P < 0.05) the number of spermatozoa/oocyte. The IVF efficiency was also reduced (P < 0.05) when DXR was added to the control medium. The exposure of presumptive zygotes to onco A did not change either the cleavage or blastocyst rates comparing control (Figure 3). The addition of DXR and A. oncocalyx to the control medium only reduced (P < 0.05) the cleavage rate. 3. Discussion and conclusion To our knowledge, the present study demonstrated for the first time the effect of A. oncocalyx and its isolated compound, onco A, on the in vitro maturation of porcine oocytes and subsequent in vitro embryo development.

117 116 When the three tested drugs exposure occurred only during IVM (Experiment 1), DXR, A. oncocalyx and onco A had a detrimental effect on the oocyte viability, being DXR the most toxic with only % viable oocytes after 44h of exposure. It is known that DXR acts on several levels by different molecular mechanisms including an interaction with iron, upsetting calcium homeostasis, altering the activity of intracellular or intra-mitochondrial oxidant enzymes, and binding to topoisomerases (TOPOs) promoting their dysfunction leading to DNA damage and apoptosis [17]. Specifically, DXR acts by inhibiting Topoisomerase II (Topo II). In the female, Topo II is required for chromosome separation during oocyte meiotic maturation, but is dispensable for resumption of meiosis [18]. On the other hand, A. oncocalyx and onco A also disrupt oocyte viability and caused damage in the chromatin configuration. Sbardelotto [19] showed that, in human promyelocytic leukemia line (HL-60) cells, onco A activates first the intrinsic apoptotic pathway by caspase 8, and then the extrinsic pathway by caspase 3 and 7. Contrary to DXR, onco A does not affect the TOPOs. However, in HL-60 cells, onco A cleaved poly (ADP-ribose) polymerase (PARP) [19]. PARP binds and repair DNA-strand breaks generated by genotoxic agents. Likewise, PARP is implicated in the regulation of a wide range of important cellular processes including transcriptional regulation, chromatin modification, cellular homeostasis, and cell proliferation and death [20]. Therefore, cleaved PARP results in an oocyte proapoptotic protein [21]. A study conducted in porcine showed that the cleavage of PARP1 was strongly implicated in follicular development and atresia of fetal, neonatal, and adult porcine ovaries [20]. In addition, PARP-1 synthesize PAR, which is required for assembly and function of the bipolar spindle [22]. PARP-1 also mediates the regulation of centrosome duplication and chromosomal stability. The inhibition of PARP-1 is associated with mislocalization of centromeric and centrosomal proteins, defective chromatin modifications and genomic instability characterized by loss of mitotic checkpoint integrity [23]. In the present study, the IVM efficiency was compromised in all treatments compared to control treatment. Interestingly, onco A increased the meiotic resumption rates. However, these oocytes were arrested at the MI stage. Anticancer drugs can cause double-strand breaks (DSBs). These DSBs do not arrest mouse oocytes in the G2/prophase but, instead, allow them to progress to the MI stage [24]. The exposure of oocytes to genotoxic agents, such as PARP inhibitors, causes failures in the spindle assembly checkpoint, leading to an oocyte meiotic arrest at MI [24]. Another study

118 117 showed that damage in the microtubules, main structural elements of the spindle, result in oocytes arrest at the MI stage during in vitro maturation in mouse [25]. Our results suggest that onco A might be affecting the oocyte chromatin configuration, through PARP inhibition, leading to failures in the spindle assembly checkpoint and therefore causing this meiotic arrest at the MI stage. In the present study, the exposure of COCs to the tested drugs only during IVM negatively affected the IVF efficiency. Even tough DXR, A. oncocalyx and onco A reduced embryo cleavage rate, only DXR showed a more toxic effect on blastocyst development. DXR elicits apoptosis by various mechanisms in a variety of cells. DXR is capable to accumulate in both nucleus and mitochondria and induce chromosomal obliteration by inhibiting Topo-II. In oocytes, it can interfere with mitochondrial function and start the intrinsic pathway of apoptosis via the mitochondria by reducing the mitochondrial membrane potential and releasing cytochrome C [26]. Impaired mitochondrial function lead to improper fertilization and a reduction of embryo development [27]. When DXR, A. oncocalyx and onco A were added only during the in vitro embryo culture (Experiment 2), all drugs negatively affected the penetration rate evaluated after 18 hpi. However, DXR and onco A showed a detrimental effect on IVF efficiency. Nonetheless, only onco A augmented the percentage of spermatozoa per oocyte. Ferreira et al. [28] showed that onco A was able to inhibit platelet aggregation by increasing the cyclic guanosine monophosphate (cgmp) levels in platelets by a synergistic mechanism, combining increased production and reduced degradation of cgmp [28]. In porcine, cgmp activates cgmp-dependent protein kinase (PKG). This pathway plays an essential role in acrosome reaction, which enables the spermatozoa to penetrate the zona pellucida, and therefore, to fuse with the oocyte plasma membrane [29]. Zhang [30] observed that when a cgmp analog, atrial natriuretic peptide (ANP), was added during IVF of frozenthawed giant panda sperm with porcine salt-stored oocytes, it resulted in a higher proportion of oocytes with spermatozoa in the zona pellucida and perivitelline space, and a higher average number of spermatozoa/oocyte. In experiment 2, DXR, A. oncocalyx and onco A negatively affected the cleavage rate. Wang et al [31] showed that DXR blocked pre-implantation development in early mouse embryos by altering apoptosis-related gene expression, Bcl2l1 and Casp3, and

119 118 inactivating DNA repair by PARP. In the same study, the authors found out that DXR arrested zygotes at the 1-cell stage by disruption of DNA and of the cytoskeleton. In addition, it is known that during blastocyst formation, the inhibition PARP suppresses selective autophagic degradation of ubiquitinated proteins, which contributes to apoptosis [32]. Thus, the interaction between PARP and autophagy influences the quality of in vitro produced embryos in porcine [33]. Due to the fact that onco A affects PARP in HL-60 cells [19], and that A. oncocalyx contains 80% of onco A in its composition [9], both drugs could be affecting embryonic competition by this pathway. Moreover, a study evaluating different concentrations (1 to 100 µg/ml) of a quinone fraction of A. oncocalyx in sea urchin eggs reported that the cleavage of eggs was inhibited in a concentrationdependent manner [34]. Despite the fact that DXR, A. oncocalyx and onco A reduced porcine embryo cleavage rate, they did not affect blastocyst development, showing that porcine blastocyst tend to be more resistant to toxic agents [35]. In conclusion, the addition of DXR during IVM or IVC negatively affected the IVF efficiency and cleavage rate. In addition, the exposure of COCs to DXR only during IVM was more detrimental to oocyte viability and blastocyst formation than A. oncocalyx and onco A. 4. Materials and methods 4.1. Culture media All chemicals used in the present study were purchased from Sigma Chemical Co. (St. Louis, MO, USA) unless otherwise indicated. The medium used for the collection of cumulus-oocyte complexes (COCs) and for washing was Dulbecco s phosphate-buffered saline (DPBS) medium composed of mm NaCl, 2.68 mm KCl, 8.1 mm Na2HPO4 and 1.46 mm CaCl2 2H2O supplemented with 4 mg/ml bovine serum albumin (BSA), 0.34 mm sodium pyruvate, 5.4 mm D-glucose and 70 µg/ml kanamycin (mdpbs). The oocyte maturation medium was modified-tcm 199supplemented with 150 µm cisteamine and 10 ng/m Lepidermal growth factor(tcm ) [15]. The basic medium used for fertilization was essentially the same as that used by Abeydeera and Day [16]. This medium, designated as a modified Tris-buffered medium, consisted of mm NaCl, 3 mm KCl, 7.5 mm CaCl2 2H2O, 20 mm Tris (crystallized free base), 11 mm

120 119 glucose and 5 mm sodium pyruvate supplemented with 2 mm caffeine and 0.2% BSA. The embryo culture medium was a sequential medium based on NCSU-23 supplemented with 0.4% BSA[15] Isolation of onco A from A. oncocalyx The obtaining of the A. oncocalyx and onco A has previously been described by Pessoa et al.[11]. Briefly, A. oncocalyx was collected and identified by Dr. Maria Iracema B. Loiola of the Department of Biology of Federal University of Ceará. Onco A (C17H18O5) was extracted from woody parts of A. oncocalyx (Boraginaceae) by phytochemical extraction methods using organic solvents, and was isolated and purified by crystallization and recrystallization. It is noteworthy that the fraction of A. oncocalyx contains 80 % of onco A [9], therefore the concentration of A. oncocalyx was in equal proportion of onco A. A. oncocalyx and onco A were diluted with DMSO as a vehicle. The concentrations of A. oncocalyx and onco A were chosen based on previous studies performed in our laboratory [12] Experimental design Experiment 1: Effect of A. oncocalyx and onco A on IVM of porcine COCs and subsequent embryo development In this experiment, the effect of DXR, A. oncocalyx and onco A on in vitro maturation (IVM) of porcine COCs and subsequent embryo development was evaluated (Figure 1). Immediately after oocyte recovery, COCs were allocated into four treatments to carry out IVM: I) TCM alone (control), or supplemented with II) 0.3 g/ml DXR; III) 1.2 g/ml A. oncocalyx or IV) 1 g/ml onco A. After IVM, oocyte chromatin configuration and viability were assessed. Moreover, oocytes from each group were pooled, exposed to spermatozoa and cultured for 18 hours post insemination (hpi) to assess fertilization parameters or for 7 (168 hpi) days to evaluate embryo development. Experiment 2: Effect of A. oncocalyx and onco A on the in vitro culture of porcine embryos. COCs were submitted to IVM and IVF as described for experiment 1 (control group), and presumptive zygotes were randomly allocated into four treatments for in vitro embryo culture (IVC): I) NCSU-23 alone (control) or supplemented with II) 0.3 g/ml

121 120 DXR; III) 1.2 g/ml A. oncocalyx or IV) 1 g/ml onco A. The presumptive zygotes were cultured for 18 hpi to assess fertilization parameters or for 7 days (168 hpi) to evaluate embryo development (Figure 1) Oocyte collection and IVM Ovaries were obtained from prepuberal gilts at a local slaughterhouse and were transported in 0.9% NaCl containing 70 µg/ml kanamycin, at 33 C within 1 h. In the laboratory, COCs were aspirated from medium-sized follicles (3 to 6 mm in diameter) using an 18-gauge needle connected to a 10-mL disposable syringe. Oocytes with a compact cumulus mass and a dark, evenly granulated cytoplasm were washed three times in maturation medium, and oocytes were transferred into each well of a 4-well multidish (Nunc, Roskilde, Denmark) containing 500-µL of maturation medium supplemented with 10 IU/mL pregnant mare's serum gonadotropin and 10 IU/mL human chorionic gonadotropin for h. The oocytes were then incubated for another h in maturation medium without hormones. Oocyte maturation was carried out under mineral oil at 39ºC in a humidified atmosphere of 5% CO2 in air. After maturation, COCs were mechanically denuded in maturationmedium and washed twice in maturation medium In vitro fertilization and embryo culture. Denuded oocytes were washed three times in pre-equilibrated fertilization medium and fertilized as previously described [15].Briefly, groups of 30 denuded oocytes were then placed in 50-µL drops of fertilization medium in a 35x10-mm Petri dish under mineral oil and held at 38.5ºC in an atmosphere of 5% CO2 in air for approximately 30 min until the addition of spermatozoa. Pool of freshly ejaculated semen diluted in extender from a three boars was obtained from a local breeding station. The semen was washed three times by centrifugation at 1900 x g for 3 min in mdpbs. The resulting pellet was re-suspended in fertilization medium, and after the appropriate dilution, 50 µl of this sperm suspension was added to a 50µL drop of fertilization medium containing the oocytes. The spermatozoa:oocyte ratio was 2000:1. The gametes were co-incubated at 38.5ºC in a humidified atmosphere of 5% CO2 in air for approximately 4 h. Presumptive zygotes were removed from the fertilization medium and washed three times in pre-equilibrated embryo culture medium. The zygotes were then transferred

122 121 to a 4-well multidish (30 zygotes per well), with each well containing 500 µl of the same medium under mineral oil, and were cultured at 38.5ºC in a humidified atmosphere of 5% CO2 in air. Presumptive zygotes were cultured for the first 2 days (Day 0 = day of fertilization) in glucose-free NCSU-23 supplemented with 0.33 mm pyruvate and 4.5 mm lactate and then in fresh NCSU-23 medium containing 5.5 mm glucose until day Assessment of oocyte chromatin configuration, viability, sperm penetration and embryo development To evaluate maturation and fertilization parameters, denuded oocytes and presumptive zygotes were washed in PBS-BSA, and incubated in 500 µl droplets containing 4 µm calcein-am, 2 µm ethidium homodimer-1 (Molecular Probes, Invitrogen, Karlsruhe, Germany), 0.5% of glutaraldehyde and 10 µm Hoechst for 15 min. The maturation rate was assessed at 44h of IVM. The chromatin configuration patterns were the following: abnormal chromatin configuration, germinal vesicle (GV) or meiotic resumption. Meiotic resumption was defined when the nucleus was in germinal vesicle break down (GVBD), metaphase I (MI) or in metaphase II (MII) stages. Maturation efficiency was calculated by MII/total oocytes cultured. Thereafter, oocytes were also examined under a fluorescence microscope (Nikon, Eclipse 80i, Tokyo, Japan) for evaluation of live/dead fluorescent staining. The emitted fluorescent signals of calcein-am and ethidium homodimer-1 were collected at 488 and 568 nm, respectively. Oocytes were considered viable when the cytoplasm was stained positively with calcein- AM (green) and chromatin was not labelled with ethidium homodimer-1 (red) and they showed a normal chromatin configuration. Fertilization parameters were evaluated at 18 hpi. The oocytes were considered penetrated when they contained one or more swollen sperm heads and/or male pronuclei, with their corresponding sperm tails, and two polar bodies. The fertilization parameters evaluated were penetration rate (number of oocytes penetrated/total matured), monospermy (number of oocytes containing only one male pronucleus/total penetrated), number of spermatozoa/oocyte (mean number of spermatozoa in penetrated oocytes), and efficiency of fertilization (number of monospermic oocytes/total inseminated). At 2 and 7 days after IVF, the cleavage rate (number of oocytes divided to 2 4 cells/total) and blastocyst formation rate (number of blastocyst/total cleaved),

123 122 respectively, were evaluated under a stereomicroscope. An embryo that had cleaved to the two-cell stage or beyond was counted as cleaved, and an embryo with a clear blastocele was defined as a blastocyst 4.7. Statistical analyses Statistical analysis was conducted with Sigma Plot 11.0 (Systat Software Inc., USA). For percentage comparison between treatments, chi-square test and Fisher's exact test were used. Data of means comparison among treatments of n spermatozoa/oocyte was performed by Mann-Whitney test. Data was presented as mean (± SEM) and percentages. In all cases, a probability of P<0.05 indicated a significant difference. 5. Acknowledgements This research was financially supported by CNPq, CAPES and FUNCAP. The authors thank Thalles Gothardo Pereira Nunes and Renato Felix da Silva, for assistance with this study. 6. Conflicts of Interest We wish to confirm that there are no known conflicts of interest associated with this publication and there has been no significant financial support for this work that could have influenced its outcome.

124 Figures and tables Figure 1. Experimental design and endpoints of experiment 1 and 2. In vitro maturation (IVM), in vitro fertilization (IVF), in vitro embryo culture (IVC), hours post insemination (hpi).

125 124 Table 1. Rates of viable oocytes, germinal vesicle (GV), meiotic resumption and metaphase II (MII) rates, after in vitro maturation of porcine oocytes in control medium alone or supplemented with DXR, A. oncocalyx or onco A (experiment 1). Maturation Oocyte chromatin configuration Efficiency Treatments Total Viable oocytes Meiotic GV GVBD MI MII MII / total resumption* (n) % % % % % % % Control (128/157) A 7.81 (10/128) A (118/128) B 2.34 (3/128) (34/128) B (81/128) A (81/157) A DXR (24/187) D 8.33 (2/24) A (22/24) AB (11/24) AB (11/24) AB 5.88 (11/187) C A. oncocalyx (88/181) C 7.95 (7/88) A (81/88) B (52/88) A (29/88) B (29/181) B Onco A (97/163) B 1.03 (1/97) A (96/97) A (63/97) A (33/97) B (33/163) B A,B,C,D Distinct capital letters represent significant differences among treatments (P < 0.05). n Total number of analyzed oocytes per treatment. * Includes GVBD, MI and MII oocytes.

126 125 Table 2. Rates of viable oocytes, matured, penetrated, monospermy and efficiency rates and number of spermatozoa per oocyte after previous exposure (only during in vitro maturation) to DXR, A. oncocalyx or onco A(experiment 1). Endpoints * Penetrated / Monospermy / IVF Efficiency Total Viability Matured / viable Treatments matured penetrated (2pn/total) # SPZ / oocyte (n) % % % % % % Control (197/251) A (191/197) A (128/191) A (73/128) A (73/251) A A DXR (66/170) C (62/66) A (48/62) A (25/48) A (25/170) B A A. oncocalyx (200/291) B (155/200) B (119/155) A (54/119) A (54/291) B A Onco A (168/252) B (141/168) B (98/141) A (50/98) A (50/252) B A A,B,C Distinct capital letters represent significant differences among treatments (P < 0.05). n Total number of analyzed oocytes per treatment. * All the endpoints were evaluated 18 hpi.

127 Figure 2. Percentage of cleaved (A) and blastocyst/cleaved (B) after previous exposure (only during in vitro maturation) to DXR, A. oncocalyx or onco A, only. a,b,c Distinct letters represent significant differences among treatments (P < 0.05) (experiment 1). 126

128 127 Table 3. Rates of viable oocytes, matured, penetrated, monospermy and efficiency rates and number of spermatozoa per oocyte after 18hpi exposure (only during in vitro embryo culture) to DXR, A. oncocalyx or onco A (experiment 2). Endpoints * Treatments Total Viability Matured / viable Penetrated / matured Monospermy / penetrated Efficiency (2pn/total) # SPZ / oocyte (n) % % % _% % % Control (51/71) AB (49/51) A 85.71(42/49) A (23/42) A (23/71) A B DXR (52/87) B (51/52) A 64.7 (33/51) B (15/33) AB (15/87) BC AB A. oncocalyx (66/88) A (62/66) A (43/62) B (22/43) AB 25 (22/88) AC B Onco A (43/73) B (42/43) A (25/42) B 28 (7/25) B 9.59 (7/73) B A A,B,C Distinct capital letters represent significant differences among treatments (P < 0.05). n Total number of analyzed oocytes per treatment. * All the endpoints were evaluated 18 hpi.

129 Figure 3. Percentage of cleaved (A) and blastocyst / cleaved (B) after exposure (only during in vitro embryo culture) to DXR, A. oncocalyx or onco A. a,b Distinct letters represent significant differences among treatments (P < 0.05) (experiment 2). 128