FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE Programa de Pós-Graduação em Biologia Experimental

Tamanho: px
Começar a partir da página:

Download "FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE Programa de Pós-Graduação em Biologia Experimental"

Transcrição

1 FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE Programa de Pós-Graduação em Biologia Experimental ESTUDO DA EXPRESSÃO GÊNICA DE MEDIADORES ENVOLVIDOS NA INIBIÇÃO DA PROLIFERAÇÃO DE MONONUCLEARES DO SANGUE PERIFERICO HUMANOS INDUZIDA PELA LECTINA BjcuL ISOLADA DO VENENO DE Bothrops jararacussu ONÁSSIS BOERI DE CASTRO PORTO VELHO/ RO 2013

2 1 FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE Programa de Pós-Graduação em Biologia Experimental ESTUDO DA EXPRESSÃO GÊNICA DE MEDIADORES ENVOLVIDOS NA INIBIÇÃO DA PROLIFERAÇÃO DE MONONUCLEARES DO SANGUE PERIFERICO HUMANOS INDUZIDA PELA LECTINA BjcuL ISOLADA DO VENENO DE Bothrops jararacussu Dissertação apresentada ao programa de Pós- Graduação em Biologia Experimental da Univerdidade Federal de Rondônia como requisito para obtenção do título de Mestre em Biologia Experimental. ÁREA DE CONCENTRAÇÃO: Imunofarmacologia ORIENTADOR (a): Profª. Drª. Juliana Pavan Zuliani PORTO VELHO/ RO 2013

3 2 FICHA CATALOGRÁFICA BIBLIOTECA PROF. ROBERTO DUARTE PIRES C355e Castro, Onássis Boeri de. Estudo da expressão gênica de mediadores envolvidos na inibição da proliferação de mononucleares do sangue periférico humanos induzida pela lectina Bjcul isolada do veneno de Bothrops jararacussu. / Onássis Boeri de Castro. Porto Velho, Rondônia, f. Dissertação (Mestrado em Biologia Experimental) Núcleo de Saúde (NUSAU), Programa de Pós-Graduação em Biologia Experimental, Fundação Universidade Federal de Rondônia, Porto Velho, Orientadora: Profª. Drª. Juliana Pavan Zuliani. 1. Lectina. 2. BjcuL. 3. PBMCs. 4. Proliferação. 5. Citocinas. I. Título. CDU: Bibliotecária Responsável: Eliane Gemaque / CRB

4 3 ONÁSSIS BOERI DE CASTRO ESTUDO DA EXPRESSÃO GÊNICA DE MEDIADORES ENVOLVIDOS NA INIBIÇÃO DA PROLIFERAÇÃO DE MONONUCLEARES DO SANGUE PERIFERICO HUMANOS INDUZIDA PELA LECTINA BjcuL ISOLADA DO VENENO DE Bothrops jararacussu Dissertação elaborada como parte dos requisitos necessários à obtenção do grau de Mestre em Biologia Experimental apresentada ao Programa de Pós-Graduação em Biologia Experimental PPGBIOEXP/ UNIR. Comissão Examinadora Drª Juliana Pavan Zuliani Examinador 1 Drª Carla Freire Celedonio Fernandes Examinador 2 Drª Giselle Martins Gonçalves Examinador 3 Data : / / Resultado:

5 4 AGRADECIMENTOS Agradeço a Deus, que me deu condições de chegar ao fim deste trabalho. Agradeço à Profª. Drª. Juliana Zuliani pelos conhecimentos transmitidos, pela simplicidade, paciência, amizade, confiança, orientação e oportunidade para realização deste trabalho. A Profª. Drª. Carla Fernandes A todos os meus Professores do PPGBIOEXP/UNIR. Agradeço aos meus amigos do laboratório, Carol, Kayano, Soraia, Weverson, Faby, Lilian, Nidiane e Neriane pelo apoio, companheirismo e amizade. As minhas amigas Adriana e Sulamita. A minha amiga Carina. Aos colegas do mestrado. A todos os funcionários do IPEPATRO. Aos meus familiares, especialmente aos meus pais e irmãos. A todos que de forma direta ou indireta vieram a ajudar na realização deste trabalho. Ao Conselho Nacional de Pesquisa e Desenvolvimento (CNPq) pelo auxilio financeiro..

6 5 SUMÁRIO RESUMO ABSTRACT LISTA DE FIGURAS LISTA DE ABREVIATURAS E SIGLAS 1. INTRODUÇÃO Lectinas Considerações sobre a resposta inflamatória e a ativação leucocitária Citocinas OBJETIVOS Objetivo Geral Objetivos Específicos MATERIAL E MÉTODOS Lectina Considerações de éticas Isolamento de mononucleares de sangue periférico humano Imunofenotipagem Determinação da viabilidade celular por redução do MTT Teste de proliferação celular por redução do MTT Determinação da produção do ânion superóxido Determinação da produção de peróxido de hidrogênio Determinação da produção de óxido nítrico (NO) Quantificação da concentração de PGE 2 por EIA Determinação da produção de citocinas por EIA... 28

7 Determinação da expressão gênica de IL-10, TGF-β, IL-12, IFN-γ, TNF-α, COX-1, COX-2 e GAPDH por RT-PCR Análise estatística RESULTADOS Obtenção de PBMCs humanos Validação do método de isolamento de PBMCs por Imunofenotipagem Viabilidade celular por redução do MTT Proliferação celular Determinação da produção do ânion superóxido Determinação da produção de peróxido de hidrogênio Determinação da produção de óxido nítrico (NO) Quantificação da concentração de PGE Produção de citocinas DISCUSSÃO CONCLUSÃO REFERÊNCIAS... 50

8 7 RESUMO As lectinas compreendem um grupo de proteínas sem atividade enzimática, capazes de se ligar de maneira específica, reversível e não covalente a carboidratos. A adesão destas lectinas aos glicoconjugados localizados nas membranas biológicas lhes conferem a propriedade de aglutinar eritrócitos, células normais e tumorais, assim como microrganismos. Desse modo, o estudo das lectinas devido à sua alta especificidade de ligação a carboidratos, é uma importante ferramenta de bioprospecção. Em contraste a maioria das lectinas, a BjcuL, uma lectina isolada do veneno de Bothrops jararacussu, demonstrou que inibe a proliferação de células mononucleares do sangue periférico (PBMCs) humanos. Neste trabalho, avaliou-se o mecanismo de inibição da proliferação de PBMCs por meio do perfil de expressão gênica e de produção de mediadores inflamatórios estimulados pela BjcuL. A BjcuL não apresentou toxicidade sobre os PBMCs após 96 horas de incubação. Nas concentrações estudadas, a proteína estimulou a produção do ânion superóxido e peróxido de hidrogênio. Com relação à produção de óxido nítrico, a lectina foi capaz de reduzir os níveis de estimulação dos PBMCs por LPS após 96 horas de incubação. Os níveis de RNAm das enzimas COX-1 e COX-2 não apresentaram mudanças significativas se comparadas ao controle, assim como não houve a produção de PGE 2 no tempo de 3 horas. Os níveis da expressão de RNAm e da produção proteica de TGF-β, IL-12, IFN-γ, TNF-α, IL-2, IL-4 e IL-17 dos PBMCs incubados com BjcuL não apresentaram mudanças significativas se comparadas ao controle. Enquanto que os níveis da expressão de RNAm e da produção proteica da IL- 10 apresentaram um aumento considerável no nível de expressão gênica no tempo de 6 horas, compatível com a produção proteica no tempo de 12 horas. Em conjunto, os dados permitem concluir que a BjcuL inibe a proliferação de linfócitos por um mecanismo que depende de IL-10. Palavras-chave: Lectina, BjcuL, PBMCs, proliferação, citocinas.

9 8 ABSTRACT Lectins comprise a group of proteins without enzymatic activity, able to bind in a specific way, reversible and non-covalent to carbohydrates. Adherence to these lectins glycoconjugates located in biological membranes impart the property of agglutinating erythrocytes, normal and tumor cells as well as microorganisms. Thus, the study of lectins due to its high carbohydrate binding specificity is an important tool for bioprospection. In contrast to most lectins, the BJcuL, a lectin isolated from Bothrops jararacussu venom showed that this protein inhibits proliferation of human peripheral blood mononuclear cells (PBMCs). In this study, we evaluated the mechanism of inhibition of PBMCs proliferation by the gene expression profile and the production of inflammatory mediators stimulated by BJcuL. The BJcuL showed no toxicity on PBMCs after 96 hours of incubation. At the concentrations studied, the protein stimulated the production of superoxide anion and hydrogen peroxide. With respect to the production of nitric oxide, the lectin was able to reduce the levels of LPS stimulation of PBMCs after 96 hours of incubation. MRNA levels of COX-1 and COX- 2 showed no significant change compared to the control, and no PGE 2 production in time of 3 hours. The expression levels of mrna and protein production of TGF-β, IL- 12, IFN-γ, TNF-α, IL-2, IL-4 and IL-17 from PBMCs incubated with BJcuL no significant changes as compared to control. While the expression levels of mrna and protein production of IL-10 showed a significant increase in the level of gene expression at 6 hours time, consistent with the protein production in time of 12 hours. Together, these data allow to conclude that BJcuL inhibits proliferation of lymphocytes by a mechanism that is dependent on IL-10. Keywords: Lectin, BJcuL, PBMCs, proliferation, inflammation, cytokines.

10 9 LISTA DE FIGURAS Figura 1: Purificação da BjcuL Figura 2: SDS-PAGE (12,5%) de lectina do veneno de Bothrops jararacussu Figura 3: Determinação da massa molecular da BjcuL Figura 4: Capacidade hemaglutinante da BjcuL e inibição da hemaglutinação Figura 5: Preparação de lâmina em citocentrífuga Figura 6: Imunofenotipagem de PBMCs humanos Figura 7: Efeito da BjcuL de Bothrops jararacussu sobre a viabilidade de PBMCs Figura 8: Proliferação de PBMCs Figura 9: Efeito da BjcuL sobre a produção de superóxido em PBMCs Figura 10: Perfil de produção de peróxido de hidrogênio por PBMCs Figura 11: Perfil de produção de óxido nítrico por PBMCs Figura 12: Perfil de produção de PGE2 e expressão gênica de COX-1 e COX-2 por PBMCs Figura 13: Perfil de produção das citocinas IL-10 e TNF-α por PBMCs Figura 14 - Perfil de produção das citocinas IFN-γ e TGF-β por PBMCs Figura 15: Perfil de produção de citocinas por PBMCs... 45

11 10 LISTA DE ABREVIATURAS E SIGLAS BjcuL - Lectina isolada de Bothrops jararacussu Con-A - Concanavalina A COX - Ciclooxigenase DMSO - Dimetil sulfóxido IL-10 - Interleucina 10 IL-12 - Interleucina 12 IL-17 - Interleucina 17 IL-2 - Interleucina 2 IL-4 - Interleucina 4 INF-γ - Interferon-γ KOH - Hidróxido de potássio LPS - Lipopolissacarídeo MTT - Brometo de azul de Tetrazólio NBT - Azul de nitrotetrazólio NO - Óxido nítrico PBMC - Mononucleares de sangue periférico humano PBS - Solução salina tamponada em fosfato PGE 2 - Prostaglandina E 2 PMA - Acetato de forbol miristato SFB - Soro Fetal Bovino TGF-β - Fator de crescimento transformador-β TMB - Tetrametilbenzidina TNF-α - Fator de necrose tumoral-α

12 11 1. INTRODUÇÃO 1.1 Lectinas As lectinas são glicoproteínas com habilidade de se ligarem de maneira específica, reversível e de forma não covalente a carboidratos (DRICKAMER e TAYLOR, 1993; SINGH et al., 1999). Por não transformarem o carboidrato ligante não são consideradas enzimas (ZELENSKY & GREADY, 2005). Estas proteínas estão presentes em plantas, animais e em vários outros organismos (SHARON, 1993; LORIS, 2002; LAKHTIN et al., 2009; LAKHTIN et al., 2011). Em animais, essas proteínas estão envolvidas no reconhecimento, adesão e tráfego celular (KALTNER e STIERSTORFER, 1998; LINEHAN et al., 2000; KALTNER e GABIUS, 2001; KILPATRICK, 2002). As lectinas possuem uma ou mais regiões moleculares ligantes a carboidratos (SINGH et al., 1999). A região molecular das lectinas que interage com o carboidrato, caracterizada como um domínio que reconhece a seqüência específica de resíduos de açúcar é denominada de Domínio de Reconhecimento de Carboidrato CRD (do inglês Carbohydrate Recognition Domain) e está presente em cada subunidade da lectina (DRICKAMER, 1993, 1996; ZELENSKY & GREADY, 2005). O grande número de lectinas identificadas e a grande variabilidade em sua estrutura, propriedades e distribuição refletem uma ampla gama de adaptações das lectinas aos mais diferentes fenômenos biológicos (SINGH et al., 1999; SELL e COSTA, 2000). As ligações das lectinas aos glicoconjugados localizados nas membranas biológicas lhes conferem a propriedade de aglutinar eritrócitos, células normais e tumorais, assim como microrganismos (HART, 1980; SHARON e LIS, 1993; STRATHMANN et al., 2002; NAKAHARA e RAZ, 2008; DAI et al., 2009; NUNES et al., 2012). Dessa forma, a especificidade de lectinas por certos carboidratos tem permitido seu uso para detectar e estudar células com carboidratos superficiais como glicoproteínas, imunoglobulinas e para identificar células cancerígenas (SINGH et al., 1999; RÜDIGER et al., 2000; ABBOTT e PIERCE, 2010; CLARK e MAO, 2012). Segundo Drickamer (1995), Kaltner e Gabius (2001) e Clemetson et al. (2009) as lectinas animais podem ser divididas em cinco grupos: (i) As lectinas tipo-c, que requerem íons Ca 2+ para sua atividade de ligação a carboidratos e apresentam

13 12 solubilidade variável, estando localizadas principalmente no meio extracelular e possuindo resíduos de cisteínas ligados formando pontes dissulfeto. (ii) As lectinas tipo- S, também conhecidas como galectinas, são solúveis e apresentam atividade independente de Ca 2+ além de possuírem grupos tióis livres. (iii) As lectinas tipo-i, são um grupo de lectinas que desempenham funções no sistema imune. Estão nesta categoria lectinas que se ligam ao ácido siálico, de maneira independente de Ca 2+ e que, estruturalmente, pertencem à superfamília das imunoglobulinas. (iv) As lectinas tipo-p, são um grupo de lectinas que inclui somente dois membros, com massa molecular de 46 e 300 kda ligantes de glicoproteínas contendo manose-6-fosfato. (v) As lectinas tipo-l, relacionadas em sequência com as lectinas de plantas leguminosas. As lectinas do tipo-c (colectinas, selectinas, receptores de manose, entre outros) interagem com resíduos de carboidrato de modo dependente de íon cálcio. Nesse sistema, o íon cálcio está diretamente envolvido na interação, bem como na manutenção da integridade estrutural do CRD, necessária para a atividade da lectina (WEIS et al., 1998; LINEHAN et al., 2000; ARLINGHAUS e EBLE, 2012; WANG et al., 2013). As lectinas tipo-c podem reconhecer oligossacarídeos, tanto de membranas celulares, quanto ligados a proteínas circulantes ou à matriz extracelular. A adesão destas lectinas aos açúcares específicos medeia vários eventos biológicos, como adesão célula-célula, renovação (turnover), indução de mitose e proliferação, apoptose ou respostas imunes inatas contra diversos patógenos (LINEHAN et al., 2000; KILPATRICK, 2002; GOLIAS et al., 2011; PILLAI et al., 2012). As lectinas tipo-c possuem um enovelamento característico do grupo e domínios de ligação a carboidratos bastante conservados. Entretanto, um grande número de proteínas, apresenta estes domínios, porém, não apresentam a capacidade de se ligar a carboidratos, não possuindo assim o clássico loop ligante de açúcar e cálcio. Tal grupo de proteínas, importantes componentes hemorrágicos do veneno de serpentes, é designado como lectinas tipo-c like ou lectina tipo-c símile. Este segundo grupo de lectinas tipo-c, está envolvido na ligação de muitos receptores e proteínas fisiologicamente importantes (DRICKAMER e TAYLOR, 1993; WEIS et al., 1998; ZELENSKY e GREADY, 2005; OGAWA et al., 2005; ARLINGHAUS e EBLE, 2012). As lectinas isoladas de venenos de serpentes incluem-se no grupo das lectinas tipo-c e lectinas tipo C like (CLEMETSON et al., 2009). Foram encontradas em venenos de serpentes pertencentes às famílias Viperidae, Elapidae e Crotalidae (ARAGÓN-ORTIZ et al., 1990). São compostas por subunidades idênticas, altamente

14 13 conservadas, com até 96% de homologia, dimerizadas ou oligomerizadas, ligadas por uma ponte dissulfeto na posição 86 (HIRABAYASHI et al., 1991; GUIMARÃES- GOMES et al., 2004; MORITA, 2005). Essas lectinas são constituídas de aproximadamente 130 resíduos de aminoácidos, massa molecular em torno de 14 kda por subunidade, são solúveis e específicas para açúcares com β-galactosídeos e requerem Ca 2+ para sua atividade (CARVALHO, 1998; KOMORIS et al., 1999; GUIMARÃES-GOMES et al., 2004). O estudo das lectinas devido à sua alta especificidade de ligação a carboidratos é uma importante ferramenta de bioprospecção (MARSH, 2001; PAL et al., 2002; KOH et al., 2006; WU et al. 2009; ABBOTT e PIERCE, 2010; DIESNER et al., 2012). Assim, a participação das lectinas em diversos estudos objetivando estabelecer as relações entre estas e processos de reconhecimento e sinalização celular, infecções parasitárias, bacterianas e virais, crescimento e diferenciação celular e neoplasias, dentre outros, está cada vez mais evidente na literatura (SELISTRE-DE-ARAUJO et al., 2005; ELIFIO- ESPOSITO et al., 2011; NUNES et al., 2011; NUNES et al., 2012; NOLTE et al., 2012). Interações de lectinas com glicoconjugados presentes na superfície de células do sistema imune podem induzir a uma ativação celular, com alterações no padrão de secreções de citocinas (CHANG et al., 2010). Muitos efeitos biológicos de lectinas de venenos de serpentes têm sido relatados, como atividade mitogênica sobre linfócitos, agregação plaquetárias e indução de edema, indução de inflamação e citotoxicidade (LOMONTE et al., 1990; PEREIRA- BITTENCOURT, 1999; CARVALHO et al., 2001; CLEMETSON, 2010; NOLTE et al., 2012; CASTANHEIRA et al, 2012). Entretanto, sua participação no processo de envenenamento permanece ainda desconhecida, uma vez que envenenamento de serpentes é considerado uma doença negligenciada, carecendo de trabalhos investigativos mais aprofundados. 1.2 Considerações sobre a resposta inflamatória e a ativação leucocitária A inflamação é uma reação fisiológica complexa a vários agentes nocivos (físicos, químicos ou biológicos), consistindo de respostas vasculares, migração e ativação de leucócitos e reações sistêmicas (RYAN e MAJNO, 1977; MAŚLIŃSKA e GAJEWSKI, 1998; RANKIN, 2004). A inflamação tem como objetivo principal

15 14 recompor a homeostase do tecido lesado, estando assim, ligada ao processo de reparo tecidual (SERHAN e SAVILL, 2007; VAN DYKE e KORNMAN, 2008; BARREIRO et al., 2010). Durante o processo inflamatório agudo pode-se observar três eventos principais: (i) alterações do calibre das arteríolas, capilares e vênulas, que levam a um aumento do fluxo sanguíneo; (ii) alterações estruturais na microcirculação, resultando em exsudação de líquido, incluindo proteínas plasmáticas como albumina, fatores do complemento e anticorpos e (iii) migração de leucócitos do espaço extravascular para o foco inflamatório. Esses eventos caracterizam os sinais clássicos da inflamação: rubor, calor, tumor, dor e perda da função (RYAN e MAJNO, 1977; RANKIN, 2004; KADL e LEITINGER, 2005; PATE et al., 2010). Muitos tecidos e células estão envolvidos na resposta inflamatória. As células circulantes incluem neutrófilos, monócitos, eosinófilos, linfócitos, basófilos e plaquetas, enquanto que os componentes celulares do tecido conjuntivo incluem os mastócitos, fibroblastos e os macrófagos locais (SPRINGER et al., 1995; WONG et al., 2010; GARCIA e DEL BRUTTO, 2012). Várias células, como os mastócitos podem iniciar a cascata de eventos dos processos inflamatórios. O estímulo inflamatório induz a formação e a liberação de substâncias farmacologicamente ativas, capazes de gerar mudanças na morfologia e integridade das células endoteliais. Estes mediadores químicos da inflamação, como histamina, cininas e algumas citocinas, promovem alterações no fluxo sanguíneo e na permeabilidade vascular, além de estimularem a marginação, diapedese e migração leucocitária (DEVREOTES e ZIGMOND, 1988; MILLER e KRANGEL, 1992; GRANGER e KUBES, 1994; RANKIN, 2004; PATE et al., 2010). Uma das principais funções da inflamação é recrutar os leucócitos diretamente ao local da injúria (FORD-HUTCHINSON, 1992; SPRINGER et al., 1995; BARREIRO e SÁNCHEZ-MADRID, 2009). Diversas classes de receptores na superfície celular dos leucócitos reconhecem estímulos diferentes, como microrganismos, complexos antígeno-anticorpo e citocinas, incluindo os fatores quimiotáticos (LINEHAN et al., 2000; HAYASHI et al., 2011). A interação com esses receptores iniciam respostas conhecidas como ativação leucocitária. A ativação leucocitária resulta de várias vias de sinalização iniciadas nos leucócitos, gerando um aumento na concentração de Ca +2 no citosol e na ativação de enzimas como a proteína-quinase C (PKC) e a fosfolipase A 2 (FLA 2 ). Os resultados funcionais da ativação leucocitária incluem a produção de

16 15 metabólitos do ácido araquidônico a partir da hidrólise de fosfolipídios de membrana celular, resultante da ativação da FLA 2 pelo aumento do cálcio intracelular; a ativação da explosão oxidativa (burst respiratório); e a secreção de citocinas, o que amplifica e regula as reações inflamatórias (FANTONE e WARD, 1982; ROCCA e FITZGERALD, 2002; NAKAMURA et al., 2003). Os metabólitos do ácido araquidônico, ou eicosanóides, são produtos de oxigenação de ácidos graxos poliinsaturados de cadeia longa. O ácido araquidônico é um ácido graxo de 20 carbonos (C20), que contém quatro ligações duplas a partir da posição ômega-6, produzindo um ácido 5,8,11,14-eicosatetraenóico (designado C20:4-6). Para que ocorra a síntese de eicosanóides, o araquidonato deve ser inicialmente liberado ou mobilizado de fosfolipídios da membrana por uma ou mais lipases do tipo FLA 2. Após a liberação, o ácido araquidônico pode ser metabolizado por duas classes de enzimas: as ciclooxigenases (COX) e as lipoxigenases. A via da ciclooxigenase, iniciada por duas enzimas diferentes (a COX-1, constitutivamente expressa, e a COX-2, uma enzima induzida), leva à geração de prostaglandinas e tromboxano. As mais importantes na inflamação são a PGE 2, PGD 2, PGF 2, PGI 2 (prostaciclina) e TXA 2 (tromboxano). A prostaciclina é um vasodilatador e um importante inibidor da agregação plaquetárias, enquanto o TXA 2 é um potente indutor da agregação plaquetária e vasoconstritor. Na via da lipoxigenase, o metabolismo do ácido araquidônico pelas 5-, 12- e 15-lipoxigenases resulta na produção de derivados hidróxi (HETE) e leucotrienos. Os leucotrienos são produzidos pela 5-lipoxigenase presente nas células inflamatórias (PMN, mastócitos e macrófagos). Essa via é de grande interesse, visto que está associada a condições inflamatórias como a asma e ao choque anafilático (DAVIES et al., 1984; BAUMANN e GAUDIE, 1994; NAKAMURA et al., 2003). Além da produção de eicosanóides, os leucócitos ativados aumentam o metabolismo oxidativo através da conversão do oxigênio molecular em intermediários reativos do oxigênio, processo chamado de burst respiratório. A geração das espécies reativas de oxigênio ocorre através da ativação de uma oxidase (NADPH oxidase) que reduz o oxigênio, formando o ânion superóxido (O - 2 ). O ânion superóxido é convertido em peróxido de hidrogênio (H 2 O 2 ), principalmente por dismutação espontânea. O H 2 O 2 pode ainda formar o radical hidroxila (OH), altamente reativo (BABIOR, 1984; BAUMANN e GAUDIE, 1994; FUJIWARA e KOBAYASHI, 2005; RUTKOWSKI et al., 2007; MANEA, 2010).

17 16 Juntamente com os derivados reativos do oxigênio, os leucócitos ativados podem produzir intermediários reativos do nitrogênio, principalmente o óxido nítrico (NO), uma molécula gasosa altamente reativa. O NO é sintetizado a partir da L-arginina por uma família de enzimas coletivamente denominadas óxido nítrico sintases NOS (EC ). Foram identificadas três isoformas de NOS, sendo duas constitutivas em determinadas células (cnos) e, uma induzível (inos). Todas as três isoenzimas são semelhantes estruturamente, porém reguladas de modo diverso e induzidas a partir de genes localizados nos cromossomos 7 (isoforma I), 12 (isoforma II) e 17 (isoforma III). A cnos ou isoforma I está presente no cérebro e pode também ser chamada de bnos ou nnos. A inos ou isoforma II não é expressa constitutivamente, sendo induzida nos macrófagos e, em outros leucócitos, por LPS ou citocinas. A enos ou isoforma III é expressa constitutivamente nas células endoteliais. O NO atua como um importante segundo mensageiro nos mamíferos superiores, além disso, o óxido nítrico pode interagir com o ânion superóxido (O 2 ) e formar um potente agente oxidante, o ânion peroxinitrito (ONOO ), mais tóxico que os seus precursores (FORSTERMANN et al., 1995; ROBBINS e GRISHAM, 1997; FILHO e ZILBERSTEIN, 2000; DREW e LEEUWENBURGH, 2002; RUTKOWSKI et al., 2007; PLEKHOVA e SOMOVA, 2012). Possuindo um importante papel nas respostas funcionais induzidas na ativação dos leucócitos, as citocinas medeiam e regulam as reações inflamatórias e imunológicas (VAN DER MEIDE e SCHELLEKENS, 1996). São moléculas protéicas ou glicoprotéicas secretadas por células tanto da imunidade inata quanto adquirida. As citocinas podem ser divididas em duas categorias: as relacionadas com a imunidade inata e as com ações biológicas na imunidade adquirida. As citocinas associadas à resposta imune inata são: TNF-α, IL-1, IL-12 e IFN-γ. Elas são produzidas principalmente por leucócitos mononucleares em resposta a agentes infecciosos. As citocinas mediadoras e reguladoras da imunidade específica são: IL-2, IL-4, IL-5 e IFNγ. Elas são produzidas principalmente por linfócitos T, em resposta ao reconhecimento específico de antígenos estranhos (BAUMANN e GAUDIE, 1994; NEWTON e DIXIT, 2012). Cabe ressaltar que a resposta inflamatória está intimamente ligada ao processo de envenenamento ofídico (GUTIÉRREZ e LOMONTE, 1995; GUTIÉRREZ, 2009). O mecanismo do dano tecidual local provocado pelo envenenamento ofídico também envolve a ativação de uma resposta imunológica. Os leucócitos ativados liberam um

18 17 amplo espectro de mediadores, no qual as citocinas desempenham papéis inflamatórios e imunológicos importantes (BARROS et al., 1998; RUCAVADO et al., 2002; ZAMUNER et al., 2005). Ademais, foi demonstrado que os venenos botrópicos induzem a liberação de mediadores inflamatórios, como a IL-6 e TNF-α e mediadores lipídicos como a PGE 2, TXA 2 e LTB 4 (ZAMUNER e TEIXEIRA, 2002; ZAMUNER et al., 2001; 2005; OLIVO et al., 2007). As respostas celulares para a maioria das citocinas consistem em alterações na expressão gênica em células-alvo, resultando na indução ou inibição de genes relacionados a regulação da proliferação e diferenciação leucocitária ou a ativação de células efetoras ou inflamatórias (BALKWILL e BURKE, 1989; NEWTON e DIXIT, 2012). Dessa forma, torna-se necessário estudar o mecanismo molecular relacionado à inibição da proliferação dos PBMCs induzidas pela lectina no que se refere ao perfil da expressão gênica e de produção de citocinas assim como os mediadores inflamatórios envolvidas na função de leucócitos. 1.3 Citocinas As citocinas são polipeptídios de sinalização intercelular produzidos em resposta a estímulos inflamatórios ou antigênicos (BALKWILL e BURKE, 1989; VAN DER MEIDE e SCHELLEKENS, 1996). São proteínas (aproximadamente 8-80 kda de peso molecular) sintetizadas por vários tipos celulares como linfócitos e macrófagos ativados, além de células do endotélio, epitélio e do tecido conjuntivo (CASSATELLA, 1995; GARROOD et al., 2006; CHOI et al., 2008). As citocinas atuam modulando a função de outros tipos celulares. Elas fazem parte de uma rede de sinalização extracelular que regula importantes processos biológicos, como crescimento e diferenciação celular, ativação celular, inflamação, imunidade, reparo tecidual, fibrose e morfogênese (OPPENHEIM et al., 1986; PAUL e SEDER, 1994; MOLDAWER, 1994; MUKAIDA, 2000; KIM, 2004; PAOLETTI et al., 2005 MORTIER et al., 2012; LIBBY, 2012). As citocinas podem agir localmente, de modo autócrino ou parácrino, ou quando produzidas em grandes quantidades, exercerem ações endócrinas. Além disso, freqüentemente, as citocinas possuem ações pleiotrópicas, agindo em diferentes tipos celulares, e efeitos redundantes, visto que, múltiplas citocinas compartilham os mesmos efeitos funcionais. Constata-se ainda que algumas citocinas estimulam a produção de outras, levando a cascatas nas quais uma segunda ou terceira citocina pode mediar os

19 18 efeitos biológicos da primeira (NATHAN e SPORN, 1991; COHEN e COHEN, 1996; OPAL et al., 2000). Assim, duas citocinas podem antagonizar a ação uma da outra ou produzir efeitos sinergísticos, criando uma rede de citocinas (MOLDAWER, 1994; VORONOV et al., 1999). A ativação leucocitária através do reconhecimento de moléculas microbianas e outros antígenos pelos leucócitos (principais produtores de citocinas) resultam no desencadeamento de várias vias intracelulares que culminam na ativação de fatores de transcrição de genes de várias citocinas. Estas, geralmente não são armazenadas como moléculas pré-formadas, e sua síntese é iniciada por indução de novas transcrições de genes, como resultado da ativação celular (CYBULSKY et al., 1988; MIYAJIMA et al., 1992). As citocinas iniciam suas ações pela ligação a receptores de membrana específicos nas células-alvo. Os receptores de citocinas consistem em uma ou mais proteínas transmembrana cujas porções extracelulares são responsáveis pela ligação da citocina, e cujas porções citoplasmáticas são responsáveis por dar início às vias de sinalização intracelular (TAGA e KISHIOMOTO, 1995; MUÑOZ et al., 2012). A interação de uma citocina ao seu receptor apropriado estabelece uma cascata que leva à indução ou à inibição da transcrição de inúmeros genes. Isso ocorre por meio da ativação de quinases associadas aos domínios citoplasmáticos dos receptores, seguido da fosforilação de substratos em uma cadeia de sinalização intracelular que leva à ligação de diversos fatores de transcrição ao DNA (KISHIMOTO et al., 1994; KARNITZ e ABRAHAM, 1995; TAGA e KISHIOMOTO, 1995; NEWTON e DIXIT, 2012). Entre as citocinas que modulam e regulam a imunidade inata, o Fator de Necrose Tumoral (TNF) é o principal mediador da resposta inflamatória aguda a bactérias gramnegativas e outros microrganismos infecciosos. Esta citocina de 17 kda possui como principal fonte os macrófagos e os linfócitos. O TNF é dividido em TNF-α, normalmente produzida por macrófagos ativados, e TNF-β (linfotoxina LT), produzida principalmente por linfócitos T ativados por antígenos. O TNF-α é inicialmente sintetizado como uma proteína transmembrânica não-glicosilada de aproximadamente 25 kda com um peptídeo sinal. O TNF-α estimula o recrutamento de neutrófilos e monócitos para locais de infecção e ativa essas células para eliminar os patógenos. Atua no catabolismo (caquexia), na fibrose, e estimula o aumento da expressão de moléculas de adesão pelo endotélio vascular, além de induzir as células endoteliais e os macrófagos a secretarem quimiocinas (AKIRA et al., 1990; ADERKA et al., 1994; ARMITAGE,

20 ; BAZZONI e BEUTLER, 1996; POPA et al., 2007; PARAMESWARAN e PATIAL, 2010; SETHU e MELENDEZ, 2011; AGGARWAL et al., 2012). A IL-12 é uma citocina heterodimérica de 70 kda, formada a partir de duas cadeias ligadas covalentemente (p35 e p40), codificadas por dois genes separados. A IL- 12 promove a diferenciação de linfócitos T auxiliares CD4 + em células T H 1, prepara essas células para aumentar a produção de IFN-γ e aumenta a capacidade citolítica de células NK ativadas e linfócitos T citotóxicos (CTLs) CD8 +. A IL-12 é produzida principalmente pelos monócitos e macrófagos, células dendríticas e, em menor grau, por neutrófilos. A produção da IL-12 é regulada negativamente pela IL-10 e pelo TGF-β, e sua síntese é potencializada pelo IFN-γ (PAUL e SEDER, 1994; DEL VECCHIO et al., 2007; GEE et al., 2009; VIGNALI e KUCHROO, 2012). O IFN-γ é uma proteína homodimérica de 40 a 70 kda, contendo 143 aminoácidos. É codificado por um único gene mapeado no cromossomo 12. O IFN-γ é produzido pelos linfócitos T H 1, células NK e células T CD8 +. Entre suas principais ações biológicas estão o aumento da ação microbicida dos macrófagos estimulando a síntese de intermediários reativos do oxigênio e do óxido nítrico; a estimulação da expressão de MHC-I e II e co-estimuladores em APCs; e o estímulo aos macrófagos a produzirem IL-12 que induz os linfócitos TCD4 + a se diferenciarem em T H 1 (DIJKMANS e BILLIAU, 1988; PAUL e SEDER, 1994; FRUCHT et al., 2001; YOUNG e BREAM, 2007). Entre as citocinas que atuam na imunidade adquirida, a IL-2 exerce um papel fundamental como fator de crescimento (expansão clonal) para linfócitos T estimulados por antígenos. A IL-2 é uma glicoproteína de 133 aminoácidos e 15,5 kda. Os genes que codificam a IL-2 foram mapeados no cromossomo 4. Além de estimular a proliferação dos linfócitos T específicos, a IL-2, estimula a proliferação de células NK e aumenta sua ação citolítica (BAZAN, 1990; SAD e MOSMANN, 1995; GOLLOB et al., 1996; PAUL e SEDER, 1994; BANCHEREAU et al., 2012). A IL-4 é uma proteína complexa, contendo numerosas ligações dissulfeto intramoleculares e múltiplos pontos de glicosilação, e seu gene foi mapeado no cromossomo 5. A produção da IL-4 é rigorosamente controlada e está restrita a linfócitos T H 2, mastócitos e basófilos ativados. Entre suas ações biológicas, a IL-4 estimula a produção de IgE e estimula a diferenciação de células T auxiliares virgens em T H 2 (PAUL e SEDER, 1994; SAD e MOSMANN, 1995; GOLLOB et al., 1996;

21 20 MAEDA e YANAGIHARA, 2001; KELLY-WELCH et al., 2005; LUZINA et al., 2012). A citocina IL-10 é uma proteína de 160 aminoácidos, com uma massa molecular de 18,5 kda, contendo quatro resíduos de cisteína e duas pontes dissulfeto que mantêm sua estrutura helicoidal e atividade biológica. O gene da IL-10 foi mapeado no cromossomo 1. Os monócitos são as células que mais produzem IL-10 na maioria das condições inflamatórias. A IL-10 atua inibindo a produção das citocinas próinflamatórias como a IL-1, IL-3, IL-8 e quimiocinas, por suprimir a transcrição de seus genes correspondentes. A IL-10 também suprime a liberação dos radicais livres do oxigênio e inibe a atividade microbicida dependente do óxido nítrico nos macrófagos (PAUL e SEDER, 1994; GOLLOB et al., 1996; ZDANOV, 2004; PLETNEV et al., 2005; ZDANOV, 2010). A IL-17 é uma citocina pró-inflamatória de 32 kda possuindo como principal fonte células T H 17 efetoras. O gene que codifica essa citocina foi mapeado no cromossomo 2 e sua expressão parece ser rigorosamente controlada. A IL-17 atua estimulando a produção de quimiocinas e citocinas em células endoteliais, macrófagos e fibroblastos, possuindo assim um papel importante nas respostas de defesa do hospedeiro contra as invasões microbianas, assim como nas patogêneses das doenças autoimunes e síndromes alérgicas (KORN et al., 2009; SONG e QIAN, 2013). O Fator de Crescimento Transformador-β (TGF-β) atua no sistema imunológico inibindo a proliferação e ativação de linfócitos e outros leucócitos, como os macrófagos, em grande parte por contrapor-se aos efeitos das citocinas pró-inflamatórias. Entretanto, o TGF- β é capaz de exercer efeitos pró-inflamatórios, dependendo da cronologia do seu aparecimento e da quantidade produzida. O TGF-β também promove a síntese de proteínas da matriz extracelular, promovendo o reparo após reações imunes e inflamatórias (MASSAGUÉ, 2012; HAN et al., 2012). Os componentes dos venenos de serpentes, substâncias biologicamente ativas, podem estimular a síntese de citocinas pelas células teciduais e leucocitárias do tecido injuriado (BARRAVIERA et al., 1995; CLISSA et al., 2001; FERNANDES et al,. 2006). Essa indução é resultado da ativação de fatores de transcrição e consequente expressão gênica de citocinas, como resultado da ativação celular (BALKWILL e BURKE, 1989; NEWTON e DIXIT, 2012). As lectinas de serpentes podem induzir a mitogênese em leucócitos humanos (HEMBOLD et al., 1986). Esse mecanismo pode estar associado à liberação de citocinas específicas, visto que, as citocinas podem agir no

22 21 controle da proliferação e diferenciação celular através da ativação de genes específicos por várias vias de sinalização intracelular (BLACKWILL e BURKE, 1989; AKIRA et al., 1994). Dessa forma, é de suma importância o estudar a ação de lectinas isoladas de venenos de serpentes sobre a expressão gênica de citocinas em células leucocitárias humanas, objetivando compreender esses mecanismos mitogênicos.

23 22 2. OBJETIVOS 2.1 Objetivo geral A presente proposta tem por objetivo geral avaliar o perfil da expressão gênica envolvido na inibição da proliferação celular e a produção de citocinas e de mediadores inflamatórios estimuladas pela BjcuL em PBMCs humanos. 2.2 Objetivos específicos Avaliar a viabilidade celular por redução de MTT em PBMCs humanos induzidos pela BjcuL; Avaliar a proliferação celular por redução de MTT em PBMCs humanos induzidos pela BjcuL; Avaliar a expressão gênica e a produção de citocinas reguladoras da ativação e proliferação leucocitária, como a IL-2, IL-4, IL-10, IL-17 e TGF-β em PBMCs humanos isolados induzidos pela BjcuL; Avaliar a expressão gênica e a produção de citocinas ativadoras como a IL-12, TNF-α e IFN-γ em PBMCs humanos isolados pela BjcuL; Avaliar a produção de peróxido de hidrogênio, do ânion superóxido e de óxido nítrico em PBMCs humanos isolados induzidos pela BjcuL; Avaliar a produção de PGE 2 e a expressão gênica de COX-1 e COX-2 em PBMCs humanos isolados induzidos pela BjcuL; Relacionar a expressão de citocinas e outros mediadores produzidos com a inibição do efeito proliferativo sobre PBMCs humanos induzidos pela BjcuL.

24 23 3. MATERIAL E MÉTODOS As atividades desenvolvidas neste projeto foram realizadas nos laboratórios de Imunologia Celular, de Cultivo Celular e Engenharia de Anticorpos do Instituto de Pesquisas em Patologias Tropicais IPEPATRO/FIOCRUZ Rondônia e Centro de Estudos de Biomoléculas Aplicadas à Saúde CEBIO/UNIR Comissão de ética O presente projeto foi submetido à análise da comissão de ética em pesquisa do Centro de Pesquisas em Medicina Tropical CEPEM e aprovado sob o número 068/2008 CEP/CEPEM Veneno O veneno de Bothrops jararacussu desidratado, mantido sob-refrigeração a 4ºC, foi doado pelo Instituto Butantan - São Paulo, obtido a partir de um pool de vários exemplares adultos Isolamento e Purificação de lectina A lectina tipo C presente no veneno da serpente Bothrops jararacussu foi purificada utilizando protocolo baseado na afinidade apresentada por esta a resíduos de carboidratos, conforme descritos por Gartner & Ogilvie (1983), Guimarães Gomes et al., (2004) e Pereira-Bitencourt (1999). O veneno bruto (100mg) foi dissolvido em 500 µl de TBS (tampão tris-salina) 20 mm, ph 8,1 e centrifugado a rpm durante 15 minutos, a 25ºC, para remoção do material insolúvel. O sobrenadante foi aplicado em coluna contendo Sepharose 6B CL lactose (3cm X 1cm), previamente equilibrada com TBS 20 mm, contendo 5 mm de CaCl 2, ph 8,1; processada com fluxo de 1 ml/min e extensivamente lavada até que a absorbância medida a 280 nm retornasse aos níveis basais. A lectina, ligada à coluna, foi então eluída com lactose 100 mm dissolvido no mesmo tampão. A presença de lectina foi monitorada verificando-se a atividade hemaglutinante e pela absorbância medida a

25 nm. Sequencialmente, as proteínas foram separadas dos demais componentes presentes no tampão, através de cromatografia de exclusão molecular, utilizando-se uma coluna de Sephadex G25 (Sigma Aldrich Inc.- USA, 5cm X 1cm) e eluída com água, reunindo-se as frações que apresentaram atividade hemaglutinante. O material foi liofilizado e armazenado a -20ºC até o momento do uso. O grau de pureza foi verificado em Cromatografia Líquida de Alta Eficiência, aplicando-se 5µg da amostra purificada em coluna de fase reversa C18 (Supelco USA, 25 X 4,6mm), com gradiente linear progressivo de 0 a 100% de acetonitrila (Carlo Erba - França) contendo 0,1% de TFA (ácido tri-fluoracético) (Vetec Quim.Fina Ltda - Brasil) e fluxo de 0,5mL/minuto. A detecção de proteína foi realizada pela medição da absorbância a 280nm. Para remoção de lipopolissacarideos, as amostras foram submetidas a cromatografia em coluna de Agarose-Polimixina B (Sigma Aldrich Inc.- USA, 3cm x 1cm), eluídas com PBS apirogênico e filtradas em filtros com poros de 0,22um imediatamente antes do uso. 3.4 Quantificação de Proteínas As concentrações de proteínas dos venenos brutos e das frações isoladas foram determinadas pelo método de Bradford (1976), utilizando soro albumina bovino (Sigma) como padrão. 3.5 Eletroforese em gel de Poliacrilamida Para a determinação da massa molecular aparente e avaliar o grau de pureza da amostra purificada, foi realizada eletroforese em gel de poliacrilamida a 12,5% com agente desnaturante (SDS) segundo a técnica descrita por Laemmli (1970), em condições redutoras e não redutoras. 3.6 Espectrometria de massa Foi realizada em equipamento Maldi TOF/TOF (Axima TOF 2 Shimadzu Coorp). Para tanto, 0,5ul de amostra protéica solubilizado em TFA 0,05% foi aplicado sobre

26 25 placa e recoberta com igual volume de solução saturada de ácido sinapínico em acetonitrina 50% + TFA 0,05% como matriz de ionização. 3.7 Determinação da atividade hemaglutinante Este ensaio foi utilizado como prova biológica para o monitoramento da presença de lectinas em amostras cromatografadas. Hemácias humanas de doadores sadios foram obtidas por punção venosa utilizando-se 10 µl de heparina sódica (50UI/mL)/mL. As hemácias foram lavadas e centrifugadas (4000rpm 5minutos) por 5 vezes com solução salina isotônica. A atividade hemaglutinante foi determinada utilizando-se microplacas com fundo em V e diluições seriadas em duplicata das lectinas isoladas para a determinação da mínima concentração capaz de aglutinar diferentes hemácias. Em cada poço foram adicionadas 50 µl de suspensão de hemácias a 3% em PBS ph 7,4 5 mm de CaCl 2 e lectinas diluídas em 50 µl do mesmo tampão de diluição das hemácias. As microplacas foram incubadas em temperatura ambiente e a atividade aglutinante foi verificada após 2 horas. 3.8 Isolamento de mononucleares de sangue periférico humano A obtenção de PBMCs foi realizada por meio do método de gradiente de densidade com uso de Hystopaque Para isso, o sangue periférico de humanos foi obtido a partir de doadores voluntários sadios com idade entre 18 a 40 anos, excluídos os doadores que apresentavam qualquer tipo de infecção ou inflamação ou em processo de tratamento medicamentoso com antibióticos e antiinflamatórios. A coleta foi realizada com a adição de 100 UI de heparina/ml de sangue, que foram vertidos sobre tubo contendo bicamada de Hystopaque-1119 numa proporção de (1:1, v/v) e centrifugados a 400 xg por 30 minutos em temperatura ambiente. Em tubos cônicos, a fase contendo PBMCs foi separada, lavada com 10 ml de PBS e centrifugada a 200 xg por 10 minutos em temperatura ambiente. Este procedimento foi repetido 3 vezes. A seguir, as células foram ressuspensas em meio RPMI suplementado com 10% de soro fetal bovino (SFB), estreptomicina (100 g/ml), penicilina (100 g/ml) e L-glutamina (2mM). Uma alíquota da suspensão celular foi colhida para a determinação do número de células totais, em hemocitômetro de Neubauer, ao microscópio de luz, após diluição (1:20, v/v) em líquido de Turk (0,2% de cristal violeta em 30% de ácido acético).

27 Imunofenotipagem A validação do método de isolamento de PBMCs foi feita por imunofenotipagem com base no tamanho (FSC) e granulosidade (SSC), juntamente com a marcação com anticorpos específicos, anti-cd3-fitc e anti-cd14-pe. A pureza da suspensão celular foi analisada usando o citômetro de fluxo Becton Dickinson modelo FACSCan. As células foram incubadas com as diluições de 1:800 dos anticorpos anti-cd3-fitc (linfócitos T) e anti-cd14-pe (monócitos) por 30 minutos, em banho de gelo e protegidas da luz. Após a marcação, as amostras foram lavadas duas vezes com PBS/2% SFB para remover os anticorpos não ligados. A dispersão de luz frontal (forward scatter) e lateral (side scatter) bem como a fluorescência remanescente (FITC e PE) foram utilizadas para diferenciar os PBMCs a partir de outros tipos de células Determinação da viabilidade celular por redução do MTT Os PBMCs (2x10 5 células/poço) foram cultivados em placas de 96 poços com 250µL de RPMI suplementado com estreptomicina (100 µg/ml), penicilina (100 µg/ml), L-glutamina (2 mm) e 10% de SFB. A seguir, as células foram incubadas com a lectina isolada (5 e 10 µg/ml) (grupo experimental) ou RPMI (grupo controle) por 96 horas a 37 C em atmosfera de 5% de CO 2. Após este período, as amostras foram centrifugadas e o sobrenadante retirado. A seguir, 10 µl de MTT (5 mg/ml em PBS) e 90 µl de RPMI/poço foram adicionados, seguidos de incubação a 37 C, em atmosfera a 5% de CO 2, por 3 horas. Após este período, as amostras foram centrifugadas, o sobrenadante desprezado e lavadas com 200 µl de PBS por 2 vezes. A seguir, foram adicionados 100 µl de DMSO para a solubilização dos cristais de formazan seguida de nova incubação a 37ºC por período de 1 hora. O grau de redução de MTT para formazan foi quantificado pela medida de densidade óptica a 540nm. Os resultados foram expressos em D.O.

28 Teste de proliferação celular por redução do MTT Para o teste de proliferação celular, PBMCs (1x10 5 ) foram cultivados em placas de 96 poços com 100µL de RPMI suplementado com estreptomicina (100 µg/ml), penicilina (100 µg/ml), L-glutamina (2 mm) e 10% de SFB. A seguir, as células foram incubadas com a BjcuL (5 e 10 µg/ml) (grupo experimental), concanavalina-a (grupo controle positivo) ou RPMI (grupo controle negativo), por 96 horas a 37 C em atmosfera de 5% de CO 2. As amostras foram então centrifugadas e o sobrenadante retirado. A seguir, 10 µl de MTT (5 mg/ml em PBS) e 90 µl de RPMI/poço foram adicionados, seguidos de incubação a 37 C em atmosfera a 5% de CO 2 por 8 horas. As amostras foram centrifugadas novamente, o sobrenadante desprezado e 100 µl de solução de SDS 10% em HCl 0,01N foram adicionados para a solubilização dos cristais de formazan seguida de incubação a 37ºC por período de 18 a 20 horas. O grau de redução de MTT para formazan foi quantificado pela medida de densidade óptica a 570nm. Os resultados foram expressos em porcentagem de proliferação Determinação da produção do ânion superóxido Para este ensaio os PBMCs isolados foram ajustados para 2x10 5 /100 µl e incubados por 2 horas com meio de cultura RPMI, 0,1% de NBT, 10µL de PMA (500 ng/ml) (controle positivo) e BjcuL 5 e 10 µg/ml (grupo experimental), a 37 C. A células foram centrifugadas e lavadas 2 vezes com 200 µl de PBS e, o NBT reduzido, presente no sedimento, foi solubilizado sob agitação em 200 µl KOH/DMSO. Os restos celulares foram sedimentados e a absorbância do sobrenadante foi determinada a 620nm em espectrofotômetro. Os resultados forma expressos em D.O Determinação da produção de peróxido de hidrogênio Para o teste da produção de peróxido de hidrogênio, uma suspensão de PBMCs (2 x 10 5 células/100 L) em PBS contendo vermelho de fenol e 0,6 g/ml de peroxidase foi dispensada em placas de 96 poços de fundo chato. Em seguida, as células foram incubadas com a BjcuL (5 e 10 µg/ml) (grupo experimental) ou RPMI (grupo controle negativo) por 3 horas a 37 C em atmosfera úmida a 5% de CO 2.

29 28 Simultaneamente, foram mantidas células com ou sem estímulo por acetato de forbol miristato (PMA), 500 ng/ml. A reação foi interrompida pela adição de 10 L de hidróxido de sódio 1N (NaOH). A absorbância foi determinada em espectofotômetro a 620 nm contra branco constituído de vermelho de fenol e os dados foram confrontados a uma curva padrão, realizada em cada ensaio. Os resultados foram expressos em nmoles de H 2 O 2 /2 x 10 5 células Determinação da produção de óxido nítrico (NO) Para avaliar a produção de NO, foi determinada a medida de nitrito no sobrenadante de culturas de PBMCs incubados ou não com BjcuL. Uma suspensão de PBMCs (2 x 10 5 /250 L) em meio de cultura RPMI suplementado com estreptomicina (100 g/ml), penicilina (100 g/ml), L-glutamina (2 mm) e 10% de SFB foram plaqueadas em placas de 96 poços de fundo chato e incubadas com a BjcuL (5 e 10µg/mL) (grupo experimental) ou LPS 1µg/mL (grupo controle positivo) ou RPMI (grupo controle negativo) por 96 horas a 37 C em atmosfera úmida a 5% de CO 2. Após esse período, os sobrenadantes das células foram transferidos para uma placa de leitura onde foi adicionado reagente de Griess na proporção de (1:1, v/v) para a determinação de nitrito. Em seguida, a absorbância foi determinada em espectrofotômetro a 550 nm e os dados foram confrontados a uma curva padrão preparada com NaNO 2 (2,5-80 M) e expressos em M de nitrito liberado por 2 x 10 5 células Quantificação da concentração de PGE 2 por EIA Os PBMCs (2 x 10 5 células/100 L) foram incubados com a BjcuL 5 e 10µg/mL (grupo experimental) ou LPS 1µg/mL (grupo controle positivo) ou RPMI (grupo controle negativo) e mantidas por 3 horas a 37ºC em atmosfera úmida com 5% de CO 2 e utilizados para a determinação da concentração de PGE 2 por ensaio imunoenzimático específico (EIA) utilizando Kit comercial (Cayman Chemicals, EUA). Para tanto, 100 L das alíquotas de cada amostra foram incubadas com a PGE 2 conjugada a acetilcolinesterase e anti-soro específico de coelho, em placas de 96 poços, revestidas com anticorpos monoclonais de camundongos contra IgG de coelho. Após a adição do substrato, a absorbância das amostras foi determinada em espectrofotômetro a 412 nm e

30 29 a concentração do eicosanóide foi estimada a partir de uma curva padrão específica. Os resultados obtidos foram expressos em pg/ml Determinação da produção de citocinas por EIA Para a dosagem de citocinas por EIA, os PBMCs (2 x 10 5 células/100 L), foram incubados com BjcuL 5 e 10µg/mL (grupo experimental) ou Con-A 5µg/mL (grupo controle positivo) ou RPMI (grupo controle negativo) e mantidas por 12 horas, a 37ºC, em atmosfera úmida com 5% de CO 2. Placas de 96 poços (NUNC MaxSorp) sensibilizadas com anticorpos de captura (anti IL-2, IL-4, IL-10, IL-17, TGF-β, IFN-γ e TNF-α) dissolvidos em PBS ph 7,4, durante 12 horas, a 4ºC. Em seguida, as placas lavadas com PBS-Tween (PBS contendo 0,5% de Tween 20), os sítios livres foram bloqueados com 300 L de tampão de bloqueio, contendo 1% de BSA em PBS e as placas incubadas por 2 horas, em temperatura ambiente. A seguir, as placas foram lavadas por três vezes com PBS-Tween e adicionados 100 µl de sobrenadante de cultura de PBMCs e incubados durante 2 horas, em temperatura ambiente. Nova lavagem com PBS-Tween por 3 vezes foi realizada e 100 µl de solução de anticorpos biotinilados anti-citocinas foram adicionados e incubados por 2 horas em temperatura ambiente. Após quatro lavagens, a presença de anticorpos biotinilados foi detectada com 100 µl de estreptoavidina-peroxidase (1:1000, v/v). Após incubação por 20 minutos, em temperatura ambiente, as placas foram lavadas com PBS-Tween e adicionados 100 µl de reagente cromogênico (3,3,5,5 -tetrametilbenzidina 0,1mg/mL) dissolvidos em tampão fosfato-citrato 0,05M (ph 5,0), contendo 0,03% de peróxido de hidrogênio. A reação foi interrompida após 20 minutos de incubação a temperatura ambiente, pela adição de 50 µl de ácido sulfúrico 1M. A absorbância foi determinada em espectrofotômetro a 450 nm e correção em 540 nm e os resultados confrontados a uma curva padrão efetuada com a citocina recombinante correspondente para a determinação da concentração desta citocina. Os resultados foram expressos em pg/ml.

31 Determinação da expressão gênica de IL-10, TGF-β, IL-12, IFN-γ, TNF-α, COX-1, COX-2 e GAPDH por RT-PCR Para avaliar a expressão gênica de IL-10, IL-12, TGF-β, IFN-γ, TNF-α, COX-1 e COX-2 por RT-PCR, os PBMCs (1 x 10 6 células/300µl) foram incubados com a BjcuL 5 e 10 µg/ml (grupo experimental) ou PMA 500 ng/ml (grupo controle positivo) ou LPS, 1 µg/ml (grupo controle positivo) ou RPMI (grupo controle negativo) e mantidos por 6 horas a 37º C em atmosfera úmida com 5% de CO 2. O RNA total foi extraído pelo método de TRIzol LS Reagent (Ambion, Life Technologies - USA ). Para a reação de transcrição reversa (RT) foram utilizados 500 ng de RNA total para todas as condições experimentais usando o kit SuperScript TM III conforme instruções do fabricante (Invitrogen TM, Life Technologies USA). Para a amplificação dos fragmentos de cdna por RT-PCR, 500 ng de cdna foram adicionados ao PCRmix (1X PCR buffer; 200 μm dntp mix; 0,5 μm de primer gene específico sense, de primer gene específico anti-sense (Tabela 1); 5 µl de Taq polymerase (HotMaster, 5Prime) e água livre de RNAse suficiente para um volume final de 25 µl). O produto de amplificação do gliceraldeído-3-fosfato desidrogenase (GAPDH) foi usado como controle do cdna. Para amplificação dos fragmentos, as reações foram submetidas a uma desnaturação inicial de 94ºC por 5 minutos, seguida por 30 ciclos de 30 segundos a 94ºC para desnaturação, 30 segundos a 58ºC (IL-10, IL-12, COX-2) 30 segundos a 56ºC (TGF-β, COX-1), 30 segundos a 60ºC (IFN-γ) e 30 segundos a 65ºC (TNF-α) para anelamento e 40 a 60 segundos a 72ºC para extensão, conforme o tamanho do amplicon gerado. E uma extensão adicional a 72ºC por 10 minutos. Os produtos da RT-PCR foram avaliados por eletroforese em gel de agarose a 1,5% corados com brometo de etídio e foto-documentados Análise estatística. Os resultados obtidos foram expressos como média erro padrão da média e analisados estatisticamente pelo teste de Turkey ou Análise de Variância (ANOVA), após o teste de normalidade. Foram considerados significativos os valores de p < 0,05.

32 31 Tabela 1: Lista de primers usados e suas Temperatura de Anelamento (TA) e sequencias de nucleotídeos. Denominação TA ( C) Sequencia 5-3 IL-10 G sense 58 CTACTAAGGCTTCTTTGGGAG IL-10 G anti-sense 58 CAGTGCCAACTGAGAATTTGG TGF-β sense 56 GCCCTGGACACCAACTATTGC TGF-β anti-sense 56 GCTGCACTTGCAGGAGCGCAC IL-12 p40 sense 58 TACTCCTTGTTGTCCCCTCTG Il-12 p40 anti-sense 58 GTGGCCATATGGGAACTGAAG IFN-γ sense 60 ACTGACTTGAATGTCCAACGCA IFN-γ anti-sense 60 ATCTGACTCCTTTTTCGCTTCC TNF-α sense 65 TCTCGAACCCCGAGTGACAA TNF-α anti-sense 65 TATCTCTCAGCTCCACGCCA COX-1 sense 56 GAGCGTCAGTATCAACTGCG COX-1 anti-sense 56 ATTGGAACTGGACACCGAAC COX-2 sense 58 TTCAAATGAGATTGTGGGAAAATTGCT COX-2 anti-sense 58 AGATCATCTCTGCCTGAGTATCTT GAPDH sense 68 CCACCCATGGCAAATTCCATGGCA GAPDH anti-sense 68 TCTAGACGGCAGGTCAGGTCCACC

33 32 4. RESULTADOS 4.1 Isolamento de lectina de Bothrops jararacussu A Bjcul foi isolada por meio de método cromatográfico, num processo único, utilizando-se uma coluna de afinidade Sepharose 6B CL lactose (3cm X 1cm) fabricada em nosso laboratório. A Figura 1-A apresenta o perfil cromatográfico do procedimento, no qual se observa a eluição dos constituintes do veneno até o retorno da absorbância aos níveis basais. A lectina que permaneceu ligada à resina foi eluída somente após a aplicação de lactose, a 100 mm. Posteriormente, a lectina foi purificada através de cromatografia de exclusão molecular. O grau de pureza da BjcuL foi verificado em Cromatografia Líquida de Alta Eficiência em coluna de fase reversa (C-18). A Figura 1-B mostra o perfil cromatográfico deste procedimento, no qual se observa a presença de um pico majoritário correspondente à lectina purificada. Uma corrida em branco, constituída somente pelos tampões utilizados foi processada, mostrando que os pequenos ruídos observados no cromatograma são deles decorrentes. Figura 1 Purificação da BjcuL. A BjcuL foi purificada através de um processo cromatográfico único, submetendo-se o veneno bruto de Bothrops jararacussu à cromatografia de afinidade em resina Sepharose 6B CL Lactose (1-A). O grau de pureza foi comprovado por cromatografia de fase reversa em coluna C18. Na figura, uma corrida em branco foi sobreposta, mostrando que as perturbações aparentes, são ruídos decorrentes dos próprios solventes (1-B). As setas indicam a BjcuL.

34 Determinação da massa molecular aparente A determinação da massa molecular aparente da BjcuL foi realizada em SDS- PAGE a 12,5% pela comparação da distância de migração de padrões com massas moleculares conhecidas. A Figura 2 mostra a BjcuL sob condições redutoras, representada por uma única banda de aproximadamente 15kDa. Já sob condições não redutoras, a lectina de Bothrops jararacussu apresentou-se como uma banda única de aproximadamente 30kDa. Estes dados, tomados em conjunto, mostram que a BjcuL encontra-se em forma dimérica, ligadas por ponte dissulfeto. 30kDa 17kDa Figura 2 Perfil eletroforético da lectina do veneno de Bothrops jararacussu em SDS-PAGE (12,5%). Raias: 1- Bjcul em condições não redutoras; 2- Bjcul em condições redutoras; 3- Veneno total de Bothrops jararacussu e 4- Marcador de peso molecular. As bandas de proteínas foram coradas com Coomassie-Blue R-250.

35 Espectrometria de massa A massa molecular da BjcuL foi confirmada através de espectrometria de massa em sistema de MALDI/TOF, sendo observado um pico principal de Da utilizando-se solução saturada de acido sinapínico como matriz de ionização (Figura 3). Figura 3 - Determinação da massa molecular da BjcuL. A massa molecular da Bjcul foi determinada por espectrometria de massa em equipamento MALDI-TOF. A seta aponta para a proteína em seu estado dimérico. 4.4 Atividade Hemaglutinante Os resultados dos ensaios de hemaglutinação processados com hemácias de coelho e diferentes grupos sanguíneos de hemácias humanas mostram a alta capacidade hemaglutinante desta lectina, como mostra a Figura 4. As hemácias de coelho mostraram-se particularmente sensíveis à ação das lectinas, as quais foram aglutinadas pela lectina numa concentração 0,29µg/mL (0,0145µg). As hemácias humanas dos diferentes fenótipos testados mostraram diferentes níveis de sensibilidade à lectina. Hemácias pertencentes ao grupo A e B foram aglutinadas pela lectina numa concentração de 2,35µg/mL (0,1175µg). Já, as hemácias pertencentes aos grupos AB e O foram aglutinadas pela lectina nas concentrações de 4,7µg/mL (0,235µg) e 9,4µg/mL (0,47µg), respectivamente. O resultado do ensaio de inibição de hemaglutinação mostrou diferenças nas concentrações de carboidratos capazes de inibir a hemaglutinação, demonstrando de maneira indireta a afinidade apresentada por esta lectina pelos diferentes carboidratos testados (Figura 4-A). A inibição da hemaglutinação induzida pelo E.D.T.A. mostrou a dependência dos íons cálcio na capacidade de ligação a carboidratos (Figura 4-B).

36 MHC (Microgramas) MIH (mm) , , ,2 0,1 50 0,0 Coelho Humano A Humano B Humano AB Humano O 0 d-galactose Lactose d-glicose E.D.T.A. Figura 4: Capacidade hemaglutinante da BjcuL e inibição da hemaglutinação. A capacidade hemaglutinante da BjcuL (4-A) foi avaliada frente a suspensão de diferentes tipos de hemácias não tripsinizadas. A inibição da capacidade hemaglutinante também foi avaliada (4-B) através da incubação com diferentes carboidratos ou agente quelante de (EDTA). As amostras foram incubadas a temperatura ambiente e a leitura foi processada após 2h. MHC Menor concentração de BjcuL capaz de aglutinar 50µl de hemácias não tripsinizadas a 3%. 4.5 Obtenção de PBMCs humanos A figura 5 ilustra as preparações realizadas em citocentrífuga com PBMCs humanos isolados. A obtenção dos PBMCs humanos pelo método de gradiente de densidade mostrou-se eficaz.

37 36 Figura 5: Preparação de lâmina em citocentrífuga. A obtenção dos PBMCs humanos foi realizada através de separação por gradiente de densidade com Histopaque Uma alíquota foi utilizada para preparação por citocentrífuga e corada com panótico. Aumento de 400x. 4.6 Validação do método de isolamento de PBMCs por Imunofenotipagem Para validar o método de isolamento de PBMCs humanos foi realizada imunofenotipagem com anticorpos anti-cd3-fitc (linfócitos T) e anti-cd14-pe (monócitos) (Figura 6). A pureza foi analisada usando o citômetro de fluxo Becton Dickinson. O painel A ilustra o controle não marcado de PBMCs no qual a separação entre as populações de linfócitos (FSC: ; SSC: ) e monócitos (FSC: ; SSC: ) está de acordo com seus respectivos tamanho e complexidade interna. O painel B ilustra o controle não marcado de PBMCs no qual as células são negativas à esquerda entre 10 1 do eixo X e 10 1 do eixo Y. O painel C ilustra os PBMCs no qual há marcação positiva para linfócitos T e monócitos.

38 37 Controle Controle CD 3/14 A B PBMC CD 3/14 C Figura 6: Imunofenotipagem de PBMCs humanos. Para validação da técnica de isolamento de PBMCs foi realizada marcação com anticorpos anti-cd14 (monócitos) e anti- CD3 (linfócitos T). A) Controle não marcado de PBMCs. B) Controle não marcado de PBMCs C) PBMCs com marcação positiva para linfócitos T e monócitos. 4.7 Viabilidade celular por redução do MTT A ação citotóxica da BjcuL sobre os PBMCs foi avaliada até 96 horas após a sua incubação com a suspensão dos PBMCs humanos isolados. Como demonstra a figura 7, a BjcuL não afetou a viabilidade dos PBMCs quando comparado ao controle no período de tempo e nas concentrações estudadas.

39 38 Figura 7: Efeito da BjcuL de Bothrops jararacussu sobre a viabilidade de PBMCs. Os PBMCs (2 x 10 5 células) foram incubados com a BjcuL (5 e 10μg/mL) ou RPMI (controle) por período de 96 horas a 37ºC em atmosfera úmida com 5% de CO 2. A viabilidade dos PBMCs foi avaliada pelo teste de redução do MTT. Os dados representam a media +/- E.P.M.de 3 experimentos independentes. 4.8 Proliferação celular Para avaliar o perfil de proliferação celular, os PBMCs humanos foram incubados com a BjcuL por até 96 horas. A Figura 8 mostra que a lectina foi capaz de inibir a proliferação de PBMCs quando comparado ao grupo controle no período de tempo e nas concentrações estudadas.

40 39 Figura 8: Proliferação de PBMCs. Os PBMCs foram incubados com BjcuL (5 e 10μg/mL), Concanavalina A (5µg/mL) ou RPMI por período de 96 horas a 37ºC em atmosfera úmida com 5% de CO 2. A proliferação foi estimada pelo teste de redução do MTT e os resultados expressos em percentagem de proliferação. Os dados representam a média +/- E.P.M. de 3-4 experimentos independentes. * p<0,05% quando comparadas ao grupo controle. 4.9 Determinação da produção do ânion superóxido A produção do ânion superóxido pelos PBMCs foi avaliada 2 horas após a sua incubação com a BjcuL. A lectina estimulou a produção pelos PBMCs do ânion superóxido quando comparado ao controle no período de tempo e nas concentrações estudadas (Figura 9).

41 40 Figura 9: Efeito da BjcuL sobre a produção de superóxido em PBMCs. Os PBMCs foram incubados por 2 horas com meio de cultura RPMI, 0,1% de NBT, 10 µl de PMA (150 ng/ml) (controle positivo), com a BjcuL nas concentrações de 5 e 10 µg/ml à 37 C e 5% de CO 2 para a formação dos cristais formazan, resultantes da redução do NBT pelo superóxido. Os cristais foram solubilizados e a absorbância do sobrenadante foi determinada a 620 nm em espectrofotômetro. Os dados foram expressos em D.O. e representam a média +/- E.P.M. de 4 experimentos independentes. *p< 0,05 em relação ao controle (ANOVA) Determinação da produção de peróxido de hidrogênio A capacidade de produção de peróxido de hidrogênio (H 2 O 2 ) pelos PBMCs foi avaliada 3 horas após a sua incubação com a BjcuL. Como demonstra a figura 10, a lectina estimulou a produção pelos PBMCs de peróxido de hidrogênio (H 2 O 2 ) quando comparado ao controle no período de tempo e nas concentrações estudadas.

42 41 Figura 10: Perfil de produção de peróxido de hidrogênio por PBMCs. As células foram incubados com BjcuL (5 e 10μg/mL) ou RPMI (controle) por período de 3 horas, a 37ºC em atmosfera úmida com 5% de CO 2. O peróxido de hidrogênio foi determinado por meio da técnica do vermelho de fenol. Os dados representam a media +/- E.P.M. de 3 experimentos independentes. *p< 0,05 em relação ao controle (ANOVA) Determinação da produção de óxido nítrico (NO) A capacidade de produção dos PBMCs liberarem NO quando estimulados pela BjcuL foi avaliada 96 horas após a sua incubação com a BjcuL. A BjcuL não foi capaz estimular os PBMCs a liberarem NO. No entanto, em sua maior concentração, quando incubada juntamente com LPS, a lectina foi capaz de reduzir significativamente os níveis de estimulação dos PBMCs por LPS no período de tempo estudado (Figura 11).

43 42 Figura 11: Perfil de produção de óxido nítrico por PBMCs. As células foram incubados com BjcuL (5 e 10 μg/ml) ou BjcuL adicionado LPS (5 e 10 μg/ml + 1 µg/ml) ou LPS (1µg/mL) ou RPMI (controle) por período de 96 horas a 37ºC, em atmosfera úmida com 5% de CO 2. O óxido nítrico foi determinado usando reagente de Griess. Os dados representam a media +/- E.P.M. de 3 experimentos independentes. * p<0,05% quando comparadas ao grupo controle. p<0,05% quando comparadas ao grupo LPS Quantificação da concentração de PGE 2 A capacidade da BjcuL em induzir a liberação de PGE 2 pelos PBMCs foi avaliada 3 horas após sua incubação. A lectina não foi capaz de estimular a produção de PGE 2 pelos PBMCs quando comparado ao controle no período de tempo e nas concentrações estudadas (Figura 12-A). Para avaliar o perfil de expressão gênica de RNAm de COX-I e COX-II, os PBMCs humanos foram incubados com a BjcuL por 6 horas. A lectina não foi capaz de aumentar significativamente os níveis de expressão

RESPOSTA INFLAMATÓRIA

RESPOSTA INFLAMATÓRIA RESPOSTA INFLAMATÓRIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas INFLAMAÇÃO É uma reação dos tecidos a uma agente agressor caracterizada morfologicamente

Leia mais

CITOCINAS/INTERLEUCINAS. Universidade Estadual Paulsita Imunologia Veterinária Prof. Helio Montassier Andréa Maria C. Calado

CITOCINAS/INTERLEUCINAS. Universidade Estadual Paulsita Imunologia Veterinária Prof. Helio Montassier Andréa Maria C. Calado CITOCINAS/INTERLEUCINAS Universidade Estadual Paulsita Imunologia Veterinária Prof. Helio Montassier Andréa Maria C. Calado Introdução Respostas imunes: interações entre as diferentes populações celulares.

Leia mais

INFLAMAÇÃO. Processos Imunológicos e Patológicos PROCESSO INFLAMATÓRIO UNIVERSIDADE CATÓLICA DE GOIÁS DEPARTAMENTO DE BIOMEDICINA

INFLAMAÇÃO. Processos Imunológicos e Patológicos PROCESSO INFLAMATÓRIO UNIVERSIDADE CATÓLICA DE GOIÁS DEPARTAMENTO DE BIOMEDICINA UNIVERSIDADE CATÓLICA DE GOIÁS DEPARTAMENTO DE BIOMEDICINA Processos Imunológicos e Patológicos INFLAMAÇÃO Prof.: Hermínio M. da R.Sobrinho PROCESSO INFLAMATÓRIO A inflamação constitui uma resposta imune

Leia mais

Inflamação: - Do latim inflamare

Inflamação: - Do latim inflamare INFLAMAÇÃO CONCEITOS: Inflamação: - Do latim inflamare Reação dos tecidos vascularizados a um agente agressor caracterizada morfologicamente pela saída de líquidos e de células do sangue para o interstício.

Leia mais

Microbiologia e Imunologia Clínica

Microbiologia e Imunologia Clínica Estudo dos mecanismos naturais de defesa contra doenças. Microbiologia e Imunologia Clínica Estudo do sistema imune do corpo e suas funções e alterações. Profa. Ms. Renata Fontes Fundamentos da Imunologia

Leia mais

Aspectos Moleculares da Inflamação:

Aspectos Moleculares da Inflamação: Patologia Molecular Lucas Brandão Aspectos Moleculares da Inflamação: os mediadores químicos inflamatórios Inflamação São uma série de eventos programados que permitem com que Leucócitos e outras proteínas

Leia mais

Tecido sanguíneo. Prof. Msc. Roberpaulo Anacleto

Tecido sanguíneo. Prof. Msc. Roberpaulo Anacleto Tecido sanguíneo Prof. Msc. Roberpaulo Anacleto Transporte Regulação Proteção Funções do Sangue Sangue É um tecido conjuntivo especializado pois apresenta sua matriz extracelular totalmente fluida. O sangue

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Bioquímica. Purificação de proteínas

Bioquímica. Purificação de proteínas Bioquímica Purificação de proteínas Estratégia geral - Liberação da proteína do material biológico - Podem ser separados por fracionamento celular - Pode-se separar proteínas por características: Solubilidade

Leia mais

Resposta imune às infecções virais ou DEFESAS DO HOSPEDEIRO CONTRA OS VÍRUS

Resposta imune às infecções virais ou DEFESAS DO HOSPEDEIRO CONTRA OS VÍRUS Resposta imune às infecções virais ou DEFESAS DO HOSPEDEIRO CONTRA OS VÍRUS MULTIPLICATION 1 Defesas Resposta imune frente a infecções 2 Defesas Imunidade inata Defesa e recuperação Genética Fatores séricos

Leia mais

Complexo principal de histocompatibilidade

Complexo principal de histocompatibilidade Complexo principal de histocompatibilidade Todas as espécies possuem um conjunto de genes denominado MHC, cujos produtos são de importância para o reconhecimento intercelular e a discriminação do que é

Leia mais

Sinalização Celular. Por que sinalizar?

Sinalização Celular. Por que sinalizar? Comunicação Celular Sinalização Celular Por que sinalizar? Sinalização Celular Quando sinalizar? Sinalização Celular Como sinalizar? Sinalização Celular Onde sinalizar? Relevância Biológica Alteração no

Leia mais

IMUNO ENSAIOS USANDO CONJUGADOS

IMUNO ENSAIOS USANDO CONJUGADOS IMUNO ENSAIOS USANDO CONJUGADOS REAÇÕES USANDO REAGENTES MARCADOS Conjugado: molécula constituída por duas substâncias ligadas covalentemente e que mantêm as propriedades funcionais de ambas Ex: globulina

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais

O Sistema do Complemento

O Sistema do Complemento UNIVERSIDADE DE SÃO PAULO Faculdade de Medicina de Ribeirão Preto Programa de Pós- Graduação em Imunologia Básica e Aplicada Disciplina- Integração Imunologia Básica- Clínica O Sistema do Complemento Elyara

Leia mais

RESPOSTA IMUNE AOS MICRORGANISMOS. Prof. Aline Aguiar de Araujo

RESPOSTA IMUNE AOS MICRORGANISMOS. Prof. Aline Aguiar de Araujo RESPOSTA IMUNE AOS MICRORGANISMOS Prof. Aline Aguiar de Araujo INTRODUÇÃO Número de indivíduos expostos à infecção é bem superior ao dos que apresentam doença, indicando que a maioria das pessoas tem condições

Leia mais

Imunidade Adaptativa Humoral

Imunidade Adaptativa Humoral Imunidade Adaptativa Humoral Daiani Cristina Ciliao Alves Taise Natali Landgraf Imunidade Adaptativa Humoral 1) Anticorpos: Estrutura Localização 2) Maturação de célula B: Interação dependente de célula

Leia mais

ANTICORPOS: ESTRUTURA E FUNÇÃO

ANTICORPOS: ESTRUTURA E FUNÇÃO ANTICORPOS: ESTRUTURA E FUNÇÃO Por definição, anticorpos são moléculas de glicoproteína, também chamadas de imunoglobulinas. São glicoproteínas altamente específicas sintetizadas em resposta a um antígeno,

Leia mais

Sinalização celular. Profa. Dra. Monica Akemi Sato

Sinalização celular. Profa. Dra. Monica Akemi Sato Sinalização celular Profa. Dra. Monica Akemi Sato Mensageiros Químicos Número de células Corpo Humano ~75 trilhões As células são especializadas na execução da função específica Ex: secreção ou contração.

Leia mais

RESPOSTA INFLAMATÓRIA

RESPOSTA INFLAMATÓRIA RESPOSTA INFLAMATÓRIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas INFLAMAÇÃO Eventos: P r o c e s s o o r d e n a d o Irritação liberação dos mediadores

Leia mais

SANDRA BERTELLI RIBEIRO DE CASTRO LABORATÓRIO DE IMUNOLOGIA. Aviso: Início das aulas práticas

SANDRA BERTELLI RIBEIRO DE CASTRO LABORATÓRIO DE IMUNOLOGIA. Aviso: Início das aulas práticas ANTÍGENO E ANTICORPO SANDRA BERTELLI RIBEIRO DE CASTRO LABORATÓRIO DE IMUNOLOGIA Aviso: Início das aulas práticas Laboratório de Imunologia, Departamento de Parasitologia, Microbiologia e Imunologia, Instituto

Leia mais

Elaborado por: Karina Salvador Revisado por: Hilda Helena Wolff Aprovado por: Andréa Cauduro

Elaborado por: Karina Salvador Revisado por: Hilda Helena Wolff Aprovado por: Andréa Cauduro ANTI- 1 Manual CAMBRIDGE BIOTECH -1 POP: BM 05 Página 1 de 7 1. Sinonímia ANTI, TESTE CONFIRMATÓRIO. 2. Aplicabilidade Aos bioquímicos e técnicos do setor de imunologia. 3. Aplicação clínica Os testes

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

UNIDADE 7 SINALIZAÇÃO CELULAR

UNIDADE 7 SINALIZAÇÃO CELULAR UNIDADE 7 SINALIZAÇÃO CELULAR 1. VISÃO GERAL A sinalização celular é um mecanismo de comunicação entre as células que se encontra presente nas mais diversas formas de vida, desde organismos unicelulares,

Leia mais

Métodos para detecção de alérgenos em alimentos. Gerlinde Teixeira Departamento de Imunobiologia Universidade Federal Fluminense

Métodos para detecção de alérgenos em alimentos. Gerlinde Teixeira Departamento de Imunobiologia Universidade Federal Fluminense Métodos para detecção de alérgenos em alimentos Gerlinde Teixeira Departamento de Imunobiologia Universidade Federal Fluminense Antigenos vs Alérgenos Antigeno Imunógeno Qualquer substância capaz de estimular

Leia mais

M E T B O L I S M O CATABOLISMO ANABOLISMO

M E T B O L I S M O CATABOLISMO ANABOLISMO METABOLISMO É o conjunto das reações químicas que ocorrem num organismo vivo com o fim de promover a satisfação de necessidades estruturais e energéticas. ...metabolismo Do ponto de vista físico-químico,

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

FOSFATO DISSÓDICO DE DEXAMETASONA

FOSFATO DISSÓDICO DE DEXAMETASONA FSFAT DISSÓDIC DE DEXAMETASNA Dexamethasoni natrii phosphas H H H P Na Na F H C 22 H 28 FNa 2 8 P 516,41 02821 Fosfato dissódico de 9-fluoro-11β,17 diidroxi-16α-metil-3, 20- dioxopregna- 1,4 dieno-21-il

Leia mais

28.03. As plaquetas são os elementos figurados do sangue responsáveis pela coagulação sanguínea.

28.03. As plaquetas são os elementos figurados do sangue responsáveis pela coagulação sanguínea. BIO 10E aula 28 28.01. Para fazer a defesa do organismo, alguns leucócitos podem atravessar a parede dos vasos sanguíneos e atuar no tecido conjuntivo. Este processo é denominado diapedese. 28.02. A coagulação

Leia mais

Peço desculpa, mas perdi o documento e apenas o consegui recuperar nesta forma. Para não atrasar mais, envio-o mesmo assim.

Peço desculpa, mas perdi o documento e apenas o consegui recuperar nesta forma. Para não atrasar mais, envio-o mesmo assim. Peço desculpa, mas perdi o documento e apenas o consegui recuperar nesta forma. Para não atrasar mais, envio-o mesmo assim. Assinale com uma cruz no(s) quadrado(s) que antecede(m) a(s)resposta(s) verdadeira(s):

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Biologia Celular e Molecular

Biologia Celular e Molecular DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA Biologia Celular e Molecular Detecção de proteínas por western-blotting 2007-2008 Na electroforese em gel de poliacrilamida

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Determinação quantitativa de amido em produtos cárneos por espectrometria

Determinação quantitativa de amido em produtos cárneos por espectrometria Página 1 de 7 1 Escopo Este método tem por objetivo quantificar amido em produtos cárneos por espectrometria molecular no. 2 Fundamentos Baseia-se na determinação espectrofotométrica a 620 nm do composto

Leia mais

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais

FISIOLOGIA ANIMAL II

FISIOLOGIA ANIMAL II DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA FISIOLOGIA ANIMAL II AULAS e 3 DETERMINAÇÃO DA CONCENTRAÇÃO DE GLICOSE E LÍPIDOS NO SANGUE POR COLORIMETRIA CAETANA CARVALHO,

Leia mais

Apoptose em Otorrinolaringologia

Apoptose em Otorrinolaringologia Apoptose em Otorrinolaringologia Teolinda Mendoza de Morales e Myrian Adriana Pérez García Definição A apoptose é um processo biológico existente em todas as células de nosso organismo, conhecida desde

Leia mais

INUMO-HEMATOLOGIA DOADOR E RECEPTOR VITÓRIA 2014

INUMO-HEMATOLOGIA DOADOR E RECEPTOR VITÓRIA 2014 INUMO-HEMATOLOGIA DOADOR E RECEPTOR VITÓRIA 2014 Imuno-Hematologia Conceito: é o estudo relacionado com imunologia de grupos sanguíneos presentes nas hemácias, e imunologia de plaquetas e leucócitos. É

Leia mais

As membranas são os contornos das células, compostos por uma bicamada lipídica

As membranas são os contornos das células, compostos por uma bicamada lipídica Células e Membranas As membranas são os contornos das células, compostos por uma bicamada lipídica Organelas são compartimentos celulares limitados por membranas A membrana plasmática é por si só uma organela.

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

ANTI HUMANO. Anti IgG Anti C 3 d Poliespecífico

ANTI HUMANO. Anti IgG Anti C 3 d Poliespecífico ANTI HUMANO Anti IgG Anti C 3 d Poliespecífico PROTHEMO Produtos Hemoterápicos Ltda. PARA TESTES EM LÂMINA OU TUBO SOMENTE PARA USO DIAGNÓSTICO IN VITRO Conservar entre: 2º e 8ºC Não congelar Conservante:

Leia mais

UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA EXPERIMENTAL

UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA EXPERIMENTAL UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA EXPERIMENTAL EFEITO DO FATOR NEUTRALIZANTE DE Crotalus (CNF), ISOLADO DO PLASMA DA SERPENTE Crotalus durissus terrificus,

Leia mais

Tipos de enxertos. Tipos de Enxertos: Tipos de Enxertos: O que é um transplante? Imunologia dos Transplantes. Singênicos

Tipos de enxertos. Tipos de Enxertos: Tipos de Enxertos: O que é um transplante? Imunologia dos Transplantes. Singênicos O que é um transplante? Imunologia dos Transplantes Prof.Dr. Gilson Costa Macedo Processo de retirada de células, tecidos ou órgãos, chamados enxertos, de um indivíduo e a sua inserção em um indivíduo

Leia mais

Métodos sorológicos de Diagnóstico e Pesquisa. Reação Ag-Ac in vitro

Métodos sorológicos de Diagnóstico e Pesquisa. Reação Ag-Ac in vitro Métodos sorológicos de Diagnóstico e Pesquisa Reação Ag-Ac in vitro Testes sorológicos Uso de soro ou outros fluidos biológicos de paciente p/ diagnóstico laboratorial Demonstração de anticorpos específicos

Leia mais

PROTOCOLOS EXPERIMENTÁIS DE CITOMETRIA DE FLUXO

PROTOCOLOS EXPERIMENTÁIS DE CITOMETRIA DE FLUXO PROTOCOLOS EXPERIMENTÁIS DE CITOMETRIA DE FLUXO Os protocolos experimentais foram adaptados e traduzidos pela Doutora Maria do Céu Rodrigues Monteiro, responsável do Laboratório de Citometria de Fluxo

Leia mais

Crescimento Microbiano

Crescimento Microbiano Crescimento Microbiano Fatores que influem no crescimento Temperatura ph Oxigênio Agitação Pressão osmótica Temperatura Para todos os microrganismos existem três temperaturas cardeais: Temperatura mínima

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS POP n.º: I 29 Página 1 de 5 1. Sinonímia Pesquisa de anticorpos frios. 2. Aplicabilidade Bioquímicos e auxiliares de laboratório do setor de Imunologia. 3. Aplicação clínica As Crioaglutininas são anticorpos

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS 1. Sinonímia VIDAS DUO 2. Aplicabilidade Aos bioquímicos do setor de imunologia. 3. Aplicação clínica POP n.º: I 56 Página 1 de 7 O vírus da imunodeficiência humana () é um retrovírus RNA, transmitido

Leia mais

Rejeição de Transplantes Doenças Auto-Imunes

Rejeição de Transplantes Doenças Auto-Imunes Rejeição de Transplantes Doenças Auto-Imunes Mecanismos da rejeição de transplantes Envolve várias reações de hipersensibilidade, tanto humoral quanto celular Habilidade cirúrgica dominada para vários

Leia mais

Procedimento Operacional

Procedimento Operacional Procedimento Operacional QUANTIFICAÇÃO DAS SUBPOPULAÇÕES LINFOCITÁRIAS CD4/CD8/CD3/CD45 PATRICIA VIANNA BONINI PALMA Fundação Hemocentro de Ribeirão Preto Centro de Terapia Celular, CRH-HCFMRP-USP Objetivo

Leia mais

BIOQUÍMICA EXPERIMENTAL

BIOQUÍMICA EXPERIMENTAL Departamento de Bioquímica Instituto de Química USP Apostila de protocolos BIOQUÍMICA EXPERIMENTAL QBQ 06N 0 Professores Carlos T. Hotta Ronaldo B. Quaggio Eduardo M. Reis Esta apostila foi desenvolvida

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Professor Fernando Stuchi M ETABOLISMO DE C ONSTRUÇÃO

Professor Fernando Stuchi M ETABOLISMO DE C ONSTRUÇÃO M ETABOLISMO DE C ONSTRUÇÃO P ROTEÍNAS P ROPRIEDADE BÁSICA São grandes moléculas (macromoléculas) constituídas por aminoácidos, através de ligações peptídicas. É o composto orgânico mais abundante no corpo

Leia mais

ANTI IgG (Soro de Coombs)

ANTI IgG (Soro de Coombs) ANTI IgG (Soro de Coombs) Soro Anti Gamaglobulinas Humanas PROTHEMO Produtos Hemoterápicos Ltda. PARA TESTES EM LÂMINA OU TUBO SOMENTE PARA USO DIAGNÓSTICO IN VITRO Conservar entre: 2º e 8ºC Não congelar

Leia mais

Departamento de Biologia da Universidade do Minho

Departamento de Biologia da Universidade do Minho Departamento de Biologia da Universidade do Minho Mestrado em Genética Molecular Ano lectivo de 2004/2005, edição de 2004-2006 Estudo da regulação do gene STL1 codificando o sistema de simporte H + /glicerol

Leia mais

BIOQUÍMICA EXPERIMENTAL

BIOQUÍMICA EXPERIMENTAL Departamento de Bioquímica Instituto de Química USP Apostila de protocolos BIOQUÍMICA EXPERIMENTAL QBQ 036N 203 Professores Carlos Takeshi Hotta Guilherme Menegon Arantes Esta apostila foi desenvolvida

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Imunidade aos microorganismos

Imunidade aos microorganismos Imunidade aos microorganismos Características da resposta do sistema imune a diferentes microorganismos e mecanismos de escape Eventos durante a infecção: entrada do MO, invasão e colonização dos tecidos

Leia mais

Ana Carolina Étori Aguiar

Ana Carolina Étori Aguiar Ana Carolina Étori Aguiar SUMÁRIO Conceito; Imunidade Inata Componentes; Reconhecimento de microrganismos; Mecanismos efetores; Distúrbios congênitos e alterações na Imunidade Inata; Desafios e Previsões.

Leia mais

O QUE SÃO SUBSTÂNCIAS INORGÂNICAS? QUAL A FUNÇÃO BIOLÓGICA DE CADA UMA?

O QUE SÃO SUBSTÂNCIAS INORGÂNICAS? QUAL A FUNÇÃO BIOLÓGICA DE CADA UMA? O QUE SÃO SUBSTÂNCIAS ORGÂNICAS? O QUE SÃO SUBSTÂNCIAS INORGÂNICAS? QUAL A FUNÇÃO BIOLÓGICA DE CADA UMA? SUBSTÂNCIAS ORGÂNICAS: CARBONO, HIDROGÊNIO, OXIGÊNIO E NITROGÊNIO FORMAM CADEIAS LONGAS E COMPLEXAS

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

2. O Óxido Nítrico. 2.1 Introdução

2. O Óxido Nítrico. 2.1 Introdução 2. O Óxido Nítrico 2.1 Introdução O óxido nítrico (NO), um gás de radical livre, é formado na atmosfera durante tempestades com raios. Foi largamente estudado pelos químicos inorgânicos em reações na atmosfera,

Leia mais

Morte Celular Programada (Apoptose)

Morte Celular Programada (Apoptose) UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR Morte Celular Programada (Apoptose) Profa. Dra. Nívea Macedo APOPTOSE A morte celular desempenha

Leia mais

ALBUMINA BOVINA 22% PROTHEMO. Produtos Hemoterápicos Ltda. PARA TESTES EM LÂMINA OU TUBO SOMENTE PARA USO DIAGNÓSTICO IN VITRO

ALBUMINA BOVINA 22% PROTHEMO. Produtos Hemoterápicos Ltda. PARA TESTES EM LÂMINA OU TUBO SOMENTE PARA USO DIAGNÓSTICO IN VITRO ALBUMINA BOVINA 22% PROTHEMO Produtos Hemoterápicos Ltda. PARA TESTES EM LÂMINA OU TUBO SOMENTE PARA USO DIAGNÓSTICO IN VITRO Conservar entre: 2º e 8ºC Não congelar Conservante: Azida de Sódio 0,1 % Responsável

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

DETERMINAÇÃO DOS GRUPOS SANGÜÍNEOS ABO

DETERMINAÇÃO DOS GRUPOS SANGÜÍNEOS ABO DETERMINAÇÃO DOS GRUPOS SANGÜÍNEOS ABO INTRODUÇÃO Foi no início do século XX que a transfusão de sangue, adquiriu bases mais científicas. Em 1900 foram descritos os grupos sanguíneos A, B e O por Landsteiner

Leia mais

WWW.CONTEUDOJURIDICO.COM.BR WWW.CONTEUDOJURIDICO.COM.BR WWW.CONTEUDOJURIDICO.COM.BR

WWW.CONTEUDOJURIDICO.COM.BR WWW.CONTEUDOJURIDICO.COM.BR WWW.CONTEUDOJURIDICO.COM.BR Acerca do transplante de células-tronco hematopoéticas (TCTH), julgue os itens seguintes. 41 Um TCTH é considerado alogênico quando as células-tronco hematopoéticas provem da medula óssea ou do sangue

Leia mais

Professor: Edilberto Antônio Souza de Oliveira Ano: 2008 RESUMO SOBRE O SISTEMA IMUNE

Professor: Edilberto Antônio Souza de Oliveira Ano: 2008 RESUMO SOBRE O SISTEMA IMUNE 1 Professor: Edilberto Antônio Souza de Oliveira Ano: 2008 RESUMO SOBRE O SISTEMA IMUNE O sistema imune tem como principal finalidade a defesa do organismo contra as doenças infecciosas, ou seja, resistência

Leia mais

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos.

c) Macrófagos e células B apresentam antígenos a células T helper. (Preencha as lacunas.). 2 pontos. Questão 1 Você é um imunologista que quer ficar rico e decide deixar o mundo da ciência, conseguindo um emprego como consultor de roteiro em um novo seriado de drama médico. Você avalia o conhecimento

Leia mais

UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA

UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA DISCIPLINA BIOQUÍMICA ESTRUTURAL Ministrante: Prof. Dr. Carlos Alberto de Almeida

Leia mais

A agricultura moderna está sendo revolucionada pela introdução de plantas geneticamente modificadas;

A agricultura moderna está sendo revolucionada pela introdução de plantas geneticamente modificadas; EXPRESSÃO DE HORMÔNIO DE CRESCIMENTO HUMANO PROCESSADO EM SEMENTES DE PLANTAS TRANSGÊNICAS DE TABACO ADILSON LEITE, EDSON L. KEMPER, MÁRCIO J. DA SILVA, AUGUSTO D. LUCHESI, RODRIGO M.P. SILOTO, ERIC D.

Leia mais

Resposta imunológica a. Ronei Luciano Mamoni

Resposta imunológica a. Ronei Luciano Mamoni Resposta imunológica a tumores Ronei Luciano Mamoni Tumores Conceitos gerais Neoplasias conceito Neoplasia (neo= novo + plasia = tecido) é o termo que designa alterações celulares que acarretam um crescimento

Leia mais

ENSAIO DE ENDOTOXINAS BACTERIANAS

ENSAIO DE ENDOTOXINAS BACTERIANAS ENSAIO DE ENDOTOXINAS BACTERIANAS O ensaio de endotoxinas bacterianas (EEB) é um ensaio para detectar ou quantificar endotoxinas de bactérias gram negativas usando um lisado de amebócitos de caranguejo

Leia mais

A eletroforese é uma técnica utilizada para separar, identificar e purificar

A eletroforese é uma técnica utilizada para separar, identificar e purificar 7. ELETROFORESE DE ÁCIDOS NUCLÉICOS João José de Simoni Gouveia Luciana Correia de Almeida Regitano A eletroforese é uma técnica utilizada para separar, identificar e purificar moléculas carregadas (como

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

A LINGUAGEM DAS CÉLULAS DO SANGUE LEUCÓCITOS

A LINGUAGEM DAS CÉLULAS DO SANGUE LEUCÓCITOS A LINGUAGEM DAS CÉLULAS DO SANGUE LEUCÓCITOS Prof.Dr. Paulo Cesar Naoum Diretor da Academia de Ciência e Tecnologia de São José do Rio Preto, SP Sob este título o leitor poderá ter duas interpretações

Leia mais

A ÁGUA COMO REAGENTE PURA PURA PURA Destilação - Deionização Osmose Reversa - Filtração através de Carvão Ativado Ultrafiltração -

A ÁGUA COMO REAGENTE PURA PURA PURA Destilação - Deionização Osmose Reversa - Filtração através de Carvão Ativado  Ultrafiltração - 1 A ÁGUA COMO REAGENTE A água é o suprimento do Laboratório Clínico de menor custo. Talvez, por este motivo, sua qualidade seja tão negligenciada, apesar de ser um reagente importante e o mais utilizado.

Leia mais

PCR. Transiluminador * Características

PCR. Transiluminador * Características PCR PCR A PCR - reação em cadeia da polimerase - é uma técnica de biologia molecular que permite a replicação in vitro do DNA de maneira eficiente, utilizando amostras que podem ser amplificadas milhões

Leia mais

CURSO de MEDICINA VETERINÁRIA - Gabarito

CURSO de MEDICINA VETERINÁRIA - Gabarito UNIVERSIDADE FEDERAL FLUMINENSE TRANSFERÊNCIA 2 o semestre letivo de 2005 e 1 o semestre letivo de 2006 CURSO de MEDICINA VETERINÁRIA - Gabarito Verifique se este caderno contém: INSTRUÇÕES AO CANDIDATO

Leia mais

Síntese Artificial de Peptídeos

Síntese Artificial de Peptídeos Síntese Artificial de Peptídeos Rebeca Bayeh Seminário apresentado para a disciplina Princípios Físicos Aplicados à Fisiologia (PGF530) Prof. Dr. Adriano Mesquita Alencar Segundo semestre de 2013 Motivação

Leia mais

Virulogia. Vírus. Vírus. características 02/03/2015. Príons: Proteína Viróides: RNA. Características. Características

Virulogia. Vírus. Vírus. características 02/03/2015. Príons: Proteína Viróides: RNA. Características. Características Vírus Virulogia Características Vírus- latim veneno - agentes filtráveis Parasita intracelular obrigatório Extracelular: virion Intracelular: vírus Possuem alta especificidade Vírus Características Alta

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL

VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL VERIFICAÇÃO DA EFICIÊNCIA DO MÉTODO DE EXTRAÇÃO DE DNA DO FUNGO MYCOSPHAERELLA FIJIENSIS PARA DETECÇÃO ATRAVÉS DE PCR EM TEMPO REAL Luciana Oliveira Barateli; Regina Melo Sartori Coelho; Abmael Monteiro

Leia mais

Disciplina de Imunologia. Curso de Biomedicina. Imunidade aos Microbios Bactéria extracelular

Disciplina de Imunologia. Curso de Biomedicina. Imunidade aos Microbios Bactéria extracelular Disciplina de Imunologia Curso de Biomedicina Imunidade aos Microbios Bactéria extracelular Como o sistema imune exerce sua função fisiológica principal = Proteger o hospedeiro de infecções por agentes

Leia mais

A importância hematofágica e parasitológica da saliva dos insetos hematófagos. Francinaldo S.Silva.

A importância hematofágica e parasitológica da saliva dos insetos hematófagos. Francinaldo S.Silva. Universidade Federal de Pernambuco Centro de Ciências da Saúde Departamento de Parasitologia PET A importância hematofágica e parasitológica da saliva dos insetos hematófagos. Francinaldo S.Silva. Maria

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS POP n.º: I 22 Página 1 de 5 1. Sinonímia Beta 2 Microglobulina, b2m 2. Aplicabilidade Aos técnicos e bioquímicos do setor de imunologia 3. Aplicação clínica A beta-2-microglobulina é uma proteína presente

Leia mais

ANTICORPOS. CURSO: Farmácia DISCIPLINA: Microbiologia e Imunologia Clínica PROFESSORES: Guilherme Dias Patto Silvia Maria Rodrigues Querido

ANTICORPOS. CURSO: Farmácia DISCIPLINA: Microbiologia e Imunologia Clínica PROFESSORES: Guilherme Dias Patto Silvia Maria Rodrigues Querido CURSO: Farmácia DISCIPLINA: Microbiologia e Imunologia Clínica PROFESSORES: Guilherme Dias Patto Silvia Maria Rodrigues Querido ANTICORPOS Anticorpo é uma globulina sintetizada por linfócitos B e principalmente

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Iniciação. Angiogênese. Metástase

Iniciação. Angiogênese. Metástase Imunidade contra tumores Câncer Cancro, tumor, neoplasia, carcinoma Características: Capacidade de proliferação Capacidade de invasão dos tecidos Capacidade de evasão da resposta imune Câncer Transformação

Leia mais