Deusilene Souza Vieira

Tamanho: px
Começar a partir da página:

Download "Deusilene Souza Vieira"

Transcrição

1 Deusilene Souza Vieira Padronização de uma técnica molecular para quantificação do vírus da hepatite C em amostras de pacientes atendidos no Ambulatório de Hepatites Virais do Centro de Pesquisa em Medicina Tropical de Rondônia CEPEM Doutorado em Biologia Experimental Porto Velho

2 UNIR - UNIVERSIDADE FEDERAL DE RONDÔNIA IPEPATRO INSTITUTO DE PESQUISAS EM PATOLOGIAS TROPICAIS CEPEM CENTRO DE PESQUISA EM MEDICINA TROPICAL DE RONDÔNIA Padronização de uma técnica molecular para quantificação do vírus da hepatite C em amostras de pacientes atendidos no Ambulatório de Hepatites Virais do Centro de Pesquisa em Medicina Tropical de Rondônia CEPEM Deusilene Souza Vieira Tese apresentada ao Programa de Pósgraduação em Biologia Experimental como requisito para obtenção do título de Doutor em Ciências. Área do Conhecimento: Hepatites Virais Orientador: Dr. Juan Miguel Villalobos Salcedo Co-orientadora: Dra. Glaucia Paranhos Baccalà Co-orientador: Dr. Eduardo Resende Honda Porto Velho

3 O nosso valor está intimamente ligado ao que de bom e de bem proporcionamos a humanidade. Marco

4 Dedico a todos que passaram pela minha vida e contribuíram de forma direta e indireta para meu desenvolvimento pessoal e profissional, especialmente minha mãe Simíria Marques Vieira.

5 Ao meu esposo Marco Dall Acqua, amigo e companheiro. Agradeço pelo amor, carinho, estímulo e incansável ajuda e apoio que dedica a mim. A minhas irmãs, Leny e Dulce e ao meu cunhado Carlos Augusto pelo incentivo e força. A Ondina Terezinha Mateus que sempre está comigo, principalmente nos meus momentos mais difíceis, e com sua sabedoria de vida mostrou-me que o amanhã sempre será melhor, só depende de nós. A Andrea, Adriane, Robson, Samara, Ana Camila, Giovana, Glenda e Rômulo pela alegria que compartilharmos e por me disponibilizarem um ambiente estimulante e agradável em família. Ao meu Amigo e irmão, Eduardo Honda, que me ensinou os primeiros passos para a biotecnologia aplicada, sendo importante para o desenvolvimento da minha experiência científica, além de sempre esta comigo em todos os momentos. Obrigada pela oportunidade, confiança e apoio.

6 AGRADECIMENTOS ESPECIAIS Ao Professor Dr. Luiz Hildebrando Pereira da Silva, pela oportunidade, incentivo e confiança que foram imprescindíveis para meu crescimento profissional. Ao Dr. Juan Miguel Villalobo Salcedo, pela orientação, profissionalismo e carinho, dedicado ao desenvolvimento e conclusão deste trabalho que muito contribuiu para minha formação. A Dra. Glaucia Paranhos Baccalà, minha co-orientadora e colaboradora deste trabalho. Que me recebeu em seu Laboratório em Lyon-França, dando valiosos ensinamentos e suporte necessário para novos conhecimentos. A equipe do Laboratório Plataforma Técnica, Alcione, Quéssia, Carina, Luan, Mayara, Rudson, Leandro e Fábio, pela amizade, incentivo e apoio nas discussões sobre resultados obtidos e perspectivas futuras que muito contribuíram para o desenvolvimento deste trabalho.

7 AGRADECIMENTOS Primeiramente a Deus. A Professora Dra. Vera Engracia, pela seriedade na coordenação do Mestrado e Doutorado em Biologia Experimental da UNIR. Ao Diretor Científico Dr. Rodrigo Guerino Stábeli, pelas oportunidades concedidas. Ao Diretor do CEPEM Dr. Mauro Shugiro Tada, pela credibilidade concedida. A todos os amigos e colegas do CEPEM e IPEPATRO, que contribuíram diretamente ou indiretamente para o desenvolvimento deste trabalho. Aos médicos e toda equipe técnica do Ambulatório de Hepatites Virais do CEPEM que colaboraram com desenvolvimento deste trabalho. A Dr. Edson Rondinelli e toda sua equipe do Laboratório de Metabolismo Macromolecular Firmino Torres de Castro da UFRJ que contribuíram para comparação dos resultados obtidos, solidificando este trabalho. A Dr. Marco Aurélio Krieger e toda sua equipe que contribuíram para os primeiros ensinamentos sobre PCR em tempo real. A Dr. Paulo Eduardo M. Ribolla e toda sua equipe pelo apoio e ensinamento concedido. A todos, que contribuíram de forma direta ou indiretamente para a realização deste trabalho, o meu mais profundo agradecimento.

8 RESUMO O vírus da hepatite C (VHC) atualmente é considerado um problema de saúde pública mundial. Devido às limitações dos testes sorológicos, para confirmar o estado do portador de VHC é feito o diagnóstico molecular para detecção direta do RNA viral considerada uma ferramenta essencial. A metodologia de PCR em tempo real é um teste molecular que permite a detecção do produto à medida que vai sendo formado, permitindo a resolução de uma ampla faixa de carga viral, mostrando ser uma alternativa para a detecção e quantificação do RNA do VHC. Neste trabalho padronizamos um método para identificar, quantificar e genotipar o vírus da hepatite C em amostras de soro de pacientes atendidos no ambulatório de hepatites virais do Centro de Pesquisa em Medicina Tropical de RO CEPEM. Foram analisadas 100 amostras de soro de pacientes com hepatite C crônica, com confirmação clínica e laboratorial. A obtenção do RNA foi feita através do kit QIAamp viral RNA, seguida de transcrição reversa. A PCR em tempo real foi utilizada de forma qualitativa e quantitativa. A quantificação foi feita através da produção de transcrito para geração de uma curva padrão externa. Os resultados referentes à padronização do processo de extração e RT foram observados na PCR em tempo real de acordo com ciclo de amplificação (Ct), utilizando a plataforma ABI 7500 SDS. Para a quantificação do RNA do VHC foram produzidos transcritos quantificados por espectofotometria, caracterizados como transcrito RO (TRO) e transcrito controle positivo (TCont + ), respectivamente. Os cdnas do transcrito diluído seriadamente foram amplificados por PCR em tempo real utilizou uma curva de sete pontos (sete diluições) para o transcrito TRO, uma curva de seis pontos (seis diluições) e uma curva de seis pontos (seis diluições) para o kit comercial. A reprodutibilidade dos testes foi observada através do coeficiente de variação (CV) produzido por cada diluição analisada, enquanto que a especificidade dos testes pela não obtenção de sinal em nenhum dos controles negativos adicionados em cada corrida. Não houve diferença significativa entre as médias do coeficiente de variação (CV) de cada transcrito com p = 0,107. Na comparação dos testes encontrou-se um coeficiente de correlação semelhantes com r 2 = 0,96 para TRO, TCont+ com r 2 = 0,98 e o kit comercial (Acrometrix) r 2 = 0,99, obtidos da curva linear de regressão que foi usada para correlacionar o número de cópias/µl ou UI/ µl x Ct. Sondas foram utilizadas para caracterização dos genótipos, sendo que a melhor eficiência de detecção foi para o genótipo 1. O método utilizado neste estudo para os processos de detecção, quantificação e genotipagem apresentou um custo final de aproximadamente R$ 100,00. Este custo é praticamente cinco vezes menor do que os valores praticados tanto nos laboratórios particulares quanto o valor pago pelo Sistema Único de Saúde (SUS). A metodologia molecular aplicada neste estudo englobou características positivas, permitindo detectar, quantificar e genotipar o VHC. Considerando que a prevalência do VHC na região norte é de 0,62%, sendo o Estado de Rondônia o segundo maior em casos positivos, a implantação desses testes atenderia a demanda de Rondônia e Estados vizinhos reunindo características moleculares essenciais, com custo mais acessível, liberação do resultado em um menor tempo e a orientação terapêutica a ser instituída.

9 ABSTRACT The hepatitis C virus (HCV) is considered a public health problem worldwide. Due to the limitations of serological tests to confirm the carrier state of HCV is made molecular diagnosis for direct detection of viral RNA considered an essential tool. The methodology of real-time PCR is a molecular test that allows detection of the product as it is being formed, permitting the resolution of a wide range of viral load, which is considered an alternative for the detection and quantification of HCV RNA. In this work we standardized a method to identify, quantify and genotype the hepatitis C virus in serum samples of patients of the viral hepatitis clinic of the Center for Research in Tropical Medicine RO - CEPEM. We analyzed 100 serum samples from patients with chronic hepatitis C with clinical and laboratory confirmation. Obtaining RNA was performed using the kit QIAamp viral RNA, followed by reverse transcription. The real-time PCR was used to qualitatively and quantitatively. The quantification was done through the production of transcript to generate an external standard curve. The results concerning the standardization of the process of extraction and RT were observed in real-time PCR according to the amplification cycle (Ct) using the ABI 7500 SDS platform. For the quantification of HCV RNA transcripts produced were quantified by spectrophotometry, characterized as transcribed RO (TRO) and transcribed positive control (TCont +), respectively. The cdnas were serially diluted transcript amplified by real-time PCR used a curve of seven points (seven dilutions) for the transcript TRO, a curve of six points (six levels) and a curve of six points (six dilutions) for the kit commercial. The reproducibility of results was observed through a coefficient of variation (CV), produced by each dilution tested, whereas the specificity of the tests by not getting the signal in any of the negative controls added in each race. There was no significant difference between the average coefficient of variation (CV) of each transcript with p = In comparison tests found a similar correlation coefficient r2 = 0.96 for TRO, TCont + r2 = 0.98 and a commercial kit (AcroMetrix) r2 = 0.99, obtained from the linear regression curve that was used to correlate the number of copies / ml or IU / ml x Ct. Probes were used for characterization of genotypes, and the better efficiency of detection was for genotype 1. The method used in this study for the processes of detection, quantification and genotyping presented a final cost of approximately $ This cost is almost five times lower than those charged in both the private laboratories and the amount paid by the Unified Health System (SUS). The molecular approach applied in this study included positive characteristics, to detect, quantify and genotype HCV. Whereas the prevalence of HCV in the northern region is 0.62%, and the state of Rondonia in the second largest positive cases, the implementation of these tests would meet the demand of Rondonia and the neighboring states together essential molecular characteristics, with more affordable, release of results in a shorter time and favoring the guide treatment to be instituted.

10 LISTA DE FIGURAS Figura 1: Estrutura do vírus da hepatite 4 Figura 2A: Organização do genoma do VHC 4 Figura 2B: Topologia das proteínas do VHC 5 Figura 3: Ciclo do VHC 10 Figura 4: Árvore filogenética da região NS5 do HCV 11 Figura 5: Distribuição dos genótipos do VHC no mundo 13 Figura 6: Distribuição dos genótipos do VHC no Brasil. 14 Figura 7: Resultado do PCR em tempo real 24 Figura 8: Real time sistema TaqMan 25 Figura 9: Vetor ptz57r/t utilizado para produção da curva padrão 45 Figura 10: Alinhamento realizado no BLAST com primer VHC F 52 Figura 11: Alinhamento realizado no BLAST com primer VHC R 53 Figura 12: PCR em tempo real utilizando o sistema SYBR 55 Figura 13a: Amostras de VHC amplificadas por SYBR Green 56 Figura 13b: Dissociação das amostras de VHC amplificadas 57 Figura 14: Gradiente de temperatura dos primers VHC F e VHC R 58 Figura 15: amplicons da RT-PCR 58 Figura 16: Digestão enzimática com Bam HI e Eco RI 59 Figura 17: Digestão enzimática do plasmideo controle 59 Figura 18: plasmídeo ptz Linearizado 60 Figura 19: plasmídeo controle Linearizado 60 Figura 20: Transcrito do RNA de VHC 61 Figura 21: Regressão linear da curva padrão para o transcrito TRO 64 Figura 22: Regressão linear da curva padrão para o controle positivo 64 Figura 23: Regressão linear da curva padrão para o kit de quantificação 65 Figura 24: Amostras amplificadas juntamente com os controles 66 Figura 25: PCR em tempo real utilizando o sistema TaqMan 67 Figura 26a: Amostras de VHC amplificadas caracterizando o genótipo 1 69 Figura 26b: Amostras de VHC amplificadas caracterizando o genótipo 2 70 Figura 26c: Amostras de VHC amplificadas caracterizando o genótipo 3 71

11 LISTA DE TABELAS Tabela 1: Seqüência dos primers e sondas do VHC 40 Tabela 2: Ct de amplificação 40 Tabela 3: Valores dos Cts de amplificação das amostras 56 Tabela 4: Diluição seriada dos transcritos de VHC 62 Tabela 5: Avaliação da reprodutibilidade da curva padrão 63 Tabela 6: Média do Coeficiente de Variação 64 Tabela 7: Quantificação do transcrito TRO, TCont+ e o kit comercial 65 Tabela 8: Valores dos Cts para as concentrações de primers e sonda 68

12 LISTA DE ABREVIATURAS AIDS Síndrome da Imunodeficiência Adquirida ARFP Proteína alternativa de leitura AVE Tampão de eluição AVL Tampão de lise AW1 Tampão de lavagem 1 AW2 Tampão de lavagem 2 C - Proteína do core ou nucleocapsídio c100-3 Antígeno derivado da região NS4 do vírus c Antígeno região capsídeo ou core c33c Antígeno da região não NS3 CD81 Célula de defesa 81 CDC Centro de Controle de Doenças cdna DNA complementar CEPEM Centro de Pesquisa em Medicina Tropical de Rondônia CGLAB Coordenação Geral de Laboratórios de Saúde Pública do Brasil CPMP - Comite europeu para propriedades de produtos medicinais bdna - branched DNA Ct Ciclo de amplificação DEIA - DNA enzima imunoensaio DNA Acido desoxirribonucleico dntps Desoxinucleotídeos E1 Envelope 1 E2 Envelope 2 eif - Fator de iniciação eucarioto ELISA Ensaio imunoenzimático F - Frameshift FRET - Transferência de energia da ressonante da fluorescência HIV Vírus da Imunodeficiência HVR1 - Região hipervariável 1 HVR2 - Região hipervariável 2 IB - Técnica de immunoblot

13 IFN Interferon IFN-α Interferon alfa IL-2 Interleucina 2 INF-PEG - Interferon Peguilato IRES - Sítio interno de entrada do ribossomo ISDR - Região determinante da sensibilidade ao interferon LDL - Lipoproteína de baixa densidade log logaritimo Min Minuto ml Mililitro MS - Ministério da Saúde NANB - Hepatite não-a e não-b NAT Teste de ácido nucléico NCR - Região não-codificadora NIH - Instituto Nacional de Saúde dos Estados Unidos NS - Não-estrutural NS2 Proteína não estrutural 2 NS3 Proteína não estrutural 3 NS4 - Proteína não estrutural 4 NS5 - Proteína não estrutural 5 ORF Cadeia aberta de leitura p21 - Polipeptídeo p7 Proteína 7 QG Tampão de Solubilização RE - Retículo endoplasmático RFLP - Polimorfismo de tamanho de fragmento de restrição RNA Ácido ribonucléico RO - Rondônia RPM Rotação por minuto RpRd - RNA-polimerase RNA-dependente RT-PCR - Transcrição Reversa Reação em Cadeia da Polimerase SINAM - Sistema de Informação Nacional de Agravo de Notificação SR-BI - Receptores escavanger, classe B tipo I (SR-BI)

14 TCLE - Termo de consentimento livre esclarecido Th1 Linfócito T auxiliar 1 Tm - Temperatura de melting TMA Amplificação mediada por transcrição UI Unidade Internacional VHA - Vírus da hepatite A VHB - Vírus da hepatite B VHC - Vírus da hepatite C VHC F Primer vírus da Hepatite C sense VHC R - Primer víirus da Hepatite C anti-sense VLDL Lipoproteínas muito baixa densidade ε - Cálculo da eficiência da amplificação, µl Microlitro

15 1. INTRODUÇÃO

16 1.1 - Aspectos Gerais e Históricos do Vírus da Hepatite C As hepatites causadas pelos vírus hepatotrópicos apresentam grande importância devido sua abrangência mundial. Estes vírus apresentam uma característica em comum, o tropismo pelos hepatócitos, porém com características biológicas diversas (Focaccia, 2007). Em 1970, testes sorológicos utilizados para investigações do vírus da hepatite A (VHA) e B (VHB), revelaram que 25% dos casos de hepatite, associados à transfusão sanguínea, estavam relacionados com o VHB. Os casos remanescentes 75% foram considerados como hepatite não-a e não-b (NANB), sugerindo a existência de um terceiro vírus (Focaccia, 2007). Em 1989, Choo e colaboradores obtiveram um clone de cdna a partir de um paciente com hepatite NANB, denominado vírus da hepatite C (VHC). Foi o primeiro vírus a ser descoberto por técnicas exclusivamente moleculares, constitui um marco na história da virologia. A metodologia de identificação iniciou-se com a extração do RNA viral, seguida de transcrição reversa e clonagem do ácido nucléico e expressão do antígeno viral in vitro, tornando-se fundamento dos ensaios de triagem do VHC. A partir desta descoberta, foram desenvolvidos os primeiros testes capazes de detectar anticorpo contra o VHC (Choo et.al., 1989; Donahue et.al., 1992). Kuo e colaboradores (1989) desenvolveram um teste imunoenzimático para detecção do causador da hepatite NANB, pelo método ELISA (Enzyme-linked immunosorbent assay). O Instituto Nacional de Saúde dos Estados Unidos (NIH) utilizou este teste para diagnosticar casos de icterícia aguda pós-transfusional e identificou cerca de 70 a 90% de positividade para hepatite NANB (Kuo et.al.,1989; Levi et.al., 2002). O cultivo do VHC só tornou-se possível recentemente, e apenas para um genoma único (JFH1), obtido de um paciente com hepatite aguda fulminante no Japão (Kato et.al., 2001). A maior parte do conhecimento sobre o VHC é proveniente de sistemas replicativos in vitro (replicons), capazes de proporcionar a replicação genômica, sub-genômica e expressão protéica (Bartenschlage et.al., 2003). Desde então, o foco das pesquisas das áreas básicas e clínicas tem sido entender melhor a biologia do VHC com diferentes objetivos, como

17 desenvolvimento de testes diagnósticos de grande sensibilidade e especificidade, maior conhecimento dos mecanismos patogenéticos, melhor caracterização da historia natural do VHC e melhorar a eficiência dos tratamentos (Tellinghuisen et.al., 2004). Atualmente o VHC é considerado um problema de saúde pública mundial. Um dos fatores é a sua alta prevalência, estima-se que aproximadamente, 170 milhões de pessoas estejam infectadas, ou seja, 3% da população global. Outro fator esta relacionado com elevado grau de cronificação, podendo evoluir para cirrose hepática e carcinoma hepatocelular (Alter et.al., 2000; McHutchison, 2004). A infecção aguda causada pelo VHC é na maioria dos casos, benigna e assintomática dificultando, assim, o seu diagnóstico. Entretanto, cerca de 80% destes evoluem para a infecção crônica, podendo progredir ao estágio de cirrose, doença hepática terminal e até para carcinoma hepatocelular (Corbet et.al., 2003; Cantaloube et.al., 2005). Existem vários estudos sugerindo os possíveis fatores que parecem influenciar a evolução da hepatite crônica, podendo ser de caráter viral, relacionado ao hospedeiro e ambiental. Dentre dos fatores virais, incluem carga viral, genótipo do VHC e multiplicidade de quasiespécies. Os fatores relacionados ao hospedeiro incluem: idade, quando ocorreu a infecção, duração da infecção, sexo, deficiência imune, susceptibilidade genética, co-infecção com outros vírus, co-morbidade com hemocromatose, sobrecarga de ferro ou obesidade. Fatores ambientais incluem alcoolismo crônico, dieta, cigarro, medicamentos, hepatotoxinas e contaminantes ambientais (Martinot-Peignoux et.al., 2000; e Di Biceglie, 2000). 1.2 Genoma do VHC O VHC pertence à Família Flaviviridae, gênero Hepacivírus apresentando uma única fita de ácido ribonucléico (RNA) com polaridade positiva, medindo 50nm de diâmetro. A partícula viral é composta por um envoltório derivado da membrana celular hospedeira contendo as glicoproteínas virais E1 e E2 inseridas. O nucleocapsídeo é formado pela proteína C (Core) e envolve o RNA viral (Figura 1) (Thomsom et.al., 2005; Murphy et.al., 2007).

18 Cor Glicoproteínas de E1 RNA Viral Figura 1: Estrutura do vírus da hepatite C. Fonte: James, 2001, modificada. O genoma do VHC possui cerca de 9600 nucleotídeos, apresentando duas regiões não-codificadores em suas extremidades 5` NCR e 3` NCR (Simmonds, 2004; Arumugaswami et.al., 2008). A região codificadora contém uma única fase de leitura aberta (ORF open reading frame ) que codifica para uma poliproteína com aproximadamente 3000 aminoácidos (dependendo do genótipo), que sob ação autoproteolítica e proteolítica da célula hospedeira (hepatócito) origina proteínas estruturais (C, E 1, E 2 ) e não-estruturais (p7, NS2, NS3, NS4A, NS4B, NS5A, NS5B) (Figura 2A) (Penin et.al., 2004; Moradpour et.al., 2007; Drexler et.al., 2009). As proteínas estruturais e o polipetídeo p7 são processados pelo retículo endoplasmático (RE) através de peptidases, enquanto que as proteínas não estruturais são processadas por duas proteases virais: protease NS2-3 e a protease serina NS3-4 (Figura 2B) (Moradpour et.al., 2007). modificada. Figura 2A: Organização do genoma do VHC. Fonte: Moradpour et.al., 2007,

19 B Figura 2B: Topologia das proteínas do VHC associada à membrana celular. Fonte: Moradpour et.al., 2007, modificada. Estudos recentes relatam a existência de uma proteína adicional designada ARFP ( alternative reading frame protein ) ou F ( Frameshift ). Esta proteína é produzida a partir de uma fase de leitura alternativa (-2/+1) encontrada na porção terminal da região codificante da proteína do core (ainda não está confirmada a sua expressão na infecção natural pelo vírus C) (Branch et.al., 2005; McMullan et.al., 2007). O genoma do VHC possui duas regiões não codificadoras (NCR): a região 5` NCR é composta por 341 nucleotídeos, sendo cerca de 100 nucleotídeos maior que a dos outros Flavivírus. Esta região é a mais conservada entre os diferentes isolados do VHC, em comparação as outras regiões codificadoras (Simmonds, 2004). A região 5` NCR é composta de 4 domínios, I a IV. Os domínios II, III e IV junto com os primeiros nucleotídeos da região do core constituem o sítio interno de entrada do ribossomo (IRES). A tradução da poliproteína do VHC inicialmente ocorre através da formação de um complexo binário entre o IRES e a subunidade 40S do ribossomo e a iniciação da tradução de uma forma cap (proteína ativadora do catabolismo) independente do RNA viral (Spahn et.al., 2001). O complexo IRES-40S recruta o fator de iniciação eucarioto (eif) 3 e o complexo Met-tRNA-eIF 2 GTP para a associação com subunidades 60S formando o complexo ativo 80S (Otto and Puglisi., 2004). A região 3`NCR é formada por uma seqüência de nucleotídeos variável, seguido por região poli U e uma seqüência de 98 nucleotídeos bem conservada, denominada região X, importante para a replicação e infecciosidade do VHC (Tanaka et.al., 1996; Imbert et.al., 2004). Ambas as regiões são altamente

20 conservadas e essenciais para a tradução protéica e para a replicação do genoma viral (Tanaka et.al., 1996) Proteínas Virais Estruturais As proteínas estruturais do VHC derivam do segmento N-terminal da poliproteína, formando a proteína do core e as proteínas E1 e E2 que se destinam ao envoltório viral (Marapdour et.al., 2007). A proteína do core (C) ou nucleocapsídio é a primeira proteína estrutural codificada pela ORF do VHC. Quando clivada da poliproteína por proteases celulares forma um polipeptídeo denominado, p21. Clivagens secundárias originam proteínas menores (p19 e p16), sendo encontrada nas membranas do retículo endoplasmático (RE) e na sua superfície por possuir resíduos de lipídios. Existem evidências de que a interação da proteína do C com os resíduos de lipídios pode afetar o metabolismo destes, contribuindo para o desenvolvimento da esteatose hepática, descrita principalmente em pacientes infectados com o genótipo 3 (Asselah et.al., 2006). Este proteína tem papel na formação do nucleocapsídeo, na modulação do gene da transcrição, na proliferação celular, morte celular e nos mecanismos de sinalização celular (Penin et al., 2004). As glicoproteínas do envelope E1 (gp35) e E2 (gp70) são liberadas da poliproteína precursora, por peptidases celulares e tem características de glicoproteínas transmembrânicas do tipo I (Deleersnyder et.al., 1997; Op De Beeck et.al., 2004). Existem evidências de que as glicoproteínas são essenciais para entrada da partícula viral na célula hospedeira, pela ligação com o receptor celular CD81, encontrado em membranas de linfócitos e hepatócitos e indução da fusão com a membrana celular (Bartosh et.al., 2003). A glicoproteína E2 pode ser encontrada junto a uma pequena proteína de membrana, conhecida como p7. A clivagem da p7 ainda não esta bem definida, mais existem relatos sugerindo que sua origem pode ser derivada de uma clivagem ineficiente da E2 (Mizushima et.,al., 1994). A função das diferentes formas E2, E2/p7 e p7 ainda não está clara, entretanto, acredita-se que estejam envolvidas na infectividade do vírus (Sakai et.al., 2003).

21 A E2 possui, na sua porção amino, uma região de 34 aminoácidos que apresenta a maior variabilidade dentro do genoma, denominada região hipervariável 1 (HVR1), sendo que estes aminoácidos podem diferir entre si em mais de 80% nos diferentes genótipos do VHC e entre os subtipos do mesmo genótipo (Griffin et.al., 2003; Sakai et.al., 2003). Esta região parece desempenhar um importante papel na determinação do curso evolutivo da doença. Alguns casos que se resolvem na fase aguda apresentam menor variabilidade nesta região, conforme relatados em pesquisas comparando pacientes de fase aguda que curaram, com aqueles que evoluíram para a fase crônica da doença. Acredita-se que esse resultado possa estar relacionado com a maior pressão imunológica, não permitindo o aparecimento de variantes virais capazes de escapar em caso de uma resposta imunológica ineficiente, fato que poderia levar a uma infecção crônica (Farci et.al., 2000). Uma região hipervariável 2 (HVR2) já foi descrita, mas sua importância ainda permanece um enigma (Kato et.al., 1992) Proteínas Virais Não-Estruturais As proteínas não estruturais são traduzidas a partir do códon 810 e compreendem várias proteínas: p7, NS2, NS3, NS4A, NS4B, NS5A e NS5B, com diversas atividades enzimáticas (Penin et.al., 2004). A p7 é uma proteína hidrofóbica pequena composta por 63 aminoácidos, e está envolvida na permeabilidade de membrana funcionando como um canal iônico (Pavilovic et.al., 2003). A proteína não estrutural 2 (NS2) possui como única função conhecida, a mediação de sua própria clivagem em cis da proteína NS3 e parece ser uma metaloprotease, uma vez que é estimulada por zinco e inibida por EDTA (Yamaga et.al., 2002). A proteína não estrutural 3 (NS3) é multifuncional com atividade de serinoprotease na região amino terminal e atividades nucleotidase (NTPase) e helicase, na extremidade carboxila (Hijikata et.al.,1991; Suzich et.al., 1993). Estudos de transcrição e tradução in vitro demonstraram que a extremidade amino apresenta atividade serino-protease e quando associada a NS4A (cofator) promove a clivagem dos sítios NS4A/4B, NS4B/5A e NS5A/5B da poliproteína

22 viral (De Francesco et.al., 2000). A extremidade carboxila apresenta as atividades RNA helicases e NTPase. A função de helicase ainda não é totalmente conhecida, mas parece estar envolvida na iniciação da replicação do RNA viral (Pang et.al., 2002; Frick et.al., 2004). Estudos demonstram a capacidade da NS3 em interagir com componentes celulares (a proteína quinase A e C, a p53 e as histonas H2B e H4) (Tellinghuisen et.al., 2002). Outros estudos referentes à NS3 mencionam sua capacidade de induzir a transformação celular e oncogênese em cultura de células (Wolk et.al., 2000). A proteína não estrutural 4 (NS4) codifica duas proteínas NS4A e NS4B. A NS4 tem função de cofator para NS3 e também participa na hiperfosforilação da NS5A. O papel de NS4B é uma proteína de membrana de 27KDa que tem papel na alteração da membrana e na formação do complexo de replicação do VHC (Gosert et.al.,2003). Estudos recentes demonstraram que a NS4B organiza o denominado complexo de replicação que promove estabilidade das proteínas do VHC (estruturais e não-estruturais) e do RNA durante a replicação viral (Egger et.al.,2002; Einav et.al., 2004). A proteína não estrutural 5 (NS5) codifica duas proteínas a NS5A e NS5B. A NS5A é uma proteína fosforilada em resíduos de serina, que pode ser hiperfosforilada na presença de NS4A, e recentemente foi demonstrado que a fosforilação modula a eficiência da replicação do RNA do VHC (Evans et.al., 2004). Vários estudos evidenciam que a proteína NS5A esteja envolvida diretamente e/ou por interação com proteínas celulares, no processo de replicação viral (Blight et.al.,2000; Bartenshlager R, 2002). Outras funções são atribuídas à proteína NS5A, incluindo a ativação da transcrição, regulação da proliferação celular e a participação nos mecanismos de sinalização celular. Entretanto, seu papel na patogênese da hepatite C permanece desconhecido (Tellinghuisen et.al., 2002; Dimitrova et.al., 2003). Outro papel atribuído a proteína NS5A do VHC está relacionado com a modulação da resposta ao interferon tem sido objetivo de diversos estudos. Em 1995, Enomoto e colaboradores identificaram em pacientes japoneses infectados com o genótipo 1b e não respondedores ao interferon, uma seqüência conservada de 40 aminoácidos na região carboxi-terminal da proteína NS5A. Por outro lado, pacientes que responderam a terapia apresentaram mutações nesta região, que passou a ser

23 designada como região determinante da sensibilidade ao interferon (ISDR) (Enomoto et.al., 1996). A proteína NS5A interage com a PKR tornando-a inativa, o que poderia explicar a resistência do VHC a terapia com interferon (Gale et.al., 1998). A proteína NS5B é uma RNA-polimerase RNA-dependente (RpRd) responsável pela replicação viral. Esta região possui uma seqüência GDD característico de uma RNA replicase, presente em diferentes vírus de RNA (Hijikata et.al.,1993). Estudos mostram que esta enzima pode se tornar o principal alvo para intervenção antiviral (Maradpour et.al., 2007). 1.3 Ciclo Celular Ainda que não determinado ao certo o mecanismo da entrada da partícula viral na célula do hospedeiro, recentes estudos demonstram que é um processo complexo que envolve diferentes passos. Os hepatócitos são o principal alvo, mas outras células como células B, células dendríticas podem ser infectadas (Flint et.al., 2001). Recentemente, manipulações genéticas do virions de RNA tem resultado em altos níveis de replicação em linhagens de células derivadas dos hepatócitos, melhorando a compreensão para o estudo RNA viral e síntese de proteínas virais do HCV (Blight et.al., 2000) Um dos principais receptores descrito é CD81 que provavelmente se liga com a glicoproteína E 2 (Pileri et.al., 1998), uma proteína encontrada na superfície de diferentes tipos de células como hepatócitos, receptores escavanger, classe B tipo I (SR-BI) (Scarselli et.al., 2002) e mais recentemente claudin-i (Evans et.al.,2004). O VHC circula de várias formas nas células infectadas do hospedeiro e pode estar associado também com lipoproteínas de baixa densidade (LDL) e de muito baixa densidade (VLDL). Ambas representam a fração que circula como viríons ligados as imunoglobulinas ou como viríons livres (Andre et.al.,2005). Através destes, os vírus se ligam nas superfícies das células do hospedeiro e a sua entrada pode envolver diferentes tipos de receptores. Uma delas, claudin-i, tem como função em estágios mais avançados da entrada na célula como ligação nos hepatócitos polarizados (Evans et.al.,2007). O vírus entra na célula por endocitose mediada por clatrina e pressume-se que ocorra fusão de peptídeos do

24 envelope viral a membrana do endossoma, mediado por baixo ph (Tscherne et.al., 2006). As proteína do envelope do VHC possuem peptídeos de fusão internos que, em baixo ph, são expostos mediante arranjo e trimerização da proteína (Modis et.al, 2004). Alguns trabalhos sugerem que a entrada de todos os vírus da família Flaviviridae, incluindo o VHC é realizado através de proteínas de fusão classe II. Entretanto, os mecanismos envolvendo a ativação do VHC em ph baixo, os passos da fusão e a identificação dos peptídeos de fusão não estão bem caracterizados (Maradpour et.al.,2007). O VHC codifica uma poliproteína simples após a liberação do RNA viral no interior da célula, este se destinará a três funções: primeiramente tradução nas proteínas estruturais e não-estruturais, replicação sob a ação de uma RNA polimerase-rna dependente (NS-5B) e finalizando com o empacotamento na partícula final do vírus (Rice et.al., 2005). O processo de tradução das proteínas é realizado por enzimas da célula e do próprio vírus, dando origem às proteínas estruturais e não estruturais. Após a síntese e maturação, essas proteínas não estruturais e o RNA formam complexos de replicação associados à membrana que catalisam a transcrição de fitas negativas de RNA intermediárias, a partir das quais moléculas progênies de fitas positivas são geradas. O RNA genômico e proteínas do capsídeo se unem formando o nucleocapsídeo, que é transportado em vesículas citoplásmicas, passando pelo complexo de Golgi, unem-se em associação com as demais partículas e sofrem exocitose e liberação das células, figura 3 (Lindenbach et.al.,2005). Figura 3: Ciclo do VHC. a) Internalização e ligação do vírus; b) Liberação no citoplasma e descapsidação; c) Tradução mediada-ires e processamento da poliproteína; d) Replicação do RNA; e) empacotamento e montagem; f) maturação do virion e liberação. Fonte: Moradpour et.al., 2007.

25 1.4 - Diversidade Genética A análise filogenética da seqüência completa ou parcial do VHC de isolados de várias regiões do mundo, levou a identificação de 6 genótipos, enumerados de 1 a 6, com um grande número de subgrupos dentro destes grupos, chamados subclados ou subtipos identificados por letras minúsculas (1a, 1b, 1c, 2a, 2b, 2c, 3a, 3b, 4a, 5a e 6a) (Robertson et.al., 1998). Os genótipos diferem entre si de 31% a 34% na seqüência de nucleotídeo e aproximadamente 30% em suas seqüências de aminoácidos, enquanto os subtipos diferem de 20% a 23% em suas seqüências de nucleotídeos, sendo que essa diferença varia de acordo com a região do genoma (figura 4) (Simmonds, 1998; Pawlotsky, 2004). Figura 4: Árvore filogenética da seqüência nucleotídica da região NS5 do HCV, Fonte: SIMMONDS et al., A variabilidade genética do VHC existe em diferentes níveis. Há evidências de que o vírus VHC sofre processo adaptativo demonstrado através da evolução da região hipervariável da glicoproteína do envelope E2 para prevenir o reconhecimento dos anticorpos induzidos pela infecção. Outra teoria mostra que a maioria das mudanças nas seqüências entre as espécies não afetam o fenótipo, explicando grande parte da diversidade genética observada em populações

26 geográficas e epidemiologicamente diferentes do VHC (Simmonds, 2004; Simmonds et.al., 2005). Existe uma divergência de 5-8% entre variantes de cepas dos genótipos 1a, 1b e 3a em infecções não correlacionadas. Essa diversidade também pode ser observada dentro de uma infecção no mesmo indivíduo, denominada de quasiespécies e podem diferir em torno de 10% dentro de uma mesma população. Esta variabilidade genética do VHC é atribuída, a baixa fidelidade da enzima RNA polimerase RNA dependente, que não possui atividade corretiva, permitindo a geração de variantes virais (Martell et.al., 1992; Simmonds, 2004). Outros fatores que também podem interferir são a tentativa de escape da vigilância do sistema imunológica do hospedeiro e a alta taxa de replicação (Zeuzem et. al., 1996). Esta diversidade genotípica tem implicações em múltiplos aspectos da doença: na epidemiologia devido às diferenças na distribuição geográfica e prováveis vias de contagio; na patogênese, pois as cepas de diferentes graus de virulência, podendo ocorrer co-infecção por diferentes genótipos; no diagnostico devido à necessidade de seleção de seqüências de nucleotídeos de regiões extremamente conservadas para garantir a sensibilidade e especificidade dos testes sorológicos e moleculares; no tratamento, pois diferentes genótipos apresentam respostas diferentes às drogas utilizadas na terapia; e na profilaxia, pois antepõem dificuldades na produção de vacinas (Charman, 1995) Distribuição Geográfica dos Genótipos do VHC Os seis principais genótipos do VHC, cada compreendendo múltiplos subtipos, foram identificados em diferentes áreas geográficas do mundo. Os genótipos 1, 2 e 3 são responsáveis por 90% das infecções encontradas na America do Norte e Sul, Europa, Rússia, China, Japão, Austrália e Nova Zelândia. O genótipo 4 e predominante no Oriente Médio, Egito e África Central, enquanto o genótipo 5 e quase exclusivo do Sul da África, enquanto que o genótipo 6 é encontrado no Sudeste da Ásia (Figura 5) (Simmonds et. al., 2005).

27 Figura 5: Distribuição dos genótipos do VHC no mundo. Fonte: Zein, 2000, modificado Epidemiologia do VHC no Brasil A dimensão da situação epidemiológica da hepatite C crônica no Brasil ainda é desconhecida. Segundo dados do Ministério da Saúde (M.S.), de 1994 a 2007 foram diagnosticados casos. Dados M.S. baseados em doadores de sangue, a prevalência de anti-vhc nas diversas regiões foi de 0,62% no Norte; 0,55% no Nordeste; 0,43% no Sudeste; 0,28% no Centro Oeste e 0,46% no Sul (Ministério da Saúde, 2006). Campiotto e Colaboradores determinaram a freqüência dos genótipos do VHC nas diferentes regiões do país: o genótipo 1 foi o mais freqüente (64,9%), seguido do genótipo 3 (30,2%). Enquanto que os genótipos 2, 4 e 5 foram encontrados com menor freqüência: 4,6%, 0,2% e 0,1%, respectivamente (Campiotto et.al., 2005). De acordo com a Sociedade Brasileira de Hepatologia, na distribuição dos subtipos do VHC no Brasil, prevalecem os genótipos 1b, 1a e 3a.

28 Figura 6: Distribuição dos genótipos do VHC em diferentes regiões do Brasil. Fonte: Campiotto et.al., 2005, modificado. No Brasil, o genótipo 1b ocorre com maior freqüência na população de doadores de sangue, sendo também encontrados em outros grupos os subtipos 1a, 2a, 2b e 3a (Gonçales et.al., 2000; Gruner et.al., 2000). Recentemente, foram detectados os genótipos 4 e 5 (Levi et.al., 2002; Campiotto et.al., 2005) Epidemiologia do VHC em Rondônia O Estado de Rondônia (RO), localizado na região Norte do País dentro Amazônia Ocidental, apresenta características de uma região de alta endemicidade para hepatites virais. Existem poucos relatos da distribuição dos genótipos do VHC na população da Amazônia brasileira, o genótipo 1 tem uma predominância 66,7%, seguido do genótipo 3 com 25% e genótipo 2 com 8,3% (Paraná et.al., 2007). O estudo de Campiotto e colaboradores (2005) para o VHC em indivíduos da região Norte, abrangendo os Estados do Acre e Amazonas descreveu a presença de 64,3% para o genótipo 1, 7,1% para genótipo 2 e 28,6% para o genótipo 3. Echevarría e colaboradores (2003) descreveram que o padrão de transmissão da infecção do VHC demonstra que a infecção prevalece na população urbana da bacia Amazônica (Bolívia, Brasil, Colômbia, Peru e Venezuela) sendo incomum entre a população de ameríndios, sugerindo que a infecção chegou à região Amazônica através da colonização pela população branca.

29 Existem poucos relatos para prevalência do VHC no Estado de RO, segundo o Sistema de Informação Nacional de Agravo de Notificação (SINAN), o Estado teve um índice de detecção 9,7% no período de 1999 a 2005 (Governo de Rondônia, 2005). Estes dados mostram que entre os estados da região Norte, Rondônia é o segundo em maior número de casos notificados (Ministério da Saúde, 2005). Um estudo realizado no Município de Monte Negro RO com 267 voluntários encontrou uma prevalência de 0,83% para o VHC (Khouri et.al., 2005). Em estudo de prevalência realizado com a população ribeirinha no rio Madeira, a prevalência da hepatite C alcançou 7% (Katsuragawa, 2006). Dados do ano 2007 mostram que o Estado de Rondônia teve uma taxa de detecção de 5,17% (SVS, 2009) Formas de Transmissão do VHC Atualmente, sabe-se que o VHC é transmissível por diversos meios. Contudo, a grande maioria das infecções ocorre por via parenteral, fundamentalmente por exposição a transfusões de sangue e hemoderivados, uso de drogas intravenosas, realizações de tatuagens, exposição percutâneas e nosocomiais (Hwang et.al., 2006; Paraná et.al., 2007). A transmissão sexual do VHC é relatada, porém com menor eficiência do que outras infecções transmitidas por vírus tais como vírus da hepatite B e vírus da imunodeficiência (Ghosn et.al., 2005). O risco estimado para a transmissão sexual é de 0 a 0,6% ao ano para os parceiros que possuem relação monogâmica por longo tempo e de 1% ao ano para aqueles com múltiplos parceiros (Terrault, 2002). A transmissão vertical pode ocorrer tanto de forma intra-uterina como por via perinatal. Alguns autores tem relatado que o risco de infecção é maior no caso de uma criança nascida por parto vaginal que em cesarianas (Norkeweicz et.al., 2007; Jain et.al., 2007). Contudo, nem todos os estudos demonstram esta ligação entre o parto vaginal e a transmissão perinatal do VHC. Níveis virêmicos elevados, acima de um milhão de cópias por mililitro, aumentam o risco de transmissão vertical (Gonçales et.al., 2000). Existem, ainda, outros fatores considerados de risco para a infecção pelo VHC, como utilização de agulhas de acupuntura, tatuagens, colocação de

30 piercing, encarceramento e serviço militar tem sido avaliados em estudos de caso-controle de infecção aguda (Alter et.al., 1999; Alter, 2002). Situações cotidianas e habituais já foram relatadas, como a partilha de lâmina de barbear, descrita na Índia (Thakral et.al., 2006), submissão ao procedimento de endoscopia (CDC, 2008), além da transmissão intrafamiliar do vírus. Outra forma de transmissão corresponde à prática de transplante de órgãos e tecidos. Pelo menos 10% dos pacientes adquirem o vírus não referem à exposição a nenhum fator risco conhecido. Estes casos são denominados esporádicos (Plancoulaine et.al., 2008) Manifestações clínicas O VHC causa hepatite aguda e crônica, sendo que cerca de 85% dos casos evolui para infecção se torna crônica, podendo apresentar cirrose hepática, após 20 a 30 anos em quase 10-20% dos casos. A infecção pelo VHC causa, ainda por mecanismos indeterminados, carcinoma hepatocelular em 4% dos pacientes com cirrose, anualmente (Ikeda et al., 1993). A infecção aguda pelo VHC se apresenta de forma assintomática na maioria dos casos, porém pode manifestar através dos seguintes sintomas: malestar, cefaléia, febre baixa, anorexia, astenia, fadiga, artralgia, náuseas, vômitos, desconforto no hipocôndrio direito e aversão a alguns alimentos e cigarro. A icterícia é encontrada entre 18 a 26% dos casos de hepatite aguda e iniciam-se quando a febre desaparece, podendo ser precedida por colúria e hipocolia fecal. Pode também haver hepatomegalia ou hepatoesplenomegalia. Na forma aguda, os sintomas vão desaparecendo paulatinamente. O período de incubação varia de 15 a 150 dias e o período de transmissibilidade inicia-se uma semana antes dos sintomas e mantém-se enquanto o paciente apresentar RNA-VHC circulante. As complicações observadas são cronificação da infecção, cirrose hepática e suas conseqüências (ascite, hemorragias digestivas, peritonite bacteriana espontânea, encefalopatia hepática) e carcinoma hepatocelular (Kumar et.al., 2002; Ministério da Saúde, 2006).

31 1.6 - Tratamento Desde a identificação do VHC, grandes avanços têm sido obtidos no desenvolvimento de terapias antivirais (Feld e Hoofnagle, 2005). O Interferon-alfa (IFN-α), um importante mediador da resposta imune antiviral inata, foi escolhido para o tratamento da hepatite crônica pelo VHC. Durante os anos 80 foi utilizado em monoterapia, no entanto, apenas 6-12% dos pacientes tratados por doze meses apresentaram resposta virológica sustentada ao tratamento (Di Bisceglie e Hoofnagle, 2002). A resposta sustentada é definida como VHC-RNA negativo por no mínimo seis meses após a suspensão da terapia (Marcellin et.al., 1997). Em 1988, foram publicados os primeiros resultados que mostravam uma melhora significativa da taxa de resposta sustentada quando se associava ao IFNα um análogo de nucleosídio de grande ação antiviral, a ribavirina. Este esquema terapêutico apresentou 40% de resposta virológica sustentada, atingindo 50% entre os doentes que tinham recidivado sob monoterapia (Davis et.al., 1998). A ribavirina é um análago nuclesídico de guanosina, que interfere na replicação viral. É administrada por via oral e seu uso tem aumentado a taxa de resposta sustentada ao tratamento, principalmente pela redução da porcentagem de recaídas virológicas após a suspensão da terapia (Davis, 1999). Outros estudos relacionados com efeito da Ribavirina evidenciam sua característica imunomoduladora, modificando a resposta antiflamatória para padrão Th1 (elevação de IL-2 e IFN), reduzindo a extensão da lesão dos hepatócitos (Bergamini et.al., 2002); modificação dos nucleotídeos intracelulares e atividade mutagênica (Feld e Hoofnagle, 2005). Recentemente foi desenvolvido o Interferon Peguilato (IFN-PEG), composto por uma molécula de polietilenoglicol associado ao IFN-α. Esta composição resultou em uma molécula ativa com meia vida longa, melhores características farmacocinéticas e melhores taxas de resposta sustentada (Glue et.al., 2000; Zeuzem et.al., 2000; Lindsay et.al., 2001). A terapia imune combinada com IFN-PEG associado a Ribavirina alcançou taxas de resposta de 54%-56%, sendo que a maior desvantagem desta terapia é seu elevado custo (Fried et.al., 2002; Strader, 2002; Hadziyannis et.al., 2004).

32 A resposta a terapia com IFN esta relacionada a características do hospedeiro, tais como idade, sexo, duração da infecção, depósito de ferro e fibrose hepática, bem como a características do vírus, tais como genótipo, quasiespécies, carga viral e mutações em determinadas regiões do genoma viral (Ferenci, 2004). Em geral, pacientes infectados com VHC genótipos 2 e 3 respondem melhor a terapia com IFN do que pacientes infectados com o genótipo 1, mas o fundamento virológico que justifique essa diferença na resposta ao IFN entre os diferentes genótipos permanece desconhecido (Murphy et.al., 2002). No Brasil, o protocolo de tratamento para o VHC, segue a Portaria 34, do Ministério da Saúde, de 28 de Setembro de 2007 publicado em 09/10/2007, preconiza que para os genótipos 2 e 3 o tratamento deve ser realizado com interferon convencional mais ribavirina por 24 semanas e para o genótipo 1 o tratamento deve ser realizado com peg-interferon mais ribavirina por 48 semanas (Ministério da Saúde, 2007) Diagnóstico Laboratorial Durante muito tempo a infecção pelo VHC foi diagnóstica por exclusão baseada na ausência de marcadores de infecção aguda do vírus da hepatite A (VHA) e hepatite B (VHB). A identificação do VHC, por métodos moleculares, permitiu o desenvolvimento de métodos de diagnóstico imunoenzimáticos (Choo et al., 1989). Estes métodos possibilitaram a implementação de rotinas sorológicas em bancos de sangue na década de 90, que produziu uma mudança das características epidemiológicas da infecção pelo VHC, passando de ser uma hepatite pós-transfusional para, para ter uma associação mais precisa com outros mecanismos parenterais como uso de drogas injetáveis e outras formas menos comuns, onde exista exposição de membranas e mucosas ao vírus. Podemos classificar os métodos correntes de diagnóstico do VHC em ensaios sorológicos e de detecção do RNA do VHC.

33 Ensaios Sorológicos O teste imunoenzimático (EIA), sobretudo o ELISA, é utilizado na triagem de anticorpos anti-vhc (Urdea et.al., 1997). No Brasil este teste tornou-se obrigatório a partir de 1993, em candidatos a doação de sangue (Ministério da Saúde, 1993). Os primeiros kits que surgiram no mercado em 1990 foram denominados de 1ª geração, iniciou-se com a clonagem do genoma do VHC e expressão do antígeno recombinante c100-3 (derivado da região NS4 do vírus) em levedura, que detectavam apenas anticorpos para este antígeno (Van Der Poel et.al., 1990). Os ensaios de 2ª geração agregaram o antígeno c22-3 da região C (capsídeo ou core) e o antígeno c33c derivado da região não NS3, neste teste sorológico 13% dos resultados são dados como indeterminados (Zein et al., 1997). Ainda assim, nem todos os pacientes em imunossupressão após transplante ou imunocomprometidos pela infecção pelo HIV podem apresentar infecção pelo VHC sem anticorpos detectáveis (Erensoy, 2001). No entanto, nas populações de alto risco, a eficácia dos testes da 3ª geração é muito boa, detectando anticorpos contra quatro proteínas recombinantes do VHC, diferindo dos ensaios da 2ª geração pela substituição da proteína NS5 no lugar do antígeno (Schiff, 1999), e a substituição de alguns antígenos recombinantes por peptídeos sintéticos, observando uma maior especificidade e sensibilidade, em relação aos demais testes sorológicos. Apesar deste avanço, resultados indeterminados não foram eliminados (Colin et al., 2001). As vantagens do teste de ELISA incluem facilidade de automação e de uso, custo acessível, baixa variabilidade e alta sensibilidade na triagem de doadores de sangue e órgãos. As principais desvantagens são a abundância de falsopositivos em populações de baixo risco e baixa sensibilidade verificada em amostras de pacientes após transplante hepático e outras situações de imunossupressão (Schiff et.al., 1999). A reatividade falsa pode ocorrer devido à ligação não específica das imunoglobulinas do soro ou plasma a contaminantes presentes nas preparações de antígeno do VHC, partes de fusão ou regiões não especificas dos antígenos recombinantes ou aos reagentes de revestimento ou de bloqueio. Resultados falso-negativos também podem ocorrer quando o

34 diagnóstico é realizado no período de janela imunológica ou em casos de imunodeficiência (Gretch, 1997). Alguns testes sorológicos suplementares já foram usados baseados na técnica de immunoblot (IB) e permitiam a confirmação da reatividade dos anticorpos contra as proteínas individuais do VHC, empregando as mesmas proteínas presentes no ELISA. Este ensaio sofreu aprimoramento tecnológico que resultou na produção de kits de 1ª, 2 ª e 3 ª geração (Schiff et.al., 1999). A interpretação deste ensaio depende do tipo e versão e dos critérios do fabricante. Os resultados são reportados como positivos, quando duas ou mais bandas estão presentes, indeterminado, quando há apenas uma banda e negativo, na ausência de bandas. Um teste positivo confirma a reatividade especifica dos anticorpos anti-vhc. Um teste indeterminado ou negativo pode ocorrer no período préconversão, em recém-nascidos de mãe positiva, em pacientes transplantados que apresentam respostas de anticorpos insuficientes, ou ainda numa reação cruzada. Um teste anti-vhc positivo com confirmação pelo IB não é um marcador verdadeiro de infecção ativa, uma vez que pacientes restabelecidos podem permanecer anti-vhc positivos por longos períodos (Erensoy, 2001) Diagnósticos Moleculares Devido às limitações dos testes sorológicos, para confirmar o estado do portador de VHC é feito o diagnóstico molecular para detecção direta do RNA viral considerada uma ferramenta essencial. Suas vantagens incluem a possibilidade do diagnóstico precoce na infecção viral na fase aguda, diagnóstico da infecção em pacientes incapazes de montar uma resposta sorológica e confirmação da infecção ativa em situações específicas. Os testes de detecção do RNA do HCV são classificados em qualitativos e quantitativos (Germer et al., 2001) Detecção Qualitativa do RNA Os testes qualitativos utilizados para detecção do RNA do VHC são: a) RT- PCR (Transcrição Reversa Reação em Cadeia da Polimerase), TMA (Transcription Mediated Amplification) e o NAT (nucleic acid tests), sendo que a

35 RT-PCR é considerada como gold standard no diagnóstico da infecção e na avaliação da resposta antiviral (Schiff et.al.,1999). A técnica de PCR é realizada através do isolamento do RNA da amostra, seguido de transcrição reversa para gerar o cdna que será utilizado na amplificação especifíca da seqüência de ácido nucléico. A utilização desta técnica de RT-PCR para a detecção da presença de RNA do VHC em soro de pacientes suspeitos iniciou-se na década de 90, sendo considerada como diagnóstico útil durante a terapia antiviral, porque o desaparecimento do RNA-VHC durante o tratamento é um forte preditor de resposta sustentada (NIH, 1997). Esta metodologia apresenta boa sensibilidade e especificidade, permitindo a detecção do vírus antes dos ensaios sorológicos tornarem-se a diferenciação dos casos de infecção ativa e diagnóstico em pacientes incapazes de formação de uma resposta imune efetiva (Garson et al.,1990; Zaaijer et al.,1993). O teste de TMA para o RNA do VHC, baseado, também, na amplificação de alvo molecular, tem se mostrado mais sensível que o teste de RT-PCR apresentando grande aplicação como teste de confirmação de resposta sustentada ao tratamento (Zarraci et al., 2000). O NAT foi introduzido nos centros de transfusão sanguínea para diminuir o período de janela, reduzindo a transmissão viral. O European Committee for Proprietary Medicinal Products (CPMP) exige que após 1 de julho de 1999 todos os derivados de plasma, distribuídos na União Européia, sejam testados negativos para VHC pelo NAT (Erensoy, 2001) Detecção Quantitativa do RNA Os testes quantitativos têm capacidade de determinar o número de partículas virais presentes no soro de pacientes infectados (carga viral), que resulta de particular importância no prognóstico e na terapêutica. Duas técnicas são utilizadas na quantificação do RNA do VHC em amostras clínicas. A primeira é baseada na técnica de PCR e detecta baixas quantidades de vírus. A segunda técnica é baseada na tecnologia de bdna (branched DNA). A técnica de bdna detecta diretamente as moléculas de ácido nucléico pela amplificação do sinal luminoso (Urdea et.al.,1997). A concentração do RNA

36 do VHC é calculada a partir de uma curva de padrões externos criada com quatro transcritos de RNA, que são usadas como padrões e incluídos na reação. Os resultados são expressos em RNA do VHC Meq/mL(Erensoy, 2001). Ambos os testes têm limites inferiores de detecção semelhante, ainda que o bdna obtenha uma faixa de resolução mais ampla no que concerne aos limites superiores de detecção, evitando a necessidade, na maioria das vezes, de retestes com diluição de amostras de maior carga viral Quantificação do VHC por PCR em Tempo-Real Apesar da metodologia de RT-PCR competitiva para quantificação de o VHC ser empregada há longa data em muitos laboratórios de diagnóstico apresentando bons resultados, sua baixa sensibilidade analítica e limitada faixa de resolução de 3 log impõe algumas limitações. Isto tem impulsionado a busca de metodologias alternativas que possam suprir estas deficiências. A PCR em tempo real é uma metodologia capaz de permitir a detecção do produto de PCR à medida que vai sendo formado, e não somente ao final da reação de PCR (Zeuzem et al., 1996). Dessa forma, acrescentou-se ao extremamente sensível método de PCR, maior praticidade, menor tempo para obtenção do resultado e diminuição da possibilidade de reação cruzada (Heid et al., 1996; Gibson et al. 1996). O equipamento de PCR em tempo real possui uma fonte de emissão de luz, que pode ser uma lâmpada halógena ou um feixe de laser. A frente da fonte de luz estão colocados os filtros de excitação, que selecionam o comprimento de onda específico para a excitação de cada fluorófo presente na reação. A luz é então direcionada para a placa de amostras através de um conjunto de espelhos dicróicos. Os corantes presentes na amostra são excitados e emitem fluorescência, que direciona os espelhos para o filtro de emissão. Esse filtro seleciona a luz emitida nos comprimentos de onda específicos de cada corante presente na reação. A luz selecionada é direcionada para a câmera CCD, que converte o sinal luminoso em sinal eletrônico, que é utilizado pelo software gerenciador do equipamento para o traçado gráfico da reação (Higuchi et.al.,1992).

37 Na PCR em tempo real, a quantidade de produto formado durante o curso da reação de amplificação é feita por monitoramento da fluorescência dos corantes ou sondas introduzidos na reação, que é proporcional à quantidade de produto formado, enquanto o número de ciclos necessário para obter uma quantidade determinada de moléculas de DNA é registrado. Assumindo uma determinada eficiência na amplificação, que normalmente é próxima a duplicação do número moléculas por ciclo de amplificação, é possível calcular o número de moléculas de DNA da seqüência amplificada presentes inicialmente na amostra. Com a utilização de químicas de detecção altamente eficientes, instrumentos sensíveis e ensaios otimizados, o número de moléculas de DNA alvo na amostra pode ser determinado com acurácia e sensibilidade sem precedentes, suficientes para detecção de uma única molécula (Kubista et.al.,2006). Esse sistema é composto por corantes fluorescentes que se ligam ao produto formado e reportam sua presença a partir da emissão de fluorescência. Durante os ciclos iniciais o sinal fluorescente é fraco e não pode ser distinguido da fluorescência de fundo ( background ). À medida que o produto de PCR se acumula, o sinal fluorescente é percebido, aumentando exponencialmente durante os primeiros ciclos da reação. Em seguida, o nível de sinal é saturado. Essa saturação ocorre em função do consumo de alguns componentes críticos para a reação; ou seja, iniciadores, sistema de detecção ou dntp. Outro componente limitante é o número de moléculas de polimerase, cujo decréscimo faz com que a amplificação exponencial seja convertida em amplificação linear (Kubista et.al.,2006; Watzinger et.al.,2006). No experimento de PCR em tempo real todas as curvas formadas são saturadas no mesmo nível de fluorescência. Portanto, a quantificação em ponto final não é demonstrativa quanto à quantidade inicial de moléculas-alvo presente na amostra e permite apenas resultados qualitativos. Por outro lado, as curvas da PCR em tempo real são monitoradas durante a fase exponencial da reação, que reflete a diferença na quantidade inicial de moléculas de DNA (Watzinger et.al.,2006). Essa diferença é quantificada pela comparação do número de ciclos de amplificação necessários para que a curva de uma determinada amostra atinja um determinado nível de sinal fluorescente ( threshold ). O número de ciclos

38 necessários para atingir o threshold é chamado Ct ( Cycle threshold ), que é o dado utilizado para a quantificação da amostra. É esperado que as curvas de amplificação sejam paralelas durante a fase exponencial da reação, de modo que o ajuste de thresohold não seja crítico para a quantificação (figura 7) (Kubista et.al.,2006). Figura 7: Resultado do PCR em tempo real em gráfico de amplificação contendo a linha que é o nível de detecção ou o ponto a partir do qual a fluorescência atinge um nível maior do que o do background e o Ct de amplificação. Dorak., 2006 (modificado). O PCR em tempo real utiliza exclusivamente fluorescência como método de detecção, dependendo da química utilizada, diferentes tipos de sondas fluorogênicas podem ser descritas. As sondas de hidrólise são comumente conhecidas como sondas TaqMan (Applied Biosystems, Foster, CA, USA) ou sondas 5` nuclease. Essas sondas são duplamente marcadas, contendo um fluoróforo reporter, como FAM ou VIC, convalentemente ligado a extremidade 5`; e um fluoróforo quencher, como TAMRA, convalentemente ligado a extremidade 3`. Quando a molécula reporter é estimulada por uma fonte de luz a emitir fluorescência, essa região é transferida para o quencher, que suprime a emissão de fluorescência pelo repórter. Esse princípio físico é conhecido como transferência de energia da ressonante da fluorescência FRET (Selvin, 1995). Durante a reação, quando a Taq DNA polimerase estende os iniciadores, a sonda hibridizada é clivada devido a atividade 5` exonuclease da enzima e as moléculas reporter e quencher são separadas. Isso extingue o FRET e faz com que a fluorescência do reporter deixe de ser captada pelo quencher e passe a ser detectada pelo sistema ótico do equipamento (figura 8).

39 Figura 8:.Em a: Sonda com presença na extremidade 5` reporter, na extremidade 3 quencher e atividade inicial da Taq polimerase. Em b: Atividade Exonuclease 5' da DNA Polimerase (Mocellin et al.,2003 modificada). As vantagens da utilização de sondas TaqMan são a facilidade para o desenho das sondas e as poucas restrições quanto a seleção das sequênciasalvo. A utilização de sondas no sistema de PCR em tempo real confere maior especificidade, tendo possibilidade de combinar duas ou mais sondas em uma única reação de PCR. Entretanto, é necessário que os produtos de PCR gerados sejam pequenos entre 80 a 130 para obter eficiência máxima no processo de amplificação (Kubista, 2004). O sistema SYBR Green I se liga inespecificamente a fitas duplas de DNA geradas durante a amplificação. Trata-se de uma assimétrica cianina que, livre em solução não emite fluorescência, mas, ligada a moléculas de DNA emite um forte sinal luminoso (Nigren et.al., 1998). A toxicidade do brometo tem levado a uma maior popularidade da SYBR Green (Bengtsson et al., 2003; Zipper et al., 2004). As vantagens do SYBR Green I incluem fácil manuseio e baixo custo. A principal desvantagem esta relacionada à ligação com produtos não-específicos. Isso ocorre porque durante os ciclos consecutivos de PCR, a quantidade de DNA de fita dupla se eleva de maneira exponencial, aumentando assim a quantidade de SYBR Green ligado e sua fluorescência. Entretanto, quando ocorre amplificação inespecífica ou amplificação de dímeros de primers, estes também são detectados, interferindo com a quantificação final dos produtos específicos da reação. Para avaliar a presença de produtos inespecíficos formados durante a

40 reação, utiliza-se a curva de dissociação. A curva de dissociação distingue diferentes seqüências a partir da porcentagem do conteúdo GC, sendo que quanto mais elevado for este valor, maior será a temperatura de melting da seqüência (Zipper et al., 2004). A PCR em tempo real permite seu uso como ferramenta diagnóstica para detecção da infecção e quantificação de seu agente etiológico. O ensaio de quantificação absoluta baseia-se na análise da curva-padrão (Applied Biosystems, 2005). A curva-padrão relaciona-se às concentrações de DNA padrão. É por meio destes dados, ou seja, quantidades conhecidas de DNA, que o software efetua a quantificação de DNA alvo nas amostras em teste (Applied Biosystems, 2005). A curva-padrão também fornece o coeficiente angular da reta (slope), composta pelos pontos da curva. Este dado será importante para o cálculo da eficiência da amplificação (ε), uma alta eficiência está associada a uma inclinação de, aproximadamente, 3,32 para cada diluição de 10 do alvo (Too, 2003; Applied Biosystems, 2005). Slope de -3,3 relaciona-se a uma eficiência de 100% indicando que o número de moléculas amplificadas dobra a cada ciclo da PCR (Kubista et al., 2006). As características da PCR em tempo real possibilitam a eliminação da etapa laboriosa pós-amplificação (preparo do gel para eletroforese), convencionalmente necessária para visualização do produto amplificado. Desta forma, pode-se observar que as vantagens da PCR em tempo real em relação à PCR convencional são inúmeras e incluem rapidez na obtenção dos resultados, reprodutibilidade e capacidade quantitativa (Sundsfjord et al., 2004; Yang and Rothman, 2004). Esta técnica é altamente sensível, já está sendo desenvolvida para o acompanhamento de inúmeras doenças, tais como AIDS, hepatite C, dengue, toxoplasmose e as leishmanioses (Francino et al., 2006; Kompalic-Cristo et al., 2007; Manna et al., 2008). Sendo considerada uma técnica inovadora porque é capaz de promover a quantificação acurada do imput de DNA e o monitoramento, em tempo real, do produto amplificado (Solano-Gallego et al., 2007). O sistema de quantificação possui aplicações variadas, incluindo identificação de alelos em DNA genômico, análise de seqüências virais, bacterianas ou de protozoários a

41 partir de várias fontes, análise de patógenos em alimentos, análise de produtos transgênicos, além da aplicação em diagnóstico (Novais et.al., 2004). Atualmente, existem conjuntos diagnósticos disponíveis para a detecção e quantificação de DNA e RNA em amostras clínicas, especialmente desenvolvidas para o acompanhamento de pacientes com AIDS e hepatite C (Raoult et.al., 2004). Diante do exposto, para alguns autores, a PCR tida como padrão-ouro anteriormente será substituída pela técnica de referência quantitativa PCR em tempo-real (Mary et al., 2004). A sensibilidade deste método de PCR em tempo real permite a resolução de uma ampla faixa de cargas virais sem a necessidade de diluição das amostras, ele vem se mostrando como a alternativa buscada para a detecção e quantificação do RNA do VHC (Kleiber et al., 2000; Komurian-Pradel et al., 2001) Identificação do Genótipos do VHC A região 5` NCR é a região de escolha para detecção qualitativa e quantitativa do RNA do VHC por ser uma região altamente conservada. Por esta razão é a mais utilizada para ensaios de genotipagem do VHC na maioria dos laboratórios clínicos. Entretanto, devido a sua alta conservação a região 5`NCR não é adequada para discriminar o genótipo 6 do genótipo 1 e os subtipos para os genótipos 1, 2, 3, 4 e 6. A única possível exceção é o genótipo 5, o qual não tem relatos de outros subtipos a não ser o 5a (Chinchai et.al., 2003). Dessa forma é fundamental a escolha de uma região que apresente um polimorfismo maior dentro do genoma e que permita diferenciar os diferentes genótipos e seus subtipos de forma mais acurada. As regiões mais estudadas com essa finalidade são as regiões do core, envelope E1 e a região NS5B (Bukh et.al.,1995). O padrão-ouro para genotipagem do VHC é a RT-PCR, seguida do seqüenciamento dos nucleotídeos de regiões como NS5B, Core e E1 e comparação das seqüencias obtidas com seqüencias consenso provenientes de banco de dados como o GenBank ou los Alamos Hepatitis C (Simmonds et.al.,1994). Muitos laboratórios utilizam o seqüenciamento para determinação dos genótipos do VHC principalmente em estudos epidemiológicos moleculares

42 (Simmonds et.al.,1994). Para este tipo de pesquisa esta técnica possui uma sensibilidade média que pode variar dependendo dos primers utilizados e de região do genoma utilizada para analise dos dados (Laperche et.al.,2005). A principal desvantagem relacionada com essa técnica é a exigência de uma mãode-obra qualificada, equipamentos de alto custo, além da necessidade de utilizar diferentes protocolos para uma melhor padronização (Weck, 2005). Existem vários trabalhos que desenvolveram ensaios de RT-PCR usando primers específicos relacionados com a região do core e da NS5B do VHC para diferentes subtipos, diferenciados pelo tamanho dos fragmentos referente associado a cada subtipo e visualizados através da técnica de eletroforese. Alguns trabalhos apresentaram problemas, tanto na diferenciação dos genótipos quanto em amostras que possuem infecções mistas (Ohno et.al.,1997). Este método apresenta vantagens, pois através da RT-PCR convencional, com utilização de controles positivos e negativos é possível genotipar as amostras analisadas diferenciando-as através do peso molecular descrito para cada genótipo. Os ensaios com polimorfismo de tamanho de fragmento de restrição (RFLP) possibilitam utilizar diferentes enzimas de restrição para diferentes genótipos que contem sítios específicos. Os sítios específicos desses produtos da RT-PCR são submetidos a digestão por diferentes enzimas de restrição. A determinação do genótipo se dá pelo perfil dos tamanhos dos fragmentos visualizados após eletroforese. Estes ensaios estão descritos na região 5` NCR, core e a região NS5B (Nakao et.al.,1991; Pohjanpelto et.al.,1996). A PCR-RFLP da região 5`NCR identifica bem os principais genótipos do VHC, entretanto, estudos comparativos desta região com outros métodos baseados na região 5`NCR mostrou discrepância para tipo e subtipos (Anderson et.al.,2003). Por outro lado, o método baseado na região do core não conseguiu distinguir com acurácia outros genótipos alem do 1 e 6 sendo preciso utilizá-lo em conjunto com outro método de genotipagem (Chinchai et.al.,2003). Este método foi um dos primeiros utilizado para genotipagem do VHC baseados nas seqüências e foi utilizado em vários estudos, incluindo um dos maiores estudos epidemiológicos realizados para verificar a distribuição geográfica dos genótipos no mundo (Davidson et.al.,1995).

43 Atualmente, a PCR em tempo real tem sido utilizada como método de genotipagem do VHC, embora ainda existam poucos trabalhos publicados. Pela plataforma TaqMan, Moghaddam (2006), descreveu a determinação dos genótipos 1, 2 e 3a, com resultados que demonstraram uma correlação de 100% quando comparado ao seqüenciamento da região 5`NCR e LiPA (Moghaddam et.al.,2006). Estudos utilizando a plataforma TaqMan podem ser uma alternativa para genotipagem de baixo custo, dependendo da quantidade de sondas utilizadas (Lindh et.al.,2005). A genotipagem do VHC pode ser feita através de análise de melting curve utilizando o fluoróforo SYBR Green I, a diferença entre os genótipos é feita através de diferentes Tm (temperatura de melting ). A principal desvantagem desse método é que os genótipos apresentam Tm muito próximas dificultando assim uma discriminação mais acurada (Fujigaki et.al.,2004). Existem inúmeros métodos comerciais disponíveis para genotipagem do VHC, a maioria deles focados na região 5`NCR que possui alto grau de conservação entre os isolados dos diferentes genótipos (Murphy et.al., 2007). Entretanto, esses métodos possuem uma deficiência em diagnosticar subtipos ou mesmo genótipos. Um dos métodos comerciais mais utilizados em laboratórios clínicos é a hibridização reversa utilizando primers biotinilados para amplificar a região 5` NCR do VHC, através da RT-PCR. O produto marcado com biotina então é hibridizado numa membrana de nitrocelulose que já esta impregnada com sondas específicas para cada genótipo. Adiciona-se a reação a estreptavidina marcada com fosfatase alcalina, que converte o substrato NBT/BCIP em um precipitado colorido. A determinação do genótipo se dá através de um perfil específico para cada um (Stuyver et.al.,1993). Este método é chamado de Versant VHC Genotype Assay (LiPA). Atualmente esta em curso uma nova versão do LiPA que utiliza a região do core e 5`NCR que poderá discriminar melhor tanto os genótipos como os subtipos (Ross et.al.,2000). Uma das vantagens do LiPA é que o produto da RT-PCR para detecção qualitativa e quantitativa do VHC poderá ser utilizado diretamente pelo LiPA, embora isso acrescente um curso extra ao teste. A desvantagem do LiPA é a presença de bandas não específicas dificulta a correta interpretação (Payne et.al.,2001).

44 Existem kits no mercado que fornecem reagentes de seqüenciamento com reações realizadas em um único tubo com fluorescência bidirecional (CLIP seqüenciamento), além do instrumento e softwares para análises. Este software analisa dados em tempo real, alinha e compara as seqüências obtidas com seqüências referências da biblioteca do software para tipo, subtipo e isolados próximos. Este método pode ser utilizado através de amplicons gerados por kits comerciais após uma purificação por coluna. Estudos demonstram bons resultados comparados com outros testes comerciais, como por exemplo, o LiPA. Estes resultados são esperados pelo fato de que os dois testes focam a região 5` NCR (Germer et.al.,2006). O teste de Invader VHC ASR é baseado na utilização de uma enzima que cliva as estruturas secundárias que são formadas quando o DNA é desnaturado e rapidamente renaturado. É um teste somente de detecção e a RT-PCR deve ser realizado a priori com primers biotinilados ou não. A região 5` NCR é utilizada neste teste pode ser usada em conjunto com produtos amplificados de kits comerciais para detecção qualitativa ou quantitativa. Após a RT-PCR, cada amostra é diluída, desnaturada e distribuída em 8 poços com a enzima cleavase I e sondas Invader que diferenciam os genótipos 1 e 6. A placa é incubada por 30 minutos a 63 C, após realiza-se a leitura da placa utilizando uma leitora. O software analisa os dados e determina os genótipos (Weck, 2005). A limitação deste teste é que apenas o genótipo é identificados sem subtipagem. O Abbot ASR é uma reação em one step por PCR em tempo real que utiliza sondas específicas para a determinação dos genótipos. Os primers e sondas são baseados na região 5`NCR com exceção dos genótipos 1a e 1b que utilizam primers e sondas focadas na região NS5B (Weck, 2005). O teste TRUGENE NS5B sequencing assay esta em desenvolvimento pela Visible Genetics/BayerDiagnostics. Este teste incorpora seqüências da região NS5B que são filogeneticamente mais informativas e como padrão ouro podem discriminar também os subtipos de modo preciso (Othman et.al.,2004). O teste utilizando DNA enzima imunoensaio (DEIA) GEN-ETI-K DNA é disponível através da Sorin Biomédica. Neste ensaio, sondas marcadas para genótipo específico da região do core que são ligados em poços de placas em microdiluições. Os

45 produtos da RT-PCR são hibridizados e detectados com anticorpos monoclonais específicos contra a fita dupla de DNA (Viazov et.al., 1994; Vatteroni et.al., 1997). Vários grupos de pesquisas desenvolveram ensaios de sorotipagem para detectar anticorpos genótipos específicos que reaja com epítopos imunodominantes na região NS4 ou da região do core. Estes anticorpos podem diferenciar os genótipos, mas não os subtipos de cada genótipo. Estes testes não são amplamente utilizados, pois no geral não possuem a acurácia dos métodos moleculares (Sandres et.al., 2001). Dois ensaios comerciais estão disponíveis no mercado. Serotyping 1-6 assay (Murex Diagnóstica) é um teste competitivo de enzima imunoensaio (EIA) que utiliza peptídeos sintéticos derivados da região NS4 e do core para detectar anticorpos específicos dos genótipos 1 a 6 (Dixit et.al.,1995). O teste RIBA serotyping SI assay (Chiron) é um imunoblot recombinante com peptídeos sorotipo-específicos da região do NS4 e do core imobilizados numa tira (Pawlotsky et.al.,1997). O teste RIBA detecta somente anticorpos dos genótipos 1 a 3, enquanto que o teste de Murex EIA teoricamente detecta genótipos de 1 a Justificativa Os testes sorológicos referentes à infecção pelo VHC no estado de Rondônia são coletados e analisados pelo Laboratório Central do Estado Lacen RO como também por laboratórios particulares. Enquanto que os testes moleculares são coletados e enviados para laboratórios de referência credenciados juntos ao Ministério da Saúde, causando uma demora maior na liberação dos resultados, podendo ocorrer extravio de amostras durante o trajeto, custo elevado de envio das amostras, além disso, existem os fatores emocionais e psicológicos relacionados ao paciente. Os testes moleculares possuem alto grau de sensibilidade e especificidade, são considerados imprescindíveis para confirmar a infecção persistente e resultam fundamentalmente no acompanhamento do tratamento, verificando o sucesso terapêutico. A PCR em tempo real engloba todas as características positivas dos testes moleculares além de permitir uma maior sensibilidade em

46 amostras com baixas cargas virais. Como podemos observar os testes de biologia molecular representam um avanço no controle e tratamento da infecção pelo VHC, pois permitem não somente a confirmação diagnóstica como também a orientação terapêutica a ser instituída. Portanto este estudo tem a finalidade de contribuir para a implementação de uma técnica que permita a identificação viral, tanto qualitativa como quantitativa em uma única reação juntamente com a genotipagem do vírus, útil não só para estudos epidemiológicos como aplicável a prática clínica, na determinação da necessidade de tratamento e no acompanhamento do paciente. Estes testes moleculares não são realizados em nenhum laboratório público ou e privado no estado de Rondônia, sendo que as amostras que são coletadas são enviadas para laboratórios de outras regiões tais como, Centro- Oeste e Sudeste do País. A padronização destes testes moleculares visa um diagnóstico de rotina que possam atender a demanda de Rondônia e Estados vizinhos com padrão de qualidade, para isso será implantado controles de qualidade no laboratório, garantindo resultados confiáveis. Isso possibilita menor tempo de liberação dos resultados dos testes e um custo mais acessível, seguindo as normas exigidas pela CGLAB Coordenação Geral de Laboratórios de Saúde Pública do Brasil para maior controle de qualidade.

47 2. OBJETIVOS

48 2.1 - Objetivo Geral Padronizar e validar um método para identificação, quantificação e genotipagem do vírus da hepatite C em amostras de soro de pacientes atendidos no ambulatório de hepatites virais do Centro de Pesquisa em Medicina Tropical de RO CEPEM Objetivos Específicos Padronizar um diagnóstico rápido qualitativo e quantitativo da infecção pelo VHC, utilizando metodologia de RT-PCR em tempo real. Produzir um transcrito de RNA para quantificação do VHC através da geração de uma curva externa. Avaliar o teste de padronização quanto à sensibilidade, especificidade e reprodutibilidade comparando com um teste já comercializado de utilização rotineira. Identificar os genótipos 1, 2 e 3 do VHC pela técnica de PCR em tempo real. Comparar os resultados de genotipagem por PCR em tempo real com o seqüenciamento para verificar a acurácia do método.

49 3. MATERIAIS E MÉTODOS

50 3.1 - Local do Estudo O Ambulatório de Hepatites Virais do Centro de Pesquisa em Medicina Tropical de Rondônia (CEPEM), esta localizado na BR 364, Km 3,5 na cidade de Porto Velho, sendo considerado o centro de referência no Estado para o diagnóstico e tratamento das hepatites virais. Foi criado no ano de 1993, com objetivo de atender pacientes com suspeita clinica de hepatites virais com característica aguda ou crônica. Atualmente existem aproximadamente 1500 pacientes cadastrados como portadores de hepatite C atendidos no ambulatório. As amostras de soro dos pacientes são armazenadas em tubo de criopreservação a -70 C para posteriores estudos sorológicos ou moleculares População Estudada Foram incluídos neste estudo pacientes portadores do VHC com marcador sorológico positivo para o vírus. O critério de inclusão: todos anti-vhc positivo utilizado neste estudo abrangia pessoas de ambos os sexos, com idade entre anos atendidos no Ambulatório de Hepatites Virais do CEPEM na cidade de Porto Velho RO durante o período compreendido entre os meses de Janeiro de 2007 a Outubro de Os critérios de exclusão: pacientes abaixo ou acima da faixa etária discriminada, indígenas, grávidas e portadores de outras patologias crônicas associadas Fluxograma da Metodologia Segue abaixo o quadro mostrando o fluxograma de todas as etapas do estudo (Quadro 1).

51 Quadro 1: Fluxograma das etapas desenvolvidas no estudo. Amostras Biológicas Extração do RNA viral Produção do cdna PCR em Tempo Real PCR Convencional - Qualitativo Quantitativo Qualitativo Clonagem Purificação do Amplicon Seqüenciamento Ligação em Vetor de Clonagem Genotipagem Transformação em TOP10F Kit Comercial cdna do Transcrito Extração do DNA Plasmidial Digestão Enzimática Linearização do Plasmídeo Quantificação do Transcrito Produção do Transcrito Purificação do Plasmídeo

52 3.4 - Amostras Biológicas Foram analisadas 100 amostras de soro de pacientes com hepatite C crônica, com confirmação clínica e laboratorial. Os pacientes foram submetidos a um questionário, explicando o objetivo do trabalho e sua relevância, sendo que todos assinaram o termo de consentimento livre esclarecido (TCLE) (Anexo I). Um volume de 10ml de sangue venoso foi coletado do paciente em tubos do tipo Vacutainer sem anticoagulantes. Estas amostras foram incubadas por 2 horas (h) a 37ºC, para retração de coágulo. Após este período as amostras foram centrifugadas por 10 minutos (min) a rotações por minuto (rpm). Em seguida os soros foram distribuídos em duas alíquotas de 1,5 ml cada e armazenados em freezer -70ºC. Uma alíquota foi armazenada na soroteca e a outra para execução dos ensaios moleculares Extração do RNA Viral A obtenção do RNA viral foi realizada através do kit QIAamp viral RNA Kit (QUIAGEN, USA) conforme instruções do fabricante. Em cada tubo estéril tipo ependorf de 1,5 ml foram adicionados 280 µl de soro e 560 µl do tampão AVL ( Viral Lysis Buffer ). Os tubos foram vigorosamente homogeneizado por 15 s (segundos), incubado a temperatura ambiente por 10 min para completa lise da partícula viral e a seguir, centrifugado por 1min a rpm. Após centrifugação foi adicionado 560 µl de etanol absoluto, homogeneizado e centrifugados por 1 min a rpm. Após centrifugação 630 µl da solução foram colocados em colunas com membrana de sílica-gel, acoplados a bases coletoras e centrifugadas por 1 min a rpm. Após este período, as bases de acoplamento da coluna foram descartadas e substituídas por novas. Novamente foram transferidos 630 µl da solução dos tubos para as colunas, centrifugadas por 1 min a rpm, e substituídas às bases. Foi adicionados 500 µl de tampão AW1 ( Washer Buffer 1 ), centrifugados por 1 min a rpm e substituídas as bases.

53 Outro tampão, o AW2 ( Washer Buffer 2 ) foi adicionado na coluna, em um volume de 500 µl, centrifugado por 3 min a rpm para lavagem das colunas. Após a centrifugação, as bases foram descartadas, as colunas acopladas a tubos estéreis de 1,5 ml e adicionados 60 µl de tampão AVE ( Elution Buffer ) no centro das colunas para eluição do RNA. As colunas acopladas aos tubos foram centrifugadas por 1 min a rpm. Por fim as colunas foram descartadas, e os tubos, contendo o RNA viral, foram quantificados por espectrofotômetro para medir a concentração e pureza do RNA da amostra extraída (NanoDrop 1000 Thermo Scientific). Após esta etapa as amostras foram armazenadas em freezer a -70ºC Reação de Transcrição Reversa - RT A produção do DNA complementar (cdna) ocorreu através da reação de transcrição reversa (RT) logo após a extração do RNA viral. Na primeira etapa deste processo o RNA viral extraído foi submetido a 70 C por 10 min e a 4 C por igual período, utilizando-se para cada amostra, 1 µl de iniciadores aleatórios [500µg/ml] (Random Primers - Promega). Na segunda etapa, ao produto da primeira foram acrescentados para cada amostra o volume de 4 µl de solução tampão 5X (First Strand Buffer 5X Invitrogen), 2 µl de Dithiothreitol 0,1 M (Ultra PureTM Dithiothreitol Invitrogen), 3 µl de Desoxinucleotídeos (100 mm dntp Invitrogen) e 0,5 µl de inibidor de RNase [40U/µL] (RNaseOUTTM Recombinant Ribonuclease Inhibitor Invitrogen), e incubados a 42 C por 2 min em termociclador. Ao final desta etapa, adicionou-se 0,5 µl de transcriptase reversa [200U/µL] (SuperScriptTM II Reverse Transcriptase Invitrogen) submetido a incubação, por 50 min a 42 C. O processo de síntese de cdna gerou um produto final de aproximadamente 20 µl de cada amostra. O material foi mantido em congelador a -20ºC até a PCR. Todas as incubações da síntese de cdna foram feitas em termociclador ABI Prism 7500 Veriti (Applied Biosystems).

54 3.7 - Reação em Cadeia da Polimerase em Tempo Real PCR em Tempo Real Primers Utilizou-se a PCR em tempo real inicialmente como qualitativa para detecção do genoma VHC, com seqüências de primers e sondas selecionados na literatura e analisados por bioinformática, através de alinhamentos múltiplos das seqüências disponíveis no banco de dados do Blast National Center for Biotechonolgy do NCBI National Center Bank Bioinformatic (http: //www.ncbi.nlm.nih.gov) para a seqüência dos primers que amplificam um fragmento de 190pb e sondas genótipo específico referente à região 5` NCR (Tabela 1) (Lindh et.al., 2005). Tabela 1: Mostra a seqüência dos primers e sondas utilizados para detecção e genotipagem do VHC. Primer Seqüência TM VHC F 5`CTGCGGAACCGGTGAGTACA 3` 60 C VHC R 5` TGCACGGTCTACGAGACCTCC 3` Sonda Gt1 FAM 5`ACCCGGTCGTCCTGGCAATTCC 3` TAMRA 68.9 C Sonda Gt2 VIC 5`AAGGACCCAGTCTTYCCGGYAATTC 3` TAMRA 68.7 C Sonda Gt3 NED 5`ACCCGGTCACCCCAGCGATTCC 3` TAMRA 70.7 C Sonda Gt4 FAM 5`CCCGGTCATCCCGGCGATTC 3` TAMRA 69.4 C Curva de Eficiência da fórmula: A curva de eficiência foi determinada de acordo com Too (2003), por meio e = (10 1/slope) -1.

55 Especificidade da Reação A avaliação da especificidade do PCR em tempo real foi utilizada a equação s = (1+ e) DCt, onde e significa a eficiência da amplificação e o DCt a diferença dos valores dos Cts da amostra (Too, 2003) Avaliação da Reprodutibilidade Para analise da reprodutibilidade do sistema foram utilizados controles diluídos seriadamente e processados em duplicata juntamente com as amostras de VHC com genótipo e carga viral desconhecida, sendo o mesmo experimento, repetido três vezes Determinação da Sensibilidade Analítica do Método A determinação da sensibilidade em relação à quantificação das amostras foram utilizados controles positivos. Sendo que um controle RNA do VHC foi produzido in house comparado com o controle transcrito de RNA do VHC cedido pelo Laboratório de Virologia da fundação Biomèrieux, referente à região de 5`NCR com fragmento de 90pb. O outro controle utilizado foi o Kit Comercial com painel de quantificação do RNA OptiQuant VHC (Acrometrix, USA). Uma amostra do painel com determinação de 5.000,000 UI/mL foi diluída em plasma humano negativo para VHC em 5.000,000 UI/mL, UI/mL, UI/mL, UI/mL, UI/mL, UI/mL e 500 UI/mL. O cdna dessas amostras foram utilizados na quantificação por PCR em tempo real PCR em Tempo Real Qualitativa Sistema SYBR GReen A reação foi realizada em um volume total de 20 µl, sendo que as amostras analisadas foram processadas em duplicatas. O mix da reação era composto de 10 µl do SYBR Green Master Mix (AppliedBiosystems, CA, USA), 0,5 µl do primer VHC F e VHC R em uma concentração de 300nM, conforme

56 seqüência mencionada na tabela 1,5 µl de cdna e um volume de água ultra pura para completar o volume final da reação. Todas as amostras foram produzidas em duplicata. A reação foi processada utilizando a plataforma tecnológica ABI PRISM 7500 SDS (Applied Biosystems, Foster CA, USA), em 40 ciclos com ciclagens 50 C por 2 min, 95 C por 10 min, 45 ciclos de 95 C por 15 s, 60 C por 1 min e um único ciclo de 95 C por 15 s, 60 C por 1 min para analise da dissociação. A velocidade de incremento da rampa de temperatura foi ajustada para simular o termociclador de PCR em Tempo Real Qualitativa Sistema TaqMan A reação foi realizada em um volume total de 20 µl, sendo 10 µl do kit TaqMan PCR Master Mix (Applied Biosystems), com 300nM de cada primer VHC F e VHC R e 50nM das sondas referentes ao genótipo 1, 2 e 3, conforme seqüência mencionada na tabela 1, 5 µl de cdna e um volume de água ultra pura para completar o volume final da reação. A reação foi processada utilizando a plataforma tecnológica ABI PRISM 7500 SDS (Applied Biosystems, Foster CA, USA), com ciclagens 50 C por 2 min, 95 C por 10 min, 45 ciclos de 95 C por 15 s, 60 C por 1 min. A velocidade de incremento da rampa de temperatura foi ajustada para simular o termociclador de PCR em Tempo Real Quantitativa Na PCR em Tempo Real quantitativa foram utilizados os sistemas SYBR Green e TaqMan, sendo realizada baseada em uma curva padrão externa que consiste em alíquotas de concentrações conhecidas do alvo molecular objeto do estudo. A amplificação e detecção da curva padrão são realizadas paralelamente com as amostras que se quer quantificar. Para a construção desta curva utilizouse a técnica clonagem a partir da inserção da região 5 NCR do VHC em um vetor de clonagem juntamente com controles positivos comerciais.

57 3.8 - Reação em Cadeia da Polimerase PCR Convencional Para a produção da curva padrão utilizou inicialmente a PCR convencional qualitativa, para amplificação do fragmento de 190pb referente à região 5` NCR, mesmo primer utilizado na PCR em Tempo Real. Um plasmídeo com inserto de 190pb foi clonado, sendo transcrito para uma molécula de RNA. O cdna do transcrito quantificado foi submetido a PCR em tempo real em duplicata juntamente com as amostras desconhecidas e os controles positivos em triplicata. Para a PCR convencional selecionou-se 02 amostras com carga viral conhecida. Aproximadamente 50ng do cdna foram usados numa reação com volume final de 50µL, sendo 5 µl do Tampão 10x concentrado da enzima (200mM Tris-HCL [ph 8,4], 500mM KCL), 2mM de Cloreto de Magnésio (MgCl 2 ) 50mM, 0,1mM dntps e 0,3 µm de cada primer (Tabela 1) e 1,5U de DNA polimerase (Platinum Taq DNA polymerase, Invitrogen). As amplificações foram realizadas no termociclador ABI Prism 7500 Veriti (Applied Biosystems) com uma temperatura de desnaturação inicial de 94 o C por 5 min, seguida de 40 ciclos de 94 o C por 1 min, 53 o C por 1 min, 72 o C por 2 min e uma extensão final de 10 min a 72 o C. O resultado das amplificações foi detectado por eletroforese em gel de agarose a 1,9%, corado com brometo de etídeo 1µg/mL, visualizados em luz ultravioleta e digitalizados pelo UVP Vision Works (UVP, Inglaterra) Purificação dos Fragmentos Utilizando QIAquick Gel Extraction Kit (Qiagen-USA) As bandas correspondentes aos fragmentos amplificados foram seccionadas do gel de agarose, colocadas em tubo tipo eppendorf, adicionandose 300 µl de QG Solubilization buffer, incubou-se a temperatura de 50 C por 5 min para solubilização da agarose, em seguida adicionou-se 150 µl de álcool isopropilico e incuba-se a temperatura ambiente por 5 min. Adicionou-se todo o volume na coluna fornecida no kit, centrifugou-se por 1 min a 8000 rpm, descartou-se o sobrenadante e lavou-se a coluna com 750 µl de Buffer PE Wash, centrifugou-se novamente por 8000 rpm por 1 min novamente, descartou-

58 se o sobrenadante, identificou-se outro tubo eppendorf e lavou-se a coluna com 40 µl de Buffer EB Elution buffer Preparação de Bactérias Competentes O preparo de células competentes seguiu a metodologia descrita por Messing (1979). Bactérias E. coli TOP 10 F, estocadas a 70 o C em meio LB/ DMSO 10% (Dimetilsulfóxido) foram semeadas em placas contendo LB/ágar a 1,5%, e incubadas a 37 o C por 18 h. Uma colônia foi inoculada em 5 ml de meio LB para crescimento durante 18 a 20 h a 37 o C em agitação constante (250 rpm/min) e então 0,5 ml desta cultura foram inoculados em 50 ml de meio LB. As culturas foram coletadas em fase exponencial de crescimento determinada quando a absorbância a 600 nm (nanômetro) estava entre 0,35 e 0,45. As bactérias foram sedimentadas por centrifugação a rpm, por 10 min a 4 o C, e logo suspensas em 0,5 volumes de uma solução de CaCl 2 50mM. Após 2 h de incubação em gelo, as bactérias foram centrifugadas e o precipitado suspenso em 0,8 vol. de tampão FSB (Acetato de potássio 10 mm ph 7,5; MnCl 2. 4H 2 O 45 mm; CaCl 2.2H 2 O 10 mm; KCl 100 mm; Glicerol 10%). Para armazenamento foi adicionado DMSO a 10% e a preparação distribuída em alíquotas de 200 µl, congelada em nitrogênio líquido e posteriormente estocadas a 70 o C Clonagem dos Amplicons Purificados Para a clonagem do fragmento de 190pb purificado do produto amplificados foi ligado ao vetor ptz57r/t (Fermentas, Life Sciences) (Figura 9) pela ligação T-A.

59 Figura 9: Mostra o vetor ptz57r/t utilizado para produção da curva padrão. Para a ligação T-A, aproximadamente 100 ng (4 µl) do produto purificado da PCR foi usado numa reação de 6 µl que continha 1 µl do tampão 10X e 1 µl do vetor ptz57r/t. A solução final foi misturada e incubada por 30 min a temperatura ambiente. Após incubação, adicionou-se 2 µl da reação a 200 µl de células competentes (E. coli TOP 10 F) e incubou-se no gelo por 15 min e logo após por 42 C por 60 s, retornou-se ao gelo por mais 15 min e em seguida adicionou-se 150 µl de meio de cultura SOC (Gibco) à solução, que foi submetida à agitação constante de 215 rpm, durante 30 min a 37 C. Após agitação, 150 µl da reação foram aplicados em uma placa contendo meio sólido LB/Agar, 100 µg/ml de ampicilina, IPTG/X-Gal e incubada a 37 C por 16 h. As colônias brancas nas placas LB/Agar, foram processadas para o isolamento do DNA plasmidial, pois é esperado que estas contenham o inserto Extração do DNA Plasmidial (Miniprep) As colônias resultantes da transformação foram selecionadas com base na mudança de coloração. As colônias brancas foram escolhidas ao acaso nas placas LB/Agar/ IPTG/X-gal, e processadas para isolamento de DNA plasmidial. As colônias foram cultivadas em 2 ml de meio LB/ampicilina a 37oC por 18 h, em agitação constante (280 rpm/min) e os plasmídeos foram extraídos usando o procedimento de mini-preparação descrito em Sambrock et al., (1989).

60 Análise do DNA Plasmidial Através de Enzimas de Restrição Para analisar se os plasmídeos extraídos pela metodologia de miniprep possuíam o inserto, foram utilizadas as enzimas de restrição Bam HI e Eco RI (Invitrogen - USA). Para isso foram utilizados 3 µl do produto de miniprep, 1µL de tampão 10X react 3, 0,8µL de Bam HI e 0,6 de Eco RI, água ultra pura 10µL, o mix foi incubada a 37 C por 2 h. O gel de agarose a 2,0%, acrescido de brometo de etídio 1µg/mL (Sigma Chemical Company, St. Louis, USA), foi usado para confirmação e visualização da ligação do inserto ao vetor de clonagem. Os produtos de digestão foram então comparados a marcador de 50 pb (Invitrogen -USA), visualizados em transluminador UV Linearização do Plasmídeo Após a confirmação do processo de clonagem através da digestão enzimática, foi realizada a linearização do plasmídeos extraídos com a enzima de restrição Eco RI (Invitrogen - USA). Para isso foram utilizados 3 µl do produto de miniprep, 1µL de tampão 10X react 3, 0,5 µl de Eco RI e água ultra pura, a mistura foi incubada a 37 C por 2 h. O gel de agarose a 2,0%, acrescido de brometo de etídio 1µg/mL (Sigma Chemical Company, St. Louis,USA), foi usado para confirmação e visualização do processo de linearização do vetor de clonagem. Os produtos de digestão foram então comparados a marcador de 50 pb (Invitrogen -USA), visualizados em transluminador UV Purificação do Plasmídeo Linearizado A purificação do fragmento linearização após corte com enzimas de restrição foi realizada com uso de kit QIAquick Gel Extraction Kit (QIAGEN- USA), conforme instrução do fabricante, descrito no item

61 Produção do Transcrito do VHC Para a produção do transcrito de RNA do VHC os plasmídeos foram quantificados por espectrofotometria seguida da digestão enzimática com a enzima de restrição Eco RI (Invitrogen - USA), conforme metodologia descrita no item Os produtos de digestão foram então comparados a marcador de peso molecular (Invitrogen -USA), visualizados em transluminador UV. Após a confirmação da digestão enzimática, o produto restante da reação de digestão (45 µl) foi utilizado para o processo de extração pelo método Fenolclorofórmio. No produto da digestão do plasmídeo foi adicionado 1 volume de Fenol:clorofórmio:álcool isoamílico na proporção 25:24:1, agitou-se a mistura em vortex e centrifugou-se por 2 min a rpm. A fase aquosa transparente superior foi transferida para um novo tubo de 1,5 ml e adicionou-se 1 volume de clorofórmio:álcool isoamílico na proporção 24:1 agitou-se a mistura em vortex e centrifugou-se por 2 min a rpm. Novamente, a fase aquosa transparente superior foi transferida para um novo tubo de 1,5 ml para adição de 0,1 volume de Acetato de Sódio 3M ph 5,2 (Promega) e 2,5 volume de etanol absoluto, incubando-a por 5 min a 4 C. Logo após esta etapa centrifugou-se por 10 min a rpm. O sobrenadante foi descartado e adicionando-se o mesmo volume de etanol a 70%, centrifugou-se por 10 min a rpm. Descartou-se o sobrenadante e o excesso de etanol foi retirado em um concentrador (Eppendorf, Alemanha) por 5 min. O pellet foi ressuspenso em 10 µl de água nuclease free (Promega). Após esta etapa ocorreu a transcrição do DNA plasmidial extraído utilizando o kit RiboMaxTM em larga escala para produção do RNA em sistema T7 ( RiboMaxTM Large Scale RNA production system T7, Promega), conforme instrução do fabricante utilizando controles positivos. Para reação foi utilizado um mix com os seguintes componentes: 8 µl Tampão T7 5x da transcrição, 6 µl rntps (25mM ATP, CTP, GTP e UTP), 12 µg do DNA plasmidial extraído, 4 µl Mix da Enzima T7 e a água livre de nuclease foi adicionada para completar o volume de 40 µl da reação. As amostras foram incubadas a 37 C por 4 h. Logo após, adicionou-se 2 U de RNase free DNase/µg de DNA e incubados a 37 C por 1 h. Em seguida ocorreu a purificação do

62 transcrito de RNA, com adição de 1 volume de fenol (ph 4.5):clorofórmio: álcool isoamílico (24:25:1), agitou-se a mistura em vortex e centrifugou-se por 2 min a rpm. A fase aquosa transparente superior foi transferida para um novo tubo de 1,5 ml e adicionou-se 1 volume de clorofórmio:álcool isoamílico na proporção 24:1 agitou-se a mistura em vortex e centrifugou-se por 2 min a rpm. Novamente, a fase aquosa transparente superior foi transferida para um novo tubo de 1,5 ml para adição de 1/10 volume de acetato de sódio 3M ph 5,2 (Promega) e álcool isopropanol, incubando-a por 5 min a 4 C. Logo após esta etapa centrifugou-se por 10 min a rpm. O sobrenadante foi descartado e adicionado o mesmo volume de etanol a 70%, centrifugando-o por 10 min a rpm. Descartou-se o sobrenadante e o excesso de etanol foi retirado em um concentrador (Eppendorf, Alemanha) por 5 min. O pellet foi ressuspenso em 20 µl de água nuclease free (Promega) e armazenados a -70 C Quantificação do Transcrito O transcrito de RNA foi quantificado por espectrofotômetro para medir a concentração e pureza do RNA (NanoDrop 1000 Thermo Scientific). A quantificação absoluta foi utilizada para determinação do número exato de moléculas de RNA transcrito para determinação da carga viral. Após a quantificação foi determinado o numero de cópias/µl do transcrito de RNA baseado na formula abaixo. As amostras quantificadas foram diluídas seriadamente e submetidas à reação de transcrição reversa (RT), conforme metodologia descrita 3.6. Número de cópias do transcrito = (X g/µl RNA/ [tamanho do transcrito em pb x 340]) x 6,022 x Genotipagem do VHC Para genotipagem das amostras do VHC foram utilizados as seguintes técnicas: seqüenciamento e a PCR em tempo real utilizando sondas especificas para os genótipos 1, 2 e 3 descrita na tabela 1.

63 Seqüenciamento das Amostras de VHC Das 100 amostras analisadas 40 amostras foram escolhidas de forma aleatórias para realização do seqüenciamento no Laboratório de Metabolismo Macromolecular Firmino Torres de Castro da Universidade Federal do Rio de Janeiro, gentilmente cedido pelo Prof. Dr. Edson Rondinelli, Dra. Rosane Silva e Dr. Túran P. Ürményí, utilizando o seqüenciador MegaBACE (GE Healthcare Life Sciences), sem prévia clonagem e primers que amplificam fragmento da região NS5b do vírus Reação de PCR para Seqüenciamento das Amostras de VHC Inicialmente foi realizada uma PCR para detecção do VHC nas amostras de cdna selecionadas. Para reação foram utilizados primers que amplificam um fragmento de 260pb da NS5b do vírus VHC, sendo 5 µl do Tampão 10x concentrado da enzima (200mM Tris-HCL [ph 8,4], 500mM KCL), 2mM de Cloreto de Magnésio (MgCl2) 50mM, 2,5mM dntps e 30pmol/µL de cada primer, e 5U de DNA polimerase (Taq DNA polymerase, Invitrogen), 10 µl de cdna e água ultra pura para completar o volume final de 50 µl. As amplificações foram realizadas no termociclador 9700 (Eppendorf), seguida de 25 ciclos com temperaturas 94 o C por 15 seg, 53 o C por 15 seg, 72 o C por 15 seg, após esta ciclagem foi realizada uma extensão final de 10 min a 72 o C. O resultado das amplificações foi detectado por eletroforese em gel de agarose a 1,5%, corado com brometo de etídeo 1µg/mL, visualizados em luz ultravioleta e digitalizados pelo UVP Vision Works (UVP, Inglaterra) Reação de Nested PCR para Seqüenciamento das Amostras de VHC Os amplicons positivos na primeira PCR foram submetidos à Nested PCR com primers que amplificam um fragmento de 215pb da NS5b do vírus VHC. Para esta reação foram utilizados 5 µl do Tampão 10x concentrado da enzima (200mM Tris-HCL [ph 8,4], 500mM KCL), 2mM de Cloreto de Magnésio (MgCl 2 ) 50mM, 2,5mM dntps e 30pmol/µL de cada primer, e 5U de DNA polimerase

64 (Taq DNA polymerase, Invitrogen), 5 µl do amplicon e água ultra pura para completar o volume final de 50 µl. As amplificações foram realizadas no termociclador 9700 (Eppendorf), seguida de 25 ciclos com temperaturas 94 o C por 15 seg, 53 o C por 15 seg, 72 o C por 15 seg, após esta ciclagem foi realizada uma extensão final de 10 min a 72 o C. O resultado das amplificações foi detectado por eletroforese em gel de agarose a 1,5%, corado com brometo de etídeo 1µg/mL, visualizados em luz ultravioleta e digitalizados pelo UVP Vision Works (UVP, Inglaterra) Purificação do Produto da Reação de Nested PCR para Seqüenciamento das Amostras de VHC Após a confirmação da amplificação das amostras por Nested PCR, foi realizada a purificação do amplicon pelo kit microcon (Montáge life science kits) conforme instrução do fabricante. Em um tubo de 1,5 ml foi acoplada a coluna com o filtro (kit), onde foram adicionados 200 µl de água destilada e todo o amplicon para centrifugação por 20 min a 4400 rpm. Após este período identificou-se um novo tubo de 1,5 ml transferindo a coluna com o filtro e adicionou-se 30 µl de água destilada dentro da coluna centrifugando por 20 min a 4400 rpm. Descartou-se a coluna e armazenou-se - 20 C Reação de Seqüenciamento As amostras foram submetidas à detecção no seqüenciador automático MegaBACE (GE Healthcare Life Sciences) utilizando protocolo e programação padrão de corrida com parâmetros padronizados pelo laboratório.

65 4. RESULTADOS

66 4.1 - Analise dos primers Os primers selecionados VHC F e VHC R mostraram-se específicos para o vírus da hepatite C quando analisado através do programa Blast, conforme figura 10 e 11. A eficiência dos primers foi demonstrada quando as amostras analisadas foram amplificadas utilizando as técnicas PCR em tempo real e na PCR convencional. Figura 10: Alinhamento realizado no BLAST com primer VHC F, mostrando uma máxima identidade entre as cepas utilizadas no alinhamento.

67 Figura 11: Alinhamento realizado no BLAST com primer VHC R, mostrando uma máxima identidade entre as cepas utilizadas no alinhamento PCR em Tempo Real Qualitativa Inicialmente foi realizada a padronização da reação de transcrição reversa (RT) das amostras de VHC. Para esta etapa foram utilizadas 05 amostras, selecionadas de forma aleatória e em uma reação em duas etapas. Os resultados referentes à padronização do processo de RT foram observados na PCR em tempo real de acordo com ciclo de amplificação (Ct). Os 05 cdnas tiveram resultados similares em ambos sistemas, estes resultados são demonstrados na tabela 2.

68 Tabela 2: Ct de amplificação do resultado obtido na reação de PCR em tempo real, utilizando os sistemas TaqMan e SYBR Green, referente a padronização da RT. PCR em Tempo Real Amostras Sistema TaqMan Sistema SYBR Green 1236 Ct = 22,40 Ct = 22, Ct = 23,88 Ct = 23, Ct = 31,92 Ct = 30, Ct = 32,97 Ct = 32, Ct = 32,98 Ct = 31, PCR em Tempo Real Qualitativa Pelo sistema SYBR Green os primers VHC F e VHC R foram testados em varias concentrações finais que variava entre 300nM a 600nM, juntamente com uma amostra controle positivo para VHC. Verificou-se que o comportamento da reação em relação ao gradiente de concentração não diferenciava em relação ao Ct de amplificação, conforme figura 12.

69 Figura 12: PCR em tempo real utilizando o sistema SYBR com a variação de concentração do primer. Amplificação no Ct 24,1= 300nM, Ct 24,7 = 400nM, Ct 25,4 = 500nM e Ct 25,8 = 600nM. A segunda analise refere-se aos cdnas de 05 amostras de VHC, testadas em duplicatas, utilizando a concentração final do primer em 500nM e 600nM, já que diferença foi mínima entre os Cts dessas concentrações. A partir dessa analise ficou determinada concentração de 500nM para o primer. A tabela 3 demonstra a média dos valores dos Cts nas duas concentrações avaliadas.

70 Tabela 3: Valores dos Cts de amplificação das amostras testadas para as concentrações finais dos primers 500nM e 600nM. Amostras Sistema SYBR Green Primer VHC F e VHC R Primer VHC F e VHC R (500nM) (600nM) 1236 Ct = 22,40 Ct = 22, Ct = 23,88 Ct = 23, Ct = 31,92 Ct = 31, Ct = 32,97 Ct = 32, Ct = 32,98 Ct = 32,24 As 100 amostras de VHC utilizados neste estudo amplificaram com primer na concentração de 500nM, testadas em duplicatas, conforme figura 13a.e 13b. Figura 13a: Amostras de VHC amplificadas com primers na concentração final de 500nM utilizando o sistema SYBR Green.

71 Figura 13b: Dissociação das amostras de VHC amplificadas com primers na concentração final de 500nM utilizando o sistema SYBR Green Produção do Plasmídeo para Construção da Curva Padrão Padronização da Reação de PCR Convencional O controle positivo VHC foi utilizado para realização de um gradiente de temperatura de anelamento dos primers com concentração final de 500nM, as temperaturas testadas foram 55 C, 56 C, 57 C, 58 C, 59 C, 60 C e 61 C, todas as amostras amplificaram, produzindo um amplicon correspondente ao tamanho 190pb, conforme demonstrada na figura 14.

72 M pb 190pb Figura 14 Perfil eletroforético do gel de agarose a 2.0%, mostrando o gradiente de temperatura dos primers VHC F e VHC R para amplificação do fragmento da região 5`NCR correspondentes a 190pb. Coluna M- peso molecular 50 pb, Coluna 1: T-55 C; Coluna 2: T-56 C; Coluna 3: T-57 C; Coluna 4: T-58 C; Coluna 5: 59 C; Coluna 6: 60 C e Coluna 7: 61 C. A temperatura de anelamento escolhida para amplificação das amostras foi 60 C. Cinco amostras amplificaram juntamente com o controle positivo, conforme figura 15. M pb 190pb Figura 15 Perfil eletroforético do gel de agarose a 2.0%, mostrando os amplicons da RT-PCR com uso de primers VHC F e VHC R para amplificação do fragmento da região 5`NCR correspondentes a 190pb. Coluna M- peso molecular 50 pb, Coluna 1 a 5: Amostras de VHC; Coluna 6: Controle Positivo de VHC; Coluna 7: Controle branco.

73 Digestão do DNA Plasmidial Na confirmação da clonagem 07 clones foram obtidos pelo processo de digestão enzimática, conforme figura 16. ptz 2886 pb 250pb 190 pb Figura 16: Perfil eletroforético do gel de agarose 2.0%, acrescido de brometo de etídio 0.1%. Digestão enzimática com Bam HI e Eco RI, dos produtos de clonagem em vetor ptz e fragmento do VHC. Coluna M: peso molecular de 50 pb; Colunas 1-7: ptz ligado ao amplicon do VHC Digestão do Plasmideo Controle No processo de re-transformação no plasmídeo controle positivo foi obtidos 04 clones, conforme figura 17. M pb pbluescript II SK 3.0 Kb 90 pb Figura 17: Perfil eletroforético do gel de agarose 2.0%, acrescido de brometo de etídio 0.1%. Digestão enzimática com Bam HI e EcoRI, do plasmideo controle re-transformado contendo fragmento do VHC. Coluna M: peso molecular de 50 pb; Colunas 1,2,4 e 5: plasmídeo controle ligado ao amplicon do VHC.

74 Linearização do Plasmídeo Foram produzidos 04 clones linearizados com Eco RI para produção do transcrito de VHC, conforme figura 18. M pb Figura 18: Em M: Marcado de peso molecular de 100pb. Linha 1 a 4: plasmídeo ptz Linearizado com a enzima de restrição EcoRI. O plasmideo controle linearizado produziu 04 clones para ser utilizado como controle na produção do transcrito de RNA de VHC, conforme figura 19. M pb Vetor + Inserto Figura 19: Em M: Marcado de peso molecular de 100pb. Linha 1 a 4: plasmídeo controle Linearizado com a enzima de restrição Eco RI.

HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem

HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem O Vírus da Hepatite C (HCV) é considerado o principal agente etiológico responsável por 90 a 95% dos casos de hepatite pós-transfusional não A e não

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

Hepatites Virais. Carmen Regina Nery e Silva agosto 2011 Regina.nery@aids.gov.br

Hepatites Virais. Carmen Regina Nery e Silva agosto 2011 Regina.nery@aids.gov.br Hepatites Virais Carmen Regina Nery e Silva agosto 2011 Regina.nery@aids.gov.br Definição Hepatite viral: Doença causada exclusivamente por vírus hepatotrópico. Diagnóstico Diferencial: CMV, mononucleose

Leia mais

MANEJO HEPATITES VIRAIS B/C - 2015

MANEJO HEPATITES VIRAIS B/C - 2015 MANEJO HEPATITES VIRAIS B/C - 2015 HEPATITE C PAPEL DA ATENÇÃO PRIMÁRIA EM SAÚDE FILIPE DE BARROS PERINI Assessor Técnico GEDST-DIVE-SES Infectologista Policlínica Municipal do Continente SMS-PMF Assessor

Leia mais

PROCEDIMENTOS SEQUENCIADOS PARA O DIAGNÓSTICO, INCLUSÃO E MONITORAMENTO DO TRATAMENTO DA INFECÇÃO PELO VÍRUS DA HEPATITE C.

PROCEDIMENTOS SEQUENCIADOS PARA O DIAGNÓSTICO, INCLUSÃO E MONITORAMENTO DO TRATAMENTO DA INFECÇÃO PELO VÍRUS DA HEPATITE C. PROCEDIMENTOS SEQUENCIADOS PARA O DIAGNÓSTICO, INCLUSÃO E MONITORAMENTO DO TRATAMENTO DA INFECÇÃO PELO VÍRUS DA HEPATITE C. A) DIAGNÓSTICO ETAPA I - TRIAGEM SOROLÓGICA ( ANTI-HCV ) ETAPA II CONFIRMAÇAO

Leia mais

VIROLOGIA RETROVÍRUS 1. HIV

VIROLOGIA RETROVÍRUS 1. HIV Instituto Federal de Santa Catarina Curso Técnico em Biotecnologia Unidade Curricular: Microbiologia VIROLOGIA RETROVÍRUS 1. Prof. Leandro Parussolo O que é um retrovírus? É qualquer vírus que possui o

Leia mais

Encerramentos de Casos de Hepatites Virais no SINAN. Lucia Mardini DVAS

Encerramentos de Casos de Hepatites Virais no SINAN. Lucia Mardini DVAS Encerramentos de Casos de Hepatites Virais no SINAN Lucia Mardini DVAS Programa Estadual para a Prevenção e o Controle das Hepatites Virais/RS CEVS Rua Domingos Crescêncio Nº 132 sala 310 hepatites@saude.rs.gov.br

Leia mais

DIAGNÓSTICO LABORATORIAL DA INFECÇÃO PELO VÍRUS DA HEPATITE C Revisão da Literatura

DIAGNÓSTICO LABORATORIAL DA INFECÇÃO PELO VÍRUS DA HEPATITE C Revisão da Literatura CLÁUDIA REGINA FAVALI SCAVASSA DIAGNÓSTICO LABORATORIAL DA INFECÇÃO PELO VÍRUS DA HEPATITE C Revisão da Literatura Trabalho de Conclusão do Curso de Biologia Molecular Aplicada ao Diagnóstico Laboratorial.

Leia mais

Hepatites Virais. Vírus da hepatite B (HBV); DNA de fita dupla, envelopado. Vírus da hepatite C (HCV); RNA de fita simples, envelopado

Hepatites Virais. Vírus da hepatite B (HBV); DNA de fita dupla, envelopado. Vírus da hepatite C (HCV); RNA de fita simples, envelopado Departamento de Microbiologia Instituto de Ciências Biológicas Universidade Federal de Minas Gerais http://www.icb.ufmg.br/mic/diaadia Hepatites Virais A hepatite é um processo inflamatório que acomete

Leia mais

Retrovírus: AIDS. Apresentador: Eduardo Antônio Kolling Professor: Paulo Roehe Pós doutorandos: Fabrício Campos e Helton dos Santos

Retrovírus: AIDS. Apresentador: Eduardo Antônio Kolling Professor: Paulo Roehe Pós doutorandos: Fabrício Campos e Helton dos Santos Retrovírus: AIDS Apresentador: Eduardo Antônio Kolling Professor: Paulo Roehe Pós doutorandos: Fabrício Campos e Helton dos Santos HIV (Vírus da Imunodeficiência Humana) Surgimento: -Provável origem durante

Leia mais

HEPATITES. Prof. Fernando Ananias HEPATITE = DISTÚRBIO INFLAMATÓRIO DO FÍGADO

HEPATITES. Prof. Fernando Ananias HEPATITE = DISTÚRBIO INFLAMATÓRIO DO FÍGADO HEPATITES Prof. Fernando Ananias HEPATITE = DISTÚRBIO INFLAMATÓRIO DO FÍGADO Hepatites virais: agentes etiológicos A B C D E Vírus hepatotrópicos G TT Herpes vírus EBV CMV Enterovírus Adenovírus Febre

Leia mais

Vigilância Epidemiológica das Hepatites Virais Programa Estadual para a Prevenção e o Controle das Hepatites Virais/RS

Vigilância Epidemiológica das Hepatites Virais Programa Estadual para a Prevenção e o Controle das Hepatites Virais/RS Vigilância Epidemiológica das Hepatites Virais Programa Estadual para a Prevenção e o Controle das Hepatites Virais/RS Lucia Mardini DVAS Hepatites Virais Hepatite: inflamação do fígado. As hepatites podem

Leia mais

SUMÁRIO 1. RESUMO EXECUTIVO... 3 1.1. CONTEXTUALIZAÇÃO... 3 1.2. CONCLUSÕES... 3 1.3. PERGUNTA ESTRUTURADA... 4 1.4. CONTEXTUALIZAÇÃO(1)...

SUMÁRIO 1. RESUMO EXECUTIVO... 3 1.1. CONTEXTUALIZAÇÃO... 3 1.2. CONCLUSÕES... 3 1.3. PERGUNTA ESTRUTURADA... 4 1.4. CONTEXTUALIZAÇÃO(1)... NT93/2013 Solicitante: Ilmo Dr Anacleto Falci 2ª Juiz de Direito Auxiliar Especial 7ª Vara Cível - Comarca de Governador Valadares/MG Data: 14/06/2013 Medicamento X Material Procedimento Cobertura Numeração:

Leia mais

Hepatites B e C Trabalho de Biologia Turma 12 Professor Cesar Fragoso José Carlos Teixeira Altomari - nº 15 Leonardo Da Costa Guimarães - nº 17 Pedro Henrique de Siqueira Vogas - nº 25 Pedro Luis Guimarães

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

HEPATITES O QUE VOCÊ PRECISA SABER

HEPATITES O QUE VOCÊ PRECISA SABER HEPATITES O QUE VOCÊ PRECISA SABER O QUE É HEPATITE? QUAIS OS TIPOS? Hepatopatias Hepatites Virais Doença hepática alcoólica Hepatopatias criptogênicas Hepatites tóxicas Hepatopatias auto-imunes Hepatopatias

Leia mais

ENSAIOS IMUNOLÓGICOS NAS ENFERMIDADES VIRAIS ANTICORPOS MONOCLONAIS GENÉTICA MOLECULAR CITOMETRIA DE FLUXO

ENSAIOS IMUNOLÓGICOS NAS ENFERMIDADES VIRAIS ANTICORPOS MONOCLONAIS GENÉTICA MOLECULAR CITOMETRIA DE FLUXO ENSAIOS IMUNOLÓGICOS NAS ENFERMIDADES VIRAIS I - INTRODUÇÃO *NOVAS TECNOLOGIAS ANTICORPOS MONOCLONAIS GENÉTICA MOLECULAR CITOMETRIA DE FLUXO *DECISÃO DIAGNÓSTICA CONFIRMAÇÃO TRATAMENTO MONITORAMENTO PREVENÇÃO

Leia mais

Seleção de Temas. Questionário - Proficiência Clínica. Área: Imunologia Rodada: Julho/2008. Prezado Participante,

Seleção de Temas. Questionário - Proficiência Clínica. Área: Imunologia Rodada: Julho/2008. Prezado Participante, Seleção de Temas Prezado Participante, Gostaríamos de contar com a sua contribuição para a elaboração dos próximos materiais educativos. Cada questionário desenvolve um assunto (temas) específico dentro

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

ESTA PALESTRA NÃO PODERÁ SER REPRODUZIDA SEM A REFERÊNCIA DO AUTOR

ESTA PALESTRA NÃO PODERÁ SER REPRODUZIDA SEM A REFERÊNCIA DO AUTOR ESTA PALESTRA NÃO PODERÁ SER REPRODUZIDA SEM A REFERÊNCIA DO AUTOR Considerações sobre o diagnóstico de doenças transmitidas pelo sangue Ms. Paulo Germano de Carvalho O sangue é uma porta de entrada para

Leia mais

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi VIROLOGIA HUMANA Professor: Bruno Aleixo Venturi O que são vírus? A palavra vírus tem origem latina e significa "veneno". Provavelmente esse nome foi dado devido às viroses, que são doenças causadas por

Leia mais

Vírus - Características Gerais. Seres acelulares Desprovidos de organização celular. Não possuem metabolismo próprio

Vírus - Características Gerais. Seres acelulares Desprovidos de organização celular. Não possuem metabolismo próprio vírus Vírus - Características Gerais Seres acelulares Desprovidos de organização celular Não possuem metabolismo próprio Capazes de se reproduzir apenas no interior de uma célula viva nucleada Parasitas

Leia mais

Infecção pelo HIV e AIDS

Infecção pelo HIV e AIDS Infecção pelo HIV e AIDS Infecção pelo HIV e AIDS 1981: pneumonia por Pneumocystis carinii/jirovecii outros sinais e sintomas: infecção do SNC, infecção disseminada por Candida albicans, perda de peso,

Leia mais

Papilomavírus Humano HPV

Papilomavírus Humano HPV Papilomavírus Humano HPV -BIOLOGIA- Alunos: André Aroeira, Antonio Lopes, Carlos Eduardo Rozário, João Marcos Fagundes, João Paulo Sobral e Hélio Gastão Prof.: Fragoso 1º Ano E.M. T. 13 Agente Causador

Leia mais

A hepatite aguda causa menos danos ao fígado que a hepatite crônica.

A hepatite aguda causa menos danos ao fígado que a hepatite crônica. Hepatites Virais O FÍGADO E SUAS FUNÇÕES. O fígado é o maior órgão do corpo humano, está localizado no lado superior direito do abdômen, protegido pelas costelas (gradio costal). É responsável por aproximadamente

Leia mais

Dengue NS1 Antígeno: Uma Nova Abordagem Diagnóstica

Dengue NS1 Antígeno: Uma Nova Abordagem Diagnóstica Dengue NS1 Antígeno: Uma Nova Abordagem Diagnóstica Dengue é uma doença endêmica que afeta mais de 100 países, incluindo as regiões de clima tropical e subtropical da África, Américas, Leste do Mediterrâneo,

Leia mais

Programa Nacional para a Prevenção e o Controle das Hepatites Virais

Programa Nacional para a Prevenção e o Controle das Hepatites Virais Programa Nacional para a Prevenção e o Controle das Hepatites Virais Secretaria de Vigilância em Saúde Ministério da Saúde Gerusa Maria Figueiredo gerusa.figueiredo@saude.gov.br I CONGRESSO BRASILEIRO

Leia mais

ANEXO II. 1 HEPATITE B VÍRUS DA HEPATITE B (Hepatitis B Vírus HBV)

ANEXO II. 1 HEPATITE B VÍRUS DA HEPATITE B (Hepatitis B Vírus HBV) ANEXO II ANEXO DA RESOLUÇÃO SESA Nº.../2009 MANUAL DE ORIENTAÇÃO PARA ALTERAÇÃO DA CAUSA DE REJEIÇÃO DO CÓDIGO 57 (INCONCLUSIVO), PELOS SERVIÇOS DE HEMOTERAPIA NO SHTWEB. 1. Segundo a RDC nº 153 de 14

Leia mais

Informação pode ser o melhor remédio. Hepatite

Informação pode ser o melhor remédio. Hepatite Informação pode ser o melhor remédio. Hepatite HEPATITE A hepatite é uma inflamação do fígado provocada na maioria das vezes por um vírus. Diferentes tipos de vírus podem provocar hepatite aguda, que se

Leia mais

HIV como modelo de estudo de retrovírus e patogênese

HIV como modelo de estudo de retrovírus e patogênese HIV como modelo de estudo de retrovírus e patogênese Retrovírus e oncogênese. Um pouco de história: 1904: Ellerman and Bang, procurando por bactérias como agentes infecciosos para leucemia em galinhas,

Leia mais

CONTROLE DE COPIA: PT-LB-IM-021 ANTI HIV 22/10/2015

CONTROLE DE COPIA: PT-LB-IM-021 ANTI HIV 22/10/2015 PT-LB-IM-1 1/6 1. INTRODUÇÃO / FINALIDADE DO MÉTODO O vírus da imunodeficiência humana é o agente causador da síndrome da imunodeficiência adquirida (AIDS). A AIDS foi pela primeira vez descrita nos Estados

Leia mais

Instituto Federal de Santa Catarina Unidade Curricular: Microbiologia Curso Técnico em Biotecnologia

Instituto Federal de Santa Catarina Unidade Curricular: Microbiologia Curso Técnico em Biotecnologia Instituto Federal de Santa Catarina Unidade Curricular: Microbiologia Curso Técnico em Biotecnologia VIROLOGIA Prof. Me Leandro Parussolo Introdução à Virologia Vírus (latim = veneno ); Classe de agentes

Leia mais

Diagnóstico Imunológico das Hepatites Virais

Diagnóstico Imunológico das Hepatites Virais Diagnóstico Imunológico das Hepatites Virais O Fígado Limpa o sangue Regula os hormônios Ajuda na coagulação sanguínea Produz bile Produz proteínas importantes Mantém o nível de açúcar sanguíneo Etc O

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

PERFIL HEPATITE. Segurança para o diagnóstico e acompanhamento clínico.

PERFIL HEPATITE. Segurança para o diagnóstico e acompanhamento clínico. PERFIL HEPATITE Segurança para o diagnóstico e acompanhamento clínico. TLA - Total Lab Automation Agilidade e Confiança TAT (Turn Around Time) de produção de 2 horas. Quatro linhas de produção totalmente

Leia mais

Gripe A (H1N1) de origem suína

Gripe A (H1N1) de origem suína Gripe A (H1N1) de origem suína A gripe é caracterizada como uma doença infecciosa com alto potencial de contagio causado pelo vírus Influenza. Este vírus apresenta três tipos, sendo eles o A, B e C. Observam-se

Leia mais

A genética do vírus da gripe

A genética do vírus da gripe A genética do vírus da gripe Para uma melhor compreensão das futuras pandemias é necessário entender sobre as pandemias passadas e os fatores que contribuem para a virulência, bem como estabelecer um compromisso

Leia mais

ISBN 978-85-334-1648-8 MINISTÉRIO DA SAÚDE 9 7 8 8 5 3 3 4 1 6 4 8 8

ISBN 978-85-334-1648-8 MINISTÉRIO DA SAÚDE 9 7 8 8 5 3 3 4 1 6 4 8 8 MINISTÉRIO DA SAÚDE MINISTÉRIO DA SAÚDE Secretaria de Vigilância em Saúde Departamento de DST, Aids e Hepatites Virais A B C D E DO DIAGNÓSTICO PARA AS HEPATITES VIRAIS Série A. Normas e Manuais Técnicos

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

HIV. O vírus da imunodeficiência humana HIV-1 e HIV-2 são membros da família Retroviridae, na subfamília Lentividae.

HIV. O vírus da imunodeficiência humana HIV-1 e HIV-2 são membros da família Retroviridae, na subfamília Lentividae. A Equipe Multiprofissional de Saúde Ocupacional da UDESC lembra: Dia 01 de dezembro é dia mundial de prevenção à Aids! Este material foi desenvolvido por alunos do Departamento de Enfermagem da Universidade

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

UNIVERSIDADE FEDERAL DO PARÁ NÚCLEO DE MEDICINA TROPICAL PROGRAMA DE PÓS-GRADUAÇÃO EM DOENÇAS TROPICAIS MARIA DE JESUS RODRIGUES DE FREITAS

UNIVERSIDADE FEDERAL DO PARÁ NÚCLEO DE MEDICINA TROPICAL PROGRAMA DE PÓS-GRADUAÇÃO EM DOENÇAS TROPICAIS MARIA DE JESUS RODRIGUES DE FREITAS UNIVERSIDADE FEDERAL DO PARÁ NÚCLEO DE MEDICINA TROPICAL PROGRAMA DE PÓS-GRADUAÇÃO EM DOENÇAS TROPICAIS MARIA DE JESUS RODRIGUES DE FREITAS PESQUISA E GENOTIPAGEM DO VÍRUS DA HEPATITE C EM PORTADORES DE

Leia mais

FACULDADE CATÓLICA SALESIANA GRADUAÇÃO EM ENFERMAGEM DISCIPLINA DE DOENÇAS INFECTO-PARASITÁRIAS HIV/AIDS

FACULDADE CATÓLICA SALESIANA GRADUAÇÃO EM ENFERMAGEM DISCIPLINA DE DOENÇAS INFECTO-PARASITÁRIAS HIV/AIDS FACULDADE CATÓLICA SALESIANA GRADUAÇÃO EM ENFERMAGEM DISCIPLINA DE DOENÇAS INFECTO-PARASITÁRIAS HIV/AIDS Descrição Doença que representa um dos maiores problemas de saúde da atualidade, em função de seu

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

HIV no período neonatal prevenção e conduta

HIV no período neonatal prevenção e conduta HIV no período neonatal prevenção e conduta O HIV, agente causador da AIDS, ataca as células do sistema imune, especialmente as marcadas com receptor de superfície CD4 resultando na redução do número e

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

6) (ANÁPOLIS) Dois seres vivos pertencentes à mesma ordem são necessariamente:

6) (ANÁPOLIS) Dois seres vivos pertencentes à mesma ordem são necessariamente: Lista de Exercícios Pré Universitário Uni-Anhanguera Aluno(a): Nº. Professor: Mário Neto Série: 1 Ano Disciplina: Biologia 1) Com que finalidade se classificam os seres vivos? 2) Considere os seguintes

Leia mais

Hepatite C Grupo Vontade de Viver

Hepatite C Grupo Vontade de Viver Hepatite C Grupo Vontade de Viver De apoio aos Portadores de Hepatite C Apresentação Data de Fundação : 19 Maio de 2002 Formação do Grupo: Portadores e ex-portadores do vírus C Trasplantados de fígado

Leia mais

Profilaxia Pós-Exposição ao HIV. Alcyone Artioli Machado FMRP-USP - 2006

Profilaxia Pós-Exposição ao HIV. Alcyone Artioli Machado FMRP-USP - 2006 Profilaxia Pós-Exposição ao HIV Alcyone Artioli Machado FMRP-USP - 2006 Fatores de risco para infecção ocupacional pelo HIV O risco de infecção ocupacional pelo HIV era aumentado quando: A exposição ocupacional

Leia mais

Métodos sorológicos de Diagnóstico e Pesquisa. Reação Ag-Ac in vitro

Métodos sorológicos de Diagnóstico e Pesquisa. Reação Ag-Ac in vitro Métodos sorológicos de Diagnóstico e Pesquisa Reação Ag-Ac in vitro Testes sorológicos Uso de soro ou outros fluidos biológicos de paciente p/ diagnóstico laboratorial Demonstração de anticorpos específicos

Leia mais

SIMPÓSIO INTERNACIONAL ZOETIS. Doenças Infecciosas e Parasitárias

SIMPÓSIO INTERNACIONAL ZOETIS. Doenças Infecciosas e Parasitárias SIMPÓSIO INTERNACIONAL ZOETIS Doenças Infecciosas e Parasitárias 22 e 23 de julho de 2014 para os animais. pela saúde. por você. 1 O presente material corresponde ao conteúdo das palestras ministradas

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

1 INTRODUÇÃO... 2 2 EPIDEMIOLOGIA... 2 3 QUADRO CLÍNICO... 4 4 DIAGNÓSTICO DIFERENCIAL... 4 5 DIAGNÓSTICO LABORATORIAL... 5

1 INTRODUÇÃO... 2 2 EPIDEMIOLOGIA... 2 3 QUADRO CLÍNICO... 4 4 DIAGNÓSTICO DIFERENCIAL... 4 5 DIAGNÓSTICO LABORATORIAL... 5 HEPATITES VIRAIS SUMÁRIO 1 INTRODUÇÃO... 2 2 EPIDEMIOLOGIA... 2 3 QUADRO CLÍNICO... 4 4 DIAGNÓSTICO DIFERENCIAL... 4 5 DIAGNÓSTICO LABORATORIAL... 5 6 ABORDAGEM SINDRÔMICA... 7 6.1 Hepatites virais agudas...

Leia mais

Virulogia. Vírus. Vírus. características 02/03/2015. Príons: Proteína Viróides: RNA. Características. Características

Virulogia. Vírus. Vírus. características 02/03/2015. Príons: Proteína Viróides: RNA. Características. Características Vírus Virulogia Características Vírus- latim veneno - agentes filtráveis Parasita intracelular obrigatório Extracelular: virion Intracelular: vírus Possuem alta especificidade Vírus Características Alta

Leia mais

VIGILÂNCIA DE HIV EM SANGUE DOADO: TENDÊNCIA DE SOROPREVALÊNCIA

VIGILÂNCIA DE HIV EM SANGUE DOADO: TENDÊNCIA DE SOROPREVALÊNCIA 25 a 28 de Outubro de 2011 ISBN 978-85-8084-055-1 VIGILÂNCIA DE HIV EM SANGUE DOADO: TENDÊNCIA DE SOROPREVALÊNCIA Janete Lane Amadei 1 ; Deborah Cristiny Dantas Moreti 2 ; Diego Montanhei 2 ; Dennis Armando

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

Hepatite C Casos Clínicos

Hepatite C Casos Clínicos DIA MUNDIAL DE ENFRENTAMENTO DAS HEPATITES VIRAIS Hepatite C Casos Clínicos Dr. Bernardo Machado de Almeida Hospital de Clínicas UFPR H. Municipal São José dos Pinhais Curitiba, 28 de julho de 2014 Para

Leia mais

Hepatites Virais 27/07/2011

Hepatites Virais 27/07/2011 SOCIEDADE DIVINA PROVIDÊNCIA Hospital Nossa Senhora da Conceição Educação Semana Continuada de Luta Contra em CCIH as Hepatites Virais 27/07/2011 Enfº Rodrigo Cascaes Theodoro Enfº CCIH Rodrigo Cascaes

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

20/12/2012 NOTA TÉCNICA

20/12/2012 NOTA TÉCNICA Data: 20/12/2012 NOTA TÉCNICA 56/2012 Medicamento X Material Solicitante Procedimento Juiz Almir Prudente dos Santos Cachoeira de Cobertura Minas Refere-se ao Processo nº. 009712001663-5 TEMA: interferon

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Arbovírus: arthropod-born virus 400 vírus isolados 100 patógenos humanos. Febres indiferenciadas Encefalites Febres hemorrágicas

Arbovírus: arthropod-born virus 400 vírus isolados 100 patógenos humanos. Febres indiferenciadas Encefalites Febres hemorrágicas Arbovírus: Hospedeiro natural vertebrado arthropod-born virus 400 vírus isolados 100 patógenos humanos Vetor hematófago Hospedeiro vert. Vetor hemat. Febres indiferenciadas Encefalites Febres hemorrágicas

Leia mais

A LINGUAGEM DAS CÉLULAS DO SANGUE LEUCÓCITOS

A LINGUAGEM DAS CÉLULAS DO SANGUE LEUCÓCITOS A LINGUAGEM DAS CÉLULAS DO SANGUE LEUCÓCITOS Prof.Dr. Paulo Cesar Naoum Diretor da Academia de Ciência e Tecnologia de São José do Rio Preto, SP Sob este título o leitor poderá ter duas interpretações

Leia mais

Questões complementares

Questões complementares Questões complementares 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares entre

Leia mais

Hepatite B: Vacina R. PARANÁ

Hepatite B: Vacina R. PARANÁ Hepatite B: Vacina R. PARANÁ Universidade Federal da Bahia Faculdade de Medicina Unidade de Gastro-Hepatologia Representação esquemática do VHB Figura 1: Estrutura do Vírus da Hepatite B Core Icosaédrico

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Introdução. Infecção pelo HIV. Uma das mais devastadoras pandemias da história da humanidade. Profundas repercussões sociais

Introdução. Infecção pelo HIV. Uma das mais devastadoras pandemias da história da humanidade. Profundas repercussões sociais Introdução Uma das mais devastadoras pandemias da história da humanidade Profundas repercussões sociais Possibilitou um enorme avanço no campo da virologia Prof. Marco Antonio Passou de doença letal a

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

O MINISTRO DE ESTADO DA SAÚDE, Interino, no uso de suas atribuições, resolve:

O MINISTRO DE ESTADO DA SAÚDE, Interino, no uso de suas atribuições, resolve: PORTARIA Nº 486, DE 16 DE MAIO DE 2.000 O MINISTRO DE ESTADO DA SAÚDE, Interino, no uso de suas atribuições, resolve: Art. 1º - Expedir a edição revisada e atualizada das orientações e critérios relativos

Leia mais

Ministério da Saúde FIOCRUZ Fundação Oswaldo Cruz Instituto Carlos Chagas - ICC- Fiocruz - PR

Ministério da Saúde FIOCRUZ Fundação Oswaldo Cruz Instituto Carlos Chagas - ICC- Fiocruz - PR Itamar Crispim Simpósio Temático - 01/07 e 02/07 Local: Auditório do TECPAR das 8:00 às 18:00 horas 01 de Julho Abertura e Apresentação Institucional Dr. Samuel Goldenberg Doença de Chagas: realidade e

Leia mais

Prioridades de Pesquisa e Inovação em Doença de Chagas

Prioridades de Pesquisa e Inovação em Doença de Chagas OFICINA DE PRIORIDADES DE PESQUISA SOBRE DOENÇAS NEGLIGENCIADAS Prioridades de Pesquisa e Inovação em Doença de Chagas Tânia C. A. Jorge (Coordenadora) - IOC/Fiocruz Bianca Zingales (Relatora) - USP Soraya

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

TRATAMENTO DE HEPATITE C CRÔNICA

TRATAMENTO DE HEPATITE C CRÔNICA TRATAMENTO DE HEPATITE C CRÔNICA Departamento de Clínica Médica Disciplina de Gastroenterologia PROTOCOLO DE TRATAMENTO DE HEPATITE C CRÔNICA COM INTERFERON E RIBAVIRINA. INTRODUÇÃO A hepatite C vem sendo

Leia mais

Diagnóstico Imunológico das Infecções Congênitas

Diagnóstico Imunológico das Infecções Congênitas Diagnóstico Imunológico das Infecções Congênitas Rubéola e Síndrome da Rubéola Congênita Rubéola e Síndrome da Rubéola Congênita Vírus da Rubéola Togavirus Vírus de RNA fita simples Principal epítopo dominante:

Leia mais

Curso Básico de Capacitação de Agentes do Sistema Nacional de Vigilância Sanitária (SNVS) para Inspeção em Boas Práticas no Ciclo do Sangue

Curso Básico de Capacitação de Agentes do Sistema Nacional de Vigilância Sanitária (SNVS) para Inspeção em Boas Práticas no Ciclo do Sangue Curso Básico de Capacitação de Agentes do Sistema Nacional de Vigilância Sanitária (SNVS) para Inspeção em Boas Práticas no Ciclo do Sangue 01 a 05 de setembro de 2014 Goiânia - GO Triagem Laboratorial

Leia mais

GOVERNO DO ESTADO DA BAHIA Secretaria da Saúde do Estado da Bahia Superintendência de Vigilância e Proteção da Saúde

GOVERNO DO ESTADO DA BAHIA Secretaria da Saúde do Estado da Bahia Superintendência de Vigilância e Proteção da Saúde GOVERNO DO ESTADO DA BAHIA Secretaria da Saúde do Estado da Bahia Superintendência de Vigilância e Proteção da Saúde NOTA TÉCNICA Nº 03/2015 DIVEP/LACEN/SUVISA/SESAB Assunto: Casos de ZIKA Vírus e de Doença

Leia mais

PlanetaBio Artigos Especiais www.planetabio.com AIDS- SÍNDROME DA IMUNODEFICIÊNCIA ADQUIRIDA

PlanetaBio Artigos Especiais www.planetabio.com AIDS- SÍNDROME DA IMUNODEFICIÊNCIA ADQUIRIDA AIDS- SÍNDROME DA IMUNODEFICIÊNCIA ADQUIRIDA (texto de Marcelo Okuma) 1. Histórico e origem do vírus HIV Há fortes indícios para se acreditar que o vírus da imunodeficiência humana (HIV) tenha evoluído

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Situação da Hepatite B no Estado de Santa Catarina

Situação da Hepatite B no Estado de Santa Catarina Situação da Hepatite B no Estado de Santa Catarina Gerência de DST/Aids/Hepatites Virais Diretoria de Vigilância em Saúde Gerência de Vigilância Epidemiológica Programa DST/HIV/Aids/HV Secretaria de Estado

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Características principais Agente etiológico das verrugas (tumores epiteliais benignos) Infectam epitélio de

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS 1. Sinonímia VIDAS DUO 2. Aplicabilidade Aos bioquímicos do setor de imunologia. 3. Aplicação clínica POP n.º: I 56 Página 1 de 7 O vírus da imunodeficiência humana () é um retrovírus RNA, transmitido

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Governador Geraldo Alckmin entrega o maior laboratório destinado a pesquisas sobre o câncer da América Latina

Governador Geraldo Alckmin entrega o maior laboratório destinado a pesquisas sobre o câncer da América Latina MATEC ENGENHARIA ENTREGA O MAIOR LABORATORIO PARA PESQUISA DE CÂNCER DA AMÉRICA LATINA Qui, 14/04/11-11h00 SP ganha maior laboratório para pesquisa de câncer da América Latina Instituto do Câncer também

Leia mais

RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128

RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128 123 RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128 RESUMOS DE PROJETOS 124 A GENÉTICA E NEUROFISIOLOGIA DO AUTISMO... 125 PAPEL DO POLIMORFISMO IL17A (RS7747909) NA TUBERCULOSE.... 126 PAPEL

Leia mais

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos.

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos. Questão 1 Você é um imunologista que quer ficar rico e decide deixar o mundo da ciência, conseguindo um emprego como consultor de roteiro em um novo seriado de drama médico. Você avalia o conhecimento

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais