Tamanho: px
Começar a partir da página:



1 DETECÇÃO DE Cryptosporidium spp. AO LONGO DA BACIA DE MANANCIAL DO RIBEIRÃO CAFEZAL, LONDRINA/PR. R. M. Kawata*, L. F. Maia** e K. V. M. C. Prates*** *Graduanda em Engenharia Ambiental / UTFPR, Londrina/PR, Brasil **Coordenação de Tecnologia em Alimentos / UTFPR, Londrina/PR, Brasil ***Coordenação em Engenharia Ambiental / UTFPR, Londrina/PR, Brasil Resumo Visto que a presença de Cryptosporidium spp. em águas para o consumo revela-se um importante problema de saúde pública, o presente trabalho teve como objetivo detectar a presença de Cryptosporidium spp. na bacia de manancial do Ribeirão Cafezal, da cidade de Londrina. Foram avaliados 9 pontos ao longo da bacia, durante os meses de Agosto a Maio. As metodologias utilizadas neste trabalho foram a técnica da membrana filtrante, extração de DNA e reação de polimerase em cadeia (PCR). Oocistos de Cryptosporidium spp. foram encontrados em vários pontos do corpo d água avaliado. Palavras-chave: Ribeirão Cafezal, Cryptosporidium, PCR. Abstract As the presence of Cryptosporidium spp. in the water for consumption proves to be an important public health problem, this study aimed to detect the presence of Cryptosporidium spp. in the Ribeirão Cafezal basin, in the city of Londrina. We evaluated nine points along the basin, during the months of August to May. The methodologies used in this study were the technique of membrane filtration, DNA extraction and polymerase chain reaction (PCR). Cryptosporidium spp. was found in various samples of the collected water. Key words: Ribeirão Cafezal, Cryptosporidium, PCR. Introdução Cryptosporidium spp. é considerado como um importante patógeno emergente de veiculação hídrica, causador de gastroenterites e diarreias autolimitadas em indivíduos sadios e infecções crônicas em imunodeficientes [1]. Todas as espécies do gênero Cryptosporidium spp. são parasitas obrigatórios, porém a espécie mais relevante deste gênero é o C. parvum, que provoca infecção no homem. Eles infectam as microvilosidades das células epiteliais do trato digestivo e respiratório de vertebrados e são liberadas nas fezes do hospedeiro infectado. Os esporozoítos e oocistos que compõem seu ciclo de vida são de tamanho reduzindo, variando de 4 a 6 µm [2]. O mecanismo de transmissão deste protozoário é influenciado pelo nível de contaminação ambiental, sobrevivência do oocisto às condições do meio, resistência do oocisto aos mais variados métodos de tratamentos da água ou a incompleta remoção dos oocistos [3]. 1/8

2 Essas características de persistência ambiental e resistência aos processos usuais de desinfecção, aliadas à alta infecciosidade relativa, têm conferido ao Cryptosporidium spp. o status de micro-organismo de referência pela OMS e legislações de alguns países [2]. Desta forma, este trabalho visou investigar a ocorrência de oocistos de Cryptosporidium spp. no percurso da bacia de manancial de abastecimento do Ribeirão Cafezal, da cidade de Londrina/PR. Para tanto foi utilizada a técnica da membrana filtrante e a confirmação molecular pela técnica da PCR (Polimerase Chain Reaction). Materiais e Métodos A área de análise compreendeu a bacia do Ribeirão Cafezal, que constitui um dos mananciais de abastecimento da cidade de Londrina, percorrendo ainda os municípios de Cambé e Rolândia. Para a análise da presença de Cryptosporidium spp foram coletados 2 litros de água de 9 pontos de coleta (Figura 1), com auxilio de frascos de vidro esterilizados, mergulhados a uma profundidade de aproximadamente 20 cm, e posteriormente armazenados em garrafas PET lavadas com solução 1% de Tween 80. Figura 1: Pontos de coleta de água distribuídos na Bacia de Manancial do Ribeirão Cafezal. Fonte: SANEPAR, /8

3 Como visto na Figura 1, os pontos abrangem os municípios de Rolândia, Cambé e Londrina. Descrevem-se os pontos como: - Ponto 1: Rio perto da antiga Big-frango em Rolândia; - Ponto 2: Rio perto do cemitério em Rolândia; - Ponto 3: Rio que passa embaixo da rodovia que da acesso à Rolândia; - Ponto 4: Rio que passa no fundo de um Clube; - Ponto 5: Parte mais barrenta do rio presente na parte rural entre Cambé e Rolândia; - Ponto 6: Parte mais cristalina do rio presente na parte rural entre Cambé e Rolândia; - Ponto 7: Rio presente na parte rural após Londrina; - Ponto 8: Rio presente no começo da parte rural após Londrina (Perto de um sítio); - Ponto 9: Estação de captação da SANEPAR. O isolamento do protozoário foi realizado pelo método da membrana filtrante, onde os 2 litros de água foram filtrados em um sistema de bomba a vácuo. Os oocistos retidos na membrana foram removidos por extração mecânica e lavagem com solução a 1% de Tween 80. O liquido resultante foi transferido para tubos de centrífuga, com rotação a 6000 rpm por 15 minutos. O sedimento obtido foi suspenso em 1 ml de água destilada esterilizada. Alíquotas foram submetidas a coloração de oocistos, pelo método de Kinyoun e observadas em microscópio óptico comum com aumento de 400 vezes. O procedimento de extração de DNA foi realizado pela técnica do choque térmico. Inicialmente pegou-se 1 ml proveniente da obtenção dos oocistos e centrifugou-se a rpm a 5 minutos. Ao pellet resultante diluiu-se 500 µm de tampão (10 mm Tris-HCl ph 8,0; 25 mm EDTA ph 8,0; 100 mm NaCl e 1% de SDS). Em seguida prosseguiu-se com 5 ciclos de congelamento em gelo seco por 5 minutos e descongelamento em banho maria a 65ºC por 5 minutos, com posterior adição de 20 µm de proteinase K (10 mg/ml). As amostras foram incubadas a 56ºC por 2 horas com agitação a 1000 rpm a cada 5 minutos. Centrifugou-se a rpm por 15 minutos e ao sobrenadante foi acrescentado 1 ml de etanol gelado e colocado no freezer overnight. Centrifugou-se por 20 minutos a rpm, descartou-se o etanol e foi adicionado 50 µm etanol 70%. O DNA precipitado foi obtido por centrifugação a rpm por 20 minutos, seguido de adição de 50 µl de água destilada estéril. A amplificação do gene de identificação do gênero CRY18SF (5 : TTCTAGAGCTAATACATGCG3 ) e CRY18R (5 CCCATTTCCTTCGAAACAGGA3 ) foi realizada em termocilador, utilizando uma mistura de 20µL contendo 2 µl de 1x tampão PCR, 1 µl de MgCl 2 (50mM), 1,4 µl de 3/8

4 dntp (10mM), 1 µl de cada oligonucleotideo iniciador, 0,5 µl da enzima Taq polimerase, 2 µl de amostra completando-se o volume para 20 µl com água bidestilada estéril. As condições de amplificação utilizadas foram as seguintes: um ciclo inicial a 94ºC por 10 minutos; 35 ciclos de desnaturação a 94ºC por 1 min; anelamento a 55ºC por 1 min e extensão a 72ºC por 1 min e 30s; e um ciclo final a 72ºC por 10 minutos. A integridade do DNA foi visualizada em gel de agarose (1,5%, p/v) corados com solução de brometo de etídio (0,005%, p/v) e revelado em luz ultravioleta. Resultados A partir das análises microscópicas realizadas das amostras coletadas no período de Agosto de 2011 a Maio de 2012, obteviveram-se os resultados de presença ou ausência do Cryptosporidium spp (Tabela 1 e Tabela2). Tabela 1: Resultados da análise microscópica da presença de oocistos de Cryptosporidium spp. nas amostras realizadas em Agosto a Dezembro de Pontos de Agosto Setembro Outubro Novembro Dezembro Coleta P A P A P A P A P A Ponto 1 x x x x x Ponto 2 x x x x x Ponto 3 x x x x x Ponto 4 x x x x x Ponto 5 x x x x x Ponto 6 x x x x x Ponto 7 x x x x x Ponto 8 x x x x x Ponto 9 x x x x x Legenda: P Presença; A Ausência. Na Figura 2 pode-se visualizar alguns dos oocistos de cryptosporidium spp. A quantificação de DNA presente nas amostras está representada na Figura 3. Os códigos identificam os pontos e o mês da coleta: - C1E: Ponto 1 do mês de Agosto; - C2E: Ponto 2 do mês de Agosto; - C3E: Ponto 3 do mês de Agosto; - C5E: Ponto 5 do mês de Agosto; - C8E: Ponto 8 do mês de Agosto; - C6F: Ponto 6 do mês de Setembro; - C7F: Ponto 7 do mês de Setembro; - C8F: Ponto 8 do mês de Setembro; - C2G: Ponto 2 do mês de Outubro; - C2H: Ponto 2 do mês de Novembro; 4/8

5 - C6I: Ponto 6 do mês de Dezembro; - C8I: Ponto 8 do mês de Dezembro. Com relação ao aspecto da água, tem-se: - Turva: C1E, C5E, C8E, C6F, C7F, C8F, C6I, C8I. - Cristalina: C2E, C3E, C2G, C2H. Tabela 2: Resultados da análise microscópica da presença de oocistos de Cryptosporidium spp. nas amostras realizadas em Fevereiro a Maio de Pontos de Coleta Fevereiro Março Abril Maio P A P A P A P A Ponto 1 x x x x Ponto 2 x x x x Ponto 3 x x x x Ponto 4 x x x x Ponto 5 x x x x Ponto 6 x x x x Ponto 7 x x x x Ponto 8 x x x x Ponto 9 x x x x Legenda: P Presença; A Ausência. Figura 2: Oocistos de Cryptosporidium spp. (seta) observados ao microscópio óptico comum, após coloração pelo método de Kinyoun. A) Oocisto do Ponto 2 da coleta do mês de Outubro. B) Oocisto do Ponto 1 da coleta do mês de Dezembro. C) Oocisto do Ponto 8 da coleta do mês de Dezembro. Na técnica de PCR não apresentou amplificação para o gene gênero específico para Cryptosporidium spp. reajustes na técnica estão sendo realizadas. Os dados de precipitação da região da bacia de manancial do Ribeirão Cafezal estão dispostos na Tabela 3. 5/8

6 Figura 3: Canaletas C1E a C8I: DNA genômico de Cryptosporidium spp. após a técnica de extração (seta). λ: DNA do fago λ em concentração de 10 ng/µl. Tabela 3: Dados de precipitação da região da bacia do Ribeirão Cafezal. Mês Precipitação (mm) Agosto 31,7 Setembro 7 Outubro 278,3 Novembro 140,1 Dezembro 86,4 Fevereiro 40,3 Março 87,8 Abril 159 Maio 64,5 Discussão A agregação de patógenos ao material particulado, ou a integração de patógenos a matéria orgânica influencia na taxa de sedimentação de patógenos e favorece o decaimento dos mesmos na coluna d água. Embora a sedimentação individual dos oocistos seja extremamente lenta, a capacidade dos oocistos de se aderirem às partículas aumenta potencialmente sua velocidade de sedimentação [4]. Como em diversos pontos a água encontrava-se aparentemente cristalina, constatou-se que a sedimentação provavelmente contribui para uma menor concentração de oocistos na camada superficial que foi a região na qual a água foi coletada. É interessante ressaltar que os organismos patogênicos costumam estar associados às partículas responsáveis pela turbidez, que parecem utilizá-las como substrato e forma de proteção. Assim, ao remover a turbidez da água, são também removidos os patogênicos a ela associados [5]. No estudo do Ribeirão Cafezal o fator turbidez seguiu o mencionado por Silva [5], onde a maioria dos pontos analisados que apresentaram o oocisto de Cryptosporidium spp. possuía uma turbidez notável. Reforçando então a probabilidade de encontrar oocistos em águas com turbidez elevada. Em estudos quanto à influência de chuvas sobre a ocorrência de oocistos em ambientes aquáticos, observou-se uma elevação de 10 a 100 vezes a concentração de oocistos durante períodos chuvosos em relação aos não chuvosos [2]. A partir de dados de precipitação da região da área de estudo há uma contradição ao relatado por Cerqueiria [2]. Os meses que apresentaram positivamente o Cryptosporidium spp. não foram os com maior precipitação mensal. O mês com precipitação 6/8

7 mais elevada obteve apenas um ponto com a presença do Cryptosporidium spp. É de extrema importância que os processos hidrodinâmicos sejam mais bem avaliados, em pesquisas mais longas, pois tais processos influenciam diretamente na distribuição e transporte dos patógenos no corpo d água [6]. A presença de Cryptosporidium spp. também pode ser fortemente influenciada pela sazonalidade e pelo uso do solo [6]. O ponto com mais frequência na detecção de oocistos foi o ponto 8 que consiste justamente em uma área de criação de gado. Na técnica de PCR não observamos amplificação do gene gênero específico para este protozoário. Provavelmente a temperatura de anelamento do oligonucleotideo não foi adequada. Demais testes estão sendo realizados. Conclusão Embora a detecção de Cryptosporidium spp. tenha ocorrido em alguns pontos de coleta deve-se considerar fatores como temperatura, radiação, variações do ph, pois estes possivelmente favorecem a inativação dos patógenos na água e consequente não detecção dos mesmos nas análises. Além disso, não se pode esquecer que o uso e ocupação do solo é um fator indispensável na avaliação da presença do Cryptosporidium spp. Agradecimentos A Universidade Tecnológica Federal do Paraná UTFPR, a Fundação Araucária e ao CNPq pelo suporte financeiro. Referências [1] Muller, A.P.B. (1999), Detecção de oocistos de Cryptosporidium spp. em águas de abastecimento superficiais e tratadas da região metropolitana de São Paulo, Dissertação de Mestrado, Instituto de Ciências Biomédicas da Universidade de São Paulo, São Paulo, p. 3. [2] Cerqueira, D.A. (2008), Remoção de oocistos de Cryptosporidium parvum e de indicadores no tratamento de água por ciclo completo, filtração direta descendente e dupla filtração, em escala piloto, Tese de Pós-graduação em Saneamento, Meio Ambiente e Recursos Hídricos da Universidade Federal de Minas Gerais, Escola de Engenharia da UFMG, Belo Horizonte, p., 2, 19. [3] Lima, E.C., Stamford, T.L.M. Cryptosporidium spp. no ambiente aquático: aspectos relevantes da disseminação e diagnóstico. Ciência & Saúde Coletiva, 8930: , /8

8 [4] Brookes, D.J., Antenucci, J., Hipsey, M., Burch, D.M., Ashbolt, J.N., Ferguson, C. Fate and transport of pathogens in lakes and reservoirs. Environment International, v.30, p , [5] Silva, C.F. (2008), Remoção de oocistos e de indicadores físicos de Cryptosporidium parvum em águas de abastecimento por meio da decantação estudo em escala piloto, Dissertação de Mestrado, Escola de Engenharia da UFMG, Belo Horizonte, p.42. [6] Lopes, A.M.M.B. (2009), Avaliação da ocorrência de oocistos de Cryptosporidium spp. e de cistos de Giardia spp. e sua associação com indicadores bacteriológicos e turbidez na represa de Vargem das Flores MG, Dissertação de Mestrado, Escola de Engenharia da UFMG, Belo Horizonte, p /8



Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais


WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ Diagnóstico molecular para Campylobacter spp.

Leia mais


Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Departamento de Biologia da Universidade do Minho

Departamento de Biologia da Universidade do Minho Departamento de Biologia da Universidade do Minho Mestrado em Genética Molecular Ano lectivo de 2004/2005, edição de 2004-2006 Estudo da regulação do gene STL1 codificando o sistema de simporte H + /glicerol

Leia mais


RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Biologia Celular e Molecular

Biologia Celular e Molecular DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA Biologia Celular e Molecular Detecção de proteínas por western-blotting 2007-2008 Na electroforese em gel de poliacrilamida

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Elaborado por: Karina Salvador Revisado por: Hilda Helena Wolff Aprovado por: Andréa Cauduro

Elaborado por: Karina Salvador Revisado por: Hilda Helena Wolff Aprovado por: Andréa Cauduro ANTI- 1 Manual CAMBRIDGE BIOTECH -1 POP: BM 05 Página 1 de 7 1. Sinonímia ANTI, TESTE CONFIRMATÓRIO. 2. Aplicabilidade Aos bioquímicos e técnicos do setor de imunologia. 3. Aplicação clínica Os testes

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes)

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes) PT Instruções de utilização CYCLER CHECK Kit de teste para a validação da uniformidade da temperatura em termocicladores pronto a usar, pré-aliquotado REF 7104 (10 testes) REF 71044 (4 testes) Índice 1.

Leia mais



Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais


Mesa redonda CIANOBACTÉRIAS Mesa redonda CIANOBACTÉRIAS Tema Gestão na implantação da Identificação e Contagem de Cianobactérias na URCQA/PE 18 a 22 de março de 2013 Belo Horizonte BH Disponibilidade hídrica no Brasil 12% da água

Leia mais


BIOQUÍMICA EXPERIMENTAL Departamento de Bioquímica Instituto de Química USP Apostila de protocolos BIOQUÍMICA EXPERIMENTAL QBQ 036N 203 Professores Carlos Takeshi Hotta Guilherme Menegon Arantes Esta apostila foi desenvolvida

Leia mais


TESTES DE EXTRAÇÃO DE DNA DE Anticarsia gemmatalis e Spodoptera frugiperda USANDO O PROTOCOLO MINIPREP (MODIFICADO DE RAEDER; BRODA, 1985) TESTES DE EXTRAÇÃO DE DNA DE Anticarsia gemmatalis e Spodoptera frugiperda USANDO O PROTOCOLO MINIPREP (MODIFICADO DE RAEDER; BRODA, 1985) Francielle Fiorentin, Alice Jacobus de Moraes, Viviane M. Celant,

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais



Leia mais

Isolamento Viral em Cultivo Celular. Adriana Candido Rodrigues

Isolamento Viral em Cultivo Celular. Adriana Candido Rodrigues Isolamento Viral em Cultivo Celular Adriana Candido Rodrigues Vírus: Parasitas intracelulares obrigatórios Célula viva para replicação Sistemas Celulares Animais de Laboratório Ovos Embrionados Cultura

Leia mais



Leia mais

Estudo com tratamento de água para abastecimento PIBIC/2010-2011

Estudo com tratamento de água para abastecimento PIBIC/2010-2011 Estudo com tratamento de água para abastecimento PIBIC/2010-2011 Cryslara de Souza Lemes, Prof. Dr. Paulo Sérgio Scalize Universidade Federal de Goiás, 74605-220, Brasil;

Leia mais



Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais



Leia mais


GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS POP n.º: I 140 Página 1 de 6 1. Sinonímia Detecção qualitativa do DNA bacteriano de Chlamydia trachomatis (CT) e Neisseria gonorrhoeae (NG) por PCR ( Polymerase Chain Reaction) em urina de homens e mulheres,

Leia mais

Protocolo laboratorial para purificação manual de DNA de amostra integral

Protocolo laboratorial para purificação manual de DNA de amostra integral Protocolo laboratorial para purificação manual de DNA de amostra integral Para a purificação de DNA genômico nos kits de coleta das famílias Oragene e ORAcollect Visite nosso site para

Leia mais



Leia mais


LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais


ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Protocolos LabDros. Organizado por: Gabriel da Luz Wallau, 2010. Meio de Cultura Estoque para Drosophila. Meio de Drosophila Especial

Protocolos LabDros. Organizado por: Gabriel da Luz Wallau, 2010. Meio de Cultura Estoque para Drosophila. Meio de Drosophila Especial Protocolos LabDros Organizado por: Gabriel da Luz Wallau, 2010. - 1 kg de Farinha de milho grossa; - 200g de germe de trigo; - 1 xícara de açúcar; - 2 colheres de leite em pó; - 1 colher de sal; - 800g

Leia mais


BIOQUÍMICA EXPERIMENTAL Departamento de Bioquímica Instituto de Química USP Apostila de protocolos BIOQUÍMICA EXPERIMENTAL QBQ 06N 0 Professores Carlos T. Hotta Ronaldo B. Quaggio Eduardo M. Reis Esta apostila foi desenvolvida

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@; 2 Escola

Leia mais



Leia mais

DNA Darwin Não Atento?

DNA Darwin Não Atento? DNA Darwin Não Atento? PÁGINA 1 DE 6 CIÊNCIAS BIOLOGIA QUÍMICA Darwin foi um dos maiores cientistas de todos os tempos. Ele percebeu que variações ocorrem nas populações ou seja, diferenças são encontradas

Leia mais

Universidade Federal de Rondônia UNIR Departamento de Engenharia Ambiental DEA Saúde Ambiental Contaminação biológica da água e saúde Acadêmicos: Anderson Rudke, Danilo Santos, Jussara de Paula e Leticia

Leia mais



Leia mais


I-053 - REMOÇÃO DE CRYPTOSPORIDIUM SP E GIARDIA LAMBLIA EM ÁGUAS DE ABASTECIMENTO I-053 - REMOÇÃO DE CRYPTOSPORIDIUM SP E GIARDIA LAMBLIA EM ÁGUAS DE ABASTECIMENTO Arthur Diaz Marques (1) Farmacêutico Bioquímico pela Faculdade de Farmácia e Bioquímica do Estado do Espírito Santo (1983).

Leia mais


EXTRAÇÃO DE DNA (2) A EXTRAÇÃO DE DNA A PRÁTICA NO LABORATÓRIO DE ENSINO BIBLIOGRAFIA EXTRAÇÃO DE DNA (2) A EXTRAÇÃO DE DNA Muitas pesquisas de Biologia Molecular começam com a extração de ácidos nucleicos. A lise celular libera as moléculas em uma fase aquosa que é separada dos restos

Leia mais

Saneamento I Tratamento de água. Eduardo Cohim

Saneamento I Tratamento de água. Eduardo Cohim Saneamento I Tratamento de água Eduardo Cohim 1 Concepção de sistemas de abastecimento de água Estação de tratamento ETA Conjunto de unidades destinado a tratar a água, adequando suas

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais


GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS POP n.º: I 29 Página 1 de 5 1. Sinonímia Pesquisa de anticorpos frios. 2. Aplicabilidade Bioquímicos e auxiliares de laboratório do setor de Imunologia. 3. Aplicação clínica As Crioaglutininas são anticorpos

Leia mais


CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Estudantes do Programa de Pós Graduação em Zootecnia da Universidade Estadual de Maringá.

Estudantes do Programa de Pós Graduação em Zootecnia da Universidade Estadual de Maringá. Extração de DNA e RNA de fígado e músculo em tilápia do Nilo Extraction of DNA and RNA from liver and muscle in Nile tilapia Extracción de ADN y ARN de hígado y músculo en tilapia del Nilo Eliane Gasparino

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais


ENSAIO DE ENDOTOXINAS BACTERIANAS ENSAIO DE ENDOTOXINAS BACTERIANAS O ensaio de endotoxinas bacterianas (EEB) é um ensaio para detectar ou quantificar endotoxinas de bactérias gram negativas usando um lisado de amebócitos de caranguejo

Leia mais


SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais



Leia mais


DATA DE APROVAÇÃO: 23/10/2015 1/6 1. INTRODUÇÃO / FINALIDADE DO MÉTODO O Trichomonas vaginalis é um parasita flagelado e é o agente causador da tricomoníase. Existe em apenas em uma única forma (trofozoíto), que é simultaneamente infecciosa

Leia mais



Leia mais

Reunião Técnica Plano de Segurança da Água. 23 de novembro de 2010 - OPAS

Reunião Técnica Plano de Segurança da Água. 23 de novembro de 2010 - OPAS Reunião Técnica Plano de Segurança da Água 23 de novembro de 2010 - OPAS Introdução Qualidade da água e saneamento inadequados provocam 1,8 milhão de mortes infantis a cada ano no mundo (OMS, 2004), o

Leia mais


AVALIAÇÃO DA EFICIÊNCIA DO COAGULANTE SULFATO FÉRRICO,EM DIFERENTES TEMPERATURAS. Abner Figueiredo Neto Fernanda Posch Rios Paulo Sérgio Scalize AVALIAÇÃO DA EFICIÊNCIA DO COAGULANTE SULFATO FÉRRICO,EM DIFERENTES TEMPERATURAS Abner Figueiredo Neto Fernanda Posch Rios Paulo Sérgio Scalize Introdução Água bruta; Remoção de impurezas: Coagulação Floculação

Leia mais

Lílian Maria Lapa Montenegro Departamento de Imunologia Laboratório rio de Imunoepidemiologia

Lílian Maria Lapa Montenegro Departamento de Imunologia Laboratório rio de Imunoepidemiologia XVIII Congresso Mundial de Epidemiologia e VII Congresso Brasileiro de Epidemiologia Avaliação do desempenho da técnica de nested- PCR em amostras de sangue coletadas de pacientes pediátricos com suspeita

Leia mais


TRATAMENTO DA ÁGUA PARA GERADORES DE VAPOR Universidade Federal do Paraná Curso de Engenharia Industrial Madeireira MÁQUINAS TÉRMICAS AT-101 Dr. Alan Sulato de Andrade 1 INTRODUÇÃO: A água nunca está em estado puro, livre de

Leia mais


FOSFATO DISSÓDICO DE DEXAMETASONA FSFAT DISSÓDIC DE DEXAMETASNA Dexamethasoni natrii phosphas H H H P Na Na F H C 22 H 28 FNa 2 8 P 516,41 02821 Fosfato dissódico de 9-fluoro-11β,17 diidroxi-16α-metil-3, 20- dioxopregna- 1,4 dieno-21-il

Leia mais



Leia mais



Leia mais


BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais


ABORDAGEM DO TRABALHO SANEAMENTO BASÍCO Estação de Tratamento de Água - ETA Eng. Civil 9 Semestre Prof. Samudio Alunos: Félix Machado Vilela. RA: 1299127696 Floriano Oliveira de Araújo. RA: 1299127695 Thiago de Jesus Lara.

Leia mais

A água destinada ao consumo humano deve ser isenta de agentes biológicos como vírus, bactérias, protozoários e helmintos (BRANCO,

A água destinada ao consumo humano deve ser isenta de agentes biológicos como vírus, bactérias, protozoários e helmintos (BRANCO, DESCONTAMINAÇÃO BACTERIOLÓGICA DA ÁGUA ATRAVÉS DE UM PASTEURIZADOR SOLAR Silva, T.C.D. (1) ; Calazans, G. M. T. (1) : Carielo, G. (1) ; Tiba, C. (1) (1) Universidade Federal de

Leia mais



Leia mais

SULFATO FERROSO HEPTAIDRATADO Ferrosi sulfas heptahydricus

SULFATO FERROSO HEPTAIDRATADO Ferrosi sulfas heptahydricus SULFATO FERROSO HEPTAIDRATADO Ferrosi sulfas heptahydricus FeSO 4.7H 2 O 278,01 06404.02-0 Fe 55,85 Sulfato ferroso heptaidratado Contém, no mínimo, 98,0% e, no máximo, 105,0% de FeSO 4.7H 2 O. DESCRIÇÃO

Leia mais

CET 303 Química Aplicada. Relatório: Visita técnica Estação de tratamento de água ETA 3 Capim Fino, em Piracicaba. Data da visita: 02.04.

CET 303 Química Aplicada. Relatório: Visita técnica Estação de tratamento de água ETA 3 Capim Fino, em Piracicaba. Data da visita: 02.04. Universidade Estadual de Campinas Faculdade de Tecnologia - FT Curso de Especialização em Meio Ambiente e Desenvolvimento Sustentável CET 303 Química Aplicada Relatório: Visita técnica Estação de tratamento

Leia mais

Numa fossa séptica não ocorre a decomposição aeróbia e somente ocorre a decomposição anaeróbia devido a ausência quase total de oxigênio.

Numa fossa séptica não ocorre a decomposição aeróbia e somente ocorre a decomposição anaeróbia devido a ausência quase total de oxigênio. As fossas sépticas são unidades de tratamento primário de esgoto doméstico nas quais são feitas a separação e a transformação físico-química da matéria sólida contida no esgoto. É uma maneira simples e

Leia mais



Leia mais



Leia mais


UM NOVO TESTE PARA TUBERCULOSE UM NOVO TESTE PARA TUBERCULOSE Rio de Janeiro e Manaus testam para o Ministério da Saúde uma nova tecnologia para o diagnóstico da tuberculose pulmonar Que novo teste é este? O Xpert MTB/RIF é um método

Leia mais

Rogério Pereira Xavier. Orientadora: Drª. Glícia Maria Torres Calazans. Co-orientadora: Drª. Francisca Janaína Soares Rocha

Rogério Pereira Xavier. Orientadora: Drª. Glícia Maria Torres Calazans. Co-orientadora: Drª. Francisca Janaína Soares Rocha Universidade Federal de Pernambuco Centro de Ciências Biológicas Curso de Biomedicina Co-orientadora: Drª. Francisca Janaína Soares Rocha Ocorrência de contaminação por bactérias e por protozoários patogênicos

Leia mais

Unidade IX Microbiologia de água destinada ao consumo humano

Unidade IX Microbiologia de água destinada ao consumo humano Unidade IX Microbiologia de água destinada ao consumo humano Dorit Schuller 1. Recolha de amostras para análise microbiológica 3 2. Contagem total de microrganismos 4 3. Pesquisa e quantificação de Escherichia

Leia mais

4027 Síntese de 11-cloroundec-1-eno a partir de 10-undecen-1-ol

4027 Síntese de 11-cloroundec-1-eno a partir de 10-undecen-1-ol 4027 Síntese de 11-cloroundec-1-eno a partir de 10-undecen-1-ol OH SOCl 2 Cl + HCl + SO 2 C 11 H 22 O C 11 H 21 Cl (170.3) (119.0) (188.7) (36.5) (64.1) Classificação Tipos de reações e classes das substâncias

Leia mais

Ar de Alta Qualidade, da Geração à Utilização

Ar de Alta Qualidade, da Geração à Utilização Ar de Alta Qualidade, da Geração à Utilização A qualidade do ar em um sistema de ar comprimido tem variações e todas elas estão contempladas no leque de opções de produtos que a hb ar comprimido oferece.

Leia mais


REUSO PLANEJADO DA ÁGUA: UMA QUESTÃO DE INTELIGÊNCIA... REUSO ÁGUA: INTELIGÊNCIA... PLANEJADO DA UMA QUESTÃO DE CONSUMO DE ÁGUA doméstico Indústria Agricultura 18,60% 8,00% 22,40% 22,00% 59,00% 70,00% Brasil Mundo Consumo mundial = 3.240 km 3 / ano Consumo

Leia mais

(Actos não legislativos) REGULAMENTOS

(Actos não legislativos) REGULAMENTOS 3.3.2010 Jornal Oficial da União Europeia L 52/1 II (Actos não legislativos) REGULAMENTOS REGULAMENTO (UE) N. o 175/2010 DA COMISSÃO de 2 de Março de 2010 que dá execução à Directiva 2006/88/CE no que

Leia mais



Leia mais

Determinação quantitativa de amido em produtos cárneos por espectrometria

Determinação quantitativa de amido em produtos cárneos por espectrometria Página 1 de 7 1 Escopo Este método tem por objetivo quantificar amido em produtos cárneos por espectrometria molecular no. 2 Fundamentos Baseia-se na determinação espectrofotométrica a 620 nm do composto

Leia mais

Géis de Entrada e Separação

Géis de Entrada e Separação (1) Géis de Entrada e Separação ESCOLHA DO GEL Depende do tamanho da proteína que se quer detectar: Tamanho da Proteína Gel 4 40 kda 20% 12 45 kda 15% 10 70 kda 12% 15 100 kda 10% 25 200 kda 8% PREPARO

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

02/08/2015. Padrões de potabilidade TRATAMENTO DA ÁGUA. Tratamento da água. Tratamento da água. Tratamento da água

02/08/2015. Padrões de potabilidade TRATAMENTO DA ÁGUA. Tratamento da água. Tratamento da água. Tratamento da água Padrões de potabilidade A água própria para o consumo deve obedecer certos requisitos: TRATAMENTO DA ÁGUA Professor: André Luiz Montanheiro Rocha Disciplina: Gestão de Recursos Naturais 2ª COLÉGIO ESTADUAL

Leia mais


AEROTEC SANEAMENTO BÁSICO LTDA. INTRODUÇÃO Todo e qualquer sistema de captação e tratamento de efluente doméstico tem como destino final de descarte desse material, direta ou indiretamente, corpos d água como seus receptores. A qualidade

Leia mais


MANUAL BÁSICO DE TRATAMENTO QUÍMICO MANUAL BÁSICO DE TRATAMENTO QUÍMICO O Tratamento Químico e fundamental para deixar a água da piscina saudável, limpa e cristalina. Você necessita medir, inicialmente, três parâmetros: Alcalinidade Total,

Leia mais

Controle de populações microbianas: eficácia da ação de desinfetantes sobre superfícies inertes

Controle de populações microbianas: eficácia da ação de desinfetantes sobre superfícies inertes Departamento de Microbiologia Instituto de Ciências Biológicas Universidade Federal de Minas Gerais Controle de populações microbianas: eficácia da ação de desinfetantes sobre

Leia mais

XIX CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA 27 de setembro a 01 de outubro de 2010


Leia mais



Leia mais

O que é filtragem? Técnicas de filtragem para irrigação. Porque utilizar a filtragem? Distribuição das partículas sólidas

O que é filtragem? Técnicas de filtragem para irrigação. Porque utilizar a filtragem? Distribuição das partículas sólidas Técnicas de filtragem para irrigação Prof. Roberto Testezlaf Faculdade de Engenharia Agrícola UNICAMP IV SIMPÓSIO DE CITRICULTURA IRRIGADA Bebedouro, 06 de julho de 2006 O que é filtragem? Processo de

Leia mais

Plásticos para Cultivo Celular

Plásticos para Cultivo Celular Linha Cultivo de Células e Tecidos Fabricada em poliestireno cristal virgem (GPPS), oferece produtos com alta transparência para ótima visualização e sem presença de contaminantes, assegurando integridade

Leia mais

NASCIMENTO, Karla Alvarenga 1 ; FERREIRA, Marcos Roberto Alves 2 ; BORGES, Guilherme Assis 3 ; MOREIRA, Cecília Nunes 4

NASCIMENTO, Karla Alvarenga 1 ; FERREIRA, Marcos Roberto Alves 2 ; BORGES, Guilherme Assis 3 ; MOREIRA, Cecília Nunes 4 Análise e orientações sobre a qualidade microbiológica da água não tratada utilizada para o consumo humano em propriedades na zona rural e periurbana e em escolas rurais de Jataí e entorno. NASCIMENTO,

Leia mais



Leia mais

Bioquímica. Purificação de proteínas

Bioquímica. Purificação de proteínas Bioquímica Purificação de proteínas Estratégia geral - Liberação da proteína do material biológico - Podem ser separados por fracionamento celular - Pode-se separar proteínas por características: Solubilidade

Leia mais

A eletroforese é uma técnica utilizada para separar, identificar e purificar

A eletroforese é uma técnica utilizada para separar, identificar e purificar 7. ELETROFORESE DE ÁCIDOS NUCLÉICOS João José de Simoni Gouveia Luciana Correia de Almeida Regitano A eletroforese é uma técnica utilizada para separar, identificar e purificar moléculas carregadas (como

Leia mais