MICROBIOLÓGICOS PARA CONTROLE DE QUALIDADE DE ALIMENTOS

Tamanho: px
Começar a partir da página:

Download "MICROBIOLÓGICOS PARA CONTROLE DE QUALIDADE DE ALIMENTOS"

Transcrição

1 MÉTODOS DE ANÁLISES MICROBIOLÓGICOS PARA CONTROLE DE QUALIDADE DE ALIMENTOS Controle de Qualidade na indústria Alimentos USFM- 19/09/2009 Msc. Vania Tronco VERUS SEGURANÇA AMBIENTAL E ALIMENTAR

2 ESCOLHA DOS MÉTODOS M DE ANÁLISES FERRAMENTAS PARA GARANTIR A QUALIDADE DA SUA PRODUÇÃO

3 ANÁLISES MICROBIOLÓGICAS SÃO FUNDAMENTAIS PARA: - segurança alimentar - qualidade geral dos alimentos produzidos - medidas profiláticas -comercialização no mercado internacional e nacional

4 EFICIÊNCIA E RAPIDEZ medidas tomadas na hora certa Garantia de resultados

5 Conceitos básicos de prevenção e controle da contaminação alimentar e doenças transmitidas alimentos sugerem: Melhorar qualidade higiênica de alimentos crus (BPP ou BPA); BPF utilizando tecnologias de processamento adequadas; BP em toda a cadeia alimentar...

6 GAP - Boas Práticas Agrícolas

7 GMP - Boas Práticas de Fabricação

8 SSOP /PPOH (Sanitation Standard Operating Procedures ) PROCEDIMENTOS PADRONIZADOS DE OPERAÇÃO DE SANITIZAÇÃO:

9 PRP - Programa de Redução de Patógenos

10 NOVOS MÉTODOS M PARA ANÁLISES DE ALIMENTOS 1. simplificação dos tradicionais 2. atividade enzimática 3. atividade antigênica 4. moleculares 5. combinação

11 ESCOLHA DO MÉTODO M DIAGNÓSTICO - capacidade física operacional -volume de testes analíticos - rastreabilidade - validações internacionais, nacionais e internas -rapidez na liberação de resultados -Capacidade e custo de estocagem - custo / benefício

12 Métodos Rápidos M étodo Rápido Por que utilizar? Escolha Aprovação Praticidade Sensibilidade Seletividade Rapidez

13 Métodos rápidos: Vantagens em tempo de análise e liberação de resultados analíticos Possibilidade de eliminar etapas de trabalho intensivo Potencial para automação Sempre cumprem com procedimentos de incubação ainda necessariamente ELISA e PCR são dominantes Falta de um procedimento comum de validação A maioria apresenta dificuldade de aceitação para fins oficiais

14 Métodos rápidos: Avanços em Métodos de Contagens de células viáveis Miniaturização e Kits de Diagnóstico, Técnicas de Identificação Bioquímica Métodos baseados em anticorpos Separação Imunomagnética Ensasios baseados em ácidos nucleicos Biosensores Microships Citometria de Fluxo Técnicas baseadas em Bacteriófagos ATP bioluminescência Bioluminescência adenilato quinase Riboprinter e Pulse-Field Gel Electroforese

15

16 Os Métodos Microbiológicos podem ser divididos em: tradicionais ( convencionais ) métodos rápidos

17

18

19

20

21 IDENTIFICAÇÃO BACTERIANA pode ser feita por avaliação características microbianas FENOTÍPICAS GENOTÍPICAS

22 METODOLOGIAS DISPONÍVEIS FENOTÍPICAS O QUE CONSIGO VISUALIZAR! - Metodologia tradicional - Padrão ouro - Kits prontos - ELISA tradicional - ELISA kit visual ou automatizado.

23 Problemas com os métodos tradicionais: Sensibilidade insuficiente Especificidade: nem sempre ocorre(podem haver falsos negativos) Repetibilidade: nem sempre se o teste for repetido por um mesmo operador inúmeras vezes se obtém o mesmo resultado Reprodutibilidade: capacidade de gerar resultados estatísticamente iguais (nem sempre ocorre)

24 Métodos convencionais: Os métodos convencionais usam a cultura de microrganismos em placas contendo ágar São laboriosos e consomem muito tempo operacional 84% de todos os testes são baseados na contagem de células viáveis Requerem controle de agências regulatórias nacionais e internacionais para controle oficial

25 Depende da integridade fisiológica bacteriana - Injúria, alterações - processamento; - Controles - meios de cultura, pessoal e equipamentos e tempo. TRADICIONAL limitações prováveis: veis:

26 - Quantidade/qualidade - provas bioquímicas; - Padrão de decisão - Chaves dicotômicas TRADICIONAL L I M I T A Ç Õ E S MULTIPLICIDADE DE ETAPAS

27 Dependendo do no. de análises: - perigo de contaminação cruzada; - muitas etapas a serem validadas; - limitada área física e pessoal. L I M I T A Ç Õ E S TRADICIONAL

28 BIOINDICADORES - KITS - maior no. análises/dia - diminuição de etapas validadas - menor perigo de contaminação - devem ser aprovados/validados TRADICIONAL

29

30

31

32

33

34

35

36

37 Métodos rápidos alternativos como Técnica fluorogênica: adiciona o MUG ( 4 metil umbeliferil beta-d-glucoronídeo): Através da enzima beta-glucoronidase (maioria das cepas de E.coli) o MUG é transformado em uma umbiliferona fluorescente quando observada na luz ultravioleta de onda longa (após 24 hs) Aplicação prática: esta determinação é fundamental na avaliação da condição higiênica do processamento de alimentos( a técnica tradicional tubos(nmp) muito lenta pode durar até 5 dias!

38 Métodos para Contagens de microrganismos:baseados na multiplicação microbiana Método tradicional (plaqueamento); Método de plaqueamento em espiral; Placas Compact Dry; Placas de Petrifilm; Placas do Simplate; Métodos alternativos: para NMP (técnica fluorogênica); Métodos alternativos: adição de substratos cromogênicos:(adição de X-Gal, X-Gluc., Salmon.-Gal no isolamento de microrganismos)

39 COMPACT DRY Enzimas cromogênicas: revela características específicos de um grupo, gênero ou espécie.

40 Placas de Compact Dry: - Prontas para uso - Reduz as horas de trabalho. - Permite aumento de produtividade e eficiência. - Uso em análises de matérias primas ou produtos acabados como alimentos, bebidas, carne e outros.

41 VANTAGENS DO COMPACT DRY Shelf life de 18 a 24 meses sem refrigeração. Atende às BPL - maior segurança por possuir tampa. A amostra se difunde sozinha e rapidamente pela placa, sem necessitar de difusores ou outros instrumentos. Sem limite de empilhamento - menor espaço na incubadora.

42 - Espaço tridimensional - excelente crescimento dos bolores e leveduras. VANTAGENS DO COMPACT DRY - Facilidade para checar ou repicar as colônias - forma idêntica ao que faria nas placas tradicionais. - Rápida manipulação sem etapas de preparação de meios de cultura, esterilização de vidraria, etc. - Manual traduzido em vários idiomas, inclusive português.

43 DISPONIBILIDADE Contagem total TC Bolores e leveduras YM Colif. totais e E. coli EC Coliformes termotolerantes CF

44 O QUE POSSO ANALISAR? Contagem total TC Bolores e leveduras YM

45 O QUE POSSO ANALISAR? Coliformes totais e E. coli EC Coliformes fecais CF

46 COMO ANALISAR? As placas já possuem tudo o que você precisa! É só abrir e adicionar 1mL da amostra ou da diluição e incubar pelos tempos/temperaturas recomendados!

47 Compact Dry TC Para contagem total de bactérias viáveis. Resultados em 24 a 48 horas Bactérias formam colônias vermelhas

48 Compact Dry YM Contagem de bolores e leveduras. Resultados em 3 a 5 dias Leveduras formam colônias azuis ou verdes

49 Compact Dry EC Contagem de coliformes totais e E. coli Resultados em 24 horas E. coli forma colônia azul Coliformes totais formam colônias vermelhas

50 Compact Dry CF Contagem de coliformes totais Resultados em horas Coliformes totais formam colônias esverdeadas

51

52 APROVAÇÕES Certificado Performance Tested Method AOAC: - Compact Dry EC: Compact Dry CF: Compact Dry TC: Compact Dry YM:100401

53

54

55 Monitoramento de Higiene Necessidade de se desenvolver métodos de tempo real para monitorar procedimentos de limpeza e higienização(detecção de resíduos de matéria orgânica e ATP de células bacterianas Métodos devem ser baratos, robustos ATP bioluminescência

56 Sistema detecta: ATP residual em superfícies A molécula de ATP pode ser encontrada em células viáveis; células não microbianas (sangue, carne..) Sistema rápido para monitoramento de higiene de processos produtivos na indústria alimentícia Sistema preventivo para tomada de medidas rápidas e efetivas(resultado em tempo real)

57 PRINCÍPIO PIO DO TESTE ESTABILIDADE! TECNOLOGIA DE RECICLAGEM

58 Mecanismo da reação Luciferina (LH 2 )+ATP+Mg++ enzima luciferase forma complexo ELH 2 +AMP+PP Em presença de oxigênio temos: oxiluciferina+amp +CO 2 + LUZ (medida com Luminômetro) AMP (Adenosina Monofosfato) ATP( Adenosina Trifosfato) PP (Pirofosfato) ELH 2 (complexo luciferase-luciferina-amp)

59 LUMITESTER

60 REALIZANDO O TESTE Passar o aplicador LuciPac na superfície previamente definida

61 REALIZANDO O TESTE Voltar o aplicador no tubo e injetar o pino para abrir a cápsula dos reagentes.

62 REALIZANDO O TESTE Agitar o LuciPac várias vezes para que o líquido escoe.

63 REALIZANDO O TESTE Colocar o LuciPac na câmara do Lumitester, fechar a tampa. ENTER

64 LENDO O RESULTADO! ENTER LEITURA EM 10 SEGUNDOS! Limiar 1 ou inferior Limiar >1 e < 2 Limiar 2 excedido A (aceito) B (atenção) C (rejeitado)

65 RESUMINDO... LEITURA DOS RESULTADOS! 10

66

67

68

69

70

71 Imunoensaios: ELISA (com tecnologias diversas), Imunocromatografia Sistemas totalmente automatizados Novos anticorpos recombinantes e técnicas de impressão molecular para melhorar a sensibilidade e versatilidade

72 ELISA KIT FENOTÍPICAS Devem possuir APROVAÇÃO!

73 - Resultados - qualidade dos anticorpos; - sensibilidade x especificidade; ELISA - KIT - Relação quantitativa Ag x Ac variabilidade; - Nível de detecção pode variar com o sorovar. FACILITAM A ROTINA TESTES DE TRIAGEM!

74 ELISA - KIT - Resultados devem ser confirmados; - Versatilidade quanto aos alvos; - Capacidade operacional compatível com o número de análises necessárias. - LIMITAÇÕES - falsos positivos??

75

76 Fundamento dos testes ELISA:

77 REAÇÕES ANTÍGENO-ANTICORPO ELISA: Ensaios Imunoabsorventes de Enzima Ligada 1. Se adiciona a amostra suspeita 2. Ac primários não são facilmente removíveis da fase sólida 3. No caso de ser positiva, os Ag ficam presos aos Ac primários fixados 4. Ac primários selecionados se fixam 5. Se adicionan Ac secundários marcados com enzima contra Ag buscados 6. Os Ac secundários se unen ao AG 7. Se libera substrato complementar a enzima 8. Se o conjugado se formou, reage com o substrato por colorimetría

78 Lateral Flow System para Listeria, Salmonella e E.coli O 157

79 LFS Listeria sp DuPont Resultados em 40 a 42 horas.

80 LFS Listeria sp minimize etapas com confiabilidade Amostra + meio LFS c/ suplemento. Ferva em BM por 5 minutos. LFS Listeria Adicione a fita LFS e aguarde 10 min. Incube a 30ºC horas. Adicione a amostra ao tubo. (-) LFS Listeria LFS Listeria (+) Retire a fita e realize a leitura.

81 LFS E. Coli O:157 rapidez na triagem Resultado em 8 a 18 horas

82 LFS E. Coli O157 resultados em 8 hs Pese a amostra no meio LFS. Ferva em BM por 5 minutos. LFS Listeria Adicione a fita LFS no tubo Incube a 42ºC por 8 a 18 hs. Adicione 0,5mL ao tubo de prova. Após 10 min. realize a leitura.

83 LFS Salmonella Resultados em 27 horas

84 LFS Salmonella Amostra + o meio LFS Adicione 1mL do TT Hajna ao tubo. Ponha a fita LFS no tubo. Incube a 42 o C / 8 a 18 hs. Repique 1mL em TT Hajna, -19 hs/42 o C Após 10 min realize a leitura.

85 Teste de ELISA (lateral flow system):

86

87

88

89

90 MÉTODOS GENOTÍPICOS - Segurança e rapidez nos resultados. - Disponível para patógenos e bioindicadores.

91 METODOLOGIAS DISPONÍVEIS GENOTÍPICAS - PCR tradicional - PCR automatizado - PCR real time EFICIÊNCIA NA DETECÇÃO!

92 GENOTÍPICOS PCR tradicional - Dependente da seleção e qualidade do primer - Necessidade de otimização das reações; - Muitas e delicadas etapas. INCOMPATÍVEL COM A ROTINA DE UMA INDÚSTRIA

93 - Mão de obra especializada; ambiente adequado; - Perigo de contaminação. GENOTÍPICOS PCR tradicional

94 BAX SYSTEM AUTOMATIZADO UM MUNDO DE INOVAÇÕES TECNOLÓGICAS DISPONÍVEL PARA A GARANTIA DOS ALIMENTOS!

95 BAX PCR automatizado Qualitativo /Quantitativo - Primers já testados e validados; - Aprovações e validações. PESQUISAS CONSTANTES GARANTINDO DIFERENÇAS TECNOLÓGICAS! FACILITA A ROTINA E DIMINUI INTERFERÊNCIAS!

96 BAX System Método de PCR para análises de patógenos

97 BAX SYSTEM Detecção de DNA ou RNA PCR automatizado PCR em tempo real EFICIÊNCIA NA DETECÇÃO!

98 METODOLOGIAS DISPONÍVEIS GENOTÍPICAS - PCR tradicional - PCR automatizado - PCR real time EFICIÊNCIA NA DETECÇÃO!

99 BAX SYSTEM Primers testados e validados; Aprovações e validações. PESQUISAS CONSTANTES GARANTINDO DIFERENÇAS TECNOLÓGICAS! FACILITA A ROTINA E DIMINUI INTERFERÊNCIAS!

100 BAX SYSTEM POUCAS ETAPAS = MENOR no. DE CONTROLES E VALIDAÇÕES INTERNAS ETAPAS - Pré-enriquecimento; - Extração do DNA; - Amplificação; Resultados rastreáveis

101

102 Método automatizado e simplificado 1. Prepare o DNA 2. Amplifique o DNA 3. Detecte o DNA

103 O que acontece com os tubos no Bax?

104 - O que é PCR? INTRODUÇÃO Reação em Cadeia da Polimerase Desenvolvido em 1983 por Kary Mullis. Prêmio Nobel em Química 1993; Cópias idênticas de determinada sequência de DNA

105 CONCEITOS - PCR ANÁLISE GENOTÍPICA

106 CONCEITOS - PCR Cópias identicas da sequência de DNA alvo ATCTGCTGCTAATCCGATACGTGTCCCAAGGGTCTA TCCCAGAT ATCTGCT TAGACGACGATTAGGCTATGCACAGGGTTCCCAGAT

107 PRIMER Sequência especifica - sequencia do DNA alvo; Regiões altamente conservadas. ATCTGCTGCTAATCCGATACGTGTCCCAAGGGTCTA TCCCAGAT PRIMERS ATCTGCT TAGACGACGATTAGGCTATGCACAGGGTTCCCAGAT

108 Como ocorre a reação? Com o aumento da temperatura, a fita de DNA se separa. ATCTGCTGCTAATCCGATACGTGTCCCAAGGGTCTA TAGACGACGATTAGGCTATGCACAGGGTTCCCAGAT Aumento da temperatura ATCTGCTGCTAATCCGATACGTGTCCCAAGGGTCTA TAGACGACGATTAGGCTATGCACAGGGTTCCCAGAT

109 Como ocorre a reação? Com a queda da temperatura, os primers se ligam a fita de DNA complementar. ATCTGCTGCTAATCCGATACGTGTCCCAAGGGTCTA TCCCAGAT Temperatura mais Baixa ATCTGCT TAGACGACGATTAGGCTATGCACAGGGTTCCCAGAT

110 Como ocorre a reação? Com o auxílio da Taq polimerase e os dntps a cópia da fita é iniciada ATCTGCTGCTAATCCGATACGTGTCCCAAGGGTCTA TCCCAGAT T Polimerase de DNA C G C A G A A C C T dntps A Iniciador Polimerase de DNA ATCTGCT TAGACGACGATTAGGCTATGCACAGGGTTCCCAGAT Molécula de DNA en cuestión G

111 Amplificação De uma molécula de DNA obtém-se 02 moléculas idênticas!! ATCTGCTGCTAATCCGATACGTGTCCCAAGGGTCTA TAGACGACGATTAGGCTATGCACAGGGTTCCCAGAT ATCTGCTGCTAATCCGATACGTGTCCCAAGGGTCTA TAGACGACGATTAGGCTATGCACAGGGTTCCCAGAT 2 cópias exatas da molécula de DNA em questão

112 BAX SYSTEM Qualitativo /Quantitativo - Primers já testados e validados; - Aprovações e validações. PESQUISAS CONSTANTES GARANTINDO DIFERENÇAS FACILITA A ROTINA TECNOLÓGICAS! E DIMINUI INTERFERÊNCIAS!

113 TRANSCRIPTASE REVERSA - rrna

114 RiboPrinter System Perfil genético Ribogrupo da bactéria ou bolores e leveduras; Técnica Southern Blot resultados em 8hrs; Biblioteca Nacional Lanagro / MAPA; Biblioteca atualizável Mundial!

115 Como o RiboPrinter System Funciona

116 COMO FUNCIONA: O DNA purificado sofre cortes por ação enzimática ( EcoRI ou PstI ou PvulI), neste processo de preparação do DNA. LISE rompe a célula DESPROTEINIZAÇÃO limpa debris DIGESTÃO enzima de restrição (e.g., EcoRI) corta DNA em fragmentos específicos.

117 O QUE ACONTECE:

118 Os fragmentos de DNA resultantes da ação enzimática são separados (por peso molecular) pelo processo de eletroforese em gel de agarose e transferidos para a membrana (Southern Blot), onde sofrem hibridização com a sonda de hibridização fluorescente, a qual seleciona os fragmentos originários da ação das enzimas de restrição. COMO FUNCIONA:

119 COMO FUNCIONA: Os fragmentos ficam fixados na membrana e então a câmara CCD registra a imagem da membrana. É feita análise e interpretação dos dados.

120 Imagem Digitalizada

121 RiboPrint Patterns Demonstra Claramente a Diferenciação

122 Identificação & Caracterização

123

124 Resultados: Após 8 horas têm-se a impressão digital da bactéria, sendo possível identificar a real fonte de contaminação, melhorar ação de antibióticos mais específicos, fazer um estudo completo e confiável da taxonomia bacteriana e muito mais.

125 INDÚSTRIA ALIMENTOS NECESSITA MÉTODOS MICROBIOLÓGICOS QUE SEJAM: Precisos Rápidos Fáceis de utilizar Flexíveis Confiáveis Econômicos Acompanhamento e suporte técnicos contínuos

126 VANTAGENS DOS MÉTODOS RÁPIDOS: Especificidade e confiabilidade; Aprovações e aceitações internacionais; Acompanhamento oficial de desempenho; Rapidez e agilidade na liberação de resultados!

127 VANTAGENS DOS MÉTODOS RÁPIDOS: Facilitam a aplicação das boas práticas de laboratório; Diminuição do número de etapas de trabalho; Diminuição do erro analítico; Melhoria da qualidade dos processos;

128

129 Não ter nenhum resultado é melhor do que ter um resultado errado Nascimento (2005)

130 OBRIGADA!

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Comparação de métodos rápidos

Comparação de métodos rápidos Comparação de métodos rápidos 03/05/2016 Sandra Heidtmann 3M 2015. All Rights Reserved A preocupação INOCUIDADE QUALIDADE SAÚDE PUBLICA COMÉRCIO NACIONAL E INTERNACIONAL 3M 2015. All Rights Reserved 2

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Elaborado por: Karina Salvador Revisado por: Hilda Helena Wolff Aprovado por: Andréa Cauduro

Elaborado por: Karina Salvador Revisado por: Hilda Helena Wolff Aprovado por: Andréa Cauduro ANTI- 1 Manual CAMBRIDGE BIOTECH -1 POP: BM 05 Página 1 de 7 1. Sinonímia ANTI, TESTE CONFIRMATÓRIO. 2. Aplicabilidade Aos bioquímicos e técnicos do setor de imunologia. 3. Aplicação clínica Os testes

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Vanderléia Bárbaro Valente Hemobrás 2.012

Vanderléia Bárbaro Valente Hemobrás 2.012 COMO IMPLANTAR NOVOS KITS E METODOLOGIAS: ELEMENTOS A SEREM CONSIDERADOS NAS TOMADAS DE DECISÕES, AÇÕES E CUIDADOS TÉCNICOS PARA VIABILIZAR A IMPLANTAÇÃO Vanderléia Bárbaro Valente Hemobrás 2.012 Qualidade

Leia mais

CARTÕES DE COLETA DE AMOSTRAS

CARTÕES DE COLETA DE AMOSTRAS CARDS CARTÕES DE COLETA DE AMOSTRAS Os cartões para extração Biopur proporcionam uma coleta simples, confiável e eficiente, garantindo a preservação de ácidos nucleicos a longo prazo. São ideais para o

Leia mais

Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia.

Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia. POP-I 67 Página 1 de 5 1. Sinonímia Teste rápido Anti-½ - OraQuick ADVANCE 2. Aplicabilidade Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia. 3. Aplicação clínica O ensaio

Leia mais

A Microbiologia em Sorvete - Aspectos básicos - Luana Tashima

A Microbiologia em Sorvete - Aspectos básicos - Luana Tashima A Microbiologia em Sorvete - Aspectos básicos - Luana Tashima Fispal - Sorvetes Junho/2014 2014 Centro de Tecnologia SENAI-RJ Alimentos e Bebidas Educação Profissional Curso Técnico de Alimentos Curso

Leia mais

Anti HBc Ref. 414. Controle Negativo

Anti HBc Ref. 414. Controle Negativo Anti HBc Ref. 414 Sistema para a determinação qualitativa de anticorpos totais contra o antígeno core do vírus da hepatite B (anti-hbc) em soro ou plasma. ELISA - Competição PREPARO DA SOLUÇÃO DE LAVAGEM

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

UM NOVO TESTE PARA TUBERCULOSE

UM NOVO TESTE PARA TUBERCULOSE UM NOVO TESTE PARA TUBERCULOSE Rio de Janeiro e Manaus testam para o Ministério da Saúde uma nova tecnologia para o diagnóstico da tuberculose pulmonar Que novo teste é este? O Xpert MTB/RIF é um método

Leia mais

Um Estudo Comparativo de Sistemas Comerciais de Monitoramento da Limpeza com ATP

Um Estudo Comparativo de Sistemas Comerciais de Monitoramento da Limpeza com ATP Um Estudo Comparativo de Sistemas Comerciais de Monitoramento da Limpeza com ATP Baseado em dados gerados pelo Sillliker Group Inc Resumo O desempenho de 5 sistemas de monitoramento da higiene com ATP

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Etapa complementar para o diagnóstico da infecção pelo HIV princípios metodológicos

Etapa complementar para o diagnóstico da infecção pelo HIV princípios metodológicos Aula 11 Etapa complementar para o diagnóstico da infecção pelo HIV princípios metodológicos As amostras com resultados reagentes, na etapa de triagem, devem ser submetidas à etapa complementar. Nessa etapa,

Leia mais

Conflict of Interest Statement. Fisico. Participou como consultor em projetos voltados a imunoensaios.

Conflict of Interest Statement. Fisico. Participou como consultor em projetos voltados a imunoensaios. Conflict of Interest Statement Fisico. Participou como consultor em projetos voltados a imunoensaios. PRINCIPAIS METODOLOGIAS APLICÁVEIS EM TESTES RÁPIDOS Dr. Stefano Spagna Congresso, Setembro 2007 Mercado

Leia mais

ENSAIO PROFICIÊNCIA: UMA FERRAMENTA PARA CONTROLE DA QUALIDADE ALINE MAGALHÃES DE MATOS

ENSAIO PROFICIÊNCIA: UMA FERRAMENTA PARA CONTROLE DA QUALIDADE ALINE MAGALHÃES DE MATOS ENSAIO PROFICIÊNCIA: UMA FERRAMENTA PARA CONTROLE DA QUALIDADE ALINE MAGALHÃES DE MATOS AEQ-FUNED 1. INTRODUÇÃO Ensaio de proficiência avalia o desempenho de um laboratório, comparando-o com os de mesma

Leia mais

IMUNO ENSAIOS USANDO CONJUGADOS

IMUNO ENSAIOS USANDO CONJUGADOS IMUNO ENSAIOS USANDO CONJUGADOS REAÇÕES USANDO REAGENTES MARCADOS Conjugado: molécula constituída por duas substâncias ligadas covalentemente e que mantêm as propriedades funcionais de ambas Ex: globulina

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Métodos sorológicos de Diagnóstico e Pesquisa. Reação Ag-Ac in vitro

Métodos sorológicos de Diagnóstico e Pesquisa. Reação Ag-Ac in vitro Métodos sorológicos de Diagnóstico e Pesquisa Reação Ag-Ac in vitro Testes sorológicos Uso de soro ou outros fluidos biológicos de paciente p/ diagnóstico laboratorial Demonstração de anticorpos específicos

Leia mais

Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia e hematologia.

Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia e hematologia. POP n.º: I70 Página 1 de 5 1. Sinonímia Teste rápido Anti-, VIKIA Biomeriéux. 2. Aplicabilidade Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia e hematologia. 3. Aplicação

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

TR DPP HIV-1/2 Bio-Manguinhos / TR DPP Sífilis

TR DPP HIV-1/2 Bio-Manguinhos / TR DPP Sífilis Pedro Paulo Ferreira Ribeiro Diagnóstico HIV ELISA Teste Rápido Diagnóstico Sífilis ELISA VDRL Testes antigênicos não treponêmicos ou testes lipoídicos: - VDRL (Venereal Disease Research Laboratory) -

Leia mais

Diagnóstico Microbiológico

Diagnóstico Microbiológico Diagnóstico Microbiológico Identificação e Tipagem Bacteriana Prof. Vânia Lúcia Diagnóstico clínico Sinais (mensuráveis) e sintomas (subjetivos) Origem Etiologia Natureza Diagnóstico laboratorial Identificação

Leia mais

Limpeza é fundamental!

Limpeza é fundamental! Limpeza é fundamental! Limpeza é absolutamente fundamental quando o assunto é a produção de alimentos de forma higiênica. A prioridade é evitar a proliferação de germes e eliminar corpos estranhos. Além

Leia mais

VERIFICAÇÃO DE METODOLOGIA PARA ANÁLISE DE ENDOTOXINA EM ÁGUA

VERIFICAÇÃO DE METODOLOGIA PARA ANÁLISE DE ENDOTOXINA EM ÁGUA VERIFICAÇÃO DE METODOLOGIA PARA ANÁLISE DE ENDOTOXINA EM ÁGUA Leandro Raimundo da Silva 1, Karyne Mourthe Miranda 2, Sibele Aryadne da Silva 3, Carla Martins Pittella 4 1 SENAI, Campus CETEC, Belo Horizonte,

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

MONITORAMENTO DA QUALIDADE: CONTROLE DE QUALIDADE INTERNO E EXTERNO

MONITORAMENTO DA QUALIDADE: CONTROLE DE QUALIDADE INTERNO E EXTERNO MONITORAMENTO DA QUALIDADE: CONTROLE DE QUALIDADE INTERNO E EXTERNO Dra. Patrícia Regina Araújo Laboratório de Sorologia Associação beneficente de Coleta de Sangue-COLSAN Controle da Qualidade Toda ação

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Instalação Fixa. Sistema UV DURON

Instalação Fixa. Sistema UV DURON Instalação Fixa Sistema UV DURON Mais ecológico, mais eficiente... Simplesmente melhor Novas luzes sobre nossas ideias originais A WEDECO é conhecida há quase 40 anos por fornecer soluções eficientes de

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS 1. Sinonímia VIDAS DUO 2. Aplicabilidade Aos bioquímicos do setor de imunologia. 3. Aplicação clínica POP n.º: I 56 Página 1 de 7 O vírus da imunodeficiência humana () é um retrovírus RNA, transmitido

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

!"!"!! #$ % $ % & ' ()# * * '* + "!! (, -./. (!!0"!"!!!% (0 "!0"!!12

!!!! #$ % $ % & ' ()# * * '* + !! (, -./. (!!0!!!!% (0 !0!!12 !"!"!! #$ % $ % & ' ()# * * '* + "!! (, -./. (!!0"!"!!!% (0 "!0"!!12 !"+RDC Nº 274, de 22/09/2005, estabelece o regulamento técnico para águas envasadas e gelo #$%!RDC Nº 275, de 22/09/2005, estabelece

Leia mais

Unidade IX Microbiologia de água destinada ao consumo humano

Unidade IX Microbiologia de água destinada ao consumo humano Unidade IX Microbiologia de água destinada ao consumo humano Dorit Schuller 1. Recolha de amostras para análise microbiológica 3 2. Contagem total de microrganismos 4 3. Pesquisa e quantificação de Escherichia

Leia mais

ENSAIO DE ENDOTOXINAS BACTERIANAS

ENSAIO DE ENDOTOXINAS BACTERIANAS ENSAIO DE ENDOTOXINAS BACTERIANAS O ensaio de endotoxinas bacterianas (EEB) é um ensaio para detectar ou quantificar endotoxinas de bactérias gram negativas usando um lisado de amebócitos de caranguejo

Leia mais

MEIOS DE CULTURA DESENVOLVIMENTO OU PRODUÇÃO DE MEIOS DE CULTURA. Necessidade Bactérias Leveduras

MEIOS DE CULTURA DESENVOLVIMENTO OU PRODUÇÃO DE MEIOS DE CULTURA. Necessidade Bactérias Leveduras MEIOS DE CULTURA Associação equilibrada de agentes químicos (nutrientes, ph, etc.) e físicos (temperatura, viscosidade, atmosfera, etc) que permitem o cultivo de microorganismos fora de seu habitat natural.

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

ANÁLISE MICROBIOLÓGICA DA ÁGUA DO POÇO ARTESIANO DO DISTRITO DE SÃO JOSÉ, PR

ANÁLISE MICROBIOLÓGICA DA ÁGUA DO POÇO ARTESIANO DO DISTRITO DE SÃO JOSÉ, PR 5 a 8 de Outubro de 11 ISBN 97885884551 ANÁLISE MICROBIOLÓGICA DA ÁGUA DO POÇO ARTESIANO DO DISTRITO DE SÃO JOSÉ, PR Jackeline Mondini 1 ; Jéssica Cristina Da Silva 1 ; Leia Carolina Lúcio RESUMO: A água

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

VIROLOGIA RETROVÍRUS 1. HIV

VIROLOGIA RETROVÍRUS 1. HIV Instituto Federal de Santa Catarina Curso Técnico em Biotecnologia Unidade Curricular: Microbiologia VIROLOGIA RETROVÍRUS 1. Prof. Leandro Parussolo O que é um retrovírus? É qualquer vírus que possui o

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS POP n.º: I 29 Página 1 de 5 1. Sinonímia Pesquisa de anticorpos frios. 2. Aplicabilidade Bioquímicos e auxiliares de laboratório do setor de Imunologia. 3. Aplicação clínica As Crioaglutininas são anticorpos

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Simpósio Latino Americano da Associação Internacional para a Proteção de Alimentos -IAFP -

Simpósio Latino Americano da Associação Internacional para a Proteção de Alimentos -IAFP - Simpósio Latino Americano da Associação Internacional para a Proteção de Alimentos -IAFP - VII Simpósio Associação Brasileira de Proteção dos Alimentos ABRAPA - Melhorando a inocuidade da carne de aves

Leia mais

O NÚMERO DE BACTÉRIAS

O NÚMERO DE BACTÉRIAS O NÚMERO DE BACTÉRIAS A CONTAGEM EM PLACAS A contagem em placas é um dos métodos mais utilizados para determinar qual o número de microrganismos viáveis em um meio líquido. Quando a concentração é baixa,

Leia mais

MANUAL DE COLETA DE AMOSTRAS

MANUAL DE COLETA DE AMOSTRAS MANUAL DE COLETA DE AMOSTRAS Rua: Victor Sopelsa, nº 3000 Bairro Salete E-mail: sac-lableite@uncnet.br Fone: (49) 3441-1086 Fax: (49) 3441-1084 Cep: 89.700-000 Concórdia Santa Catarina Responsável /Gerente

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

Um laboratório pertencente às redes REBLAS (Anvisa) e RBLE (Inmetro)

Um laboratório pertencente às redes REBLAS (Anvisa) e RBLE (Inmetro) Matéria de Capa nanocore Um laboratório pertencente às redes REBLAS (Anvisa) e RBLE (Inmetro) Qualidade assegurada em bioensaios E m 2013 o Inmetro reafirmou a competência da Nanocore ao reconhecer e ampliar

Leia mais

Biologia Celular e Molecular

Biologia Celular e Molecular DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA Biologia Celular e Molecular Detecção de proteínas por western-blotting 2007-2008 Na electroforese em gel de poliacrilamida

Leia mais

CONCEITOS E APLICAÇÃO DA NORMA ISO 22000

CONCEITOS E APLICAÇÃO DA NORMA ISO 22000 CONCEITOS E APLICAÇÃO DA NORMA ISO 22000 ISO SEGURANÇA DOS ALIMENTOS A norma especifica requisitos para o sistema de gestão da segurança dos alimentos, onde uma organização na cadeia produtiva precisa

Leia mais

PAPILOMA VÍRUS HUMANO

PAPILOMA VÍRUS HUMANO PAPILOMA VÍRUS HUMANO PAPILOMA VÍRUS HUMANO *INNO-LiPA HPV Genotipagem Extra 28 genótipos HPV Controles Praticidade Aplicações Automação ESCOLHA DE QUALIDADE PARA O SEU LABORATÓRIO. Genótipos: 28 genótipos

Leia mais

SELEÇÃO DE ESTÁGIO 2013/02

SELEÇÃO DE ESTÁGIO 2013/02 SELEÇÃO DE ESTÁGIO 2013/02 Estão abertas as inscrições para o processo seletivo de estágio no Laboratório Teuto. Os interessados deverão enviar currículos até dia 04/06/13, para o e-mail seleção@teuto.com.br,

Leia mais

BIOSSEGURANÇA DA TEORIA À PRÁTICA NO ENSINO DE BIOTECNOLOGIA. Dra. Maria Antonia Malajovich Instituto de Tecnologia ORT do Rio de Janeiro

BIOSSEGURANÇA DA TEORIA À PRÁTICA NO ENSINO DE BIOTECNOLOGIA. Dra. Maria Antonia Malajovich Instituto de Tecnologia ORT do Rio de Janeiro ANBIO - VI Congresso Brasileiro de Biossegurança (2009) BIOSSEGURANÇA DA TEORIA À PRÁTICA NO ENSINO DE BIOTECNOLOGIA Dra. Maria Antonia Malajovich Instituto de Tecnologia ORT do Rio de Janeiro MariaAntonia@ort.org.br

Leia mais

L IE CATÁLOGO DE PRODUTOS

L IE CATÁLOGO DE PRODUTOS L IE CATÁLOGO DE PRODUTOS L IE Linha de produtos fabricados em material de alta transparência, em sala limpa escala 100,000, de acordo com as normas ISO 9001 e ISO 13485:2003/AC:2007, certificados como

Leia mais

Plásticos para Cultivo Celular

Plásticos para Cultivo Celular Linha Cultivo de Células e Tecidos Fabricada em poliestireno cristal virgem (GPPS), oferece produtos com alta transparência para ótima visualização e sem presença de contaminantes, assegurando integridade

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

Apoiada nestes 3 pilares buscamos oferecer uma completa linha de produtos e serviços (de???), oferecendo aos nosso clientes o mais elevado nível de

Apoiada nestes 3 pilares buscamos oferecer uma completa linha de produtos e serviços (de???), oferecendo aos nosso clientes o mais elevado nível de Apoiada nestes 3 pilares buscamos oferecer uma completa linha de produtos e serviços (de???), oferecendo aos nosso clientes o mais elevado nível de satisfação, de forma sustentável. Solução analítica para

Leia mais

BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE

BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE Cláudio Martin Jonsson Vera Lúcia Castro Jaguariúna, outubro 2005. O modelo de agricultura utilizado atualmente visa

Leia mais

RELATÓRIO TÉCNICO FINAL

RELATÓRIO TÉCNICO FINAL RELATÓRIO TÉCNICO FINAL Título do Projeto: Rastreamento e detecção de Salmonella enteritidis através do gene inva, pela técnica de PCR em tempo real, na Avicultura de corte e postura de ovos nas granjas

Leia mais

Sandra Heidtmann 2010

Sandra Heidtmann 2010 Sandra Heidtmann 2010 Definições: Amostra: Pequena parte ou porção de alguma coisa que se dá para ver, provar ou analisar, a fim de que a qualidade do todo possa ser avaliada ou julgada; Coleta: Ato de

Leia mais

Padronização de imunoblot para diagnóstico sorológico da esquistossomose utilizando antígeno de vermes adultos

Padronização de imunoblot para diagnóstico sorológico da esquistossomose utilizando antígeno de vermes adultos Padronização de imunoblot para diagnóstico sorológico da esquistossomose utilizando antígeno de vermes adultos Guedes, PP 1 ; Pinto, PLS 1 e Oliveira, KC 1. 1 Núcleo de Enteroparasitas, Centro de Parasitologia

Leia mais

OraQuick ADVANCE HIV-1/2 Teste Rápido para a Detecção de Anticorpos HIV-1/2. Plasma. Amostras HIV-1. Amostras HIV-1. Amostras

OraQuick ADVANCE HIV-1/2 Teste Rápido para a Detecção de Anticorpos HIV-1/2. Plasma. Amostras HIV-1. Amostras HIV-1. Amostras Dispositivo Médico para Diagnóstico In vitro Nome Mandatário Fabricante Distribuidor Tipo de Teste Teste rápido. OraQuick ADVANCE /2 Teste Rápido para a Detecção de Anticorpos /2 Aplicação Diagnóstica

Leia mais

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes)

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes) PT Instruções de utilização CYCLER CHECK Kit de teste para a validação da uniformidade da temperatura em termocicladores pronto a usar, pré-aliquotado REF 7104 (10 testes) REF 71044 (4 testes) Índice 1.

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

INDICADOR BIOLÓGICO. Para o código 1262 adotaremos, neste documento, a nomenclatura de Convencional

INDICADOR BIOLÓGICO. Para o código 1262 adotaremos, neste documento, a nomenclatura de Convencional INDICADOR BIOLÓGICO Para o código 1262 adotaremos, neste documento, a nomenclatura de Convencional Para os códigos 1292 e 1291 adotaremos, neste documento, a nomenclatura RRBI (Indicador Biológico de Leitura

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

MICROSCÓPIO ESPECULAR VOROCELL. Duvidas freqüentes a respeito do microscópio Vorocell, mitos e verdades.

MICROSCÓPIO ESPECULAR VOROCELL. Duvidas freqüentes a respeito do microscópio Vorocell, mitos e verdades. MICROSCÓPIO ESPECULAR VOROCELL Duvidas freqüentes a respeito do microscópio Vorocell, mitos e verdades. Porque o Microscópio Especular da Eyetec chama-se Vorocell? Vorocell é uma homenagem ao pesquisador

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Anexo I - TERMO DE REFERÊNCIA

Anexo I - TERMO DE REFERÊNCIA Anexo I - TERMO DE REFERÊNCIA 1 - CARACTERÍSTICAS DO PROCESSO DE COMPRA 1.1 Órgão Requisitante: SUBVISA/LCP Nº 03/2013. Subsecretária de Vigilância, Fiscalização Sanitária e Controle de Zoonoses Laboratório

Leia mais

Análise de risco em alimentos, com foco na área de resistência microbiana

Análise de risco em alimentos, com foco na área de resistência microbiana IV CONGRESSO BRASILEIRO DE QUALIDADE DO LEITE Análise de risco em alimentos, com foco na área de resistência microbiana Perigo (hazard): agente biológico, químico ou físico, ou propriedade do alimento

Leia mais

Exercício 2 DNA e Eletroforese

Exercício 2 DNA e Eletroforese Exercício 2 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir

Leia mais

TOTVS Gestão Hospitalar Manual Ilustrado Central de Material Esterilizado. 11.8x. março de 2015 Versão: 3.0

TOTVS Gestão Hospitalar Manual Ilustrado Central de Material Esterilizado. 11.8x. março de 2015 Versão: 3.0 TOTVS Gestão Hospitalar Manual Ilustrado Central de Material Esterilizado 11.8x março de 2015 Versão: 3.0 1 Sumário 1 Objetivos... 4 2 Introdução... 4 3 Cadastros... 5 3.1 Cadastros de Unidades de CME...

Leia mais

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS ! Universidade Federal de Pernambuco Centro de Ciências da Saúde Departamento de Patologia Laboratório de Imunopatologia Keizo Asami Prof. Dr. Lucas Brandão BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais