MicroRNAs: nova classe de reguladores gênicos envolvidos na função endócrina e câncer

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "MicroRNAs: nova classe de reguladores gênicos envolvidos na função endócrina e câncer"

Transcrição

1 FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETO Novas tecnologias de biologia molecular no câncer MicroRNAs: nova classe de reguladores gênicos envolvidos na função endócrina e câncer Filho J.C.M Ricarte, Kimura E. Teruko, Arq Bras Endocr Metabol, vol 50, n 6, Dez 2006 Rodrigo Nunes Cal Marcelo Bandeira Fernandes

2 MicroRNA / mirna Moléculas de RNA fita simples de nucleotídeos Não codificadores de proteínas Potentes reguladores pós-transcricionais Lin4 (lineage-deficient-4) descoberto em 1993, no Caenorhabditis elegans

3 Estudos de bioinformática estimam que há mais de 1000 mirnas em humanos. Os mirnas possuem seqüências pequenas e agem sem a necessidade de pareamento completo, por isso, um único mirna pode regular muitos RNAm-alvo, além de cooperarem no controle de um único RNAm. Grande parte de seus genes está alinhada no genoma, formando nichos denominados de cluster. Neste caso, um grupo de genes forma um único transcrito primário que originará diversos micrornas maduros após processamento.

4 Biogênese dos micrornas 1- Transcrição do seu gene pela RNA polimerase II mirna primário contendo cap5 e cauda poli(a). 2- Processamento do pri-mirna pela enzima RNase III (Drosha) e seu cofator DGCR8. 3- Formação do pré-mirna e transferência para o citoplasma pela exportina-5, que utiliza o RanGTP como co-fator. 4- Processamento do pré-mirna pela RNase III (Dicer), gerando um mirna fita dupla. 5- Incorporação do mirna a um complexo multimérico RISC. 6- Uma das fitas do duplex de mirna é degradada enquanto a outra permanece no complexo RISC para controlar a expressão pós-transcricional de genes-alvo.

5 Caracterização biológica de mirnas Loop Dicer (RNAase III) UGAGGUAGUAGGUUGUAUAGU (mirna)

6 Mecanismos regulatórios dos mirnas 1. Degradação do RNAm: ligação por complementaridade perfeita ou quase perfeita ao RNAm-alvo, degrandando-o através de ribonucleases no complexo mirisc (silenciamento genético). 2. Inibição traducional: ligação por complementaridade imperfeita em regiões 3 não traduzidas do RNAm, inibindo a expressão gênica de maneira pós-transcricional.

7 Inibição traducional mirna Interrupção mirna

8 mirnas e a função endócrina O mir-375 regula a secreção da insulina em células β do pâncreas de camundongo e inibe a expressão da miotrofina (proteína que induz a exocitose de grânulos de insulina). O mir-124 e o let-7b atuam em conjunto com o mir-375 no controle da expressão da miotrofina. Outros 67 mirnas já foram identificados em células β. Atualmente não se sabe se ocorrem alterações na função dos mirnas em pacientes diabéticos. A melhor caracterização do papel dos mirnas nos mecanismos de secreção de insulina poderá levar à compreensão da fisiopatologia do diabetes, além de auxiliar no desenvolvimento de novos tratamentos.

9 A deleção do mir-14 em Drosophila melanogaster está associada com o aumento do tamanho da gota do adipócito e o maior acúmulo do triacilglicerol. O mir-143 está associado à diferenciação de adipócitos e a redução dos seus níveis in vitro em pré-adipócitos humanos promove a diminuição da expressão de genes específicos das células adipócitas, além de diminuir sua habilidade em acumular triglicérides. Poucos mirnas foram associados com o funcionamento endócrino; no entanto, muitos genes importantes neste sistema são alvos potenciais dos mirnas.

10 mirna e Câncer 50% dos genes de mirnas estão localizados em sítios genômicos associados ao câncer. Podem atuar como oncogene ou gene supressor tumoral

11 mirnas que atuam como genes supressores tumorais mir-15 e o mir-16 Localização de seus genes: cromossomo 13q14 (uma região deletada em mais da metade das leucemias linfocíticas crônicas de células B). Uma mutação germinativa no lócus gênico de mir-15/mir-16 diminuiu a expressão destes mirnas em células de LLC. Menor expressão em adenomas hipofisiários, sendo esta expressão inversamente correlacionada com o tamanho do tumor. Regulação negativa da expressão do oncogene anti-apoptótico BCL2 que se apresenta superexpresso em diversos cânceres humanos.

12 Os níveis dos mirnas de mir-143 e mir-145 estão diminuídos em tumores colorretais e linhagens celulares de câncer linfóide, mama, próstata e colo uterino. Os mirnas pertencentes à família let-7 também estão inseridos no grupo de mirnas supressores tumorais, regulando negativamente a expressão das isoformas do oncogene RAS. Estudos in vitro utilizando linhagem celular de adenoma de pulmão humano mostra que a superexpressão de let-7 apresenta efeito inibitório na proliferação celular destas células, indicando que o mesmo seja um agente terapêutico promissor no tratamento de câncer causado pela ativação de RAS.

13 mirnas que exercem ação oncogênica O mir-155 apresenta expressão aumentada em linfomas e células de câncer de mama. A análise da expressão global de mirnas em carcinoma papilífero da tiróide revelou um grande aumento na expressão de três mirnas: mir-221, mir-222 e mir-146. O mir-21 apresenta expressão aumentada em tumores de mama e glioblastoma e o knockout deste mirna em cultura de células de glioblastoma leva à indução de apoptose.

14 Um cluster de mirnas designado mir-17-92, compreendendo os mirnas mir-17-5p, mir-17-3p, mir-18a, mir-19a, mir-20a, mir-19b-1 e mir-92-1, tem sido considerado potencialmente oncogênico. A introdução do mir intensifica a proliferação das células de câncer de pulmão. Em um modelo de camundongos transgênicos, a expressão do cluster mir adicionada à expressão do oncogene MYC induziu a progressão de linfomas de células B. Os alvos preditos para o cluster mir incluem os genes supressores de tumor PTEN, associados com a Síndrome de Cowden, e RB2, membro da família da proteína Retinoblastoma.

15 O padrão de expressão de mirnas por microarray em câncer humano pode ser utilizado eficientemente na classificação tumoral. Num painel de mais de 200 cânceres humanos, dados de expressão de 217 mirnas foram mais eficientes na definição do tipo de câncer do que RNAs, indicando que o perfil de expressão de mirna poderá ter extrema utilidade no diagnóstico de câncer. Observou-se de forma global a diminuição da expressão dos mirnas em tumores, sugerindo que a maioria dos mirnas representem supressores tumorais. O desafio atual é identificar os alvos que estão regulados pelos mirnas. Estudos apontam que um único complexo mirisc pode se ligar à mais de 200 genes-alvo, e estes alvos podem ter funções diversas. Portanto, os mirnas controlam a expressão de cerca de 1/3 do RNAm humano, e a deleção ou alteração na expressão pode contribuir para diversas doenças, incluindo o câncer.

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren

AU10. Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica. Juliana da Silveira Schauren AU10 Princípios Básicos de Genética Molecular 2: Regulação da Expressão Gênica Juliana da Silveira Schauren Doutoranda PPG-GEN julianaschauren@gmail.com Resumo Introdução: revisão transcrição e tradução

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

Carcinogêse e Neoplasia. Profº Ary da Silveira Mendes Jr.

Carcinogêse e Neoplasia. Profº Ary da Silveira Mendes Jr. Carcinogêse e Neoplasia Profº Ary da Silveira Mendes Jr. Epidemiologia Principal causa de morte entre 45-60 anos Incidência no Brasil em 2003 (INCA) 126.290 mortes 402.190 casos novos DOENÇA GENÉTICA Padrão

Leia mais

Sistemas de controle da transcrição gênica. Procariotos

Sistemas de controle da transcrição gênica. Procariotos Sistemas de controle da transcrição gênica Procariotos Controle Positivo e Negativo: Há dois tipos de controle transcricional: Controle negativo: no qual uma proteína reguladora atua como um repressor

Leia mais

Prof. Dr. Bruno Lazzari de Lima. Genes e Câncer

Prof. Dr. Bruno Lazzari de Lima. Genes e Câncer Prof. Dr. Bruno Lazzari de Lima Genes e Câncer O que é câncer? Diferente de doenças cromossômicas, monogênicas e multifatoriais. Presente em todas as células do organismo inclusive gametas. Doenças genéticas

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Material genético Material genético Genes e cromossomas As informações hereditárias transmitidas ao longo das gerações, segundo

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro

PROCESSAMENTO DE RNA. Prof. Marcelo A. Soares. Universidade Federal do Rio de Janeiro PROCESSAMENTO DE RNA Prof. Marcelo A. Soares Laboratório rio de Virologia Molecular Universidade Federal do Rio de Janeiro Curso de Genética Molecular I - Ciências Biológicas Transcrição/Tradução Em procariotos

Leia mais

COMPLEXO PRINCIPAL DE HISTOCOMPATIBILIDADE - MHC. Profa Valeska Portela Lima

COMPLEXO PRINCIPAL DE HISTOCOMPATIBILIDADE - MHC. Profa Valeska Portela Lima COMPLEXO PRINCIPAL DE HISTOCOMPATIBILIDADE - MHC Profa Valeska Portela Lima Introdução Todas as espécies possuem um conjunto de genes denominado MHC, cujos produtos são de importância para o reconhecimento

Leia mais

Relembrando: Material genético

Relembrando: Material genético REGULAÇÃO GÉNICA Relembrando: Material genético O MATERIAL GENÉTICO é o suporte físico do conjunto de padrões de informações hereditárias, transmitidas ao longo das gerações. GENE é a unidade de informação

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

CICLO CELULAR Eduardo Montagner Dias

CICLO CELULAR Eduardo Montagner Dias CICLO CELULAR Eduardo Montagner Dias O ciclo celular é um processo através do qual uma célula somática duplica seu material genético e o reparte igualmente às suas células-filhas. É didaticamente dividido

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Ontogênese de linfócitos T

Ontogênese de linfócitos T Ontogênese de linfócitos T Linfócitos T Linfócitos T Os linfócitos T formados durante o desenvolvimento intratímico são: Linfócitos T (TCR γδ) Linfócitos T (TCR αβ) CD4+ CD8+ T reguladores Linfócitos NKT

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA ÍNDICE Introdução Evolução: mutação e recombinação do DNA Erros de Recombinação: Câncer? Engenharia Genética e Transgênicos Recombinação homóloga - Modelo Holliday

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Nutrigenômica x Nutrigenética - doenças relacionadas

Nutrigenômica x Nutrigenética - doenças relacionadas Nutrigenômica x Nutrigenética - doenças relacionadas Início Projeto Genoma Humano 20.000 genes (120.000 inicialmente estimados) Diversidade nucleotídica: 0,1 a 0,4% pares de base correspondente a aproximadamente

Leia mais

Núcleo celular: O centro de comando. Unidade 4 Pág 34

Núcleo celular: O centro de comando. Unidade 4 Pág 34 Núcleo celular: O centro de comando. Unidade 4 Pág 34 NÚCLEO O núcleo é o centro de coordenação das atividades da célula. Em geral há um núcleo por célula; células sem núcleo são apenas uma fase da vida;

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

Processamento de RNA

Processamento de RNA Seminário de Bioquímica II Prof. Dr. Julio César Borges Processamento de RNA Grupo: Rodrigo Rossi de Araújo nº USP 7144403 Edvaldo Maciel Vasconcelos nº USP 7275921 Introdução Sintetizados a partir de

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

O Cancro - Aspectos gerais O termo Cancro é aplicado e utilizado genericamente para identificar um vasto conjunto de doenças que são os tumores malign

O Cancro - Aspectos gerais O termo Cancro é aplicado e utilizado genericamente para identificar um vasto conjunto de doenças que são os tumores malign presentes na Leucemia Daniela Bessa O Cancro - Aspectos gerais O termo Cancro é aplicado e utilizado genericamente para identificar um vasto conjunto de doenças que são os tumores malignos, também designamos

Leia mais

COMO UMA SÓ CÉLULA FECUNDADA PODE DAR ORIGEM A UM ORGANISMO COMPLEXO?

COMO UMA SÓ CÉLULA FECUNDADA PODE DAR ORIGEM A UM ORGANISMO COMPLEXO? COMO UMA SÓ CÉLULA FECUNDADA PODE DAR ORIGEM A UM ORGANISMO COMPLEXO? DIFERENTES TIPOS DE CÉLULAS NUM MESMO ORGANISMO DIFEREM DRAMÁTICAMENTE LINFÓCITOS NEURÔNIO É POSSÍVEL ATÉ OBTER UM NOVO ORGANISMO A

Leia mais

BioMol (CV novo) Questões sobre os Seminários. GRUPO 1 Teoria unificada da expressão gênica

BioMol (CV novo) Questões sobre os Seminários. GRUPO 1 Teoria unificada da expressão gênica BioMol (CV novo) Questões sobre os Seminários GRUPO 1 Teoria unificada da expressão gênica Compare a expressão gênica de genes que são utilizados para a manutenção básica da célula, com genes que são usados

Leia mais

INTRODUÇÃO À BIOQUÍMICA DA CÉLULA. Bioquímica Celular Prof. Júnior

INTRODUÇÃO À BIOQUÍMICA DA CÉLULA. Bioquímica Celular Prof. Júnior INTRODUÇÃO À BIOQUÍMICA DA CÉLULA Histórico INTRODUÇÃO 1665: Robert Hooke Compartimentos (Células) 1840: Theodor Schwann Teoria Celular 1. Todos os organismos são constituídos de uma ou mais células 2.

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

Genética e Saúde - Genética na Escola. Depois de aproximadamente 150 anos dos revolucionários experimentos

Genética e Saúde - Genética na Escola. Depois de aproximadamente 150 anos dos revolucionários experimentos Genética e Saúde - Genética na Escola Depois de aproximadamente 150 anos dos revolucionários experimentos de Mendel, a genética alcança sua fase molecular com toda força, tornando um desafio para os professores

Leia mais

Superlista núcleo 1.

Superlista núcleo 1. Superlista núcleo 1. (Unicamp) Em relação a um organismo diploide, que apresenta 24 cromossomos em cada célula somática, pode-se afirmar que a) seu código genético é composto por 24 moléculas de DNA de

Leia mais

Marcadores Moleculares

Marcadores Moleculares Marcadores Moleculares Pedro Fernandes Instituto Gulbenkian de Ciência Oeiras, Portugal 04-12 12-20062006 LEBM - Bioinformática 1 No corpo humano Há 30,000 proteínas diferentes As proteínas: São os blocos

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

CITOCINAS. Aarestrup, F.M.

CITOCINAS. Aarestrup, F.M. CITOCINAS Propriedades gerais Proteínas de baixo peso molecular Comunicação Cel-Cel Mensageiros do sistema imune Receptores de membrana Signal transduction Célula Alvo Expressão de genes Gene Citocina

Leia mais

Samyr Coradini Lopes Acadêmico de Medicina 3º Período Monitor de Genética/2015 Orientadora: profª. Dra. Cibele Veloso Rodrigues

Samyr Coradini Lopes Acadêmico de Medicina 3º Período Monitor de Genética/2015 Orientadora: profª. Dra. Cibele Veloso Rodrigues Samyr Coradini Lopes Acadêmico de Medicina 3º Período Monitor de Genética/2015 Orientadora: profª. Dra. Cibele Veloso Rodrigues A descoberta do DNA e o projeto genoma. Rev. Assoc. Med. Bras., São Paulo,

Leia mais

Iniciação e progressão neoplásica

Iniciação e progressão neoplásica Biopatologia Iniciação e progressão neoplásica Diana Santos Ana Isabel Teixeira Doenças degenerativas -Nos indivíduos novos - a etiologia é hereditária: são sobretudo doenças catabólicas que ocorrem em

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

Tópicos de Imunologia Celular e Molecular (Parte 2)

Tópicos de Imunologia Celular e Molecular (Parte 2) IMUNOLOGIA BÁSICA Tópicos de Imunologia Celular e Molecular (Parte 2) Prof. M. Sc. Paulo Galdino Os três outros tipos de hipersensibilidade ( II, III e IV) têm em comum uma reação exagerada do sistema

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

Pâncreas O Pâncreas é um órgão do sistema digestivo e endócrino. Tem uma função exócrina (segregando suco pancreático que contém enzimas digestivas) e

Pâncreas O Pâncreas é um órgão do sistema digestivo e endócrino. Tem uma função exócrina (segregando suco pancreático que contém enzimas digestivas) e Projecto Tutorial - Diabetes Trabalho realizado por: Carlos Bernardo 2 º Ano Bioquímica No âmbito da Cadeira de M.E.T. III Ano Lectivo: 2007/2008 Pâncreas O Pâncreas é um órgão do sistema digestivo e endócrino.

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Tópicos! Estrutura e função

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

Regulação Gênica em Eucariotos.

Regulação Gênica em Eucariotos. Regulação Gênica em Eucariotos. As últimas estimativas são que uma célula humana, uma célula eucariótica, contenha aproximadamente 35.000 genes. Alguns destes genes são expressos na célula todo o tempo.

Leia mais

Fisiologia Endócrina

Fisiologia Endócrina Fisiologia Endócrina Profa. Letícia Lotufo Claude Bernard: pai da endocrinologia Definiu o termo milieu intérieur Endocrinologia estudo das secreções internas do organismos. 1 Sistema Endócrino e Homeostasia

Leia mais

Fases do Ciclo Celular.

Fases do Ciclo Celular. Ciclo celular Fases do Ciclo Celular http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4.figgrp.3170 Fases do Ciclo Celular http://www.ncbi.nlm.nih.gov/books/bv.fcgi?rid=mboc4.figgrp.3171 Leveduras são

Leia mais

Ontogenia do Linfócito T

Ontogenia do Linfócito T Ontogenia do Linfócito T Processamento e Apresentação de Antígenos para Reconhecimento por TCR Diferente da imunoglobulina, o receptor do linfócito T reconhece antígeno protéico somente quando associado

Leia mais

Reprogramação Celular. Pítia Ledur pitialedur@gmail.com

Reprogramação Celular. Pítia Ledur pitialedur@gmail.com Reprogramação Celular Pítia Ledur pitialedur@gmail.com Reprogramação Celular O que é isso? ipsc = induced pluripotent stem cells Shinya Yamanaka Reprogramação Celular O que é isso? ipsc = induced pluripotent

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

Microambiente tumoral. Cristiane C. Bandeira A. Nimir

Microambiente tumoral. Cristiane C. Bandeira A. Nimir Microambiente tumoral Cristiane C. Bandeira A. Nimir cristiane@nimir.com.br PROGRESSÃO E AGRESSÃO TUMORAL CÉLULA NEOPLÁSICA: - Acúmulo de mutações CONTROLE DO CICLO CELULAR!! PROGRESSÃO E AGRESSÃO TUMORAL

Leia mais

UNIVERSIDADE FEDERAL DA BAHIA

UNIVERSIDADE FEDERAL DA BAHIA UNIVERSIDADE FEDERAL DA BAHIA FACULDADE DE ODONTOLOGIA PROGRAMA DE PÓS-GRADUAÇÃO EM ODONTOLOGIA E SAÚDE POLIANA RAMOS BRAGA SANTOS PERFIL DE EXPRESSÃO DE MICRORNAS RELACIONADOS À ATIVAÇÃO DE MASTÓCITOS

Leia mais

Universidade Federal dos Vales do Jequitinhonha e Mucuri - UFVJM. Fisiologia Endócrina. O Pâncreas. Prof. Wagner de Fátima Pereira

Universidade Federal dos Vales do Jequitinhonha e Mucuri - UFVJM. Fisiologia Endócrina. O Pâncreas. Prof. Wagner de Fátima Pereira Universidade Federal dos Vales do Jequitinhonha e Mucuri - UFVJM Fisiologia Endócrina O Pâncreas Prof. Wagner de Fátima Pereira Departamento de Ciências Básicas Faculdade de Ciências Biológica e da Saúde

Leia mais

Aconselhamento genético para o estudo do câncer de mama e ovário hereditário

Aconselhamento genético para o estudo do câncer de mama e ovário hereditário Aconselhamento genético para o estudo do câncer de mama e ovário hereditário Quando devemos suspeitar que um câncer pode ser hereditário? O câncer é uma doença muito frequente. É fácil que em uma família

Leia mais

Macroevolução molecular

Macroevolução molecular Evo-Devo Macroevolução molecular Evolução e Desenvolvimento (Evo-Devo) A árvore temporal da vida Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Biologia evolutiva

Leia mais

Questões complementares

Questões complementares Questões complementares 1247-2005 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares

Leia mais

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: Genética: É o estudo da hereditariedade. Hereditariedade: fenômeno que explica as semelhanças

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Biologia molecular dos carcinomas epiteliais e tumores de baixo grau (borderline) do ovário e implicações para a prática clínica

Biologia molecular dos carcinomas epiteliais e tumores de baixo grau (borderline) do ovário e implicações para a prática clínica Biologia molecular dos carcinomas epiteliais e tumores de baixo grau (borderline) do ovário e implicações para a prática clínica Filomena M Carvalho filomena.carvalho@fm.usp.br 2 Epiteliais 80-90% Cél.

Leia mais

Vírus - Caracterização Geral

Vírus - Caracterização Geral Noções de Vírus By Profª. Cynthia Vírus - Caracterização Geral Vírus = veneno ou fluído venenoso (Latim) Acelulares/ Partículas Infecciosas Composição química de nucleoproteínas (DNA ou RNA+Proteínas)

Leia mais

INSA, I.P. Instituto Nacional de Saúde Doutor Ricardo Jorge Departamento de Genética Humana. Peter Jordan

INSA, I.P. Instituto Nacional de Saúde Doutor Ricardo Jorge Departamento de Genética Humana. Peter Jordan INSA, I.P. Instituto Nacional de Saúde Doutor Ricardo Jorge Departamento de Genética Humana Peter Jordan Visita de estudo Colégio St. Peter s School, Palmela 29 de Abril de 2014 (1858 1939) Controle de

Leia mais

Câncer e Sistema Imune

Câncer e Sistema Imune Câncer e Sistema Imune Causas de morte no ocidente Doenças cardiovasculares Câncer Tumores (neoplasias) Tumores benignos: incapazes de crescer indefinidamente, não invadem tecidos vizinhos saudáveis Tumores

Leia mais

Fundação Educacional Lucas Machado - FELUMA Faculdade Ciências Médicas - MG Concurso de Transferência 2016 PROGRAMA DE ANATOMIA (20 QUESTÕES)

Fundação Educacional Lucas Machado - FELUMA Faculdade Ciências Médicas - MG Concurso de Transferência 2016 PROGRAMA DE ANATOMIA (20 QUESTÕES) Fundação Educacional Lucas Machado - FELUMA Faculdade Ciências Médicas - MG Concurso de Transferência 2016 1 PROGRAMAS PARA A 2 ª SÉRIE DO CURSO DE MEDICINA PROGRAMA DE ANATOMIA (20 QUESTÕES) I Anatomia

Leia mais

Ciclo Celular e Controle do Ciclo Celular

Ciclo Celular e Controle do Ciclo Celular Ciclo Celular e Controle do Ciclo Celular Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Profa. Dra. Ester Tartarotti MSc. Rita Luiza Peruquetti Divisão Celular Deve ser regulada e Coordenada Ciclo

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 11 SISTEMA ENDÓCRINO

BIOLOGIA - 2 o ANO MÓDULO 11 SISTEMA ENDÓCRINO BIOLOGIA - 2 o ANO MÓDULO 11 SISTEMA ENDÓCRINO Como pode cair no enem Os mecanismos de autorregulação que levam à homeostase, para garantir um equilíbrio dinâmico, implicam retroalimentação (feedback),

Leia mais

Como diferentes células tronco adultas sabem seu destino celular? Diferentes tipos celulares mas sequência de DNA idêntica

Como diferentes células tronco adultas sabem seu destino celular? Diferentes tipos celulares mas sequência de DNA idêntica Epigenética Como diferentes células tronco adultas sabem seu destino celular? Diferentes tipos celulares mas sequência de DNA idêntica Como organismos geneticamente idênticos podem apresentar diferentes

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Descoberta da Estrutura do DNA

Descoberta da Estrutura do DNA DNA Estrutura Descoberta da Estrutura do DNA James Watson (geneticista americano) Francis Crick (físico inglês) Esclareceram a estrutura do DNA em 1953 O que se sabia sobre os genes Fatores hereditários

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

ONCOLOGIA. Aula I Profª.Enfª: Darlene Carvalho (www.darlenecarvalho.webnode.com.br)

ONCOLOGIA. Aula I Profª.Enfª: Darlene Carvalho (www.darlenecarvalho.webnode.com.br) ONCOLOGIA Aula I Profª.Enfª: Darlene Carvalho (www.darlenecarvalho.webnode.com.br) CLASSIFICAÇÃO DAS CÉLULAS Lábeis Estáveis Perenes CLASSIFICAÇÃO DAS CÉLULAS Células lábeis: São aquelas em constante renovação

Leia mais

NÚCLEO CELULAR. Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme

NÚCLEO CELULAR. Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme NÚCLEO CELULAR Disciplina: Embriologia e Genética Curso Odontologia Profa Ednilse Leme A presença do núcleo é a principal característica que distingue a célula eucariótica da procariótica. No núcleo está

Leia mais

Fisiologia do Sistema Endócrino. Pâncreas Endócrino. Anatomia Microscópica. Anatomia Microscópica

Fisiologia do Sistema Endócrino. Pâncreas Endócrino. Anatomia Microscópica. Anatomia Microscópica Fisiologia do Sistema Endócrino Pâncreas Endócrino Prof. Dr. Leonardo Rigoldi Bonjardim Profa. Adjunto do Depto. De Fisiologia-CCBS-UFS Material disponível em: http://www.fisiologiaufs.xpg.com.br 2006

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Nucléolo, cromatina e cromossomos

Nucléolo, cromatina e cromossomos Nucléolo, cromatina e cromossomos NUCLÉOLO Tem aspecto de grânulo, mas não é limitado por membrana. É o centro de produção de ribossomos. O DNA origina os RNAr que são conjugados com proteínas vindas

Leia mais

VOLUFILINE (Hydrogenated Polyisobutene Anemarrhena asphodeloides (Root) extract)

VOLUFILINE (Hydrogenated Polyisobutene Anemarrhena asphodeloides (Root) extract) VOLUFILINE (Hydrogenated Polyisobutene Anemarrhena asphodeloides (Root) extract) RESGATA A VOLUMETRIA DA PELE ADIPOGÊNESE PARA LIPOLIFTING + PREENCHIMENTO CUTÂNEO, muito além do colágeno REVERTE O ASPECTO

Leia mais

CHECKPOINT MITÓTICO. Eduardo Montagner Dias (Adaptação do texto de Niara Oliveira)

CHECKPOINT MITÓTICO. Eduardo Montagner Dias (Adaptação do texto de Niara Oliveira) CHECKPOINT MITÓTICO Eduardo Montagner Dias (Adaptação do texto de Niara Oliveira) Durante o ciclo celular a célula passa por uma série de eventos seqüenciais, onde um passo tem de ser completado antes

Leia mais

Nome Completo para Faturamento/Emissão de Nota Fiscal

Nome Completo para Faturamento/Emissão de Nota Fiscal Cadastro Financeiro Nome Completo para Faturamento/Emissão de Nota Fiscal CPF / CNPJ RG / Inscrição Estadual Endereço Bairro Município Estado CEP DDD / Telefone DDD / Celular E-mail Nome do Paciente CPF

Leia mais

TRANSDUÇÃO DE SINAL E VIAS DE SINALIZAÇÃO

TRANSDUÇÃO DE SINAL E VIAS DE SINALIZAÇÃO TRANSDUÇÃO DE SINAL E VIAS DE SINALIZAÇÃO Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanes de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia, Maio

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade.

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. 1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. Um estudo realizado por pesquisadores do departamento de medicina da Imperial College London, na Inglaterra, revelou

Leia mais

I Curso de Verão em Oncologia Experimental Cursos Práticos

I Curso de Verão em Oncologia Experimental Cursos Práticos I Curso de Verão em Oncologia Experimental Cursos Práticos 1. Técnicas Experimentais para o Estudo da Expressão Gênica O curso terá como base o estudo da expressão gênica utilizando um fator de transcrição.

Leia mais

Bases Moleculares da Obesidade e Diabetes. IGF- I System. Carlos Cas(lho de Barros

Bases Moleculares da Obesidade e Diabetes. IGF- I System. Carlos Cas(lho de Barros Bases Moleculares da Obesidade e Diabetes IGF- I System Carlos Cas(lho de Barros Visão Geral do Sistema IGF-I - É o maior mediador do crescimento intra uterino e pós natal - Receptor IGF- I crescimento

Leia mais

Mecanismos da divisão celular: Mitose e meiose. Professor Otaviano Netto

Mecanismos da divisão celular: Mitose e meiose. Professor Otaviano Netto Mecanismos da divisão celular: Mitose e meiose Professor Otaviano Netto CICLO CELULAR Eventos que preparam e realizam a divisão celular Mecanismos responsáveis pelo crescimento e desenvolvimento Células

Leia mais

19/04/2016. Profª. Drª. Andréa Fontes Garcia E -mail:

19/04/2016. Profª. Drª. Andréa Fontes Garcia E -mail: Profª. Drª. Andréa Fontes Garcia E -mail: andrea@salesiano-ata.br 1 A Obesidade Definida como doença crônica caracterizada pelo excesso de peso corporal Decorre na maior parte dos casos de um desequilíbrio

Leia mais

Hematopoiese. Aarestrup, F.M.

Hematopoiese. Aarestrup, F.M. Hematopoiese Stem cells - pluripotencial Baixa frequência -1/10 4 cels da M.O Proliferação e diferenciação - linhagens linfóide e mielóide (3.7 X 10 11 cels/dia) Cels do estroma M.O - hematopoietic-inducing

Leia mais

A nova grande promessa da inovação em fármacos:

A nova grande promessa da inovação em fármacos: A nova grande promessa da inovação em fármacos: RNA interferência saindo do laboratório para a clínica CARLOS Frederico Martins Menck Introdução Am o l é c u l a de RNA foi recentemente identificada como

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

Como diferentes células tronco adultas sabem seu destino celular? Diferentes tipos celulares mas sequência de DNA idêntica

Como diferentes células tronco adultas sabem seu destino celular? Diferentes tipos celulares mas sequência de DNA idêntica Epigenética Como diferentes células tronco adultas sabem seu destino celular? Diferentes tipos celulares mas sequência de DNA idêntica Como organismos geneticamente idênticos podem apresentar diferentes

Leia mais

Iniciação. Angiogênese. Metástase

Iniciação. Angiogênese. Metástase Imunidade contra tumores Câncer Cancro, tumor, neoplasia, carcinoma Características: Capacidade de proliferação Capacidade de invasão dos tecidos Capacidade de evasão da resposta imune Câncer Transformação

Leia mais

Apostila de Biologia 03 Ciclo Celular Matheus Borges

Apostila de Biologia 03 Ciclo Celular Matheus Borges Apostila de Biologia 03 Ciclo Celular Matheus Borges 1.0 Interfase 1.1 G1 Dividida em 3 fases G1,S e G2 ; replicação do DNA e transcrição gênica. Cromatina simples. Cromossomos não são visíveis descondensados.

Leia mais

MicroRNAs: Novos Biomarcadores para Cancro da Próstata

MicroRNAs: Novos Biomarcadores para Cancro da Próstata MicroRNAs: Novos Biomarcadores para Cancro da Próstata Ana Luísa Teixeira 1,2*, Joana Silva 1,2*, Rui Medeiros 1,2 1 Grupo de Oncologia Molecular- CI, Instituto Português de Oncologia do Porto FG, EPE

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Biologia Molecular. Volume 3 - Módulos 3 e 4. Gonçalo A. de Souza Filho Jacyara M. B. Macedo. Apoio:

Biologia Molecular. Volume 3 - Módulos 3 e 4. Gonçalo A. de Souza Filho Jacyara M. B. Macedo. Apoio: Biologia Molecular Volume 3 - Módulos 3 e 4 Gonçalo A. de Souza Filho Jacyara M. B. Macedo Apoio: Fundação Cecierj / Consórcio Cederj Rua Visconde de Niterói, 1364 Mangueira Rio de Janeiro, RJ CEP 20943-001

Leia mais

Prof. Juliana -

Prof. Juliana - Mitose e Meiose CICLO CELULAR Célula encaminhada à progressão no ciclo por mecanismos de regulação relacionados a crescimento multiplicação diferenciação celular condição de latência. Falhas nos mecanismos

Leia mais

Bases ecológicas da resistência bacteriana às drogas

Bases ecológicas da resistência bacteriana às drogas Bases ecológicas da resistência bacteriana às drogas Drogas antimicrobianas: mecanismo de ação Um aspecto do controle do crescimento dos microrganismos envolve a utilização de fármacos no tratamento de

Leia mais

Biologia Luiz Segundo

Biologia Luiz Segundo Biologia Luiz Segundo TEXTO PARA A PRÓXIMA QUESTÃO: Desde que médicos começaram a solicitar regularmente exames de tomografia computadorizada, cientistas se preocupam que o procedimento de imageamento

Leia mais