Unidade 6. Transcrição e regulação da expressão gênica. I. Introdução. II. Do DNA ao RNA. III. Mecanismos de transcrição

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Unidade 6. Transcrição e regulação da expressão gênica. I. Introdução. II. Do DNA ao RNA. III. Mecanismos de transcrição"

Transcrição

1 EIXO BIOLÓGICO

2 Unidade 6 Transcrição e regulação da expressão gênica Autor: Elisângela de Paula Silveira Lacerda I. Introdução II. Do DNA ao RNA III. Mecanismos de transcrição IV. Particularidades da RNAP I e RNAP II V. Processamento de RNA VI. Processamento de rrna VII. Processamento de trna VIII. A regulação da expressão gênica IX. Referências

3 #M3U6 I. Introdução No início dos anos 1950, após a descoberta da estrutura do DNA, pôde-se entender como a informação hereditária nas células é codificada em seqüências de nucleotídeos de DNA. Cinqüenta anos depois, a ciência já dispõe de seqüências completas de genomas de muitos organismos, inclusive humanos, ou seja, conhecemos a quantidade máxima de informação necessária para produzir um organismo complexo como nós mesmos. Nesta unidade, você verá como as células decodificam e usam a informação de seus genomas por meio de quatro diferentes nucleotídeos do DNA. Ainda temos muito a descobrir sobre como a informação armazenada no genoma de um organismo produz desde o mais simples organismo unicelular bacteriano, contendo 500 genes, até o desenvolvimento de um ser humano com aproximadamente 30 mil genes. Uma enorme quantidade de informações ignoradas persiste; portanto, muitos desafios fascinantes aguardam as próximas gerações de biólogos. 258 Módulo III Processos de manutenção da vida

4 Eixo Biológico P BSC B #M3U6 II. Do DNA ao RNA Saiba mais ADN é a abreviatura em português para ácido desoxirribonucleico (em inglês, DNA: deoxyribonucleic acid). RNA é a abreviatura em inglês ribonucleic acid (que em português seria ARN: ácido ribonucléico). O DNA não direciona a síntese protéica diretamente, mas utiliza o RNA como uma molécula intermediária. No início do processo de transcrição, a seqüência de nucleotídeos da porção apropriada de uma longa molécula de DNA em um cromossomo é primeiramente copiada sob forma de RNA. São essas cópias de RNA de segmentos de DNA que são usadas diretamente como moldes para direcionar a síntese da proteína (processo denominado de tradução), que será estudado em um próximo módulo. O fluxo de informação genética nas células é, portanto, de DNA para RNA para proteína (Figura 1). Todas as células, desde a bactéria até os seres humanos, expressam sua informação genética dessa maneira um princípio tão fundamental que é denominado o Dogma Central da Biologia Molecular. Figura 1: do DNA à proteína. A informação genética é lida e processada em duas etapas. Primeiro, na transcrição, os segmentos de uma seqüência de DNA são usados para guiar a síntese de moléculas de RNA. Depois, na tradução, as moléculas de RNA são usadas para guiar a síntese de moléculas de proteínas. Saiba mais Base é uma substância que pode aceitar um próton em solução. As purinas e pirimidinas do DNA e RNA são bases orgânicas nitrogenadas e freqüentemente são referidas simplesmente como bases. Nessa etapa, começaremos com o primeiro passo da decodificação de um genoma: o processo de transcrição pelo qual uma molécula de RNA é produzida, a partir do DNA de um gene. Em uma próxima oportunidade, seguiremos então o destino dessa molécula de RNA, através da célula, finalizando quando a molécula protéica corretamente dobrada tiver sido formada. A transcrição começa com a abertura e a desespiralização de uma pequena porção da dupla hélice de DNA, para expor as bases em cada fita de DNA. Uma das duas fitas da dupla hélice de DNA age, então, como um molde para a síntese de uma molécula de RNA. Assim, como na replicação de DNA, a seqüência de nucleotídeos da cadeia de RNA é determinada pela complementaridade do pareamento de bases entre os nucleotídeos a serem incorporados e o DNA-molde. Para que tudo isso ocorra, ocorre a ação de algumas enzimas, denominadas RNA polimerases. Assim como a DNA polimerase catalisa a replicação do DNA, as RNAs polimerases catalisam a formação de pontes fosfodiéster, que ligam os nucleotídeos entre si para formar uma cadeia linear (Figura 2). Consórcio Setentrional de Ensino a Distância 259

5 # M3U6 Transcrição e regulação da expressão gênica Figura 2: a estrutura química do RNA. (A) O RNA contém o açúcar ribose, o qual difere da desoxirribose, o açúcar utilizado no DNA pela presença de um agrupamento OH adicional. (B) O RNA contém a base uracila, a qual difere da timina, a base equivalente no DNA, pela ausência de um grupo CH3. (C) Um pequeno fragmento de RNA. A ligação química fosfodiéster entre nucleotídeos no RNA é a mesma que ocorre no DNA. A Transcrição é o processo pelo qual uma molécula de RNA é sintetizada a partir de um molde de DNA. Através da transcrição, são sintetizados todos os tipos de RNAs da célula, ou seja, o RNA mensageiro (mrna), o RNA ribossômico (rrna), o RNA transportador (trna) e outros RNAs menores. Todos os RNAs estão envolvidos ativamente na síntese protéica. O mrna será usado para transferir a informação genética do DNA às proteínas, mas os demais RNAs sintetizados têm, por si, funções finais na célula, tanto estruturais como catalíticas (Tabela 1). 260 Módulo III Processos de manutenção da vida

6 Eixo Biológico P BSC B Tabela 1: principais tipos de RNAs produzidos nas células. Tipo de RNA Função mrnas RNAs mensageiros - codificam proteínas rrnas RNAs ribossomais, - formam a estrutura básica do ribossomo e catalisam a síntese protéica. trnas RNAs transportadores elementos essenciais para a síntese protéica, funcionando como adaptadores entre o mrna e os aminoácidos. snrnas Pequenos RNAs nucleares atuam em uma série de processos nucleares, incluindo o splicing do pré-mrna. snornas Pequenos RNAs nucleolares utilizados para processar e modificar quimicamente os rrnas. Outros RNAs não codificantes Atuam em diversos processos celulares, incluindo a síntese de telômeros, a inativação do cromossomo X e o transporte de proteínas para o retículo endoplasmático (ER). É principalmente durante a transcrição que a célula exerce o controle da expressão gênica. Os genes não são transcritos indiscriminadamente, pois esse processo é regulado por proteínas. Na maioria dos casos, o principal ponto de regulação da atividade de um gene é no local onde se inicia ou não a sua transcrição. Existem muitas semelhanças entre a síntese de DNA e a de RNA. Entretanto, a função biológica de cada um desses processos é bastante diferente. A síntese de DNA é bastante precisa e uniforme. Esses conceitos se referem ao fato de que, como o DNA contém a informação genética para a síntese do ser vivo, caso a nova cópia de DNA não fosse uma réplica bastante precisa da original, o novo ser formado provavelmente não existiria. É importante que você perceba que, apesar de todos os mecanismos de reparo Consórcio Setentrional de Ensino a Distância 261

7 # M3U6 Transcrição e regulação da expressão gênica que você verá a seguir, a cópia nunca é exata. Sempre ocorrem erros ocasionais, embora em freqüência muito baixa. E são esses erros que, conhecidos como mutações, permitem a evolução da vida. Em contradição, a transcrição espelha o estado fisiológico da célula. Ela é extremamente variável, transcrevendo somente um gene ou grupo de genes em particular em um dado instante fisiológico. Por outro lado, dependendo da situação metabólica da célula, o mesmo gene pode ser transcrito incontáveis vezes até que a demanda seja suprida. Além da característica temporal da transcrição, esse é um processo extremamente seletivo. Essa seletividade acontece em dois níveis: somente partes do DNA são transcritas para produzir RNA. Por exemplo, nas células da maioria dos mamíferos, somente 1% de toda a seqüência do DNA é copiada para formar seqüências de RNA funcional, e algumas partes do DNA podem nunca ser transcritas; somente uma porção ainda menor da seqüência de nucleotídeos do RNA sobrevive aos passos de processamento, pelos quais o RNA recém-transcrito passa, para se tornar maduro e funcional. Para resumir, a célula restringe a expressão de informação genética para a formação de produtos gênicos que terão utilidade naquele momento especificamente. #M3U6 III. Mecanismos de transcrição A transcrição ocorre a partir da informação contida na seqüência de nucleotídeos de uma molécula de DNA fita dupla, sendo sempre no sentido 5 3. Apenas uma das fitas do DNA, chamada de fita molde, é utilizada durante a síntese, que segue as mesmas regras de complementaridade e antiparalelismo, exceto pelo pareamento de uracil (U), ao invés de timina (T), com adenina (A). O RNA recém-sintetizado (5 3 ) é, portanto, complementar à fita de DNA, que serviu de molde (3 5 ), e idêntico (salvo o aparecimento ocasional de uma mutação, como anteriormente explicado) à outra fita de DNA do duplex (5 3 ). Por convenção, entretanto, a seqüência de nucleotídeos de um gene é sempre representada na orientação 5 3, ou seja, a fita que não serve de molde. Saiba mais Duas seqüências de ácidos nucléicos são ditas complementares se elas podem formar uma dupla hélice com as bases perfeitamente pareadas. Antiparalelismo é a característica que descreve a orientação relativa das duas fitas em uma dupla hélice de DNA; a polaridade de uma fita é orientada na direção oposta da polaridade da outra. Atividade complementar 1 Para que você possa entender melhor o termo sentido 5 3, faça uma revisão do Módulo I, em Estrutura e Função dos ácidos nucléicos. Esse termo está relacionado com a posição dos novos nucleotídeos inseridos na nova molécula a ser formada, por meio da ligação fosfodiéster (Figura 3). Em 1960, foi descoberta uma enzima capaz de, na presença de DNA fita dupla e dos ribonucleotídeos trifosfatados (ATP, CTP, GTP e UTP), sintetizar RNA. Essa enzima foi denominada RNA-polimerase (RNAP). A reação catalisada pelas RNAPs é mecanisticamente idêntica à reação catalisada pelas DNA-polimerases (Figura 3). 262 Módulo III Processos de manutenção da vida

8 Eixo Biológico P BSC B Figura 3: o DNA é transcrito pela enzima RNA polimerase. A RNA polimerase (azul claro) move-se paulatinamente ao longo do DNA, desespiralando, em seu sítio ativo, a hélice de DNA. Conforme avança, a polimerase adiciona nucleotídeos (aqui, pequenos objetos na forma de T ), um a um, à cadeia de RNA, no sítio de polimerização, usando uma fita de DNA exposta como molde. O RNA transcrito é, conseqüentemente, uma cópia complementar, fita simples, de uma das duas fitas do DNA. A polimerase tem uma projeção que desloca o RNA recém-formado, permitindo que as duas fitas de DNA atrás da polimerase voltem a se espiralizar. Uma região curta de hélice DNA/RNA (de aproximadamente nove nucleotídeos) é, portanto, formada temporariamente, e uma janela da hélice DNA/RNA move-se ao longo do DNA, com a polimerase. Os nucleotídeos a serem incorporados estão na forma de ribonucleotídeos trifosfatos (ATP, UTP, CTP E GTP), e a energia estocada em vias ligações fosfato-fosfato fornece a força necessária para a reação de polimerização. As RNAPs desempenham todas as atividades necessárias para a transcrição, pois reconhecem e se ligam a seqüências específicas de DNA. Elas: desnaturam o DNA, expondo a seqüência de nucleotídeos a ser copiada; mantêm as fitas de DNA separadas na região de síntese; mantêm estável o duplex DNA:RNA na região de síntese; restauram o DNA na região imediatamente posterior à da síntese; sozinhas, ou com auxílio de proteínas específicas, terminam a síntese do RNA. Existem, pelo menos, cinco RNAPs diferentes que estão envolvidas na síntese de RNAs específicos: RNAP I, RNAP II, RNAP III, RNAP mitocondrial (mtrnap) e RNAP de cloroplastos. As RNAPs nucleares são abordadas a seguir: RNAP I, que sintetiza os rrnas Essa polimerase catalisa a síntese de apenas um tipo de RNA, precursor dos rrnas 18S, 5,8S e 28S. Entretanto, esse é o RNA mais abundante na célula. Esses pré-rnas são bastante longos, variando de a nucleotídeos. Para responder a essa demanda, a célula possui de 100 a cópias dos genes para rrna, uma ao lado da outra, e sua síntese ocorre em um ponto especializado no núcleo, o nucléolo. Consórcio Setentrional de Ensino a Distância 263

9 # M3U6 Transcrição e regulação da expressão gênica RNA polimerase II, que sintetiza mrna Todos os pré-mrnas das células são sintetizados pela RNAP II que, portanto, transcreve a maior parte dos RNA heterogêneos nucleares (hnrna) precursores dos mrnas. RNAP III, que sintetiza os trna, rrna 5S e outros RNAs Essas polimerases catalisam a síntese de cerca de 10% do RNA da célula, do rrna 5S, dos trnas e de outros pequenos RNAs. Embora consigam sintetizar RNA a partir de nucleotídeos livres, as RNA polimerases sempre trabalham em conjunto com proteínas acessórias, chamadas de fatores de transcrição, que auxiliam o início da transcrição. São esses fatores que identificam ao longo de um gene as seqüências específicas no DNA, que indicam o local de início da transcrição, ou seja, a partir de qual base o gene deve ser copiado em RNA. Como a célula sabe que está na hora de transcrever seu material genético? Os promotores para transcrição no DNA são inicialmente reconhecidos por fatores de transcrição que, ligados ao DNA, interagem com outros fatores, formando um complexo, a qual as RNAPs se associam. Os promotores são, em geral, seqüências de 100 a 200 pb. Eles sempre estão próximos ao sítio de início da transcrição e possuem seqüências consenso, comuns a todos os promotores, reconhecidas pelos fatores de transcrição. Eles são responsáveis por uma transcrição em nível basal muito baixo. Os enhancers são seqüências pequenas de DNA, que podem ocorrer na região 5 do gene, antes do promotor ou após o terminador, e ativam a expressão. Podem estar muito distantes do promotor (até milhares de pb) e ainda assim serem ativados. Alguns desses elementos de regulação dão a especificidade à transcrição, tanto temporal quanto tecido-específico. O processo pode ser dividido em três partes: iniciação, alongamento e terminação. Essas etapas serão detalhadas para os genes transcritos pela RNAP II, genes que codificam proteínas. Iniciação O primeiro passo da transcrição requer regiões reguladoras, acoplamento de fatores de transcrição e fatores de RNAP II. Embora a organização das regiões reguladoras da transcrição por RNAP II varie para os diferentes genes e nos diferentes organismos, existem alguns componentes básicos: elementos que constituem o promotor: 1) sítio de início da transcrição representado pela primeira base a ser transcrita; 2) uma região que inclui uma seqüência conservada TATA Box localizada na região 25, anterior, portanto, ao sítio de início da síntese. Esse elemento determina onde a síntese deve ser iniciada e, normalmente, não afeta os níveis de expressão. É aqui que ocorre o reconhecimento inicial do gene a ser transcrito por parte dos fatores de transcrição; 3) uma região regulatória upstream denominada CAAT Box (consenso GGNCAA- TCT), situada na região 60 a 80. 4) outras seqüências upstream. Aqui e no CAAT Box, ligam-se fatores que aumentam a eficiência de reconhecimento do promotor. Saiba mais TATA Box é a seqüência de consenso na região promotora de vários genes eucarióticos, que se ligam a fatores gerais de transcrição e, portanto, especificam a posição do início da transcrição. enhancers: Esses elementos aumentam a expressão do gene, independentemente da sua orientação, localização (a 5 do promotor ou após o sinal de término da transcrição) e distância do promotor. 264 Módulo III Processos de manutenção da vida

10 P Eixo Biológico BSC B O início da transcrição, em genes que utilizam RNAP II, é complexo e envolve uma cascata, na qual vários fatores de transcrição vão se ligando ao DNA. Primeiramente, há ligação de um fator ao TATA Box. Saiba mais Todos esses detalhes da formação da cascata para iniciação da transcrição pela RNA polimerase II em célula eucariótica, você encontrará em nossa bibliografia indicada. A figura 4 dará uma idéia de toda essa complexidade. Ativador (sítio de ligação para a proteína ativadora) Proteína ativadora TATA box Início da transcrição Ligação dos fatores gerais de transcrição, RNA polimerase, mediador, complexos remodeladores de cromatina e acetilases de histonas. Mediador Complexo remodelador de cromatina INÍCIO DA TRANSCRIÇÃO Acetilase de histona Figura 4: iniciação da transcrição pela RNA polimerase II em uma célula eucariótica. O início da transcrição in vivo necessita da presença de proteínas ativadoras transcricionais. Essas proteínas se ligam a pequenas seqüências específicas no DNA. Embora somente uma seja apresentada aqui, um gene eucariótico típico tem muitas proteínas ativadoras que, juntas, determinam sua taxa de seu padrão de transcrição. Às vezes agindo a uma distância de vários milhares de pares de nucleotídeos (indicado pela molécula de DNA segmentada), essas proteínas reguladoras de genes auxiliam a RNA polimerase, os fatores gerais e o mediador a se associarem no promotor. Além disso, os ativadores atraem complexos remodeladores de cromatina dependentes de ATP e acetilases de histonas. Essa ligação sinaliza para que outros fatores se liguem entre si e a outros elementos do promotor. Quando todos os fatores já estiverem em seus devidos locais, o complexo estará pronto para receber a RNAP II e formar o chamado complexo de iniciação da transcrição. A RNAP II é responsável por abrir as fitas de DNA e colocar a primeira base. Essa abertura das cadeias forma a bolha de transcrição, estrutura que é característica do processo. Para ativar a transcrição, outros fatores ligam-se ao enhancer e interagem com o complexo de iniciação da transcrição. Alongamento É o aumento da cadeia de RNA envolvendo outros fatores acessórios que são necessários. Os fatores utilizados no complexo de iniciação da transcrição são liberados, e a RNAP II sofre alterações na sua conformação. A bolha de transcrição move-se sobre o Consórcio Setentrional de Ensino a Distância 265

11 # M3U6 Transcrição e regulação da expressão gênica molde de DNA, abrindo o DNA à frente e fechando atrás de si. Um duplex híbrido DNA- RNA forma-se dentro da bolha à medida que o RNA é sintetizado. Os erros na seqüência da cadeia produzidos nessa etapa são cuidadosamente corrigidos pela RNA polimerase. Uma peculiaridade irônica e não freqüente descrita sobre a meticulosidade dessa correção é que a RNA polimerase, ao demorar tanto tempo corrigindo seus erros, pode até esquecer de continuar a transcrição. Terminação Muito pouco se conhece sobre o término da transcrição. Sabe-se que todas as três RNAPs terminam a síntese em regiões consenso do DNA ricas em T. Essas regiões são sinais codificados pelo DNA, que indicam onde deve ser a extremidade 3. Esses sinais são reconhecidos por enzimas que se ligam ao RNA, clivando-o para formar a extremidade 3, ou seja, o sítio de clivagem precede essa região consenso. Após a clivagem, esses nucleotídeos que compunham a região consenso sinalizadora para a clivagem são degradados no núcleo. A figura 5, abaixo, dará uma visão geral dos passos que levam do gene à proteína em eucariotos e em bactérias. Figura 5: resumo dos passos que levam do gene à proteína em eucariotos e em bactérias. O nível final de uma proteína em uma célula depende da eficiência de cada passo e das taxas de degradação das moléculas de RNA e de proteína. (A) Nas células eucarióticas, a molécula de RNA produzida por transcrição (às vezes referida como o transcrito primário) pode conter tanto seqüências codificantes (éxon) como não codificantes (íntron). Antes de esse ser traduzido em proteína, as duas extremidades do RNA são modificadas, os íntrons são removidos por uma reação de RNA splicing catalisada enzimaticamente, e o mrna resultante é transportado do núcleo para o citoplasma. Embora esses passos estejam ilustrados como se ocorressem um a um, em uma seqüência, na verdade, eles são articulados, e diferentes passos podem ocorrer simultaneamente. Por exemplo, a capa de RNA é adicionada, e o splicing caracteristicamente inicia antes que a transcrição tenha sido completada. Devido a essa associação, o transcrito primário de RNA completo não existe caracteristicamente na célula. (B) Nos procariotos, a produção de moléculas de mrna é muito mais simples. A extremidade de 5 de uma molécula de mrna é produzida por meio da iniciação da transcrição pela RNA polimerase, e a extremidade 3 é produzida pela terminação da transcrição. Como as células procarióticas não possuem núcleo, a transcrição e a tradução ocorrem em um compartimento comum. De fato, a tradução de um mrna bacteriano freqüentemente inicia antes de sua síntese ter sido completada. 266 Módulo III Processos de manutenção da vida

12 Eixo Biológico P BSC B #M3U6 IV. Particularidades da RNAP I e RNAP II Tanto a RNAP I quanto a RNAP II possuem mecanismos de transcrição semelhantes ao já descrito para RNAP III. Conhece-se, porém, algumas propriedades particulares dessas duas enzimas. Os promotores para RNAP I são geralmente compostos por 2 domínios de atividade: um, localizado entre 45 e +20 (domínio central ou core), e o outro, localizado entre 107 e 186 (domínio upstream). Essa organização é similar em todos os organismos, embora as seqüências específicas desses promotores sejam variadas. A transcrição necessita de, pelo menos, 3 proteínas ou complexos protéicos além da RNAP I. Já os promotores, para RNAP III, são bastante diferenciados daqueles até aqui descritos. Existe um tipo de promotor localizado a 5 de +1 que é mais parecido com os envolvidos com a RNAP II. Além desse promotor, existem outros 2 elementos que se localizam internamente, após o sítio de início de transcrição e dentro da região codificadora, sendo denominados regiões controladoras internas (ICRs). Os dois tipos de ICRs são promotores de trna e de genes RNA 5S. www. Assista esta animação do processo de transcrição para melhor entendimento: #M3U6 V. Processamento de RNA Os diferentes RNAs sintetizados, no processo de transcrição, são chamados de transcritos primários, RNA precursor ou pré-rna. Na maioria das vezes, esses transcritos primários não representam uma molécula de RNA madura, ou seja, aquela cuja seqüência e estrutura correspondem à forma final do RNA funcional. Nesses casos, esses transcritos primários sofrem modificações, as quais chamamos de processamento de RNA. O processamento de RNA inclui alterações do tipo adição, deleção ou modificação de nucleotídeos, ou mesmo de regiões maiores do transcrito primário. Processamento de mrna A molécula de mrna recém-sintetizada no núcleo sofre várias alterações bioquímicas. Assim, transforma-se no que é chamado de mrna maduro ou mrna processado, para, só então, ser transportado ao citoplasma e lá ser traduzido. Esses precursores de mrna são chamados de RNA nuclear heterogêneo (hnrna heterogeneous nuclear RNA). O processamento desses hnrnas envolve modificações de nucleotídeos que acabam por aumentar a estabilidade do mrna e convertê-lo em RNA maduro. Adição do cap a primeira modificação do hnrna ocorre em sua extremidade 5, logo após o início do processo de transcrição. Um resíduo de guanina é ligado covalentemente ao primeiro nucleotídeo do hnrna através de uma ligação fosfato 5-5, com o resíduo de guanina, estando na posição inversa a dos demais nucleotídeos. Essa estrutura é chamada de cap. O cap sofre, então, uma metilação na posição 7 da guanina, resultando no nucleotídeo 7-metilguanilato (m7g). Todas essas reações são Consórcio Setentrional de Ensino a Distância 267

13 # M3U6 Transcrição e regulação da expressão gênica catalisadas por enzimas específicas de cada reação. O cap protege a extremidade 5 do transcrito da ação de exonucleases. Essas enzimas têm a propriedade de cortar ou clivar ácidos nucléicos, conseqüentemente, moléculas de mrna sem cap são rapidamente degradadas. O cap também facilita o splicing do RNA e seu transporte do núcleo para o citoplasma. O cap tem também papel importante na síntese protéica. Adição da cauda de poli A (poliadenilação) a maioria dos mrnas possui uma seqüência de aproximadamente 200 resíduos de adenina na sua extremidade 3, que é chamada de cauda poli A. Essa cauda poli A não está codificada no DNA e não existe nos rrnas e trnas. Ela é adicionada aos hnrnas pela enzima poli A-polimerase. Um aspecto comum a todos pré-rnas mensageiros é a presença da seqüência consenso AAUAAA, localizada entre nucleotídeos antes do sítio de poliadenilação (local onde deve ser adicionado a cauda poli A). Essa seqüência, chamada de seqüência sinal para poliadenilação, é reconhecida por um fator específico que marca o local e permite que ocorra a clivagem por uma endonuclease. A adição da cauda poli A é feita na extremidade 3 OH gerada pela clivagem. Depois que o mrna poliadenilado chega ao citoplasma, a cauda poli A vai diminuindo, com o decorrer do tempo, provavelmente devido à ação de nucleases. A cauda poli A é uma parte importante do processamento, pois facilita o transporte do mrna para o citoplasma e, ao ser lentamente degradada, estabiliza a molécula no citoplasma. Para que você possa visualizar toda essa descrição, acompanhe o esquema das figuras 6 e 7. Figura 6: uma comparação das estruturas de moléculas de mrna procariótico e eucariótico. (A) As extremidades 5 e 3 de um mrna bacteriano são as extremidades não modificadas da cadeia sintetizada pela RNA polimerase, a qual inicia e termina a transcrição naqueles pontos, respectivamente. As extremidades correspondentes de um mrna eucariótico são formadas pela adição de uma capa na extremidade 5 e pela clivagem do transcrito pré-mrna e adição de uma cauda poli-a, respectivamente. A figura também ilustra outra diferença entre os mrnas procarióticos e eucarióticos: os mrnas bacterianos podem conter as instruções para várias proteínas diferentes, enquanto que os mrnas eucarióticos praticamente contêm sempre a informação para uma única proteína. (B) A estrutura da capa na extremidade 5 de moléculas de mrna eucariótico. Observe a ligação incomum 5 - a 5 do 7 metil G ao restante do RNA. Muitos mrnas eucarióticos apresentam uma modificação adicional: um grupamento 2 - hidroxil do segundo açúcar ribose no mrna, o qual é metilado (não ilustrado). 268 Módulo III Processos de manutenção da vida

14 Eixo Biológico P BSC B Figura 7: as reações que capeiam a extremidade 5 de cada molécula de RNA sintetizada pela RNA polimerase II. A capa final contém uma nova ligação 5 - a 5 entre o resíduo 7 metil G positivamente carregado e a extremidade 5 do transcrito de RNA. A letra N representa qualquer um dos quatro ribonucleotídeos, embora o nucleotídeo que comece uma cadeia de erna seja geralmente uma purina (um A ou um G). Existe também a possibilidade da cauda poli A estar relacionada com o reconhecimento da molécula de mrna pelo complexo que posteriormente realizará a tradução. Há um grupo de mrnas que é transportado ao citoplasma e que não possui cauda de poli A. São os mrnas de histonas, as proteínas que participam do empacotamento do DNA. Mesmo sem poli A, a extremidade 3 do hnrna é clivada como descrito anteriormente. Em geral, a clivagem e a poliadenilação precedem a excisão de íntrons do hnrna. Metilação muitos mrnas possuem o nitrogênio 6 dos resíduos de adenina metilado. Essa metilação ocorre apenas nos éxons, antes da retirada dos íntrons do hnrna. Provavelmente, o radical metil serve para proteger as porções do transcrito primário que precisam ser preservadas. Excisão de íntrons (splicing) a maioria dos transcritos primários de mrna apresenta dois tipos de seqüências: os éxons, porção codificadora do transcrito primário que estão presentes no RNA maduro, e os íntrons, seqüências que não estão presentes no RNA maduro, portanto, não codificam nenhum aminoácido da proteína a ser sintetizada. Os íntrons, ao serem retirados, dão origem a um mrna funcional (ou tradutível). Assim, após a adição do cap, da cauda poli A, e, às vezes, a metilação de adeninas, o hnrna sofre o processo de excisão dos íntrons e junção dos éxons. Esse mecanismo é conhecido como splicing do RNA. Para que o splicing ocorra corretamente, existem seqüências consenso sempre presentes localizadas nos íntrons dos mrnas. Essas seqüências sinalizam o local Consórcio Setentrional de Ensino a Distância 269

15 # M3U6 Transcrição e regulação da expressão gênica onde deverá ser efetuado o splicing (chamado de sítio de splice), ou auxiliar na sua localização, e têm características importantes: os primeiros e os últimos dois nucleotídeos da extremidade 5 e 3 dos íntrons são GU e AG, respectivamente; há uma adenina aproximadamente nucleotídeos upstream da extremidade 3 do íntron. Ambas têm um papel importante no processo de splicing. Além dessas seqüências consenso, há uma freqüência maior de algumas bases que estão próximas do sítio de splicing, tanto no éxon como no íntron, e há, também, uma tendência da região próxima à extremidade 3 do íntron ser rica em pirimidinas (U e C). Sem essas seqüências consenso, ocorrem alterações no processo de splicing. Como ocorre o processo de splicing na célula? O processo de splicing envolve a retirada de cada íntron da molécula de hnrna e a união dos éxons, liberando o íntron. A remoção de íntrons envolve a quebra de uma ligação fosfodiéster, na junção éxon com íntron, e a formação de outra, entre as extremidades dos éxons. Esse processo pode ocorrer de duas maneiras: mediado por spliceossomos e auto-splicing. A figura 8 mostra a reação de splicing de RNA. Figura 8: a reação de splicing de RNA. (A) No primeiro passo, um nucleotídeo adenina específico na seqüência do íntron (indicado em vermelho) ataca a região 5 de splicing e corta a estrutura de açúcar-fosfato do RNA neste ponto. A extremidade 5 cortada do íntron torna-se covalentemente ligada ao nucleotídeo de adenina, como mostrado no detalhe em (B), criando, assim, uma alça na molécula de RNA. A extremidade 3 -OH livre e liberada da seqüência do éxon reage com o início da seqüência do éxon seguinte, unindo os dois éxons e liberando a seqüência do íntron na forma de um laço ou de uma alça. Conseqüentemente, as seqüências dos dois éxons se unem, formando uma seqüência codificante contínua. A seqüência do íntron liberado é degradada no momento adequado. 270 Módulo III Processos de manutenção da vida

16 Eixo Biológico P BSC B Atividade complementar 2 Agora chegou o momento de pesquisa e estudo! Consulte os livros da nossa bibliografia indicada e veja como ocorre o processo mediado por spliceossomos e auto-splicing. www. Após o estudo teórico, vemos a necessidade de uma interação melhor com multimídias disponíveis na internet. < E quanto aos processamentos do rrna e o trna, como isso ocorre? #M3U6 VI. Processamento de rrna Sabemos, atualmente, que o nucléolo é a região onde acontece o processamento de rrnas e a sua montagem sob a forma de ribossomos. Diferentemente de outras organelas na célula, o nucléolo não se encontra delimitado por uma membrana, como foi visto em outro módulo; em vez disso, é um grande agregado de macromoléculas, incluindo-se os próprios genes rrna, rrnas precursores, rrnas maduros, enzimas processadoras de rrnas, snornps, subunidades protéicas ribossomais e ribossomos parcialmente montados. A íntima associação de todos esses componentes, presumivelmente, permite que a montagem dos ribossomos ocorra rapidamente e sem erros. O processo de maturação ocorre em várias etapas de clivagem em uma ordem preferencial, mas não obrigatória, sendo a primeira delas a remoção dos espaçadores transcritos externos. Depois, há outras duas clivagens que liberam o RNA 18S maduro. As três próximas clivagens liberam o RNA 5,8S e, na maioria dos casos, o 28S maduro, as quais já permanecem ligados por pontes de hidrogênio devido à complementaridade de bases entre esses rrnas. O quarto tipo de rrna, 5S, é transcrito separadamente. Os genes para RNA 5S estão localizados separados dos outros três e são transcritos pela RNA-polimerase III. Também se encontram em cópias múltiplas e separadas por espaçadores. A transcrição desses genes não é coordenada com a dos outros RNAs e não se sabe por que eles estão localizados separadamente. Após o processamento, os rrnas participam na formação das subunidades do ribossomo e, só então, deixam o núcleo. O RNA ribossômico sofre, ainda, algumas modificações pós-transcricionais, entre elas: as metilações. Muitas dessas metilações são extremamente conservadas e algumas delas têm uma função importante no início da síntese de proteínas. A modificação da base U para Ø (psi) também é comum. #M3U6 VII. Processamento de trna Os genes de trna são encontrados em cópias múltiplas. Os transcritos primários precisam ser processados para originar o trna maduro. Isso envolve a ação de ribonucleases para gerar as extremidades 5 e 3 da molécula madura e a retirada do único íntron. O Consórcio Setentrional de Ensino a Distância 271

17 # M3U6 Transcrição e regulação da expressão gênica mecanismo de retirada do íntron de p-trrna ocorre em duas etapas. Na primeira, ocorre clivagem endonucleásica nas extremidades 5 e 3 do íntron, liberando-o e dividindo o trna em duas metades (éxons). As duas metades são mantidas juntas devido ao pareamento de bases do trna em regiões complementares, apesar de não estarem ainda ligadas covalentemente. Na segunda etapa, ocorre a ligação dos dois éxons para a formação do trna maduro. A ligação dos dois éxons é feita por uma RNA-ligase. Aparentemente não há seqüências consenso no íntron, essenciais ao processo de splicing. As seqüências do éxon e a conseqüente estrutura tridimensional do pré-trna são os elementos importantes para o reconhecimento e para a correta clivagem pelas endonucleases. As moléculas de trna maduras contêm um grande número de nucleotídeos raros, originados pela modificação pós-transcricional das bases comuns (A,U,C,G). A maioria das modificações envolve metilação e/ou tiolação e dependem de cisteína, metionina e treonina, que são as fontes dos grupos utilizados na alteração das bases. Outro processamento importante é a adição da seqüência CCA na extremidade 3 por uma enzima específica. Todos os trna têm essa seqüência. #M3U6 VIII. A regulação da expressão gênica Você já parou para pensar como os organismos procarióticos e eucarióticos conseguem ligar e desligar genes, que comandarão a síntese de mrnas, e, assim, dar origem, por fim, às proteínas necessárias? A esse processo chamamos controle da expressão gênica. Existem vários diferentes mecanismos de controle da expressão gênica, mesmo se considerarmos apenas a bactéria E. coli. Dessa forma, iremos centrar nossos esforços na análise de um deles, no controle da expressão gênica em procariotos, que tem muita aplicação em engenharia genética Na década de 1950, as primeiras evidências para a existência de proteínas de regulação gênica, que ligam ou desligam conjuntos específicos de genes, foram por meio das análises genéticas em bactérias. Saiba mais Em 1965, os franceses François Jacob e Jacques Monod, juntamente com Andre Lwoff, descreveram esse mecanismo, recebendo por isso o Prêmio Nobel em Medicina. Eles estudaram os genes que codificam as enzimas responsáveis pela degradação da lactose em E. coli. Este modelo se encontra em vários livros, textos, e introduziremos de forma didática um mecanismo que é comum a muitos outros microrganismos, observado na regulação de muitos genes. Francois Jacob Jaques Monod Andre Lwoff 272 Módulo III Processos de manutenção da vida

18 Eixo Biológico P BSC B Você já ouviu falar no operon lac? Através de experimentos em genética clássica (empregando mutantes e plasmídeos que transportavam genes e sítios reguladores para a bactéria hospedeira, criando assim diplóides parciais), Jacob e Monod criaram um modelo no qual o sítio promotor, associado a um outro sítio chamado operador, controlava a expressão de todos os genes imediatamente abaixo, isto é, 3, do promotor. Todo esse conjunto de genes foi chamado de operon lac, pois os genes que estudavam eram os responsáveis pela síntese das proteínas que degradavam lactose. A figura 9 abaixo representa o operon lac esquematizado. Figura 9: distribuição dos genes e módulos de controle do operon lac. O gene i, para o repressor lac, expresso constitutivamente, está situado próximo ao conjunto dos genes induzíveis lacz, lacy e laca, responsáveis pela síntese das proteínas b-galactosidase, permease e transacetilase. O promotor p lac é controlado pelo operador o lac, onde se ligam duas moléculas do repressor. Saiba mais Os plasmídeos são moléculas circulares de DNA que estão separadas do DNA cromossômico. Geralmente ocorrem em bactérias e as vezes em organismos eucarióticos. Saiba mais Agora é um momento importante de estudar como tudo isso ocorre. Para que você possa compreender melhor todo esse fenômeno, busque algumas referências para leitura e interagir melhor com o assunto: Capítulo 14 do livro: Regulação da Transcrição Gênica. Genética Moderna Autores: J.F Antohony Griffiths, Jeffrey H. Miller, Richard C. Lewontin, Consórcio Setentrional de Ensino a Distância 273

19 # M3U6 Transcrição e regulação da expressão gênica Lembre-se que: O sítio operador é uma região do DNA logo abaixo do sítio promotor. Na verdade, os dois sítios estão parcialmente imbricados, pois o promotor se estende da base -45 até a base +5, enquanto o sítio operador vai da base -8 até a +12. Dessa forma, se tivermos uma proteína ligada ao sítio operador, ela vai impedir que esse seja ligado pela RNApol. O repressor lac, por sua vez, é o produto de um gene que está próximo ao óperon, porém não faz parte integral dele (na verdade, esse gene poderia estar muito distante no genoma de E. coli). Na ausência de lactose, as poucas moléculas de repressor presentes no citosol da bactéria (menos de 10 por célula!) são suficientes para silenciar a expressão do óperon, ligando-se ao sítio operador. Na presença de lactose, contudo, o repressor é inativado pela ligação de um produto do metabolismo da lactose: a alolactose. Inicia-se, então, a transcrição dos genes lacz, lacy e laca, formando-se um mrna policistrônico. Bom! O que você acha? Será que nesse momento o mrna já foi traduzido? Esse mrna é imediatamente traduzido para formar três enzimas da via de degradação da lactose: a b-galactosidase (b-gal), a permease e a transacetilase. A b-gal degrada a lactose, até galactose e glicose, e a permease aumenta muitas vezes a permeabilidade da célula à lactose. Com isso, a lactose do meio de cultura é rapidamente assimilada e utilizada pela célula. Quando a concentração de lactose reduz-se muito, até as moléculas que estão ligadas ao repressor acabarão sendo clivadas pela b-gal. A conseqüência disso é a ligação dos repressores, agora ativos, ao sítio operador, provocando a parada da transcrição dos genes lacz, lacy e laca (Figura 10). Figura 10: esquema representativo do controle da transcrição dos genes para as enzimas responsáveis pelo uso da lactose em E. coli. O repressor, produto do gene i, liga-se ao operador (em verdade, duas moléculas), impedindo a ligação da RNApol ao sítio promotor P lac e bloqueando a transcrição. A lactose no citosol bacteriano liga-se ao repressor, inativando-o e liberando o promotor para ser ligado pela RNApol. O processo de transcrição estará liberado até que a concentração citosólica de lactose seja insuficiente para garantir a inativação das moléculas do repressor. 274 Módulo III Processos de manutenção da vida

20 Eixo Biológico P BSC B Esse é o exemplo clássico de um óperon que funciona por repressão. Há muitos outros semelhantes, que controlam em geral a síntese de enzimas responsáveis pela degradação de um determinado produto nem sempre disponível no ambiente. Há também genes óperons que estão sempre ligados e que devem ser silenciados em determinadas situações. São, em geral, os genes para biossíntese de algum produto que a bactéria pode obter do ambiente. Somente quando falta esse produto no meio de cultura é que a bactéria ativa a transcrição dos genes que irão produzir as enzimas necessárias à biossíntese do produto em falta. Além desses dois sistemas, há ainda outros bastante mais complexos, que modulam de forma fina a expressão de genes nos procariotos. Há mesmo óperons que são controlados por repressão e ativação simultaneamente. Vale ressaltar que o próprio óperon lac tem uma particularidade (descoberta muitos anos depois de sua elucidação por Jacob e Monod): o controle da sua expressão exercido por uma proteína chamada CAP (catabolite gene activator protein), uma proteína dimérica como o repressor lac, com aprox Da. Detalhes sobre essa proteína você encontra na literatura indicada. Esse curioso mecanismo de controle positivo do óperon lac também foi observado em diversos outros óperons bacterianos. Qual seu objetivo, afinal? A explicação é simples: quando a bactéria não tem glicose para degradar, ela passa por um processo de fome celular, com conseqüente aumento dos níveis de camp celulares. Esse camp se liga à proteína CAP, permitindo uma expressão aumentada de todos os óperons que são responsáveis pela degradação de açúcares e outros produtos energéticos. A figura a seguir ilustra os dois controles (pelo repressor e pelo complexo CAP-cAMP) do óperon lac (Figura 11). Figura 11: controle do óperon lac pela proteína CAP e pelo repressor lac. Consórcio Setentrional de Ensino a Distância 275

21 # M3U6 Transcrição e regulação da expressão gênica Diante de tantos detalhes, vem a pergunta! Que importância tem o óperon lac na genética molecular? Muitos dos vetores de expressão, sejam eles fagos ou plasmídeos, empregados em engenharia genética, têm o gene clonado sob o controle de um promotor/operador lac. Esse sistema propicia o controle da expressão do gene clonado através da adição de um análogo da lactose: o IPTG (isopropiltiogalactosídeo). Este produto é muitas vezes mais efetivo que a lactose na indução da expressão do óperon lac, além de não ser degradado. Veremos, mais adiante, como podemos tirar vantagem dessas construções artificiais de genes para a produção de proteínas recombinantes. Leia mais sobre todo o processo do óperon triptofano (óperon tryp). Lembre-se que será necessário correlacionar com os módulos vistos anteriormente, como a biossíntese de aminoácidos, no site < www. Após as leituras complementares, pode-se observar que o mesmo mecanismo descrito para o triptofano é empregado em outras vias biossíntéticas de aminoácidos. A razão parece ser o alto custo energético dessas vias. Esse sistema permite à Natureza discriminar entre pouco e insuficiente, contornando a forma rudimentar com que o sistema repressor/operador controla a expressão gênica (lembrese de que o repressor se desliga ocasionalmente do operador, dando origem ao vazamento, que é importante para a expressão gênica, particularmente ao disparo de certos óperons, como o lac). É possível que se um sistema de repressão simples, como o das bactérias, fosse regulado para não ser aberto ou fechado, senão em circunstâncias extremas, ele jamais funcionaria, ficando sempre fechado ou sempre aberto, conforme o caso. Até o momento, o estudo se concentrou no processo de regulação da expressão gênica em bactérias. E quanto às células eucariotas? Você já imaginou como isso ocorre? A expressão gênica pode ser regulada em muitas das etapas na via que vai do DNA para o RNA até a proteína. Se as diferenças entre os vários tipos celulares dependem de genes particulares que a célula expressa, em qual nível o controle da expressão gênica é exercido? De modo geral, os passos pelos quais a expressão gênica eucariótica pode ser controlada estão descritos abaixo. Como vimos, existem muitos passos no caminho que leva do DNA à proteína, e todos podem, inicialmente, ser regulados. Portanto, uma célula pode controlar as proteínas que podem, em princípio, ser reguladas. Portanto, uma célula pode controlar as proteínas que produz das seguintes formas (Figura 12): pelo controle de quando e como um determinado gene é transcrito (controle transcricional); pelo controle de como um transcrito de RNA é submetido a splicing ou processado de alguma outra maneira (controle do processamento de RNA); pela seleção de quais mrnas completos no núcleo celular são exportados para o citoplasma e quais determinam a sua localização no citoplasma (transporte de RNA e controle da localização); pela seleção de quais mrnas no citoplasma são traduzidos pelos ribossomos (controle traducional); pela desestabilização seletiva de certas moléculas de mrna no citoplasma (controle da degradação do mrna); pela ativação, desativação, degradação ou compartimentalização seletiva de moléculas de proteína específicas após a sua produção (controle da atividade protéica). 276 Módulo III Processos de manutenção da vida

22 P Eixo Biológico BSC B Figura 12: seis passos pelos quais a expressão gênica eucariótica pode ser controlada. Os controles que operam nos passos de 1 a 5 são discutidos neste módulo. O passo 6, a regulação da atividade protéica, inclui a ativação e a inativação reversível pela fosforilação das proteínas, assim como a inativação irreversível por degradação proteolítica. A lógica da regulação gênica segue por aí. No entanto, em eucariotos, a regulação envolve fatores muito mais complexos, como a integração celular (Tabela 2). Tabela 2: algumas Proteínas de regulação gênica e as seqüências de DNA que elas reconhecem. Organismo Bactéria Fungo Drosophila Mamíferos Nome lac repressor CAP lambda repressor Gal4 Mat?2 Gcn4 Kruppel Bicoid Sp1 Oct-1 Pou domain GATA-1 MyoD p53 Recombinação da sequencia de DNA* 5? AATTGTGAGCGGATAACAATT 3? TTAACACTCGCCTATTGTTAA TGTGAGTTAGCTCACT ACACTCAATCGAGTGA TATCACCGCCAGAGGTA ATAGTGGCGGTCTCCAT CGGAGGACTGTCCTCCG GCCTCCTGACAGGAGGC CATGTAATT GTACATTAA ATGACTCAT TACTGAGTA AACGGGTTAA TTGCCCAATT GGGATTAGA CCCTAATCT GGGCGG CCCGCC ATGCAAAT ATGCAAAT TGATAG ACTATC CAAATG GTTTAC GGGCAAGTCT CCCGTTCAGA * Cada proteína na tabela pode reconhecer um conjunto de seqüências de DNA estreitamente relacionadas; por conveniência, somente uma seqüência de reconhecimento, e não de uma seqüência consenso, é mostrada para cada proteína. Consórcio Setentrional de Ensino a Distância 277

23 # M3U6 Transcrição e regulação da expressão gênica O genoma de uma célula contém na sua seqüência de DNA a informação para fazer milhares de diferentes moléculas de proteína e de RNA. Uma célula expressa, tipicamente, somente uma fração de seus genes, e surgem diferentes tipos de células nos organismos multicelulares, porque diferentes conjuntos de genes são expressos. Além disso, as células podem alterar o padrão de genes que elas expressam em resposta às mudanças no seu ambiente, tais como sinais de outras células. Embora todas as etapas envolvidas na expressão de um gene possam, em princípio, ser reguladas, para a maioria dos genes, o início da transcrição do RNA é o ponto de controle mais importante. Dessa forma, é de grande valia a compreensão do sentido dessa regulação e sua importância na manutenção da vida. #M3U6 IX. Referências NUSSBAUM, R. L.; MCINNES, R. R.: WILLARD, HUNTINGTON F. Genética Médica. 6. ed. Rio de Janeiro: Guanabara Koogan, STRACHAN, T.; READ, A. P. Genética Molecular Humana. 2 ed. Porto Alegre: ARTMED Editora, SNUSTAD, P.; SIMMONS, M. J. Fundamentos de Genética. 2. ed. Rio de Janeiro: Guanabara Koogan, BROWN, T. A. Genética: Um enfoque molecular. 3. ed. Rio de Janeiro: Guanabara Koogan, GRIFFITHS, A. J.F.; MILLER, J. H.; LEWONTIN, R. C.; GELBART, W. G. Genética Moderna. 1. ed. Rio de Janeiro: Guanabara Koogan, Módulo III Processos de manutenção da vida

24 Eixo Biológico P BSC B Consórcio Setentrional de Ensino a Distância 279

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi Como a vida funciona? O processo de Transcrição Prof. Dr. Francisco Prosdocimi Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos Transcrição

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

TRANSCRIÇÃO DO DNA: Tipos de RNA

TRANSCRIÇÃO DO DNA: Tipos de RNA TRANSCRIÇÃO DO DNA: Síntese do mrna Gene (Unidades transcricionais) Tipos de RNA Tipos de RNA polimerase Tipos de RNA polimerase DNA dependente Transcrição em Procariotos Transcrição em Eucariotos Mecanismos

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS

MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS BIOLOGIA MOLECULAR BÁSICA MÓDULO III Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas de animações. Dê uma olhada nas animações

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade Estrutura do RNA: um mundo de diferenças & extrema plasticidade Estrutura do RNA: extrema plasticidade RNA: extrema plasticidade... funcional RNA: funções múltiplas rrna, mrna, trna, RNAs de funções especiais

Leia mais

Controle da expressão gênica

Controle da expressão gênica Programa de Biologia Celular V Curso de Verão Controle da expressão gênica Renata Ramalho Oliveira roliveira@inca.gov.br Desenvolvimento e fenótipos explicados pela modulação da expressão gênica Lehninger.

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Fluxo da informação gênica transcrição em eucariotos

Fluxo da informação gênica transcrição em eucariotos Fluxo da informação gênica transcrição em eucariotos AULA 21 objetivos Ao final desta aula, você deverá ser capaz de: Estudar o mecanismo de transcrição em eucariotos. Entender a formação do RNA mensageiro

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

Ácidos Nucléicos OS ÁCIDOS NUCLÉICOS

Ácidos Nucléicos OS ÁCIDOS NUCLÉICOS Ácidos Nucléicos DNA e RNA Profª Ana Luisa Miranda Vilela OS ÁCIDOS NUCLÉICOS Constituintes: Nucleotídeos formados por três diferentes tipos de moléculas: um açúcar (pentose) desoxirribose no DNA e ribose

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira Faculdade de Tecnologia de Araçatuba Curso Superior de Tecnologia em Bioenergia Sucroalcooleira 1 ÁCIDOS NUCLÉICOS Estrutura e funções 2 Ácidos nucléicos são polímeros de nucleotídeos adenina citosina

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Controle da expressão gênica. Prof. Dr. José Luis da C. Silva

Controle da expressão gênica. Prof. Dr. José Luis da C. Silva Controle da expressão gênica Prof. Dr. José Luis da C. Silva Controle da Expressão gênica Procariotos Princípios da regulação gênica Organismos procariontes e eucariontes são sensíveis à pequenas variações

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Questões complementares

Questões complementares Questões complementares 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares entre

Leia mais

Aula 1. Controle da expressão gênica em procariotos. Módulo III Avançado. 1. Introdução. Biologia Molecular Básica

Aula 1. Controle da expressão gênica em procariotos. Módulo III Avançado. 1. Introdução. Biologia Molecular Básica Biologia Molecular Básica Módulo III Avançado Aula 1 Staphylococcus aureus Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito RNA aspectos funcionais e estruturais 5 objetivo Ao final desta aula, você terá a oportunidade de: Descrever os aspectos funcionais e estruturais do RNA. Pré-requisito Para acompanhar mais facilmente esta

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA GENÉTICA BACTERIANA INTRODUÇÃO O DNA existe como uma hélice de fita dupla, mantidas pelo pareamento de bases nitrogenadas específicas (AT; CG). - A seqüência de bases codifica a informação genética; -

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Regulação do metabolismo do glicogênio

Regulação do metabolismo do glicogênio Regulação do metabolismo do glicogênio A U L A 27 objetivos Ao final desta aula, você deverá ser capaz de: Aprender sobre as vias de regulação do metabolismo de glicogênio. Reforçar os conceitos adquiridos

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

A descoberta da célula

A descoberta da célula A descoberta da célula O que são células? As células são a unidade fundamental da vida CITOLOGIA A área da Biologia que estuda a célula, no que diz respeito à sua estrutura e funcionamento. Kytos (célula)

Leia mais

Estudo Dirigido. Organelas membranosas- Compartimentos intracelulares- endereçamento de proteínas

Estudo Dirigido. Organelas membranosas- Compartimentos intracelulares- endereçamento de proteínas UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR Estudo Dirigido Organelas membranosas- Compartimentos

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA REPLICAÇÃO DO Plano de Aula -Composição e estrutura do - e Hereditariedade -Processo de replicação REPLICAÇÃO DO Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DIVISÃO CELULAR E REPLICAÇÃO Bibliografia

Leia mais

Processamento de RNA

Processamento de RNA Seminário de Bioquímica II Prof. Dr. Julio César Borges Processamento de RNA Grupo: Rodrigo Rossi de Araújo nº USP 7144403 Edvaldo Maciel Vasconcelos nº USP 7275921 Introdução Sintetizados a partir de

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular.

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular. Módulo Núcleo Exercícios de Aula 1) O envelope nuclear encerra o DNA e define o compartimento nuclear. Assinale a afirmativa INCORRETA sobre o envelope nuclear. a) É formado por duas membranas concêntricas

Leia mais

Ficha de Apoio Teórico: Replicação do DNA

Ficha de Apoio Teórico: Replicação do DNA Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Apoio Teórico: Replicação do DNA Introdução Uma das características mais pertinentes de todos

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

O complexo maquinário de replicação e suas enzimas

O complexo maquinário de replicação e suas enzimas O complexo maquinário de replicação e suas enzimas AULA 10 objetivos Ao final desta aula, você deverá ser capaz de: Apresentar os diferentes componentes do maquinário de replicação. Conhecer as diferentes

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais