V Congresso de Iniciação Científica do IAMSPE

Tamanho: px
Começar a partir da página:

Download "V Congresso de Iniciação Científica do IAMSPE"

Transcrição

1 V Congresso de Iniciação Científica do IAMSPE São Paulo 17/11/2011

2 Estudo genético da síndrome de Birt- Hogg-Dubé (variante Hornstein- Knickenberg) Bolsista: Sergio Aparecido do Amaral Junior (Faculdade de Medicina do ABC) Orientador: Jaques Waisberg

3 INTRODUÇÃO A síndrome de Birt-Hogg-Dubé é uma doença autossômica dominante que envolve pele e pulmões, com risco aumentado para tumores de pele, rim e, possivelmente, cólon, tireóide e parótida Os indivíduos portadores possuem maior incidência de cistos pulmonares e pneumotórax espontâneo Os tumores renais são tipicamente bilaterais e multifocais, com crescimento lento, geralmente oncocitomas

4 INTRODUÇÃO Síndrome de Birt-Hogg-Dubé x S. Hornstein-Knickenberg Lesões pele Acometimento pulmonar Acometimento renal Acometimento colônico SHBD Fibrofoliculoma Tricodiscoma Cistos e pneumotórax espontâneo Neoplasias Ausente SHK Fibroma perifolicular Cistos e pneumotórax espontâneo Neoplasias Neoplasias (pólipos hiperplásicos e neoplasias malignas)

5 INTRODUÇÃO Esta síndrome decorre de mutações (seis tipos de mutações identificadas) no gene foliculina (FLCN) localizado no cromossomo 17p11 Mutações no gene FLCN podem interferir com a capacidade da foliculina para conter o crescimento e divisão celular Modificações no sistema de reparo do DNA, presente nesta síndrome através da expressão na imuno-histoquímica do anti-hmsh2 contribuem para a formação dos tumores Pode ocorrer deleção (c.1285delc) ou duplicação (c.1285dupc) de um nucleotídeo C no trato da policitosina no exon 11

6 RELATO DO CASO Homem, 60 anos, com dor abdominal, alteração do hábito intestinal e lesões de pele na face e na área cervical Antecedentes: retirada de angioma de corda vocal, tireoidectomia total (sic), parotidectomia esquerda (oncocitoma e sialodenite crônica) Exames realizados Biópsias das lesões da pele: proliferação fibrosa dérmica (tricodiscoma?); fibroepitelioma; carcinoma basocelular Colonoscopia: pólipos sésseis e pediculados ao longo de toda a mucosa colônica; AP: pólipos hiperplásicos

7 RELATO DO CASO Exames realizados Endoscopia digestiva alta: grande quantidade de pólipos sésseis e pediculados no estômago e na1ª porção do duodeno. AP: pólipos hiperplásicos Enteroscopia: pólipos sésseis, subpediculados e pediculados nas porções distais do duodeno e no jejuno proximal. AP: pólipos hiperplásicos Ultrassonografia abdominal: colecistolitíase, cisto renal esquerdo, calcificação renal esquerda e formação sólida retroperitoneal à direita

8 RELATO DO CASO Ressonância magnética de abdome: múltiplas lesões expansivas sólidas, localizadas em topografia de rins bilateralmente, a maior localizada no rim direito e medindo cerca de 100mm

9 OBJETIVOS Relatar o caso de paciente de 60 anos com quadro clínico fortemente sugestivo da síndrome de Birt-Hogg-Dubé Investigar a existência de mutações no éxon 11 do gene FLCN (mutação mais frequente) Analisar a expressão da proteína MSH2 do sistema de reparo do DNA

10 MÉTODO Pesquisa genética realizada no Laboratório de Biologia Molecular da FMABC DNA genômico extraído de sangue periférico, com o uso do kit Illustra Blood GenomicPrep Mini Spin (GE Healthcare, Alemanha) Quantificação do DNA: aparelho Qubit (Invitrogen ) com kit QuantiTTM dsdna HS Assay (Invitrogen, Oregon, USA) Amplificação do éxon 11 do gene da foliculina por PCR semiquantitativo Amplificação do éxon 11 do gene da foliculina (FLCN): Oligonucleotídeo iniciadores: sequência 5 3 FLCN éxon 11 sense ACAAGCTGGTGTGTGACTGG FLCN éxon 11 antisense TCCACAACCCATGACAGAGA

11 MÉTODO Purificação e sequenciamento do produto de PCR com o kit QIAquick Gel Extraction (Qiagen, Valencia, CA) Imuno-histoquímica Blocos de parafina: biópsias de estômago, intestino delgado e cólon Anticorpo primário anti-hmsh2 N-20 (Santa Cruz Biotechnology, Santa Cruz, CA, USA)

12 RESULTADOS Amplificação do éxon 11 do gene FLCN presente no DNA genômico (Amostra P)

13 RESULTADOS Sequenciamento do éxon 11 do gene FLCN no DNA e comparação com a sequência não mutada obtida no GenBank

14 RESULTADOS Imuno-histoquímica

15 CONCLUSÕES Na investigação genética não foram encontradas mutações no éxon 11 do gene FLCN Estudos serão realizados para avaliar a ocorrência de mutações nos demais éxons do gene FLCN A presença protéica da MSH2 nos tumores biopsiados pode sugerir a relação entre o sistema de reparo do DNA e a síndrome de Birt- Hogg-Dubé

Hereditariedade e cancer de mama Mutacoes e Polimorfismos

Hereditariedade e cancer de mama Mutacoes e Polimorfismos Hereditariedade e cancer de mama Mutacoes e Polimorfismos Dr. Jose Claudio Casali da Rocha Laboratorio Mantis Diagnosticos Avancados IOP Instituto de Oncologia do Parana Hospital Erasto Gaertner PUC-PR

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS.

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Laura S. W ard CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Nódulos da Tiróide e o Carcinoma Medular Nódulos da tiróide são um

Leia mais

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014

Mutações. Escola Secundária Quinta do Marquês. Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Escola Secundária Quinta do Marquês Mutações Disciplina: Biologia e Geologia Professor: António Gonçalves Ano letivo: 2013/2014 Trabalho realizado por: Bárbara Dória, nº4, 11ºB Definição de mutação As

Leia mais

Síndromes Hereditários de Cancro Coloretal. André Goulart Interno Cirurgia Geral 4º ano

Síndromes Hereditários de Cancro Coloretal. André Goulart Interno Cirurgia Geral 4º ano Síndromes Hereditários de Cancro Coloretal André Goulart Interno Cirurgia Geral 4º ano Introdução Epidemiologia CCR 2ª causa de morte Risco desenvolver CCR 6% 90% CCR após os 50 anos Incidência aumentou

Leia mais

VI Workshop Internacional de Atualização em Hepatologia 2012 Pólipos de Vesícula Biliar Diagnóstico e Conduta

VI Workshop Internacional de Atualização em Hepatologia 2012 Pólipos de Vesícula Biliar Diagnóstico e Conduta VI Workshop Internacional de Atualização em Hepatologia 2012 Pólipos de Vesícula Biliar Diagnóstico e Conduta Júlio Coelho Universidade Federal do Paraná Pólipo de Vesícula Biliar Estudos Científicos Ausência

Leia mais

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Introdução Agentes internos ou externos causam alterações

Leia mais

Glicosaminoglicanos (GAGS) Introdução. heteropolissacarídeos lineares constituídos por unidades dissacarídicas repetitivas.

Glicosaminoglicanos (GAGS) Introdução. heteropolissacarídeos lineares constituídos por unidades dissacarídicas repetitivas. Identificação e quantificação pela espectroscopia de massa de glicosaminoglicanos sulftados da matriz extracelular no tecido colorretal neoplásico e não neoplásico* * Departmento de Biologia Molecular,

Leia mais

DIVERTÍCULO DIVERTÍCULO VERDADEIRO FALSO Composto por todas as camadas da parede intestinal Não possui uma das porções da parede intestinal DIVERTICULOSE OU DOENÇA DIVERTICULAR Termos empregados para

Leia mais

Tumor Estromal Gastrointestinal

Tumor Estromal Gastrointestinal Tumor Estromal Gastrointestinal Pedro Henrique Barros de Vasconcellos Hospital Cardoso Fontes Serviço de Cirurgia Geral Introdução GIST é o tumor mesenquimal mais comum do TGI O termo foi desenvolvido

Leia mais

Infecções e inflamações do trato urinário, funçao sexual e reprodutiva Urologia Denny

Infecções e inflamações do trato urinário, funçao sexual e reprodutiva Urologia Denny DATA hora AULA PROGRAMADA Módulo PROFESSOR 25/10/2013 14:00-14:55 Abdome Agudo - inflamatório e obstrutivo Clínica Cirúrgica João Marcos 14:55-15:50 Abdome Agudo - perfurativo e vascular/hemorrágico Clínica

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

Tumor carcinoide de duodeno: um tumor raro em local incomum. Série de casos de uma única instituição

Tumor carcinoide de duodeno: um tumor raro em local incomum. Série de casos de uma única instituição Tumor carcinoide de duodeno: um tumor raro em local incomum. Série de casos de uma única instituição Jaques Waisberg- Orientador do Programa de Pós Graduação do Instituto de Assistência Médica ao Servidor

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER Gyzelly Gondim de Oliveira 1 ; Cristiane Alves da Fonseca 2 1 Graduanda do Curso de Farmácia, UnuCET Anápolis - UEG

Leia mais

Médico, este é um canal de comunicação dedicado exclusivamente a você!

Médico, este é um canal de comunicação dedicado exclusivamente a você! CANAL MÉDICO Médico, este é um canal de comunicação dedicado exclusivamente a você! A equipe do canal médico do laboratório Alvaro, é formada por bioquímicos, biomédicos e médicos com grande experiência

Leia mais

Caso Clínico. Andrea Canelas

Caso Clínico. Andrea Canelas Caso Clínico Andrea Canelas 28-06 06-2006 Identificação Sexo: Idade: 79 anos Raça: a: Caucasiana Naturalidade: Coimbra História da doença a actual Seguida na consulta de Gastro desde Novembro de 2005:

Leia mais

Aulas teórica s PROFESSOR DATA HORA AULA PROGRAMADA MÓDULO. Sessão Avaliação ED Supervisão TOTAL

Aulas teórica s PROFESSOR DATA HORA AULA PROGRAMADA MÓDULO. Sessão Avaliação ED Supervisão TOTAL DATA HORA AULA PROGRAMADA MÓDULO PROFESSOR Aulas teórica s Amb. Sessão Avaliação ED Supervisão TOTAL 13:15 Abdome Agudo - inflamatório e obstrutivo Clínica Cirúrgica João Marcos 24/7/2015 Abdome Agudo

Leia mais

Avanços na Patologia cirúrgica. Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein.

Avanços na Patologia cirúrgica. Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein. Avanços na Patologia cirúrgica Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein.br Avanços Neoplasias de pulmão Câncer colorretal Carcinoma

Leia mais

UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL-REI CAMPUS CENTRO OESTE Planilha de aulas - Internato em Cirurgia 1º semestre de 2015

UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL-REI CAMPUS CENTRO OESTE Planilha de aulas - Internato em Cirurgia 1º semestre de 2015 UNIVERSIDADE FEDERAL DE SÃO JOÃO DEL-REI CAMPUS CENTRO OESTE Planilha de aulas - Internato em Cirurgia 1º semestre de 2015 DATA SALA HORA AULA PROGRAMADA MÓDULO PROFESSOR 6/2/2015 102. D 13:15-14:10 Tratamento

Leia mais

Módulo: Câncer de Rim Localizado

Módulo: Câncer de Rim Localizado Módulo: Câncer de Rim Localizado Caso 1 CAL, 56 anos, masculino Paciente médico, obeso (IMC = 41; peso 120 kg) Antecedentes clínicos: nefrolitíase Antecedentes cirúrgicos: Laparotomia mediana por divertículo

Leia mais

Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE

Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE Instituto de Assistência Médica ao Servidor Público Estadual IAMSPE IV Congresso de Iniciação Científica do IAMSPE São Paulo 2010 Níveis séricos e imunoexpressão tecidual do marcador CA19-9 no carcinoma

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

DATA hora SALA AULA PROGRAMADA Módulo PROFESSOR

DATA hora SALA AULA PROGRAMADA Módulo PROFESSOR DATA hora SALA AULA PROGRAMADA Módulo PROFESSOR 14:00-14:55 Abdome Agudo - inflamatório e obstrutivo Clínica Cirúrgica João Marcos 14:55-15:50 Abdome Agudo - perfurativo e vascular/hemorrágico Clínica

Leia mais

Relatos de casos de Strongyloides stercoralis. Isabelle Assunção Nutrição

Relatos de casos de Strongyloides stercoralis. Isabelle Assunção Nutrição Relatos de casos de Strongyloides stercoralis Isabelle Assunção Nutrição RECIFE/2011 INTRODUÇÃO A estrongiloidíase é uma helmintíase predominantemente intestinal causada pelo Strongyloides stercoralis,

Leia mais

203 A. 16:30-17:20 Trauma cervical Clinica Cirúrgica Raphael 17:20-18:10 Queimaduras Clínica Cirúrgica Raphael

203 A. 16:30-17:20 Trauma cervical Clinica Cirúrgica Raphael 17:20-18:10 Queimaduras Clínica Cirúrgica Raphael CRONOGRAMA INTERNATO DE CIRURGIA 1º 2013 9º PERÍODO DATA/LOCAL HORÁRIO AULA PROGRAMADA Módulo PROFESSOR 24/5/2013 11:00-11:50 Lesões corporais Medicina Legal Andressa 11:50-12:40 Lesões corporais Medicina

Leia mais

8:00 Horas Sessão de Temas Livres concorrendo a Premiação. 8:30 8:45 INTERVALO VISITA AOS EXPOSITORES E PATROCINADORES.

8:00 Horas Sessão de Temas Livres concorrendo a Premiação. 8:30 8:45 INTERVALO VISITA AOS EXPOSITORES E PATROCINADORES. MAPA AUDITÓRIO ÓPERA DE ARAME (200 LUGARES) DOMINGO 02 DE AGOSTO DE 2015. 8:00 Horas Sessão de Temas Livres concorrendo a Premiação. 8:00 8:15 TEMA LIVRE SELECIONADO. 8:15 8:30 TEMA LIVRE SELECIONADO.

Leia mais

PlanetaBio Resolução de Vestibulares FUVEST 2006 2ª fase www.planetabio.com

PlanetaBio Resolução de Vestibulares FUVEST 2006 2ª fase www.planetabio.com 1-O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. Com relação a esse ambiente: a) Indique os consumidores primários. b) Dentre

Leia mais

João Marcos + Raphael + Aisha + Clarissa + Tiago + Marcelo

João Marcos + Raphael + Aisha + Clarissa + Tiago + Marcelo DATA HORA AULA PROGRAMADA SALA MÓDULO PROFESSOR 05/02/2016 13:15 Abdome Agudo - inflamatório e obstrutivo Clínica Cirúrgica 14:10 Abdome Agudo - perfurativo e vascular/hemorrágico Clínica Cirúrgica 15:25

Leia mais

Metástase Cutânea de Carcinoma de Células Claras Renais: Relato de Caso Aichinger, L.A. 1, Kool, R. 1, Mauro, F.H.O. 1, Preti, V.

Metástase Cutânea de Carcinoma de Células Claras Renais: Relato de Caso Aichinger, L.A. 1, Kool, R. 1, Mauro, F.H.O. 1, Preti, V. Metástase Cutânea de Carcinoma de Células Claras Renais: Relato de Caso Aichinger, L.A. 1, Kool, R. 1, Mauro, F.H.O. 1, Preti, V. 1 1 Hospital Erasto Gaertner, Curitiba, Paraná. Introdução e Objetivo O

Leia mais

POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE

POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE Jeany Camelo Santos 1, Rafael Lucas Leonídeo 2, Flávio Monteiro Ayres 3,4 1 Bolsista PBIC/UEG. 2 Aluno de iniciação científica PVIC.

Leia mais

Fibrose Cística. Triagem Neonatal

Fibrose Cística. Triagem Neonatal Fibrose Cística Triagem Neonatal Fibrose cística Doença hereditária autossômica e recessiva, mais frequente na população branca; Distúrbio funcional das glândulas exócrinas acometendo principalmente os

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Coffee Break 10:30hs às 11:30hs Biologia Molecular do Processo de Apoptose Prof. Dr. Roberto César Pereira Lima Júnior Departamento de Fisiologia e

Coffee Break 10:30hs às 11:30hs Biologia Molecular do Processo de Apoptose Prof. Dr. Roberto César Pereira Lima Júnior Departamento de Fisiologia e II Curso Avançado em Citogenômica do Câncer - realizado pelo Laboratório de Citogenômica do Câncer da Universidade Federal do Ceará. 20 a 23 de novembro no Seara Praia Hotel em Fortaleza - Ceará. Carga

Leia mais

NEOPLASIA DE CÓLON: UMA ANÁLISE DA PREVALÊNCIA E TAXA DE MORTALIDADE NO PERÍODO DE 1998 A 2010 NO BRASIL

NEOPLASIA DE CÓLON: UMA ANÁLISE DA PREVALÊNCIA E TAXA DE MORTALIDADE NO PERÍODO DE 1998 A 2010 NO BRASIL 25 a 28 de Outubro de 2011 ISBN 978-85-8084-055-1 NEOPLASIA DE CÓLON: UMA ANÁLISE DA PREVALÊNCIA E TAXA DE MORTALIDADE NO PERÍODO DE 1998 A 2010 NO BRASIL Camila Forestiero 1 ;Jaqueline Tanaka 2 ; Ivan

Leia mais

1º modelo: doença degenerativa

1º modelo: doença degenerativa 2ª Aula de Biopatologia 18/09/2006 Medicina molecular: Da nova Biologia à Clínica Nesta aula vamos falar de três modelos de relevância entre a biologia básica e a clínica. 1º modelo: doença degenerativa

Leia mais

OBJETIVOS GERAIS OBJETIVOS ESPECÍFICOS

OBJETIVOS GERAIS OBJETIVOS ESPECÍFICOS OBJETIVOS GERAIS O Programa de Residência Médica opcional de Videolaparoscopia em Cirurgia do Aparelho Digestivo (PRMCAD) representa modalidade de ensino de Pós Graduação visando ao aperfeiçoamento ético,

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

UNIVERSIDADE DO VALE DO ITAJAI CENTRO DE CIÊNCIAS DA SAÚDE MEDICINA - BACHARELADO

UNIVERSIDADE DO VALE DO ITAJAI CENTRO DE CIÊNCIAS DA SAÚDE MEDICINA - BACHARELADO UNIVERSIDADE DO VALE DO ITAJAI CENTRO DE CIÊNCIAS DA SAÚDE MEDICINA - BACHARELADO EMENTAS DISCIPLINAS MATRIZ 3 1º AO 3º PERÍODO 1 º Período C.H. Teórica: 90 C.H. Prática: 90 C.H. Total: 180 Créditos: 10

Leia mais

7ª Reunião Luso-Galaica de Endocrinologia, Diabetes e Metabolismo. Caso Clínico. Hospital de Braga

7ª Reunião Luso-Galaica de Endocrinologia, Diabetes e Metabolismo. Caso Clínico. Hospital de Braga 7ª Reunião Luso-Galaica de Endocrinologia, Diabetes e Metabolismo Hospital de Braga Serviço de Cirurgia Director: Dr. Mesquita Rodrigues Sónia Ribas 12 de Dezembro F.C.R, sexo masculino, 69 anos Antecedentes

Leia mais

CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO. Ana Flavia Damasceno Luiz Gonzaga Porto. Introdução

CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO. Ana Flavia Damasceno Luiz Gonzaga Porto. Introdução CAPÍTULO 2 CÂNCER DE MAMA: AVALIAÇÃO INICIAL E ACOMPANHAMENTO Ana Flavia Damasceno Luiz Gonzaga Porto Introdução É realizada a avaliação de um grupo de pacientes com relação a sua doença. E através dele

Leia mais

7º Imagem da Semana: Radiografia de Tórax

7º Imagem da Semana: Radiografia de Tórax 7º Imagem da Semana: Radiografia de Tórax Legenda da Imagem 1: Radiografia de tórax em incidência póstero-anterior Legenda da Imagem 2: Radiografia de tórax em perfil Enunciado: Homem de 38 anos, natural

Leia mais

Explicação sobre o processo de rastreio do cancro do intestino

Explicação sobre o processo de rastreio do cancro do intestino Explicação sobre o processo de rastreio do cancro do intestino 1 www.bowelscreeningwales.org.uk Explicação sobre o processo de rastreio do cancro do intestino Este folheto dá-lhe informações sobre o rastreio

Leia mais

As principais causas de diabetes insípidus central são tumores que acometem a região hipotalâmica hipofisária, como por exemplo:

As principais causas de diabetes insípidus central são tumores que acometem a região hipotalâmica hipofisária, como por exemplo: Diabetes insípidus O que é Diabetes insípidus? Diabetes insípidus consiste em um distúrbio de controle da água no organismo, no qual os rins não conseguem reter adequadamente a água que é filtrada. Como

Leia mais

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Patologia Cirúrgica macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Exame Histopatológico Exame anatomopatológico é ATO MÉDICO! lâminas microscopia laudo

Leia mais

5ª Reunião de Casos. www.digimaxdiagnostico.com.br/

5ª Reunião de Casos. www.digimaxdiagnostico.com.br/ 5ª Reunião de Casos www.digimaxdiagnostico.com.br/ Caso 1 Paciente J.M., 81 anos, sexo masculino. TC sem contraste TC com contraste Diagnóstico Aneurisma roto da aorta abdominal, parcialmente trombosado,

Leia mais

Tumor Desmoplásico de Pequenas Células Redondas: Relato de um caso.

Tumor Desmoplásico de Pequenas Células Redondas: Relato de um caso. Everton Pereira D. Lopes² Eduardo M Pracucho¹ Ricardo de Almeida Campos² Karla Thaiza Thomal¹ Celso Roberto Passeri¹ Renato Morato Zanatto¹ 1-Departamento de Cirurgia Oncológica Aparelho Digestivo Alto

Leia mais

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva).

Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 1 Gráficos: experimento clássico de Gause, 1934 (Princípio de Gause ou princípio da exclusão competitiva). 2 O câncer surge de uma única célula que sofreu mutação, multiplicou-se por mitoses e suas descendentes

Leia mais

PATOLOGIA DA MAMA. Ana Cristina Araújo Lemos

PATOLOGIA DA MAMA. Ana Cristina Araújo Lemos PATOLOGIA DA MAMA Ana Cristina Araújo Lemos Freqüência das alterações mamárias em material de biópsia Alteração fibrocística 40% Normal 30% Alterações benignas diversas 13% Câncer 10% Fibroadenoma

Leia mais

Cancro Gástrico. Prevenção, Diagnóstico e Tratamento. Cancro Digestivo. 30 de Setembro 2006. Organização. Sponsor. Apoio.

Cancro Gástrico. Prevenção, Diagnóstico e Tratamento. Cancro Digestivo. 30 de Setembro 2006. Organização. Sponsor. Apoio. Organização Sponsor Cancro Gástrico Prevenção, Diagnóstico e Tratamento Apoio Secretariado Central Park R. Alexandre Herculano, Edf. 1-4º C 2795-240 Linda-a-Velha Telefones: 21 430 77 40/1/2/3/4 Fax: 21

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

INFERTILIDADE MASCULINA E FIBROSE CÍSTICA

INFERTILIDADE MASCULINA E FIBROSE CÍSTICA INFERTILIDADE MASCULINA E FIBROSE CÍSTICA A infertilidade pode ser definida como a inabilidade de um casal sexualmente ativo, sem a utilização de métodos contraceptivos, de estabelecer gravidez dentro

Leia mais

CÂNCER DE MAMA. O controle das mamas de seis em seis meses, com exames clínicos, é também muito importante.

CÂNCER DE MAMA. O controle das mamas de seis em seis meses, com exames clínicos, é também muito importante. CÂNCER DE MAMA Dr. José Bél Mastologista/Ginecologista - CRM 1558 Associação Médico Espírita de Santa Catarina AME/SC QUANDO PEDIR EXAMES DE PREVENÇÃO Anualmente, a mulher, após ter atingindo os 35 ou

Leia mais

ANOMALIAS DO TRATO URINÁRIO UNIDADE DE NEFROLOGIA PEDIÁTRICA HC - UFMG BELO HORIZONTE - BRASIL

ANOMALIAS DO TRATO URINÁRIO UNIDADE DE NEFROLOGIA PEDIÁTRICA HC - UFMG BELO HORIZONTE - BRASIL ANOMALIAS DO TRATO URINÁRIO UNIDADE DE NEFROLOGIA PEDIÁTRICA HC - UFMG BELO HORIZONTE - BRASIL Investigação Imagens Anomalias obstrutivas do trato urinário Obstrução da junção ureteropélvica Obstrução

Leia mais

LINFOMAS. Maria Otávia da Costa Negro Xavier. Maio -2013

LINFOMAS. Maria Otávia da Costa Negro Xavier. Maio -2013 LINFOMAS GASTROINTESTINAIS Maria Otávia da Costa Negro Xavier Maio -2013 1 INTRODUÇÃO Cerca de 1 a 4% de todas as malignidades gastrointestinais são linfomas. Por definição os linfomas gastrointestinais

Leia mais

04/06/2012 INTRODUÇÃO À RAGIOLOGIA SIMPLES DO TÓRAX. Dante L. Escuissato RADIOGRAFIAS DO TÓRAX INCIDÊNCIAS: FRONTAL (PA) PERFIL TÓRAX

04/06/2012 INTRODUÇÃO À RAGIOLOGIA SIMPLES DO TÓRAX. Dante L. Escuissato RADIOGRAFIAS DO TÓRAX INCIDÊNCIAS: FRONTAL (PA) PERFIL TÓRAX INTRODUÇÃO À RAGIOLOGIA SIMPLES DO TÓRAX Dante L. Escuissato RADIOGRAFIAS DO TÓRAX INCIDÊNCIAS: FRONTAL (PA) PERFIL TÓRAX 1 RADIOGRAFIAS AS RADIOGRAFIAS APRESENTAM 4 DENSIDADES BÁSICAS: AR: traquéia, pulmões,

Leia mais

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica

CONHECIMENTO GOTAS. neoplasias hematológicas: leucemia mieloide crônica CONHECIMENTO EM GOTAS neoplasias hematológicas: leucemia mieloide crônica leucemia é uma doença maligna dos leucócitos (glóbulos brancos). ela pode ser originada em duas linhagens diferentes: a linhagem

Leia mais

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

Tumores Benignos dos Tecidos Moles

Tumores Benignos dos Tecidos Moles Tumores Benignos dos Tecidos Moles Classificação - OMS (2005) Hamartoma: crescimento dismórfico de tecido original de uma região. Geralmente autolimitante e pode sofrer involução Neoplasia: crescimento

Leia mais

Diagnóstico do câncer

Diagnóstico do câncer UNESC FACULDADES ENFERMAGEM - ONCOLOGIA FLÁVIA NUNES Diagnóstico do câncer Evidenciado: Investigação diagnóstica por suspeita de câncer e as intervenções de enfermagem no cuidado ao cliente _ investigação

Leia mais

DISCIPLINA DE RADIOLOGIA UFPR

DISCIPLINA DE RADIOLOGIA UFPR DISCIPLINA DE RADIOLOGIA UFPR MÓDULO ABDOME AULA 2 AVALIAÇÃO INTESTINAL POR TC E RM Prof. Mauricio Zapparoli Neste texto abordaremos protocolos de imagem dedicados para avaliação do intestino delgado através

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

RESOLUÇÃO DA DIRETORIA Nº 08/2014

RESOLUÇÃO DA DIRETORIA Nº 08/2014 RESOLUÇÃO DA DIRETORIA Nº 08/2014 A Diretoria Administrativa do Consórcio Público Intermunicipal de Saúde do Norte Pioneiro - CISNORPI, no uso de suas atribuições legais, resolve: Regulamentar o Credenciamento

Leia mais

INSTRUÇÕES PARA O CANDIDATO:

INSTRUÇÕES PARA O CANDIDATO: INSTRUÇÕES PARA O CANDIDATO: 1) Esta prova é composta por 20 (vinte) questões de múltipla escolha, cada uma valendo 0,5 (meio) ponto. 2) Cada questão apresenta apenas uma resposta correta. Questões rasuradas

Leia mais

PRINCÍPIOS DE GENÉTICA MÉDICA

PRINCÍPIOS DE GENÉTICA MÉDICA PRINCÍPIOS DE GENÉTICA MÉDICA Conceitos Genética / Genômica Doença genética Hereditariedade Congênito DNA / Gene / Locus / Alelo Homozigoto / Heterozigoto Cromossomos Autossomos Sexuais Dominante / Recessivo

Leia mais

Departamento de Diagnóstico por Imagem do I.C.A.V.C. TOMOGRAFIA EM ONCOLOGIA

Departamento de Diagnóstico por Imagem do I.C.A.V.C. TOMOGRAFIA EM ONCOLOGIA TOMOGRAFIA EM ONCOLOGIA Tomografia: diagnóstico stico, estadiamento, acompanhamento, prevenção e pesquisa clínica nica; Objetivo da aula; TC Helicoidal X Multi slice Limitações do método. *Ajustes das

Leia mais

Genética e Câncer. Viviane Ferreira Esteves

Genética e Câncer. Viviane Ferreira Esteves Genética e Câncer Viviane Ferreira Esteves Fatores de risco Fatores internos Predisposição hereditária Fatores externos Ambientais Predisposição Genética para o Câncer Tipo de câncer Mama Cólon Leucemias

Leia mais

INSTRUÇÕES PARA O CANDIDATO:

INSTRUÇÕES PARA O CANDIDATO: INSTRUÇÕES PARA O CANDIDATO: 1) Esta prova é composta por 20 (vinte) questões de múltipla escolha, cada uma valendo 0,5 (meio) ponto. 2) Cada questão apresenta apenas uma resposta correta. Questões rasuradas

Leia mais

TUMORES GIGANTES DE OVÁRIO

TUMORES GIGANTES DE OVÁRIO TUMORES GIGANTES DE OVÁRIO Os autores apresentam três casos de Tumores Gigantes de Ovário, sendo um com alto grau de malignidade (Linfoma do tipo Burkitt), dois benignos (Cisto Seroso e Teratoma), porém

Leia mais

Neoplasias Gástricas. Pedro Vale Bedê

Neoplasias Gástricas. Pedro Vale Bedê Neoplasias Gástricas Pedro Vale Bedê Introdução 95% dos tumores gástricos são malignos 95% dos tumores malignos são adenocarcinomas Em segundo lugar ficam os linfomas e em terceiro os leiomiosarcomas Ate

Leia mais

Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer

Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer Hospital A.C.Camargo, um dos principais centros de diagnóstico, tratamento, ensino e pesquisa sobre o câncer da América Latina. Pesquisadores que

Leia mais

Linfomas gastrointestinais

Linfomas gastrointestinais Linfomas gastrointestinais Louise Gracielle de Melo e Costa R3 do Serviço de Patologia SAPC/HU-UFJF Introdução Linfomas extranodais: a maioria é de TGI. Ainda assim, linfomas primários gastrointestinais

Leia mais

Pâncreas. Pancreatite aguda. Escolha uma das opções abaixo para ler mais detalhes.

Pâncreas. Pancreatite aguda. Escolha uma das opções abaixo para ler mais detalhes. Pâncreas Escolha uma das opções abaixo para ler mais detalhes. Pancreatite aguda Pancreatite crônica Cistos pancreáticos Câncer de Pancrêas Pancreatite aguda O pâncreas é um órgão com duas funções básicas:

Leia mais

TUMORES DE GLÂNDULAS SALIVARES

TUMORES DE GLÂNDULAS SALIVARES Dr. Marcio R. Studart da Fonseca Cirurgia de Cabeça e Pescoço-HUWC/UFC Sistema Salivar 3 pares de Glândulas Salivares Maiores Parótidas Submandibulares Sublinguais Centenas de Glândulas Salivares Menores

Leia mais

Prof.: José Rubens de Andrade

Prof.: José Rubens de Andrade Prof.: José Rubens de Andrade 2º Semestre/2012 Definição: Toda estrutura tecidual que se projeta acima da superfície da camada mucosa do trato digestivo, de forma regular e circunscrita, fazendo proeminência

Leia mais

Abordagem diagnóstica a casos oncológicos em Répteis. Filipe Martinho, DVM

Abordagem diagnóstica a casos oncológicos em Répteis. Filipe Martinho, DVM Abordagem diagnóstica a casos oncológicos em Répteis Filipe Martinho, DVM III Congresso OMV - Novembro 2012 Oncologia e Répteis Aparentemente casos oncológicos são raros; Em colecções zoológicas até 23%

Leia mais

02 DE AGOSTO DE 2015 (DOMINGO)

02 DE AGOSTO DE 2015 (DOMINGO) 02 DE AGOSTO DE 2015 (DOMINGO) Horário Programação 8:00: 08:30 Sessão de Temas Livres concorrendo a Premiação. Procedimentos Robóticos em Cirurgia abdominal 8:45-9:00 Cirurgia Robótica das afecções do

Leia mais

Câncer Colorretal Hereditário

Câncer Colorretal Hereditário Câncer Colorretal Hereditário Critérios Diagnósticos João Gomes Netinho jgnetinho@riopreto.com.br Câncer Colorretal Incidência no mundo - 3ª causa mais comum em ambos os sexos - 2ª nos paises desenvolvidos

Leia mais

Paramiloidose: Prof. Dr. Corino de Andrade

Paramiloidose: Prof. Dr. Corino de Andrade Amiloidose Polineuropatia amiloidótica familiar As doenças amiloidóticas As Amiloidoses são um grupo de doenças definido pela presença de depósitos de proteína insolúvel (fibrilas) nos tecidos. As Polineuropatias

Leia mais

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1 Oncologia Aula 2: Conceitos gerais Profa. Camila Barbosa de Carvalho 2012/1 Classificação da Quimioterapia Em relação ao número de medicamentos usados; Em relação ao objetivo; Em relação à via de administração;

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

A síndrome da obstrução piloroduodenal

A síndrome da obstrução piloroduodenal A síndrome da obstrução piloroduodenal QUADRO CLÍNICO Distensão e dor abdominal Náuseas Vômitos Perda do apetite Perda de peso Desidratação Oligúria Desequilíbrio hidro-eletrolítico A Estenose Piloroduodenal

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

Programação Preliminar do 41 Curso de Atualização em Cirurgia do Aparelho Digestivo, Coloproctologia e Transplantes de Órgãos do Aparelho Digestivo

Programação Preliminar do 41 Curso de Atualização em Cirurgia do Aparelho Digestivo, Coloproctologia e Transplantes de Órgãos do Aparelho Digestivo Programação Preliminar do 41 Curso de Atualização em Cirurgia do Aparelho Digestivo, Coloproctologia e Transplantes de Órgãos do Aparelho Digestivo Cirurgia do Esôfago Painel de perguntas e filmes cirúrgicos

Leia mais

SEQÜENCIAMENTO DO PROTO-ONCOGENE RET

SEQÜENCIAMENTO DO PROTO-ONCOGENE RET SEQÜENCIAMENTO DO PROTO-ONCOGENE RET Importância da identificação das mutações do proto-oncogene RET e sua atuação no desenvolvimento dos diversos fenótipos das neoplasias endócrinas múltiplas tipo 2 As

Leia mais

Mutações e Aberrações Cromossômicas

Mutações e Aberrações Cromossômicas Mutações e Aberrações Cromossômicas Aula 32, 33 e 34 Aspectos Conceituais e Rotas Metabólicas Prof. Antonio Márcio Teodoro Cordeiro Silva, M.Sc. Mutação Mutações são modificações casuais do material genético,

Leia mais

HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA

HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA HISTÓRIA NATURAL DOS TIPOS RAROS DE CÂNCER DE MAMA Carcinomas Profª. Dra. Maria do Carmo Assunção Carcinoma tipo basal Grau 3 CK14 & CK5 = Positivo P63 pode ser positivo (mioepitelial) Triplo negativo

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Perda da uniformidade nas células e desarranjo estrutural tecidual

Perda da uniformidade nas células e desarranjo estrutural tecidual .Leucoplasia: (grego: leuco = branco - plasis = formação) Transformação metaplásica do epitélio escamoso estratificado não ceratinizado consistindo em aumento das camadas de ceratina. Exemplos: mucosa

Leia mais

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas.

Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. Unidade IV Ser Humano e Saúde. Aula 15.1 Conteúdo: Mutações gênicas e cromossômicas. 2 Habilidade: Conceituar mutações gênicas e cromossômicas, compreendendo como podem influenciar nossas vidas. 3 REVISÃO

Leia mais

Linfomas. Claudia witzel

Linfomas. Claudia witzel Linfomas Claudia witzel Pode ser definido como um grupo de diversas doenças neoplásicas : Do sistema linfático Sistema linfóide Que tem origem da proliferação de linfócitos B ou T em qualquer um de seus

Leia mais

Tumores Gastrointestinais BIOLOGIA MOLECULAR

Tumores Gastrointestinais BIOLOGIA MOLECULAR Tumores Gastrointestinais BIOLOGIA MOLECULAR JOSE CLAUDIO CASALI DA ROCHA Oncogeneticista Clinica COI Clinica Salus Renovação e diferenciação epitelial. A Renovação do epitélio através da divisão mitótica

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

INTRODUÇÃO À PATOLOGIA Profª. Thais de A. Almeida

INTRODUÇÃO À PATOLOGIA Profª. Thais de A. Almeida INTRODUÇÃO À PATOLOGIA Profª. Thais de A. Almeida DEFINIÇÃO: Pathos: doença Logos: estudo Estudo das alterações estruturais, bioquímicas e funcionais nas células, tecidos e órgãos visando explicar os mecanismos

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais

AMBULATORIAL - PROCEDIMENTOS REALIZADOS JULHO./2014.02 Proced com finalidade diagnóstica 15.985.02.01 Col de mat por meio de punção/biopsia

AMBULATORIAL - PROCEDIMENTOS REALIZADOS JULHO./2014.02 Proced com finalidade diagnóstica 15.985.02.01 Col de mat por meio de punção/biopsia AMBULATORIAL - PROCEDIMENTOS REALIZADOS JULHO./2014.02 Proced com finalidade diagnóstica 15.985.02.01 Col de mat por meio de punção/biopsia 107.02.01.01 biópsia de pele e partes moles 39.02.01.01 Biópsia

Leia mais

AULAS TEÓRICAS SEMIOLOGIA MÉDICA GERAL I 5º PERÍODO 2009/2 DATA HORÁRIO ASSUNTO PROFESSORES

AULAS TEÓRICAS SEMIOLOGIA MÉDICA GERAL I 5º PERÍODO 2009/2 DATA HORÁRIO ASSUNTO PROFESSORES SEMIOLOGIA MÉDICA GERAL I 5º PERÍODO 2009/2 4 ago 11:00 ÀS 11:50 RELAÇÃO MÉDICO-PACIENTE E ÉTICA MÉDICA FLÁVIA MAGALHÃES 11 ago 11:00 ÀS 11:50 ANAMNESE FLÁVIA MAGALHÃES 18 ago 11:00 ÀS 11:50 SEMIOLOGIA

Leia mais

CÂnCER DE EnDOMéTRIO. Estados anovulatórios (ex: Síndrome dos ovários policísticos) Hiperadrenocortisolismo

CÂnCER DE EnDOMéTRIO. Estados anovulatórios (ex: Síndrome dos ovários policísticos) Hiperadrenocortisolismo CAPÍTULO 3 CÂnCER DE EnDOMéTRIO O Câncer de endométrio, nos Estados Unidos, é o câncer pélvico feminino mais comum. No Brasil, o câncer de corpo de útero perde em número de casos apenas para o câncer de

Leia mais