BIOLOGIA. 08. O desenho ilustra os cromossomos em uma fase da divisão celular e seus respectivos alelos.

Tamanho: px
Começar a partir da página:

Download "BIOLOGIA. 08. O desenho ilustra os cromossomos em uma fase da divisão celular e seus respectivos alelos."


1 BIOLOGIA CURSO APOIO 08. O desenho ilustra os cromossomos em uma fase da divisão celular e seus respectivos alelos. a) Qual fase da divisão celular está representada? Justifique sua resposta. b) Ao final da divisão celular, qual será a constituição genotípica da célula formada? Justifique sua resposta. a) Está representada a metáfase da mitose porque se observa os cromossomos homólogos alinhados e não emparelhados no plano médio (equador) da célula e também porque cada cromossomo do par de homólogos está ligado a uma fibra do fuso diferente. b) A constituição genética da célula formada será AaBbEe. Na divisão celular por mitose as células resultantes têm cromossomos simples (com uma só cromátide) e são iguais entre si e à célula original (mãe). 1

2 UFTM JAN/13 PSICOLOGIA 09. As imagens representam duas espécies de anfíbios do gênero Dendrobates. Esses animais apresentam características adaptativas que os diferenciam dos répteis e suas cores se destacam numa floresta. a) Considerando-se a reprodução, o que diferencia um anfíbio de um réptil? b) É possível imaginar que as cores desses animais não sejam adaptativas em uma floresta. Justifique, do ponto de vista da teoria darwinista, a existência desses anfíbios nesse ambiente. a) Nos anfíbios a fecundação é externa, não há ovo com casca e tem apenas saco vitelínico como anexo embrionário. Nos répteis a fecundação é interna, há ovo com casca e alem do anexo embrionário saco vitelínico tem também o âmnio, o cório e o alantóide. b) A adaptação desses animais não é em relação à floresta, mas, em relação aos predadores. Do ponto de vista darwinista as cores vivas servem para destacá-los no ambiente e serem vistos por outros animais. Essas cores, na natureza, são cores de advertência, indicando a possíveis predadores que são venenosos ou que têm gosto ruim, sendo assim, são poupados de ataques. Nota-se, portanto, uma adaptação positiva em relação à seleção natural. Outra adaptação positiva é a visibilidade deles por outros da mesma espécie na época da reprodução, garantindo, assim, a perpetuação da espécie e com os indivíduos mais bem adaptados. 2

3 CURSO APOIO 10. A ingestão de bebida alcoólica está aumentando entre os jovens. Quando não destrói o glutamato, um neurotransmissor envolvido no raciocínio e no movimento, o álcool pode dificultar as reações que ocorrem nas sinapses nervosas. O álcool também pode interferir na atividade hepática e renal. a) Explique o que se entende por sinapse nervosa e qual o papel dos neurotransmissores nesse local. b) O álcool pode provocar uma resposta fisiológica nos rins. Indique a curva que representaria essa reação e explique por que isso ocorre. a) Sinapse nervosa é a passagem do estímulo nervoso do axônio de um neurônio para os dendritos de outro neurônio. Como não há contato direto entre neurônios, os neurotransmissores servem de pontes para o estímulo nervoso passar de um neurônio para outro. b) A curva que representaria uma resposta fisiológica nos rins é a curva D. Essa reação ocorre porque a ingestão de álcool em excesso inibe a ação do Hormônio Anti-Diurético (ADH) que controla a reabsorção da água nos rins. Com a inibição da ação desse hormônio, diminui a reabsorção renal de água nos tubos renais, aumentando a diurese. 3

4 UFTM JAN/13 PSICOLOGIA 11. O feijoeiro, a samambaia, o musgo e o pinheiro são os principais exemplos dos grandes grupos vegetais. Assim, podem-se organizar esses diferentes grupos em uma simplificada chave de identificação, como ilustrada a seguir. a) Considere que as características indicadas por A, B e C sejam, respectivamente, tecidos condutores de seiva, produção de grão de pólen e produção de ovário, e que o sinal + indique a presença e o sinal a ausência da característica. Quais das plantas citadas seriam indicadas por 1, 2, 3 e 4, respectivamente? b) A maioria das plantas pode realizar o ciclo reprodutivo chamado metagênese ou alternância de gerações. Explique de forma sequencial como ocorre a alternância entre as fases de esporófito e de gametófito. a) Seriam indicadas, respectivamente por 1, 2, 3 e 4 o feijoeiro (1), o pinheiro (2), a samambaia (3) e o musgo (4). b) O esporófito produz esporo, por meiose,e esse, através de mitoses, germina e produz o gametófito. O gametófito produz gametas, por mitoses, que, por fecundação, produz o zigoto que irá germinar, por mitoses, e formar o esporófito 4

5 12. A figura mostra os órgãos do sistema reprodutor masculino. CURSO APOIO De acordo com as estruturas apontadas e a sua fisiologia, responda: a) Qual número indica a estrutura que é seccionada durante a realização da vasectomia? Explique por que esse método é considerado contraceptivo. b) Explique por que um homem esterilizado pela vasectomia não consegue ser pai, porém elimina sêmen e continua produzindo testosterona. a) A estrutura que é seccionada durante a realização da vasectomia é a de número 3. Esse método é considerado contraceptivo porque impede a liberação dos espermatozóides durante a ejaculação. b) Não consegue ser pai porque não libera espermatozóides juntamente com o sêmen que, agora, é formado por apenas líquido seminal e líquido prostático e continua produzindo a testosterona porque esse hormônio é produzidos nos testículos que continuam intactos e funcionais após a vasectomia. 5

6 UFTM JAN/ A tabela fornece alguns dados do código genético. PSICOLOGIA Considere uma sequência de nucleotídeos presentes em um gene de determinado fungo: 5 GCTACGGTTCGGAAGGGAAGGTAACTC3 a) Uma vez identificado o códon de iniciação, suponha que um ribossomo faça a tradução da molécula de RNA sintetizada, a partir da molécula acima, da esquerda para a direita, até encontrar o códon de parada. Indique a sequência de aminoácidos que será codificada a partir do gene fornecido. Quantos nucleotídeos compõem esse gene? b) Suponha que uma mutação provoque a substituição do 12.º nucleotídeo do gene pelo nucleotídeo timina. Após essa mutação, percebe-se que ela não foi deletéria. Explique por que isso é possível. a) DNA: 5 GCTACGGTTCGGAAGGGAAGGTAACTC3 RNA-m imaturo: CGAUGCCAAGCCUUCCCUUCCAUUGAG O RNA-m maduro será AUG CCA AGC CUU CCC UUC CAU UGA AUG = códon de iniciação; UGA= códon de parada. b) Porque, de acordo com a propriedade do código genético denominada degeneração, códons diferentes podem codificar o mesmo aminoácido na tradução proteica e a mudança da 12ª base nitrogenada do gene mudou o códon do RNA-m (de CUU para CUA), porém, não mudou o aminoácido codificado (leucina). A sequência de aminoácidos que será codificada é: metionina prolina serina leucina prolina fenilalanina histidina. Esse gene ativo é composto por 21 nucleotídeos, não levando em consideração o códon de parada; se levar em consideração o códon de parada são 24 nucleotídeos no gene ativo. 6

7 CURSO APOIO 14. Árvores são atacadas por cupins. Esses pequenos animais ingerem a madeira rica em celulose e conseguem os nutrientes, graças à presença de protozoários simbiontes no interior do tubo digestório. a) Desenhe uma pirâmide de número e outra de energia, de modo que expressem a cadeia alimentar composta pelos seres vivos citados. b) Explique por que a relação entre as árvores e os cupins é denominada parasitismo e por que a relação entre os protozoários e os cupins é denominada mutualismo. a) b) A relação entre as árvores e os cupins é denominada parasitismo porque os cupins vivem às custas das árvores causando prejuízos, até matá-las. A relação entre os protozoários e os cupins é denominada mutualismo porque há uma troca de favores de maneira obrigatória entre essas espécies associadas.. 7


GABARITO - BIOLOGIA - Grupos A e B 1 a QUESTÃO: (2,0 pontos) Avaliador Revisor A figura abaixo representa um trecho da fita codificante de uma molécula de DNA que codifica um segmento peptídico de seis aminoácidos. A seta 1 indica o local

Leia mais

Aula 2 Os vegetais Talófita : Briófitas: Pteridófita:

Aula 2 Os vegetais Talófita : Briófitas: Pteridófita: Aula 2 Os vegetais O reino Plantae (ou Metaphyta) está representado por uma enorme diversidade de espécies, como algas, musgos, samambaias, pinheiros, mangueiras. São classificadas de acordo com a presença

Leia mais

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B100010RJ Observe o esquema abaixo. 46 23 46 23 46 23 23 Disponível em: . Acesso

Leia mais

Questão 89. Questão 91. Questão 90. alternativa A. alternativa E

Questão 89. Questão 91. Questão 90. alternativa A. alternativa E Questão 89 O esquema representa o sistema digestório humano e os números indicam alguns dos seus componentes. Nível de açúcar no sangue mg/100ml 200 150 100 50 B A 0 1 2 3 4 5 Número de horas após a alimentação

Leia mais

PlanetaBio Resolução de Vestibulares UFRJ 2009 2ª fase

PlanetaBio Resolução de Vestibulares UFRJ 2009 2ª fase 1- O gráfico a seguir mostra as fases do ciclo ovariano que ocorre ao longo do ciclo de menstruação de uma mulher. Sabe-se que um óvulo pode viver até 48 horas e os espermatozóides podem viver até cinco

Leia mais

Questão 1. Questão 2. Questão 3. Resposta. Resposta

Questão 1. Questão 2. Questão 3. Resposta. Resposta Questão 1 Os esquemas representam cortes transversais de regiões jovens de uma raiz e de um caule de uma planta angiosperma. Alguns tecidos estão identificados por um número e pelo nome, enquanto outros

Leia mais

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº . 3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº Valor: 10 Nota:. 1. (Uel 2015) Leia o texto a seguir. Quando se fala em divisão celular, não

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

1 a QUESTÃO: (2,0 pontos) Avaliador Revisor

1 a QUESTÃO: (2,0 pontos) Avaliador Revisor 1 a QUESTÃO: (2,0 pontos) Avaliador Revisor Na Música Popular Brasileira (MPB), podem ser encontrados alguns temas de Biologia, os quais não estão devidamente conceituados como, por exemplo, no fragmento

Leia mais


EXAME DISCURSIVO 2ª fase EXAME DISCURSIVO 2ª fase 30/11/2014 Biologia Caderno de prova Este caderno, com dezesseis páginas numeradas sequencialmente, contém dez questões de Biologia. Não abra o caderno antes de receber autorização.

Leia mais

Exercícios de Reprodução Comparada

Exercícios de Reprodução Comparada Exercícios de Reprodução Comparada Material de apoio do Extensivo 1. (PUC) Os seres vivos podem reproduzir-se sexuada ou assexuadamente. Sobre este assunto, destaque a afirmativa correta: a) A reprodução

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

a) Que característica do coração dos mamíferos impede a mistura do sangue venoso e arterial?

a) Que característica do coração dos mamíferos impede a mistura do sangue venoso e arterial? Q.01 Os esquemas representam cortes transversais de regiões jovens de uma raiz e de um caule de uma planta angiosperma. Alguns tecidos estão identificados por um número e pelo nome, enquanto outros estão

Leia mais

Vestibular 2013. 005. Prova de Conhecimentos Específicos e produção de texto. Fase. Confira seus dados impressos neste caderno.

Vestibular 2013. 005. Prova de Conhecimentos Específicos e produção de texto. Fase. Confira seus dados impressos neste caderno. Vestibular 2013 Segunda Fase Assinatura do candidato 005. Prova de Conhecimentos Específicos e produção de texto Confira seus dados impressos neste caderno. Assine com caneta de tinta azul ou preta apenas

Leia mais

EXERCÍCIOS EXTRAS REINO PLANTAE Professora: Giselle Cherutti - Ensino Fundamental II - 7º ano

EXERCÍCIOS EXTRAS REINO PLANTAE Professora: Giselle Cherutti - Ensino Fundamental II - 7º ano EXERCÍCIOS EXTRAS REINO PLANTAE Professora: Giselle Cherutti - Ensino Fundamental II - 7º ano 1. As briófitas são plantas que possuem pequeno porte. A característica que impede que essas plantas atinjam

Leia mais

PlanetaBio Resolução de Vestibulares FUVEST 2010 1ª fase

PlanetaBio Resolução de Vestibulares FUVEST 2010 1ª fase 1- O Índice de Massa Corporal (IMC) é o número obtido pela divisão da massa de um indivíduo adulto, em quilogramas, pelo quadrado da altura, medida em metros. É uma referência adotada pela Organização

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015.

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Aula 5 Reprodução das Angiospermas

Aula 5 Reprodução das Angiospermas Aula 5 Reprodução das Angiospermas Nas angiospermas, o esporófito é formado por raízes, caule, folhas, flores, frutos e sementes. As flores são folhas modificadas, preparadas para a reprodução das angiospermas.

Leia mais

b) As enzimas lisossômicas são proteínas produzidas pelos ribossomos e por comando genético.

b) As enzimas lisossômicas são proteínas produzidas pelos ribossomos e por comando genético. 1 BIOLOGIA Certas doenças hereditárias decorrem da falta de enzimas lisossômicas. Nesses casos, substâncias orgânicas complexas acumulam-se no interior dos lisossomos e formam grandes inclusões que prejudicam

Leia mais

b) a transpiração estomatar e a força de adesão das moléculas de água com as paredes dos vasos liberianos.

b) a transpiração estomatar e a força de adesão das moléculas de água com as paredes dos vasos liberianos. 21 c BIOLOGIA A figura mostra a subida da água, desde a raiz até as folhas. Essa subida envolve principalmente: a) a transpiração cuticular e a força de coesão das moléculas de água. b) a transpiração

Leia mais

Fuvest 2005 2ª fase BIOLOGIA

Fuvest 2005 2ª fase BIOLOGIA Fuvest 2005 2ª fase BIOLOGIA 1. Os esquemas representam cortes transversais de regiões jovens de uma raiz e de um caule de uma planta angiosperma. Alguns tecidos estão identificados por um número e pelo

Leia mais


BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Resposta: No terço externo das tubas uterinas (=trompas, ovidutos, trompas de Falópio) Tubas uterinas útero endométrio

Resposta: No terço externo das tubas uterinas (=trompas, ovidutos, trompas de Falópio) Tubas uterinas útero endométrio 1 a Questão: (15 pontos) Uma mulher de 30 anos tem um ciclo padrão de 28 dias e deseja engravidar. A data da última menstruação foi no dia 1 o do mês passado. Suas dosagens hormonais estão normais. a)

Leia mais

Tradicionalmente, as plantas têm sido divididas em dois grandes grupos:

Tradicionalmente, as plantas têm sido divididas em dois grandes grupos: INTRODUÇÃO À BOTÂNICA CARACTERÍSTICAS GERAIS O Reino vegetal reúne as plantas ou vegetais, tais como, musgos, samambaias, pinheiros, árvores, arbustos, etc. São organismos eucariontes, multicelulares e

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais


ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais


BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA A prova aplicada pela UFPR 2012 apresentou boa distribuição das diferentes áreas do conhecimento biológico. As questões exigiram que o candidato apresentasse organização

Leia mais


CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais


BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais


EXERCÍCIOS PARA O 8 ANO (2015) EXERCÍCIOS PARA O 8 ANO (2015) 1- A Fábrica Celular Células de bactérias (procarióticas) e células animais (eucarióticas), apresentam semelhanças e diferenças. a) Qual a estrutura presente em ambas que

Leia mais

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular.

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular. Módulo Núcleo Exercícios de Aula 1) O envelope nuclear encerra o DNA e define o compartimento nuclear. Assinale a afirmativa INCORRETA sobre o envelope nuclear. a) É formado por duas membranas concêntricas

Leia mais

Professor Fernando Stuchi

Professor Fernando Stuchi REPRODUÇÃO Aulas 2 a 5 1º Bimestre Professor Fernando Stuchi Seres Vivos Segundo a Teoria Celular, todos os seres vivos (animais e vegetais) são constituídos por células (exceção dos vírus que não possuem

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

BIOLOGIA. Consumidores Primários. Consumidores Secundários. Consumidores Terciários III

BIOLOGIA. Consumidores Primários. Consumidores Secundários. Consumidores Terciários III 46 c Em vários córregos existentes na periferia de uma cidade, foram encontradas larvas denominadas miracídios. Essas larvas dariam segmento ao ciclo de vida do verme 1 se pudessem se instalar no corpo

Leia mais

a) Que característica do coração dos mamíferos impede a mistura do sangue venoso e arterial?

a) Que característica do coração dos mamíferos impede a mistura do sangue venoso e arterial? Q.01 Os esquemas representam cortes transversais de regiões jovens de uma raiz e de um caule de uma planta angiosperma. Alguns tecidos estão identificados por um número e pelo nome, enquanto outros estão

Leia mais

BIOLOGIA. 02 A afirmação O tecido ósseo pode ser citado como o único exemplo de tecido que não possui células vivas pode ser classificada como

BIOLOGIA. 02 A afirmação O tecido ósseo pode ser citado como o único exemplo de tecido que não possui células vivas pode ser classificada como BIOLOGIA 01 O crescimento externo dos artrópodes ocorre pelo processo denominado ecdise, caracterizado pela troca do exoesqueleto. Assinale o gráfico que melhor representa o crescimento desses animais.

Leia mais

De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um

De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um indivíduo. 01) Considerando-se um indivíduo AaBbcc pode-se

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Segundo a classificação de Whittaker (1969), as plantas são organismos eucariontes, multicelulares, autótrofos, que realizam fotossíntese.

Segundo a classificação de Whittaker (1969), as plantas são organismos eucariontes, multicelulares, autótrofos, que realizam fotossíntese. 1 2 Segundo a classificação de Whittaker (1969), as plantas são organismos eucariontes, multicelulares, autótrofos, que realizam fotossíntese. Neste caso, incluem-se as algas multicelulares (Chlorophyta,

Leia mais



Leia mais

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA...

A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA... Atividade extra Fascículo 4 Biologia Unidade 9 Questão 1 A função básica do ciclo celular das células somáticas é duplicar todo o conteúdo de DNA. O processo de divisão celular é composto por cinco etapas:

Leia mais

e) O indivíduo X é o esporófito proveniente da multiplicação celular mitótica.

e) O indivíduo X é o esporófito proveniente da multiplicação celular mitótica. Aula n ọ 05 01. A meiose é um processo de divisão celular que ocorre na natureza e que visa à produção de esporos ou gametas. Esta divisão celular produz células-filhas com a metade dos cromossomos da

Leia mais


COLÉGIO XIX DE MARÇO excelência em educação PROVA DE RECUPERAÇÃO ANUAL DE CIÊNCIAS COLÉGIO XIX DE MARÇO excelência em educação 2012 PROVA DE RECUPERAÇÃO ANUAL DE CIÊNCIAS Aluno(a): Nº Ano: 8º Turma: Data: / /2013 Nota: Professor(a): Karina Valor da Prova: 90 pontos MATUTINO: Orientações

Leia mais


BIOLOGIA - 1 o ANO MÓDULO 41 APARELHO REPRODUTOR MASCULINO BIOLOGIA - 1 o ANO MÓDULO 41 APARELHO REPRODUTOR MASCULINO Como pode cair no enem? (PUC) A produção do hormônio luteinizante estimula as células intersticiais ou de Leydig a liberar um hormônio que,

Leia mais

b) Justifique sua resposta. Resolução a) A afirmação não é válida. b) Os vírus são parasitas obrigatórios de células procarióticas

b) Justifique sua resposta. Resolução a) A afirmação não é válida. b) Os vírus são parasitas obrigatórios de células procarióticas 1 BIOLOGIA Devido ao fato de serem muito simples em termos de organização, podemos afirmar que os vírus provavelmente tiveram sua origem antes do surgimento das primeiras células procarióticas. a) A afirmação

Leia mais

BIOLOGIA. (cada questão vale até cinco pontos) Questão 01

BIOLOGIA. (cada questão vale até cinco pontos) Questão 01 BIOLOGIA (cada questão vale até cinco pontos) Questão 01 O Chester é uma variedade de frango obtida por melhoramento genético, que se caracteriza por possuir maior massa muscular no peito e nas coxas.

Leia mais


BIOLOGIA - 3 o ANO MÓDULO 37 REPRODUTOR MASCULINO BIOLOGIA - 3 o ANO MÓDULO 37 REPRODUTOR MASCULINO Bexiga urinária Vesícula seminal Canal deferente Osso Púbis Pênis Uretra Corpos cavernosos Glande peniana Prepúcio Escroto Testículo Glândula bulbouretal

Leia mais

BOTÂNICA PARTE I Ramo da biologia que estuda as plantas. Briófita & Pteridófita

BOTÂNICA PARTE I Ramo da biologia que estuda as plantas. Briófita & Pteridófita BOTÂNICA PARTE I Ramo da biologia que estuda as plantas. Briófita & Pteridófita BOTÂNICA (Reino Plantae) Para pertencer ao grupo das plantas o organismo deve: Ter raiz, caule e folha; Ser autótrofo fotossintetizante

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a):

COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a): COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a): Trabalho de Recuperação Data: / /15 1. O sistema endócrino é formado por glândulas endócrinas e de secreção

Leia mais

Núcleo Celular. Carlos Moura

Núcleo Celular. Carlos Moura Núcleo Celular Carlos Moura Características do núcleo: Descoberta do núcleo celular por Robert Brown 1833; Presente nas células eucariontes; Delimitado pelo envoltório celular Carioteca. Regular as reações

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam

Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características hereditárias desse estudante que são influenciadas

Leia mais

Questão 13. Questão 15. Questão 14. alternativa E. alternativa C

Questão 13. Questão 15. Questão 14. alternativa E. alternativa C Questão 13 A cidade de São Paulo, atravessada por dois grandes rios, Tietê e Pinheiros, e seus inúmeros afluentes, é freqüentemente assolada por grandes enchentes nos períodos chuvosos. Após as enchentes,

Leia mais

e) do grupo A são hermafroditas, do grupo B apresentam

e) do grupo A são hermafroditas, do grupo B apresentam 13 c Considerando aspectos gerais da biologia de algumas espécies animais, tem-se o grupo A representado por espécies monóicas, como minhocas e caracóis; o grupo B, por espécies que apresentam desenvolvimento

Leia mais

TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres. INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade

TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres. INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade Todas as pessoas são diferentes, cada um é único, apresentam características que são próprias

Leia mais


REPRODUÇÃO MECANISMO DE PERPETUAÇÃO DAS ESPÉCIES REPRODUÇÃO MECANISMO DE PERPETUAÇÃO DAS ESPÉCIES Reprodução: Mecanismo pelo qual os seres vivos se multiplicam. Duas modalidades de reprodução: SEXUADA ASSEXUADA REPRODUÇÃO SEXUADA Eventos fundamentais:

Leia mais


CIÊNCIAS DA NATUREZA REVISÃO 1 REVISÃO 2 INTERATIVIDADE SISTEMA SOLAR SISTEMA SOLAR 2 Aula de Revisão 1 Planeta terra Somos todos habitantes do planeta Terra. É nosso dever mantê-lo habitável. 3 Planeta Terra habitável 4 Planeta Terra não habitável 5 Dicas para cuidar melhor

Leia mais


SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII Título do Podcast Área Segmento Duração Por que você se parece com sua avó? A genética vai ajudá-lo a entender como isso é possível! Ciências Ciências da Natureza

Leia mais

Exercícios de Monera e Principais Bacterioses

Exercícios de Monera e Principais Bacterioses Exercícios de Monera e Principais Bacterioses 1. (Fuvest) O organismo A é um parasita intracelular constituído por uma cápsula protéica que envolve a molécula de ácido nucléico. O organismo B tem uma membrana

Leia mais

Lista de Exercícios. Aluno(a): Nº. Pré Universitário Uni-Anhanguera. Disciplina: Biologia

Lista de Exercícios. Aluno(a): Nº. Pré Universitário Uni-Anhanguera. Disciplina: Biologia Lista de Exercícios Pré Universitário Uni-Anhanguera Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Biologia 1) (UFMG) Estes animais costumam estar presentes no dia-a-dia dos seres humanos:

Leia mais

Questão 16. Questão 18. Questão 17. alternativa C. alternativa E. alternativa C

Questão 16. Questão 18. Questão 17. alternativa C. alternativa E. alternativa C Questão 16 Certos fármacos, como a colchicina, ligam-se às moléculas de tubulina e impedem que elas se associem para formar microtúbulos. Quando células em divisão são tratadas com essas substâncias, a

Leia mais

PlanetaBio Resolução de Vestibulares UFRJ 2007

PlanetaBio Resolução de Vestibulares UFRJ 2007 1-O gráfico a seguir mostra como variou o percentual de cepas produtoras de penicilinase da bactéria Neisseria gonorrhoeae obtidas de indivíduos com gonorréia no período de 1980 a 1990. A penicilinase

Leia mais


FISIOLOGIA RENAL EXERCÍCIOS DE APRENDIZAGEM EXERCÍCIOS DE APRENDIZAGEM FISIOLOGIA RENAL 01. A sudorese (produção de suor) é um processo fisiológico que ajuda a baixar a temperatura do corpo quando está muito calor ou quando realizamos uma atividade

Leia mais

Esse raciocínio é correto e não serve apenas para a espécie humana. Todas as espécies de seres vivos realizam a reprodução para a continuação da vida.

Esse raciocínio é correto e não serve apenas para a espécie humana. Todas as espécies de seres vivos realizam a reprodução para a continuação da vida. Você sabe qual é a importância da reprodução humana? Se alguém lhe perguntasse isso você responderia rapidamente: Para a manutenção ou perpetuação da espécie. Esse raciocínio é correto e não serve apenas

Leia mais

Ciclos de Vida Unidade e diversidade

Ciclos de Vida Unidade e diversidade Aula nº 24_12-Nov Prof. Ana Reis 2008 Ciclos de Vida Unidade e diversidade Unidade vs. Diversidade dos ciclos de vida Uma das características inerentes aos seres vivos é a sua capacidade de reprodução.

Leia mais

46. Com relação à pequena circulação, assinale a afirmativa CORRETA:

46. Com relação à pequena circulação, assinale a afirmativa CORRETA: 2 o PROCESSO SELETIVO/2005 2 O DIA GABARITO 1 29 BIOLOGIA QUESTÕES DE 46 A 60 46. Com relação à pequena circulação, assinale a afirmativa CORRETA: a) A artéria pulmonar sai do ventrículo esquerdo e transporta

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

Disciplina: Ciências Professor (a): Sueli Costa Ano: 9º Turmas: 91 e 92

Disciplina: Ciências Professor (a): Sueli Costa Ano: 9º Turmas: 91 e 92 Rede de Educação Missionárias Servas do Espírito Santo Colégio Nossa Senhora da Piedade Av. Amaro Cavalcanti, 2591 Encantado Rio de Janeiro / RJ CEP: 20735042 Tel: 2594-5043 Fax: 2269-3409 E-mail:

Leia mais


AGUARDE O AVISO PARA INICIAR SUA PROVA A 2 a etapa Instruções ao candidato O tempo disponível para realizar as provas dos dois cadernos que você recebeu o das provas específicas e o da redação é de quatro horas e trinta minutos. Verifique se

Leia mais

7ª série / 8º ano 2º bimestre U. E. 10

7ª série / 8º ano 2º bimestre U. E. 10 7ª série / 8º ano 2º bimestre U. E. 10 Tipos de reprodução Reprodução é a capacidade que os seres vivos têm de gerar descendentes da mesma espécie. A união dos gametas é chamada fecundação, ou fertilização,

Leia mais

Sabendo-se que: - a afidicolina inibe a enzima DNA polimerase. - a colchicina inibe a polimerização das subunidades que formam os microtubulos.

Sabendo-se que: - a afidicolina inibe a enzima DNA polimerase. - a colchicina inibe a polimerização das subunidades que formam os microtubulos. SECRETARIA DE SEGURANÇA PÚBLICA/SECRETARIA DE EDUCAÇÃO POLÍCIA MILITAR DO ESTADO DE GOIÁS COMANDO DE ENSINO POLICIAL MILITAR COLÉGIO DA POLÍCIA MILITAR SARGENTO NADER ALVES DOS SANTOS SÉRIE/ANO: 9º Ano

Leia mais


PROFESSOR GUILHERME BIOLOGIA Laranjeiras do Sul: Rua 7 de Setembro, 1930. Fone: (42) 3635 5413 Quedas do Iguaçu: Pça. Pedro Alzide Giraldi, 925. Fone: (46) 3532 3265 / PROFESSOR

Leia mais

Questão 1. Questão 3. Questão 2 1ª PARTE: QUESTÕES OBJETIVAS. alternativa E. alternativa B. A, B e C pertenceriam, respectivamente, a organismos

Questão 1. Questão 3. Questão 2 1ª PARTE: QUESTÕES OBJETIVAS. alternativa E. alternativa B. A, B e C pertenceriam, respectivamente, a organismos 1ª PARTE: QUESTÕES OBJETIVAS Questão 1 O exame de um epitélio e do tecido nervoso de um mesmo animal revelou que suas células apresentam diferentes características. Isso ocorre porque a) as moléculas de

Leia mais

Utilize-se das informações acima e de seus conhecimentos sobre esse assunto e assinale a melhor resposta a ser fornecida pelo ginecologista:

Utilize-se das informações acima e de seus conhecimentos sobre esse assunto e assinale a melhor resposta a ser fornecida pelo ginecologista: Avaliação: Aluno: Data: Ano: Turma: Professor: Biologia Questão 1 A questão da fertilização é muito discutida hoje na mídia, principalmente em programas que visam a informação para leigos interessados

Leia mais

Corresponde ao local de cada gene em específico. Em um mesmo cromossomo há vários genes, cada um com sua localização específica.

Corresponde ao local de cada gene em específico. Em um mesmo cromossomo há vários genes, cada um com sua localização específica. Espiralização do Cromossomo O material genético (DNA) encontra-se associado a proteínas, formando histonas, que vão se enrolando e formam a cromatina. Quando a cromatina está no nível máximo de espiralização,

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: Telefone: (16) 3373-9159 O processo da

Leia mais


GABARITO DE BIOLOGIA FRENTE 3 Módulo 09 GABARITO DE BIOLOGIA FRENTE 3 Quando ocorre o fechamento dos estômatos a condução de seiva bruta fica prejudicado bem como a entrada de gás carbônico para o processo fotossintético. 02. C O deslocamento

Leia mais


CURSO APOIO BIOLOGIA RESOLUÇÃO BIOLOGIA CURSO APOIO 01. As florestas vêm retardando o processo de aquecimento global, pelo fato de utilizarem uma das substâncias responsáveis por esse fenômeno. As árvores absorvem parte dos gases liberados

Leia mais


COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Biologia Celular. Exercícios Objetivos

Biologia Celular. Exercícios Objetivos Exercícios Objetivos 1. (2000) Em um organismo, células musculares e células nervosas diferem principalmente por: (a) possuírem genes diferentes. (b) possuírem ribossomos diferentes. (c) possuírem cromossomos

Leia mais



Leia mais

EXERCÍCIOS DE REVISÃO 1ª VP4 de Ciências 6ª SÉRIE 1ª ETAPA. Professora: Alexsandra Ribeiro

EXERCÍCIOS DE REVISÃO 1ª VP4 de Ciências 6ª SÉRIE 1ª ETAPA. Professora: Alexsandra Ribeiro CONTEÚDO: CAP. 1, 2 e 3 EXERCÍCIOS DE REVISÃO 1ª VP4 de Ciências 6ª SÉRIE 1ª ETAPA Professora: Alexsandra Ribeiro 1. O esquema abaixo nos mostra como a vida está organizada no planeta. A complexidade da

Leia mais


UNICAMP - 2005. 2ª Fase BIOLOGIA BERNOULLI COLÉGIO E PRÉ-VESTIBULAR UNICAMP - 2005 2ª Fase BIOLOGIA BERNOULLI COLÉGIO E PRÉ-VESTIBULAR Biologia Questão 01 O amido nas plantas pode ser facilmente detectado porque, em presença de uma solução fraca de iodo, apresenta coloração

Leia mais


UFJF CONCURSO VESTIBULAR 2012-2 GABARITO DA PROVA DE BIOLOGIA Questão 1 Sobre as mitocôndrias, responda: a) Através da análise de DNA, demonstrou-se que muitos genes da bactéria Rickettsia prowazekii, que causa um tipo de febre, são parecidos com os genes das mitocôndrias.

Leia mais

BIOLOGIA 2ª Série do Ensino Médio Atividades direcionadas Prova final - 2011

BIOLOGIA 2ª Série do Ensino Médio Atividades direcionadas Prova final - 2011 Para a prova final da 2ª Série do Ensino Médio, o aluno deverá ser capaz de: Interpretar árvores filogenéticas; Identificar as principais características dos grupos vegetais; Identificar as principais

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo.

Dra. Kátia R. P. de Araújo Sgrillo. Dra. Kátia R. P. de Araújo Sgrillo São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

Questões complementares

Questões complementares Questões complementares 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares entre

Leia mais

Exercícios Genética e sistema imunitário. Professora: Ana Paula Souto

Exercícios Genética e sistema imunitário. Professora: Ana Paula Souto Exercícios Genética e sistema imunitário Professora: Ana Paula Souto Nome: n o : Turma: 1) Cite as diferenças entre mitose e meiose. Relacione o número de cromossomos da célulamãe com o das células-filhas.

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais


CIÊNCIAS 8º ano 3º Trimestre / 2015 BATERIA DE EXERCÍCIOS COMPLEMENTARES CIÊNCIAS 8º ano 3º Trimestre / 2015 BATERIA DE EXERCÍCIOS COMPLEMENTARES 1. Quais as camadas que formam a pele? 2. De que tecidos a pele se compõe? 3. Qual a função da melanina e da queratina? 4. Que glândulas

Leia mais

BIOLOGIA. Pulmões. I II III IV Coração. Tecidos do Corpo

BIOLOGIA. Pulmões. I II III IV Coração. Tecidos do Corpo BIOLOGIA Questão 01 Com relação ao Sistema Cardiovascular e com base no esquema abaixo, cujas setas indicam o trajeto do sangue no corpo, assinale a(s) proposição(ões) CORRETA(S). Pulmões A C I II III

Leia mais

1. (Ufg 2014) Analise a figura a seguir que representa a gástrula, uma estrutura embrionária.

1. (Ufg 2014) Analise a figura a seguir que representa a gástrula, uma estrutura embrionária. 1. (Ufg 2014) Analise a figura a seguir que representa a gástrula, uma estrutura embrionária. Considerando a figura: a) denomine os folhetos embrionários primordiais X, Y e Z, respectivamente, e identifique

Leia mais

PlanetaBio Resolução de Vestibulares UFRJ 2006

PlanetaBio Resolução de Vestibulares UFRJ 2006 1-No processo evolutivo, centenas de espécies podem ser criadas em um tempo relativamente curto. Esse fenômeno é conhecido como radiação adaptativa. No grupo dos répteis, ocorreu uma grande radiação adaptativa

Leia mais