V Congresso de Iniciação Científica do IAMSPE

Save this PDF as:

Tamanho: px
Começar a partir da página:

Download "V Congresso de Iniciação Científica do IAMSPE"

Transcrição

1 V Congresso de Iniciação Científica do IAMSPE São Paulo 17/11/2011

2 Estudo genético da síndrome de Birt- Hogg-Dubé (variante Hornstein- Knickenberg) Bolsista: Sergio Aparecido do Amaral Junior (Faculdade de Medicina do ABC) Orientador: Jaques Waisberg

3 INTRODUÇÃO A síndrome de Birt-Hogg-Dubé é uma doença autossômica dominante que envolve pele e pulmões, com risco aumentado para tumores de pele, rim e, possivelmente, cólon, tireóide e parótida Os indivíduos portadores possuem maior incidência de cistos pulmonares e pneumotórax espontâneo Os tumores renais são tipicamente bilaterais e multifocais, com crescimento lento, geralmente oncocitomas

4 INTRODUÇÃO Síndrome de Birt-Hogg-Dubé x S. Hornstein-Knickenberg Lesões pele Acometimento pulmonar Acometimento renal Acometimento colônico SHBD Fibrofoliculoma Tricodiscoma Cistos e pneumotórax espontâneo Neoplasias Ausente SHK Fibroma perifolicular Cistos e pneumotórax espontâneo Neoplasias Neoplasias (pólipos hiperplásicos e neoplasias malignas)

5 INTRODUÇÃO Esta síndrome decorre de mutações (seis tipos de mutações identificadas) no gene foliculina (FLCN) localizado no cromossomo 17p11 Mutações no gene FLCN podem interferir com a capacidade da foliculina para conter o crescimento e divisão celular Modificações no sistema de reparo do DNA, presente nesta síndrome através da expressão na imuno-histoquímica do anti-hmsh2 contribuem para a formação dos tumores Pode ocorrer deleção (c.1285delc) ou duplicação (c.1285dupc) de um nucleotídeo C no trato da policitosina no exon 11

6 RELATO DO CASO Homem, 60 anos, com dor abdominal, alteração do hábito intestinal e lesões de pele na face e na área cervical Antecedentes: retirada de angioma de corda vocal, tireoidectomia total (sic), parotidectomia esquerda (oncocitoma e sialodenite crônica) Exames realizados Biópsias das lesões da pele: proliferação fibrosa dérmica (tricodiscoma?); fibroepitelioma; carcinoma basocelular Colonoscopia: pólipos sésseis e pediculados ao longo de toda a mucosa colônica; AP: pólipos hiperplásicos

7 RELATO DO CASO Exames realizados Endoscopia digestiva alta: grande quantidade de pólipos sésseis e pediculados no estômago e na1ª porção do duodeno. AP: pólipos hiperplásicos Enteroscopia: pólipos sésseis, subpediculados e pediculados nas porções distais do duodeno e no jejuno proximal. AP: pólipos hiperplásicos Ultrassonografia abdominal: colecistolitíase, cisto renal esquerdo, calcificação renal esquerda e formação sólida retroperitoneal à direita

8 RELATO DO CASO Ressonância magnética de abdome: múltiplas lesões expansivas sólidas, localizadas em topografia de rins bilateralmente, a maior localizada no rim direito e medindo cerca de 100mm

9 OBJETIVOS Relatar o caso de paciente de 60 anos com quadro clínico fortemente sugestivo da síndrome de Birt-Hogg-Dubé Investigar a existência de mutações no éxon 11 do gene FLCN (mutação mais frequente) Analisar a expressão da proteína MSH2 do sistema de reparo do DNA

10 MÉTODO Pesquisa genética realizada no Laboratório de Biologia Molecular da FMABC DNA genômico extraído de sangue periférico, com o uso do kit Illustra Blood GenomicPrep Mini Spin (GE Healthcare, Alemanha) Quantificação do DNA: aparelho Qubit (Invitrogen ) com kit QuantiTTM dsdna HS Assay (Invitrogen, Oregon, USA) Amplificação do éxon 11 do gene da foliculina por PCR semiquantitativo Amplificação do éxon 11 do gene da foliculina (FLCN): Oligonucleotídeo iniciadores: sequência 5 3 FLCN éxon 11 sense ACAAGCTGGTGTGTGACTGG FLCN éxon 11 antisense TCCACAACCCATGACAGAGA

11 MÉTODO Purificação e sequenciamento do produto de PCR com o kit QIAquick Gel Extraction (Qiagen, Valencia, CA) Imuno-histoquímica Blocos de parafina: biópsias de estômago, intestino delgado e cólon Anticorpo primário anti-hmsh2 N-20 (Santa Cruz Biotechnology, Santa Cruz, CA, USA)

12 RESULTADOS Amplificação do éxon 11 do gene FLCN presente no DNA genômico (Amostra P)

13 RESULTADOS Sequenciamento do éxon 11 do gene FLCN no DNA e comparação com a sequência não mutada obtida no GenBank

14 RESULTADOS Imuno-histoquímica

15 CONCLUSÕES Na investigação genética não foram encontradas mutações no éxon 11 do gene FLCN Estudos serão realizados para avaliar a ocorrência de mutações nos demais éxons do gene FLCN A presença protéica da MSH2 nos tumores biopsiados pode sugerir a relação entre o sistema de reparo do DNA e a síndrome de Birt- Hogg-Dubé

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Introdução Agentes internos ou externos causam alterações

Leia mais

VI Workshop Internacional de Atualização em Hepatologia 2012 Pólipos de Vesícula Biliar Diagnóstico e Conduta

VI Workshop Internacional de Atualização em Hepatologia 2012 Pólipos de Vesícula Biliar Diagnóstico e Conduta VI Workshop Internacional de Atualização em Hepatologia 2012 Pólipos de Vesícula Biliar Diagnóstico e Conduta Júlio Coelho Universidade Federal do Paraná Pólipo de Vesícula Biliar Estudos Científicos Ausência

Leia mais

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Escola Secundária Quinta do Marquês Mutações Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Trabalho realizado por: Bárbara Dória, nº4, 11ºB Definição de mutação As

Leia mais

Hereditariedade e cancer de mama Mutacoes e Polimorfismos

Hereditariedade e cancer de mama Mutacoes e Polimorfismos Hereditariedade e cancer de mama Mutacoes e Polimorfismos Dr. Jose Claudio Casali da Rocha Laboratorio Mantis Diagnosticos Avancados IOP Instituto de Oncologia do Parana Hospital Erasto Gaertner PUC-PR

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

Glicosaminoglicanos (GAGS) Introdução. heteropolissacarídeos lineares constituídos por unidades dissacarídicas repetitivas.

Glicosaminoglicanos (GAGS) Introdução. heteropolissacarídeos lineares constituídos por unidades dissacarídicas repetitivas. Identificação e quantificação pela espectroscopia de massa de glicosaminoglicanos sulftados da matriz extracelular no tecido colorretal neoplásico e não neoplásico* * Departmento de Biologia Molecular,

Leia mais

Síndromes Hereditários de Cancro Coloretal. André Goulart Interno Cirurgia Geral 4º ano

Síndromes Hereditários de Cancro Coloretal. André Goulart Interno Cirurgia Geral 4º ano Síndromes Hereditários de Cancro Coloretal André Goulart Interno Cirurgia Geral 4º ano Introdução Epidemiologia CCR 2ª causa de morte Risco desenvolver CCR 6% 90% CCR após os 50 anos Incidência aumentou

Leia mais

Módulo: Câncer de Rim Localizado

Módulo: Câncer de Rim Localizado Módulo: Câncer de Rim Localizado Caso 1 CAL, 56 anos, masculino Paciente médico, obeso (IMC = 41; peso 120 kg) Antecedentes clínicos: nefrolitíase Antecedentes cirúrgicos: Laparotomia mediana por divertículo

Leia mais

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS.

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Laura S. W ard CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Nódulos da Tiróide e o Carcinoma Medular Nódulos da tiróide são um

Leia mais

Tumor Estromal Gastrointestinal

Tumor Estromal Gastrointestinal Tumor Estromal Gastrointestinal Pedro Henrique Barros de Vasconcellos Hospital Cardoso Fontes Serviço de Cirurgia Geral Introdução GIST é o tumor mesenquimal mais comum do TGI O termo foi desenvolvido

Leia mais

DIVERTÍCULO DIVERTÍCULO VERDADEIRO FALSO Composto por todas as camadas da parede intestinal Não possui uma das porções da parede intestinal DIVERTICULOSE OU DOENÇA DIVERTICULAR Termos empregados para

Leia mais

Caso Clínico. Andrea Canelas

Caso Clínico. Andrea Canelas Caso Clínico Andrea Canelas 28-06 06-2006 Identificação Sexo: Idade: 79 anos Raça: a: Caucasiana Naturalidade: Coimbra História da doença a actual Seguida na consulta de Gastro desde Novembro de 2005:

Leia mais

Tumor carcinoide de duodeno: um tumor raro em local incomum. Série de casos de uma única instituição

Tumor carcinoide de duodeno: um tumor raro em local incomum. Série de casos de uma única instituição Tumor carcinoide de duodeno: um tumor raro em local incomum. Série de casos de uma única instituição Jaques Waisberg- Orientador do Programa de Pós Graduação do Instituto de Assistência Médica ao Servidor

Leia mais

Infecções e inflamações do trato urinário, funçao sexual e reprodutiva Urologia Denny

Infecções e inflamações do trato urinário, funçao sexual e reprodutiva Urologia Denny DATA hora AULA PROGRAMADA Módulo PROFESSOR 25/10/2013 14:00-14:55 Abdome Agudo - inflamatório e obstrutivo Clínica Cirúrgica João Marcos 14:55-15:50 Abdome Agudo - perfurativo e vascular/hemorrágico Clínica

Leia mais

Aulas teórica s PROFESSOR DATA HORA AULA PROGRAMADA MÓDULO. Sessão Avaliação ED Supervisão TOTAL

Aulas teórica s PROFESSOR DATA HORA AULA PROGRAMADA MÓDULO. Sessão Avaliação ED Supervisão TOTAL DATA HORA AULA PROGRAMADA MÓDULO PROFESSOR Aulas teórica s Amb. Sessão Avaliação ED Supervisão TOTAL 13:15 Abdome Agudo - inflamatório e obstrutivo Clínica Cirúrgica João Marcos 24/7/2015 Abdome Agudo

Leia mais

Metástase Cutânea de Carcinoma de Células Claras Renais: Relato de Caso Aichinger, L.A. 1, Kool, R. 1, Mauro, F.H.O. 1, Preti, V.

Metástase Cutânea de Carcinoma de Células Claras Renais: Relato de Caso Aichinger, L.A. 1, Kool, R. 1, Mauro, F.H.O. 1, Preti, V. Metástase Cutânea de Carcinoma de Células Claras Renais: Relato de Caso Aichinger, L.A. 1, Kool, R. 1, Mauro, F.H.O. 1, Preti, V. 1 1 Hospital Erasto Gaertner, Curitiba, Paraná. Introdução e Objetivo O

Leia mais

OBJETIVOS GERAIS OBJETIVOS ESPECÍFICOS

OBJETIVOS GERAIS OBJETIVOS ESPECÍFICOS OBJETIVOS GERAIS O Programa de Residência Médica opcional de Videolaparoscopia em Cirurgia do Aparelho Digestivo (PRMCAD) representa modalidade de ensino de Pós Graduação visando ao aperfeiçoamento ético,

Leia mais

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva).

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 1 Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 2 O câncer surge de uma única célula que sofreu mutação, multiplicou-se por mitoses e suas descendentes

Leia mais

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER Gyzelly Gondim de Oliveira 1 ; Cristiane Alves da Fonseca 2 1 Graduanda do Curso de Farmácia, UnuCET Anápolis - UEG

Leia mais

7ª Reunião Luso-Galaica de Endocrinologia, Diabetes e Metabolismo. Caso Clínico. Hospital de Braga

7ª Reunião Luso-Galaica de Endocrinologia, Diabetes e Metabolismo. Caso Clínico. Hospital de Braga 7ª Reunião Luso-Galaica de Endocrinologia, Diabetes e Metabolismo Hospital de Braga Serviço de Cirurgia Director: Dr. Mesquita Rodrigues Sónia Ribas 12 de Dezembro F.C.R, sexo masculino, 69 anos Antecedentes

Leia mais

04/06/2012 INTRODUÇÃO À RAGIOLOGIA SIMPLES DO TÓRAX. Dante L. Escuissato RADIOGRAFIAS DO TÓRAX INCIDÊNCIAS: FRONTAL (PA) PERFIL TÓRAX

04/06/2012 INTRODUÇÃO À RAGIOLOGIA SIMPLES DO TÓRAX. Dante L. Escuissato RADIOGRAFIAS DO TÓRAX INCIDÊNCIAS: FRONTAL (PA) PERFIL TÓRAX INTRODUÇÃO À RAGIOLOGIA SIMPLES DO TÓRAX Dante L. Escuissato RADIOGRAFIAS DO TÓRAX INCIDÊNCIAS: FRONTAL (PA) PERFIL TÓRAX 1 RADIOGRAFIAS AS RADIOGRAFIAS APRESENTAM 4 DENSIDADES BÁSICAS: AR: traquéia, pulmões,

Leia mais

Cancro Gástrico. Prevenção, Diagnóstico e Tratamento. Cancro Digestivo. 30 de Setembro 2006. Organização. Sponsor. Apoio.

Cancro Gástrico. Prevenção, Diagnóstico e Tratamento. Cancro Digestivo. 30 de Setembro 2006. Organização. Sponsor. Apoio. Organização Sponsor Cancro Gástrico Prevenção, Diagnóstico e Tratamento Apoio Secretariado Central Park R. Alexandre Herculano, Edf. 1-4º C 2795-240 Linda-a-Velha Telefones: 21 430 77 40/1/2/3/4 Fax: 21

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica CONHECIMENTO EM GOTAS neoplasias hematológicas: leucemia mieloide crônica leucemia é uma doença maligna dos leucócitos (glóbulos brancos). ela pode ser originada em duas linhagens diferentes: a linhagem

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Patologia Cirúrgica macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Exame Histopatológico Exame anatomopatológico é ATO MÉDICO! lâminas microscopia laudo

Leia mais

Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE

Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE São Paulo 2010 Níveis séricos e imunoexpressão tecidual do marcador CA19-9 no carcinoma

Leia mais

DOENÇA INFLAMATÓRIA INTESTINAL. Profª. Thais de A. Almeida Aula 21/05/13

DOENÇA INFLAMATÓRIA INTESTINAL. Profª. Thais de A. Almeida Aula 21/05/13 DOENÇA INFLAMATÓRIA INTESTINAL Profª. Thais de A. Almeida Aula 21/05/13 Doença Inflamatória Intestinal Acometimento inflamatório crônico do TGI. Mulheres > homens. Pacientes jovens (± 20 anos). Doença

Leia mais

PERSPECTIVA. ciências. Sugestão de avaliação. Coleção Perspectiva

PERSPECTIVA. ciências. Sugestão de avaliação. Coleção Perspectiva PERSPECTIVA Coleção Perspectiva ciências 8 Sugestão de avaliação Professor, esta sugestão de avaliação corresponde ao segundo bimestre escolar ou às Unidades 3 e 4 do Livro do Aluno. Avaliação Ciências

Leia mais

Explicação sobre o processo de rastreio do cancro do intestino

Explicação sobre o processo de rastreio do cancro do intestino Explicação sobre o processo de rastreio do cancro do intestino 1 www.bowelscreeningwales.org.uk Explicação sobre o processo de rastreio do cancro do intestino Este folheto dá-lhe informações sobre o rastreio

Leia mais

Mutações e Aberrações Cromossômicas

Mutações e Aberrações Cromossômicas Mutações e Aberrações Cromossômicas Aula 32, 33 e 34 Aspectos Conceituais e Rotas Metabólicas Prof. Antonio Márcio Teodoro Cordeiro Silva, M.Sc. Mutação Mutações são modificações casuais do material genético,

Leia mais

Tumores Benignos dos Tecidos Moles

Tumores Benignos dos Tecidos Moles Tumores Benignos dos Tecidos Moles Classificação - OMS (2005) Hamartoma: crescimento dismórfico de tecido original de uma região. Geralmente autolimitante e pode sofrer involução Neoplasia: crescimento

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

DATA hora SALA AULA PROGRAMADA Módulo PROFESSOR

DATA hora SALA AULA PROGRAMADA Módulo PROFESSOR DATA hora SALA AULA PROGRAMADA Módulo PROFESSOR 14:00-14:55 Abdome Agudo - inflamatório e obstrutivo Clínica Cirúrgica João Marcos 14:55-15:50 Abdome Agudo - perfurativo e vascular/hemorrágico Clínica

Leia mais

Journal Club 23/06/2010. Apresentador: João Paulo Lira Barros-E4 Orientador: Dr. Eduardo Secaf

Journal Club 23/06/2010. Apresentador: João Paulo Lira Barros-E4 Orientador: Dr. Eduardo Secaf Journal Club 23/06/2010 Apresentador: João Paulo Lira Barros-E4 Orientador: Dr. Eduardo Secaf Introdução O câncer gástrico é a mais freqüente das neoplasias malignas do aparelho digestivo e ocupa o segundo

Leia mais

DIAGNÓSTICO MÉDICO DADOS EPIDEMIOLÓGICOS FATORES DE RISCO FATORES DE RISCO 01/05/2015

DIAGNÓSTICO MÉDICO DADOS EPIDEMIOLÓGICOS FATORES DE RISCO FATORES DE RISCO 01/05/2015 01/05/2015 CÂNCER UTERINO É o câncer que se forma no colo do útero. Nessa parte, há células que podem CÂNCER CERVICAL se modificar produzindo um câncer. Em geral, é um câncer de crescimento lento, e pode

Leia mais

8:00 Horas Sessão de Temas Livres concorrendo a Premiação. 8:30 8:45 INTERVALO VISITA AOS EXPOSITORES E PATROCINADORES.

8:00 Horas Sessão de Temas Livres concorrendo a Premiação. 8:30 8:45 INTERVALO VISITA AOS EXPOSITORES E PATROCINADORES. MAPA AUDITÓRIO ÓPERA DE ARAME (200 LUGARES) DOMINGO 02 DE AGOSTO DE 2015. 8:00 Horas Sessão de Temas Livres concorrendo a Premiação. 8:00 8:15 TEMA LIVRE SELECIONADO. 8:15 8:30 TEMA LIVRE SELECIONADO.

Leia mais

Tumor Desmoplásico de Pequenas Células Redondas: Relato de um caso.

Tumor Desmoplásico de Pequenas Células Redondas: Relato de um caso. Everton Pereira D. Lopes² Eduardo M Pracucho¹ Ricardo de Almeida Campos² Karla Thaiza Thomal¹ Celso Roberto Passeri¹ Renato Morato Zanatto¹ 1-Departamento de Cirurgia Oncológica Aparelho Digestivo Alto

Leia mais

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto Genética Humana Faculdade Anísio Teixeira Prof João Ronaldo Neto Jan/2012 Herança Multifatorial Herança Monogênica Herança Cromossômica Padrões de Herança Distúrbios Monogênicos São determinados por um

Leia mais

O que é câncer de mama?

O que é câncer de mama? Câncer de Mama O que é câncer de mama? O câncer de mama é a doença em que as células normais da mama começam a se modificar, multiplicando-se sem controle e deixando de morrer, formando uma massa de células

Leia mais

HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA

HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA Carcinomas Profª. Dra. Maria do Carmo Assunção Carcinoma tipo basal Grau 3 CK14 & CK5 = Positivo P63 pode ser positivo (mioepitelial) Triplo negativo

Leia mais

As principais causas de diabetes insípidus central são tumores que acometem a região hipotalâmica hipofisária, como por exemplo:

As principais causas de diabetes insípidus central são tumores que acometem a região hipotalâmica hipofisária, como por exemplo: Diabetes insípidus O que é Diabetes insípidus? Diabetes insípidus consiste em um distúrbio de controle da água no organismo, no qual os rins não conseguem reter adequadamente a água que é filtrada. Como

Leia mais

ANOMALIAS DO TRATO URINÁRIO UNIDADE DE NEFROLOGIA PEDIÁTRICA HC - UFMG BELO HORIZONTE - BRASIL

ANOMALIAS DO TRATO URINÁRIO UNIDADE DE NEFROLOGIA PEDIÁTRICA HC - UFMG BELO HORIZONTE - BRASIL ANOMALIAS DO TRATO URINÁRIO UNIDADE DE NEFROLOGIA PEDIÁTRICA HC - UFMG BELO HORIZONTE - BRASIL Investigação Imagens Anomalias obstrutivas do trato urinário Obstrução da junção ureteropélvica Obstrução

Leia mais

POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE

POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE Jeany Camelo Santos 1, Rafael Lucas Leonídeo 2, Flávio Monteiro Ayres 3,4 1 Bolsista PBIC/UEG. 2 Aluno de iniciação científica PVIC.

Leia mais

7º Imagem da Semana: Radiografia de Tórax

7º Imagem da Semana: Radiografia de Tórax 7º Imagem da Semana: Radiografia de Tórax Legenda da Imagem 1: Radiografia de tórax em incidência póstero-anterior Legenda da Imagem 2: Radiografia de tórax em perfil Enunciado: Homem de 38 anos, natural

Leia mais

João Marcos + Raphael + Aisha + Clarissa + Tiago + Marcelo

João Marcos + Raphael + Aisha + Clarissa + Tiago + Marcelo DATA HORA AULA PROGRAMADA SALA MÓDULO PROFESSOR 05/02/2016 13:15 Abdome Agudo - inflamatório e obstrutivo Clínica Cirúrgica 14:10 Abdome Agudo - perfurativo e vascular/hemorrágico Clínica Cirúrgica 15:25

Leia mais

Apresentador: Dr. Saul Oliveira e Costa Coordenador: Dr. Gustavo Caldas

Apresentador: Dr. Saul Oliveira e Costa Coordenador: Dr. Gustavo Caldas Apresentador: Dr. Saul Oliveira e Costa Coordenador: Dr. Gustavo Caldas Câncer Anaplásico de Tireóide INTRODUÇÃO Prognóstico => 6 meses após diagnóstico 1,7% dos cânceres da tireóide Incidência caindo:

Leia mais

CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO. Ana Flavia Damasceno Luiz Gonzaga Porto. Introdução

CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO. Ana Flavia Damasceno Luiz Gonzaga Porto. Introdução CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO Ana Flavia Damasceno Luiz Gonzaga Porto Introdução É realizada a avaliação de um grupo de pacientes com relação a sua doença. E através dele

Leia mais

TUMORES DE GLÂNDULAS SALIVARES

TUMORES DE GLÂNDULAS SALIVARES Dr. Marcio R. Studart da Fonseca Cirurgia de Cabeça e Pescoço-HUWC/UFC Sistema Salivar 3 pares de Glândulas Salivares Maiores Parótidas Submandibulares Sublinguais Centenas de Glândulas Salivares Menores

Leia mais

INSTRUÇÕES PARA O CANDIDATO:

INSTRUÇÕES PARA O CANDIDATO: INSTRUÇÕES PARA O CANDIDATO: 1) Esta prova é composta por 20 (vinte) questões de múltipla escolha, cada uma valendo 0,5 (meio) ponto. 2) Cada questão apresenta apenas uma resposta correta. Questões rasuradas

Leia mais

203 A. 16:30-17:20 Trauma cervical Clinica Cirúrgica Raphael 17:20-18:10 Queimaduras Clínica Cirúrgica Raphael

203 A. 16:30-17:20 Trauma cervical Clinica Cirúrgica Raphael 17:20-18:10 Queimaduras Clínica Cirúrgica Raphael CRONOGRAMA INTERNATO DE CIRURGIA 1º 2013 9º PERÍODO DATA/LOCAL HORÁRIO AULA PROGRAMADA Módulo PROFESSOR 24/5/2013 11:00-11:50 Lesões corporais Medicina Legal Andressa 11:50-12:40 Lesões corporais Medicina

Leia mais

INSTRUÇÕES PARA O CANDIDATO:

INSTRUÇÕES PARA O CANDIDATO: INSTRUÇÕES PARA O CANDIDATO: 1) Esta prova é composta por 20 (vinte) questões de múltipla escolha, cada uma valendo 0,5 (meio) ponto. 2) Cada questão apresenta apenas uma resposta correta. Questões rasuradas

Leia mais

UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL-REI CAMPUS CENTRO OESTE Planilha de aulas - Internato em Cirurgia 1º semestre de 2015

UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL-REI CAMPUS CENTRO OESTE Planilha de aulas - Internato em Cirurgia 1º semestre de 2015 UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL-REI CAMPUS CENTRO OESTE Planilha de aulas - Internato em Cirurgia 1º semestre de 2015 DATA SALA HORA AULA PROGRAMADA MÓDULO PROFESSOR 6/2/2015 102. D 13:15-14:10 Tratamento

Leia mais

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior

Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos. Antonio Luiz Gomes Júnior Métodos de investigação em genotoxicidade em ensaios pré-clínicos de novos fitomedicamentos Antonio Luiz Gomes Júnior Genotoxicidade Definição: é o setor da genética que estuda os processos que alteram

Leia mais

O que é câncer de estômago?

O que é câncer de estômago? Câncer de Estômago O que é câncer de estômago? O câncer de estômago, também denominado câncer gástrico, pode ter início em qualquer parte do estômago e se disseminar para os linfonodos da região e outras

Leia mais

Avanços na Patologia cirúrgica. Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein.

Avanços na Patologia cirúrgica. Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein. Avanços na Patologia cirúrgica Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein.br Avanços Neoplasias de pulmão Câncer colorretal Carcinoma

Leia mais

TUMORES BENIGNOS DOS OVARIOS. Pedro Cordeiro de Sá Filho

TUMORES BENIGNOS DOS OVARIOS. Pedro Cordeiro de Sá Filho TUMORES BENIGNOS DOS OVARIOS Pedro Cordeiro de Sá Filho Videoendoscopia Ginecológica Retorno as atividades Tempo cirúrgico Complicações Custos Cirurgia convencional X Videolaparoscopia Estética Pós-operatório

Leia mais

Abordagem diagnóstica a casos oncológicos em Répteis. Filipe Martinho, DVM

Abordagem diagnóstica a casos oncológicos em Répteis. Filipe Martinho, DVM Abordagem diagnóstica a casos oncológicos em Répteis Filipe Martinho, DVM III Congresso OMV - Novembro 2012 Oncologia e Répteis Aparentemente casos oncológicos são raros; Em colecções zoológicas até 23%

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Seminário Metástases Pulmonares

Seminário Metástases Pulmonares Seminário Metástases Pulmonares Tatiane Cardoso Motta 09/02/2011 CASO CLÍNICO Paciente do sexo feminino, 52 anos, refere que realizou RX de tórax de rotina que evidenciou nódulos pulmonares bilaterais.

Leia mais

Humberto Brito R3 CCP

Humberto Brito R3 CCP Humberto Brito R3 CCP ABSTRACT INTRODUÇÃO Nódulos tireoideanos são achados comuns e raramente são malignos(5-15%) Nódulos 1cm geralmente exigem investigação A principal ferramenta é a citologia (PAAF)

Leia mais

TUMORES GIGANTES DE OVÁRIO

TUMORES GIGANTES DE OVÁRIO TUMORES GIGANTES DE OVÁRIO Os autores apresentam três casos de Tumores Gigantes de Ovário, sendo um com alto grau de malignidade (Linfoma do tipo Burkitt), dois benignos (Cisto Seroso e Teratoma), porém

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Diagnóstico de endometriose

Diagnóstico de endometriose Diagnóstico de endometriose Endometriose se caracteriza pelo achado de glândulas e/ou estroma endometrial em locais anormais. Acomete aproximadamente 15% das mulheres em idade fértil tornando-se uma doença

Leia mais

Programação Preliminar do 41 Curso de Atualização em Cirurgia do Aparelho Digestivo, Coloproctologia e Transplantes de Órgãos do Aparelho Digestivo

Programação Preliminar do 41 Curso de Atualização em Cirurgia do Aparelho Digestivo, Coloproctologia e Transplantes de Órgãos do Aparelho Digestivo Programação Preliminar do 41 Curso de Atualização em Cirurgia do Aparelho Digestivo, Coloproctologia e Transplantes de Órgãos do Aparelho Digestivo Cirurgia do Esôfago Painel de perguntas e filmes cirúrgicos

Leia mais

Linfomas. Claudia witzel

Linfomas. Claudia witzel Linfomas Claudia witzel Pode ser definido como um grupo de diversas doenças neoplásicas : Do sistema linfático Sistema linfóide Que tem origem da proliferação de linfócitos B ou T em qualquer um de seus

Leia mais

atitudeé prevenir-se Moradores da Mooca:

atitudeé prevenir-se Moradores da Mooca: atitudeé prevenir-se Moradores da Mooca: Nós temos atitude, e você? O Câncer do Intestino pode ser prevenido com um teste simples e indolor que pode ser realizado em sua casa. O teste é GRATUITO oferecido

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

5ª Reunião de Casos. www.digimaxdiagnostico.com.br/

5ª Reunião de Casos. www.digimaxdiagnostico.com.br/ 5ª Reunião de Casos www.digimaxdiagnostico.com.br/ Caso 1 Paciente J.M., 81 anos, sexo masculino. TC sem contraste TC com contraste Diagnóstico Aneurisma roto da aorta abdominal, parcialmente trombosado,

Leia mais

INFERTILIDADE MASCULINA E FIBROSE CÍSTICA

INFERTILIDADE MASCULINA E FIBROSE CÍSTICA INFERTILIDADE MASCULINA E FIBROSE CÍSTICA A infertilidade pode ser definida como a inabilidade de um casal sexualmente ativo, sem a utilização de métodos contraceptivos, de estabelecer gravidez dentro

Leia mais

Lesões císticas do pâncreas: abordagem diagnóstica e terapêutica

Lesões císticas do pâncreas: abordagem diagnóstica e terapêutica Lesões císticas do pâncreas: abordagem diagnóstica e terapêutica Gustavo Rêgo Coêlho (TCBC) Serviço de Cirurgia e Transplante de Fígado Hospital das Clínicas - UFC Tumores Cís+cos do Pâncreas Poucos tópicos

Leia mais

DISCIPLINA DE RADIOLOGIA UFPR

DISCIPLINA DE RADIOLOGIA UFPR DISCIPLINA DE RADIOLOGIA UFPR MÓDULO ABDOME AULA 2 AVALIAÇÃO INTESTINAL POR TC E RM Prof. Mauricio Zapparoli Neste texto abordaremos protocolos de imagem dedicados para avaliação do intestino delgado através

Leia mais

Qual é a função dos pulmões?

Qual é a função dos pulmões? Câncer de Pulmão Qual é a função dos pulmões? Os pulmões são constituídos por cinco lobos, três no pulmão direito e dois no esquerdo. Quando a pessoa inala o ar, os pulmões absorvem o oxigênio, que é levado

Leia mais

Coffee Break 10:30hs às 11:30hs Biologia Molecular do Processo de Apoptose Prof. Dr. Roberto César Pereira Lima Júnior Departamento de Fisiologia e

Coffee Break 10:30hs às 11:30hs Biologia Molecular do Processo de Apoptose Prof. Dr. Roberto César Pereira Lima Júnior Departamento de Fisiologia e II Curso Avançado em Citogenômica do Câncer - realizado pelo Laboratório de Citogenômica do Câncer da Universidade Federal do Ceará. 20 a 23 de novembro no Seara Praia Hotel em Fortaleza - Ceará. Carga

Leia mais

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas.

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. 2 Habilidade: Conceituar mutações gênicas e cromossômicas, compreendendo como podem influenciar nossas vidas. 3 REVISÃO

Leia mais

1º modelo: doença degenerativa

1º modelo: doença degenerativa 2ª Aula de Biopatologia 18/09/2006 Medicina molecular: Da nova Biologia à Clínica Nesta aula vamos falar de três modelos de relevância entre a biologia básica e a clínica. 1º modelo: doença degenerativa

Leia mais

Câncer Colorretal Hereditário

Câncer Colorretal Hereditário Câncer Colorretal Hereditário Critérios Diagnósticos João Gomes Netinho jgnetinho@riopreto.com.br Câncer Colorretal Incidência no mundo - 3ª causa mais comum em ambos os sexos - 2ª nos paises desenvolvidos

Leia mais

As Mutações. Aumento da biodiversidade

As Mutações. Aumento da biodiversidade As Mutações Aumento da biodiversidade Mutações As mutações são espontâneas e podem ser silenciosas, ou seja, não alterar a proteína ou sua ação. Podem ainda ser letais, quando provocam a morte, ou ainda

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa Pesquisa A pesquisa no INCA compreende atividades de produção do conhecimento científico, melhoria dos procedimentos diagnósticos e terapêuticos do câncer e formação de recursos humanos em pesquisa oncológica.

Leia mais

Diretrizes ANS para realização do PET Scan / PET CT. Segundo diretrizes ANS

Diretrizes ANS para realização do PET Scan / PET CT. Segundo diretrizes ANS Diretrizes ANS para realização do PET Scan / PET CT Segundo diretrizes ANS Referencia Bibliográfica: Site ANS: http://www.ans.gov.br/images/stories/a_ans/transparencia_institucional/consulta_despachos_poder_judiciari

Leia mais

PROVA TEÓRICO-PRÁTICA

PROVA TEÓRICO-PRÁTICA PROVA TEÓRICO-PRÁTICA 1. Na atresia de esôfago pode ocorrer fistula traqueoesofágica. No esquema abaixo estão várias opções possíveis. A alternativa indica a forma mais freqüente é: Resposta B 2. Criança

Leia mais

PRINCÍPIOS DE GENÉTICA MÉDICA

PRINCÍPIOS DE GENÉTICA MÉDICA PRINCÍPIOS DE GENÉTICA MÉDICA Conceitos Genética / Genômica Doença genética Hereditariedade Congênito DNA / Gene / Locus / Alelo Homozigoto / Heterozigoto Cromossomos Autossomos Sexuais Dominante / Recessivo

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

RESOLUÇÃO DA DIRETORIA Nº 08/2014

RESOLUÇÃO DA DIRETORIA Nº 08/2014 RESOLUÇÃO DA DIRETORIA Nº 08/2014 A Diretoria Administrativa do Consórcio Público Intermunicipal de Saúde do Norte Pioneiro - CISNORPI, no uso de suas atribuições legais, resolve: Regulamentar o Credenciamento

Leia mais

RADIOLOGIA DO SISTEMA URINÁRIO

RADIOLOGIA DO SISTEMA URINÁRIO RADIOLOGIA DO SISTEMA URINÁRIO Aspectos Radiográficos Normais de Rins e Ureteres Visualização variável da imagem renal quanto ao número, forma, contorno, tamanho, posição e densidade (intermediária entre

Leia mais

Relatos de casos de Strongyloides stercoralis. Isabelle Assunção Nutrição

Relatos de casos de Strongyloides stercoralis. Isabelle Assunção Nutrição Relatos de casos de Strongyloides stercoralis Isabelle Assunção Nutrição RECIFE/2011 INTRODUÇÃO A estrongiloidíase é uma helmintíase predominantemente intestinal causada pelo Strongyloides stercoralis,

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

AULAS TEÓRICAS SEMIOLOGIA MÉDICA GERAL I 5º PERÍODO 2009/2 DATA HORÁRIO ASSUNTO PROFESSORES

AULAS TEÓRICAS SEMIOLOGIA MÉDICA GERAL I 5º PERÍODO 2009/2 DATA HORÁRIO ASSUNTO PROFESSORES SEMIOLOGIA MÉDICA GERAL I 5º PERÍODO 2009/2 4 ago 11:00 ÀS 11:50 RELAÇÃO MÉDICO-PACIENTE E ÉTICA MÉDICA FLÁVIA MAGALHÃES 11 ago 11:00 ÀS 11:50 ANAMNESE FLÁVIA MAGALHÃES 18 ago 11:00 ÀS 11:50 SEMIOLOGIA

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Manuseio do Nódulo Pulmonar Solitário

Manuseio do Nódulo Pulmonar Solitário VIII Congresso de Pneumologia e Tisiologia do Estado do Rio de Janeiro Manuseio do Nódulo Pulmonar Solitário Universidade do Estado do Rio de Janeiro Faculdade de Ciências Médicas Hospital Universitário

Leia mais

HLA HLA. HEMOSC Centro de Hematologia e Hemoterapia de Santa Catarina. Tipagem HLA ROTINA DE EXAMES DE HISTOCOMPATIBILIDADE PARA TRANSPLANTE

HLA HLA. HEMOSC Centro de Hematologia e Hemoterapia de Santa Catarina. Tipagem HLA ROTINA DE EXAMES DE HISTOCOMPATIBILIDADE PARA TRANSPLANTE HEMSC Centro de Hematologia e Hemoterapia de Santa Catarina RTINA DE EXAMES DE HISTCMPATIBILIDADE PARA TRANSPLANTE LABRATÓRI RI DE IMUNGENÉTICA Farmacêutica-Bioquímica: Mariana Chagas Laboratório rio de

Leia mais

Registro Hospitalar de Câncer de São Paulo:

Registro Hospitalar de Câncer de São Paulo: Registro Hospitalar de Câncer de São Paulo: Análise dos dados e indicadores de qualidade 1. Análise dos dados (jan ( janeiro eiro/2000 a setembro/201 /2015) Apresenta-se aqui uma visão global sobre a base

Leia mais

Neoplasias Gástricas. Pedro Vale Bedê

Neoplasias Gástricas. Pedro Vale Bedê Neoplasias Gástricas Pedro Vale Bedê Introdução 95% dos tumores gástricos são malignos 95% dos tumores malignos são adenocarcinomas Em segundo lugar ficam os linfomas e em terceiro os leiomiosarcomas Ate

Leia mais

Perda da uniformidade nas células e desarranjo estrutural tecidual

Perda da uniformidade nas células e desarranjo estrutural tecidual .Leucoplasia: (grego: leuco = branco - plasis = formação) Transformação metaplásica do epitélio escamoso estratificado não ceratinizado consistindo em aumento das camadas de ceratina. Exemplos: mucosa

Leia mais

Fibrose Cística. Triagem Neonatal

Fibrose Cística. Triagem Neonatal Fibrose Cística Triagem Neonatal Fibrose cística Doença hereditária autossômica e recessiva, mais frequente na população branca; Distúrbio funcional das glândulas exócrinas acometendo principalmente os

Leia mais