DETECÇÃO DE Cryptosporidium spp. AO LONGO DA BACIA DE MANANCIAL DO RIBEIRÃO CAFEZAL, LONDRINA/PR.

Tamanho: px
Começar a partir da página:

Download "DETECÇÃO DE Cryptosporidium spp. AO LONGO DA BACIA DE MANANCIAL DO RIBEIRÃO CAFEZAL, LONDRINA/PR."

Transcrição

1 DETECÇÃO DE Cryptosporidium spp. AO LONGO DA BACIA DE MANANCIAL DO RIBEIRÃO CAFEZAL, LONDRINA/PR. R. M. Kawata*, L. F. Maia** e K. V. M. C. Prates*** *Graduanda em Engenharia Ambiental / UTFPR, Londrina/PR, Brasil **Coordenação de Tecnologia em Alimentos / UTFPR, Londrina/PR, Brasil ***Coordenação em Engenharia Ambiental / UTFPR, Londrina/PR, Brasil Resumo Visto que a presença de Cryptosporidium spp. em águas para o consumo revela-se um importante problema de saúde pública, o presente trabalho teve como objetivo detectar a presença de Cryptosporidium spp. na bacia de manancial do Ribeirão Cafezal, da cidade de Londrina. Foram avaliados 9 pontos ao longo da bacia, durante os meses de Agosto a Maio. As metodologias utilizadas neste trabalho foram a técnica da membrana filtrante, extração de DNA e reação de polimerase em cadeia (PCR). Oocistos de Cryptosporidium spp. foram encontrados em vários pontos do corpo d água avaliado. Palavras-chave: Ribeirão Cafezal, Cryptosporidium, PCR. Abstract As the presence of Cryptosporidium spp. in the water for consumption proves to be an important public health problem, this study aimed to detect the presence of Cryptosporidium spp. in the Ribeirão Cafezal basin, in the city of Londrina. We evaluated nine points along the basin, during the months of August to May. The methodologies used in this study were the technique of membrane filtration, DNA extraction and polymerase chain reaction (PCR). Cryptosporidium spp. was found in various samples of the collected water. Key words: Ribeirão Cafezal, Cryptosporidium, PCR. Introdução Cryptosporidium spp. é considerado como um importante patógeno emergente de veiculação hídrica, causador de gastroenterites e diarreias autolimitadas em indivíduos sadios e infecções crônicas em imunodeficientes [1]. Todas as espécies do gênero Cryptosporidium spp. são parasitas obrigatórios, porém a espécie mais relevante deste gênero é o C. parvum, que provoca infecção no homem. Eles infectam as microvilosidades das células epiteliais do trato digestivo e respiratório de vertebrados e são liberadas nas fezes do hospedeiro infectado. Os esporozoítos e oocistos que compõem seu ciclo de vida são de tamanho reduzindo, variando de 4 a 6 µm [2]. O mecanismo de transmissão deste protozoário é influenciado pelo nível de contaminação ambiental, sobrevivência do oocisto às condições do meio, resistência do oocisto aos mais variados métodos de tratamentos da água ou a incompleta remoção dos oocistos [3]. 1/8

2 Essas características de persistência ambiental e resistência aos processos usuais de desinfecção, aliadas à alta infecciosidade relativa, têm conferido ao Cryptosporidium spp. o status de micro-organismo de referência pela OMS e legislações de alguns países [2]. Desta forma, este trabalho visou investigar a ocorrência de oocistos de Cryptosporidium spp. no percurso da bacia de manancial de abastecimento do Ribeirão Cafezal, da cidade de Londrina/PR. Para tanto foi utilizada a técnica da membrana filtrante e a confirmação molecular pela técnica da PCR (Polimerase Chain Reaction). Materiais e Métodos A área de análise compreendeu a bacia do Ribeirão Cafezal, que constitui um dos mananciais de abastecimento da cidade de Londrina, percorrendo ainda os municípios de Cambé e Rolândia. Para a análise da presença de Cryptosporidium spp foram coletados 2 litros de água de 9 pontos de coleta (Figura 1), com auxilio de frascos de vidro esterilizados, mergulhados a uma profundidade de aproximadamente 20 cm, e posteriormente armazenados em garrafas PET lavadas com solução 1% de Tween 80. Figura 1: Pontos de coleta de água distribuídos na Bacia de Manancial do Ribeirão Cafezal. Fonte: SANEPAR, /8

3 Como visto na Figura 1, os pontos abrangem os municípios de Rolândia, Cambé e Londrina. Descrevem-se os pontos como: - Ponto 1: Rio perto da antiga Big-frango em Rolândia; - Ponto 2: Rio perto do cemitério em Rolândia; - Ponto 3: Rio que passa embaixo da rodovia que da acesso à Rolândia; - Ponto 4: Rio que passa no fundo de um Clube; - Ponto 5: Parte mais barrenta do rio presente na parte rural entre Cambé e Rolândia; - Ponto 6: Parte mais cristalina do rio presente na parte rural entre Cambé e Rolândia; - Ponto 7: Rio presente na parte rural após Londrina; - Ponto 8: Rio presente no começo da parte rural após Londrina (Perto de um sítio); - Ponto 9: Estação de captação da SANEPAR. O isolamento do protozoário foi realizado pelo método da membrana filtrante, onde os 2 litros de água foram filtrados em um sistema de bomba a vácuo. Os oocistos retidos na membrana foram removidos por extração mecânica e lavagem com solução a 1% de Tween 80. O liquido resultante foi transferido para tubos de centrífuga, com rotação a 6000 rpm por 15 minutos. O sedimento obtido foi suspenso em 1 ml de água destilada esterilizada. Alíquotas foram submetidas a coloração de oocistos, pelo método de Kinyoun e observadas em microscópio óptico comum com aumento de 400 vezes. O procedimento de extração de DNA foi realizado pela técnica do choque térmico. Inicialmente pegou-se 1 ml proveniente da obtenção dos oocistos e centrifugou-se a rpm a 5 minutos. Ao pellet resultante diluiu-se 500 µm de tampão (10 mm Tris-HCl ph 8,0; 25 mm EDTA ph 8,0; 100 mm NaCl e 1% de SDS). Em seguida prosseguiu-se com 5 ciclos de congelamento em gelo seco por 5 minutos e descongelamento em banho maria a 65ºC por 5 minutos, com posterior adição de 20 µm de proteinase K (10 mg/ml). As amostras foram incubadas a 56ºC por 2 horas com agitação a 1000 rpm a cada 5 minutos. Centrifugou-se a rpm por 15 minutos e ao sobrenadante foi acrescentado 1 ml de etanol gelado e colocado no freezer overnight. Centrifugou-se por 20 minutos a rpm, descartou-se o etanol e foi adicionado 50 µm etanol 70%. O DNA precipitado foi obtido por centrifugação a rpm por 20 minutos, seguido de adição de 50 µl de água destilada estéril. A amplificação do gene de identificação do gênero CRY18SF (5 : TTCTAGAGCTAATACATGCG3 ) e CRY18R (5 CCCATTTCCTTCGAAACAGGA3 ) foi realizada em termocilador, utilizando uma mistura de 20µL contendo 2 µl de 1x tampão PCR, 1 µl de MgCl 2 (50mM), 1,4 µl de 3/8

4 dntp (10mM), 1 µl de cada oligonucleotideo iniciador, 0,5 µl da enzima Taq polimerase, 2 µl de amostra completando-se o volume para 20 µl com água bidestilada estéril. As condições de amplificação utilizadas foram as seguintes: um ciclo inicial a 94ºC por 10 minutos; 35 ciclos de desnaturação a 94ºC por 1 min; anelamento a 55ºC por 1 min e extensão a 72ºC por 1 min e 30s; e um ciclo final a 72ºC por 10 minutos. A integridade do DNA foi visualizada em gel de agarose (1,5%, p/v) corados com solução de brometo de etídio (0,005%, p/v) e revelado em luz ultravioleta. Resultados A partir das análises microscópicas realizadas das amostras coletadas no período de Agosto de 2011 a Maio de 2012, obteviveram-se os resultados de presença ou ausência do Cryptosporidium spp (Tabela 1 e Tabela2). Tabela 1: Resultados da análise microscópica da presença de oocistos de Cryptosporidium spp. nas amostras realizadas em Agosto a Dezembro de Pontos de Agosto Setembro Outubro Novembro Dezembro Coleta P A P A P A P A P A Ponto 1 x x x x x Ponto 2 x x x x x Ponto 3 x x x x x Ponto 4 x x x x x Ponto 5 x x x x x Ponto 6 x x x x x Ponto 7 x x x x x Ponto 8 x x x x x Ponto 9 x x x x x Legenda: P Presença; A Ausência. Na Figura 2 pode-se visualizar alguns dos oocistos de cryptosporidium spp. A quantificação de DNA presente nas amostras está representada na Figura 3. Os códigos identificam os pontos e o mês da coleta: - C1E: Ponto 1 do mês de Agosto; - C2E: Ponto 2 do mês de Agosto; - C3E: Ponto 3 do mês de Agosto; - C5E: Ponto 5 do mês de Agosto; - C8E: Ponto 8 do mês de Agosto; - C6F: Ponto 6 do mês de Setembro; - C7F: Ponto 7 do mês de Setembro; - C8F: Ponto 8 do mês de Setembro; - C2G: Ponto 2 do mês de Outubro; - C2H: Ponto 2 do mês de Novembro; 4/8

5 - C6I: Ponto 6 do mês de Dezembro; - C8I: Ponto 8 do mês de Dezembro. Com relação ao aspecto da água, tem-se: - Turva: C1E, C5E, C8E, C6F, C7F, C8F, C6I, C8I. - Cristalina: C2E, C3E, C2G, C2H. Tabela 2: Resultados da análise microscópica da presença de oocistos de Cryptosporidium spp. nas amostras realizadas em Fevereiro a Maio de Pontos de Coleta Fevereiro Março Abril Maio P A P A P A P A Ponto 1 x x x x Ponto 2 x x x x Ponto 3 x x x x Ponto 4 x x x x Ponto 5 x x x x Ponto 6 x x x x Ponto 7 x x x x Ponto 8 x x x x Ponto 9 x x x x Legenda: P Presença; A Ausência. Figura 2: Oocistos de Cryptosporidium spp. (seta) observados ao microscópio óptico comum, após coloração pelo método de Kinyoun. A) Oocisto do Ponto 2 da coleta do mês de Outubro. B) Oocisto do Ponto 1 da coleta do mês de Dezembro. C) Oocisto do Ponto 8 da coleta do mês de Dezembro. Na técnica de PCR não apresentou amplificação para o gene gênero específico para Cryptosporidium spp. reajustes na técnica estão sendo realizadas. Os dados de precipitação da região da bacia de manancial do Ribeirão Cafezal estão dispostos na Tabela 3. 5/8

6 Figura 3: Canaletas C1E a C8I: DNA genômico de Cryptosporidium spp. após a técnica de extração (seta). λ: DNA do fago λ em concentração de 10 ng/µl. Tabela 3: Dados de precipitação da região da bacia do Ribeirão Cafezal. Mês Precipitação (mm) Agosto 31,7 Setembro 7 Outubro 278,3 Novembro 140,1 Dezembro 86,4 Fevereiro 40,3 Março 87,8 Abril 159 Maio 64,5 Discussão A agregação de patógenos ao material particulado, ou a integração de patógenos a matéria orgânica influencia na taxa de sedimentação de patógenos e favorece o decaimento dos mesmos na coluna d água. Embora a sedimentação individual dos oocistos seja extremamente lenta, a capacidade dos oocistos de se aderirem às partículas aumenta potencialmente sua velocidade de sedimentação [4]. Como em diversos pontos a água encontrava-se aparentemente cristalina, constatou-se que a sedimentação provavelmente contribui para uma menor concentração de oocistos na camada superficial que foi a região na qual a água foi coletada. É interessante ressaltar que os organismos patogênicos costumam estar associados às partículas responsáveis pela turbidez, que parecem utilizá-las como substrato e forma de proteção. Assim, ao remover a turbidez da água, são também removidos os patogênicos a ela associados [5]. No estudo do Ribeirão Cafezal o fator turbidez seguiu o mencionado por Silva [5], onde a maioria dos pontos analisados que apresentaram o oocisto de Cryptosporidium spp. possuía uma turbidez notável. Reforçando então a probabilidade de encontrar oocistos em águas com turbidez elevada. Em estudos quanto à influência de chuvas sobre a ocorrência de oocistos em ambientes aquáticos, observou-se uma elevação de 10 a 100 vezes a concentração de oocistos durante períodos chuvosos em relação aos não chuvosos [2]. A partir de dados de precipitação da região da área de estudo há uma contradição ao relatado por Cerqueiria [2]. Os meses que apresentaram positivamente o Cryptosporidium spp. não foram os com maior precipitação mensal. O mês com precipitação 6/8

7 mais elevada obteve apenas um ponto com a presença do Cryptosporidium spp. É de extrema importância que os processos hidrodinâmicos sejam mais bem avaliados, em pesquisas mais longas, pois tais processos influenciam diretamente na distribuição e transporte dos patógenos no corpo d água [6]. A presença de Cryptosporidium spp. também pode ser fortemente influenciada pela sazonalidade e pelo uso do solo [6]. O ponto com mais frequência na detecção de oocistos foi o ponto 8 que consiste justamente em uma área de criação de gado. Na técnica de PCR não observamos amplificação do gene gênero específico para este protozoário. Provavelmente a temperatura de anelamento do oligonucleotideo não foi adequada. Demais testes estão sendo realizados. Conclusão Embora a detecção de Cryptosporidium spp. tenha ocorrido em alguns pontos de coleta deve-se considerar fatores como temperatura, radiação, variações do ph, pois estes possivelmente favorecem a inativação dos patógenos na água e consequente não detecção dos mesmos nas análises. Além disso, não se pode esquecer que o uso e ocupação do solo é um fator indispensável na avaliação da presença do Cryptosporidium spp. Agradecimentos A Universidade Tecnológica Federal do Paraná UTFPR, a Fundação Araucária e ao CNPq pelo suporte financeiro. Referências [1] Muller, A.P.B. (1999), Detecção de oocistos de Cryptosporidium spp. em águas de abastecimento superficiais e tratadas da região metropolitana de São Paulo, Dissertação de Mestrado, Instituto de Ciências Biomédicas da Universidade de São Paulo, São Paulo, p. 3. [2] Cerqueira, D.A. (2008), Remoção de oocistos de Cryptosporidium parvum e de indicadores no tratamento de água por ciclo completo, filtração direta descendente e dupla filtração, em escala piloto, Tese de Pós-graduação em Saneamento, Meio Ambiente e Recursos Hídricos da Universidade Federal de Minas Gerais, Escola de Engenharia da UFMG, Belo Horizonte, p., 2, 19. [3] Lima, E.C., Stamford, T.L.M. Cryptosporidium spp. no ambiente aquático: aspectos relevantes da disseminação e diagnóstico. Ciência & Saúde Coletiva, 8930: , /8

8 [4] Brookes, D.J., Antenucci, J., Hipsey, M., Burch, D.M., Ashbolt, J.N., Ferguson, C. Fate and transport of pathogens in lakes and reservoirs. Environment International, v.30, p , [5] Silva, C.F. (2008), Remoção de oocistos e de indicadores físicos de Cryptosporidium parvum em águas de abastecimento por meio da decantação estudo em escala piloto, Dissertação de Mestrado, Escola de Engenharia da UFMG, Belo Horizonte, p.42. [6] Lopes, A.M.M.B. (2009), Avaliação da ocorrência de oocistos de Cryptosporidium spp. e de cistos de Giardia spp. e sua associação com indicadores bacteriológicos e turbidez na represa de Vargem das Flores MG, Dissertação de Mestrado, Escola de Engenharia da UFMG, Belo Horizonte, p /8

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Departamento de Biologia da Universidade do Minho

Departamento de Biologia da Universidade do Minho Departamento de Biologia da Universidade do Minho Mestrado em Genética Molecular Ano lectivo de 2004/2005, edição de 2004-2006 Estudo da regulação do gene STL1 codificando o sistema de simporte H + /glicerol

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

AVALIAÇÃO EMPÍRICA DOS TEMPOS DE FLOCULAÇÃO E SEDIMENTAÇÃO A SEREM APLICADOS NO JARTESTE DA ETA CENTRAL DE JACAREÍ

AVALIAÇÃO EMPÍRICA DOS TEMPOS DE FLOCULAÇÃO E SEDIMENTAÇÃO A SEREM APLICADOS NO JARTESTE DA ETA CENTRAL DE JACAREÍ AVALIAÇÃO EMPÍRICA DOS TEMPOS DE FLOCULAÇÃO E SEDIMENTAÇÃO A SEREM APLICADOS NO JARTESTE DA ETA CENTRAL DE JACAREÍ NELSON GONÇALVES PRIANTI JUNIOR (1) - Biólogo (UNITAU), Pedagogo (UNIFRAN), Especialista

Leia mais

Elaborado por: Karina Salvador Revisado por: Hilda Helena Wolff Aprovado por: Andréa Cauduro

Elaborado por: Karina Salvador Revisado por: Hilda Helena Wolff Aprovado por: Andréa Cauduro ANTI- 1 Manual CAMBRIDGE BIOTECH -1 POP: BM 05 Página 1 de 7 1. Sinonímia ANTI, TESTE CONFIRMATÓRIO. 2. Aplicabilidade Aos bioquímicos e técnicos do setor de imunologia. 3. Aplicação clínica Os testes

Leia mais

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes)

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes) PT Instruções de utilização CYCLER CHECK Kit de teste para a validação da uniformidade da temperatura em termocicladores pronto a usar, pré-aliquotado REF 7104 (10 testes) REF 71044 (4 testes) Índice 1.

Leia mais

TESTES DE EXTRAÇÃO DE DNA DE Anticarsia gemmatalis e Spodoptera frugiperda USANDO O PROTOCOLO MINIPREP (MODIFICADO DE RAEDER; BRODA, 1985)

TESTES DE EXTRAÇÃO DE DNA DE Anticarsia gemmatalis e Spodoptera frugiperda USANDO O PROTOCOLO MINIPREP (MODIFICADO DE RAEDER; BRODA, 1985) TESTES DE EXTRAÇÃO DE DNA DE Anticarsia gemmatalis e Spodoptera frugiperda USANDO O PROTOCOLO MINIPREP (MODIFICADO DE RAEDER; BRODA, 1985) Francielle Fiorentin, Alice Jacobus de Moraes, Viviane M. Celant,

Leia mais

Protocolo laboratorial para purificação manual de DNA de amostra integral

Protocolo laboratorial para purificação manual de DNA de amostra integral Protocolo laboratorial para purificação manual de DNA de amostra integral Para a purificação de DNA genômico nos kits de coleta das famílias Oragene e ORAcollect Visite nosso site www.dnagenotek.com para

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Mesa redonda CIANOBACTÉRIAS

Mesa redonda CIANOBACTÉRIAS Mesa redonda CIANOBACTÉRIAS Tema Gestão na implantação da Identificação e Contagem de Cianobactérias na URCQA/PE 18 a 22 de março de 2013 Belo Horizonte BH Disponibilidade hídrica no Brasil 12% da água

Leia mais

Biologia Celular e Molecular

Biologia Celular e Molecular DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA Biologia Celular e Molecular Detecção de proteínas por western-blotting 2007-2008 Na electroforese em gel de poliacrilamida

Leia mais

ANÁLISE DA UTILIZAÇÃO DE TRÊS DIFERENTES COAGULANTES NA REMOÇÃO DA TURBIDEZ DE ÁGUA DE MANANCIAL DE ABASTECIMENTO

ANÁLISE DA UTILIZAÇÃO DE TRÊS DIFERENTES COAGULANTES NA REMOÇÃO DA TURBIDEZ DE ÁGUA DE MANANCIAL DE ABASTECIMENTO 25 a 28 de Outubro de 2011 ISBN 978-85-8084-055-1 ANÁLISE DA UTILIZAÇÃO DE TRÊS DIFERENTES COAGULANTES NA REMOÇÃO DA TURBIDEZ DE ÁGUA DE MANANCIAL DE ABASTECIMENTO Diana Janice Padilha 1, Fabiane Cristina

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS POP n.º: I 140 Página 1 de 6 1. Sinonímia Detecção qualitativa do DNA bacteriano de Chlamydia trachomatis (CT) e Neisseria gonorrhoeae (NG) por PCR ( Polymerase Chain Reaction) em urina de homens e mulheres,

Leia mais

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI.

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. Antonia Cardoso Almeida ( ICV/ UFPI); Francilene Leonel Campos(orientadora, Curso de Licenciatura em Ciências Biológicas/

Leia mais

BIOQUÍMICA EXPERIMENTAL

BIOQUÍMICA EXPERIMENTAL Departamento de Bioquímica Instituto de Química USP Apostila de protocolos BIOQUÍMICA EXPERIMENTAL QBQ 036N 203 Professores Carlos Takeshi Hotta Guilherme Menegon Arantes Esta apostila foi desenvolvida

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

BIOQUÍMICA EXPERIMENTAL

BIOQUÍMICA EXPERIMENTAL Departamento de Bioquímica Instituto de Química USP Apostila de protocolos BIOQUÍMICA EXPERIMENTAL QBQ 06N 0 Professores Carlos T. Hotta Ronaldo B. Quaggio Eduardo M. Reis Esta apostila foi desenvolvida

Leia mais

Protocolos LabDros. Organizado por: Gabriel da Luz Wallau, 2010. Meio de Cultura Estoque para Drosophila. Meio de Drosophila Especial

Protocolos LabDros. Organizado por: Gabriel da Luz Wallau, 2010. Meio de Cultura Estoque para Drosophila. Meio de Drosophila Especial Protocolos LabDros Organizado por: Gabriel da Luz Wallau, 2010. - 1 kg de Farinha de milho grossa; - 200g de germe de trigo; - 1 xícara de açúcar; - 2 colheres de leite em pó; - 1 colher de sal; - 800g

Leia mais

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015

TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015 TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015 CATEGORIA: CONCLUÍDO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: MEDICINA VETERINÁRIA INSTITUIÇÃO:

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

I-053 - REMOÇÃO DE CRYPTOSPORIDIUM SP E GIARDIA LAMBLIA EM ÁGUAS DE ABASTECIMENTO

I-053 - REMOÇÃO DE CRYPTOSPORIDIUM SP E GIARDIA LAMBLIA EM ÁGUAS DE ABASTECIMENTO I-053 - REMOÇÃO DE CRYPTOSPORIDIUM SP E GIARDIA LAMBLIA EM ÁGUAS DE ABASTECIMENTO Arthur Diaz Marques (1) Farmacêutico Bioquímico pela Faculdade de Farmácia e Bioquímica do Estado do Espírito Santo (1983).

Leia mais

PCR. Transiluminador * Características

PCR. Transiluminador * Características PCR PCR A PCR - reação em cadeia da polimerase - é uma técnica de biologia molecular que permite a replicação in vitro do DNA de maneira eficiente, utilizando amostras que podem ser amplificadas milhões

Leia mais

XIX CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA 27 de setembro a 01 de outubro de 2010

XIX CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA 27 de setembro a 01 de outubro de 2010 MARCADORES SSR PARA A CARACTERIZAÇÃO E IDENTIFICAÇÃO DE CULTIVARES DE MILHETO (Pennisetum glaucum (L.) R. Br.) ADRIANO ALVES DA SILVA 1, ÉDILA VILELA RESENDE VON PINHO 2 ; BRUNA LINE CARVALHO 3, VIVIAN

Leia mais

* Verificar item 9 Preparo dos Reagentes e item 8 - Reagentes e Equipamentos necessários, mas não fornecidos.

* Verificar item 9 Preparo dos Reagentes e item 8 - Reagentes e Equipamentos necessários, mas não fornecidos. KIT DE EXTRAÇÃO MINI VAC AUTOMAÇÃO DE 96 AMOSTRAS Instruções de Uso 1. USO PRETENDIDO O BIOPUR Kit de Extração Mini VAC Automação 96 Amostras é a ferramenta ideal para extração automática rápida e confiável

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Isolamento Viral em Cultivo Celular. Adriana Candido Rodrigues

Isolamento Viral em Cultivo Celular. Adriana Candido Rodrigues Isolamento Viral em Cultivo Celular Adriana Candido Rodrigues Vírus: Parasitas intracelulares obrigatórios Célula viva para replicação Sistemas Celulares Animais de Laboratório Ovos Embrionados Cultura

Leia mais

ENSAIO DE ENDOTOXINAS BACTERIANAS

ENSAIO DE ENDOTOXINAS BACTERIANAS ENSAIO DE ENDOTOXINAS BACTERIANAS O ensaio de endotoxinas bacterianas (EEB) é um ensaio para detectar ou quantificar endotoxinas de bactérias gram negativas usando um lisado de amebócitos de caranguejo

Leia mais

EXTRAÇÃO DE DNA (2) A EXTRAÇÃO DE DNA A PRÁTICA NO LABORATÓRIO DE ENSINO BIBLIOGRAFIA

EXTRAÇÃO DE DNA (2) A EXTRAÇÃO DE DNA A PRÁTICA NO LABORATÓRIO DE ENSINO BIBLIOGRAFIA EXTRAÇÃO DE DNA (2) A EXTRAÇÃO DE DNA Muitas pesquisas de Biologia Molecular começam com a extração de ácidos nucleicos. A lise celular libera as moléculas em uma fase aquosa que é separada dos restos

Leia mais

Anais do Conic-Semesp. Volume 1, 2013 - Faculdade Anhanguera de Campinas - Unidade 3. ISSN 2357-8904

Anais do Conic-Semesp. Volume 1, 2013 - Faculdade Anhanguera de Campinas - Unidade 3. ISSN 2357-8904 Anais do Conic-Semesp. Volume 1, 2013 - Faculdade Anhanguera de Campinas - Unidade 3. ISSN 2357-8904 TÍTULO: PESQUISA DE LISTERIA MONOCYTOGENES EM AMOSTRAS DE PESCADO RESFRIADO DESTINADO AO CONSUMO HUMANO,

Leia mais

Fundamentos teórico-práticos e protocolos de extração e de amplificação de dna por meio da técnica de reação em cadeia da polimerase

Fundamentos teórico-práticos e protocolos de extração e de amplificação de dna por meio da técnica de reação em cadeia da polimerase Fundamentos teórico-práticos e protocolos de extração e de amplificação de dna por meio da técnica de reação em cadeia Empresa Brasileira de Pesquisa Agropecuária Embrapa Pecuária Sudeste Ministério da

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Estudantes do Programa de Pós Graduação em Zootecnia da Universidade Estadual de Maringá.

Estudantes do Programa de Pós Graduação em Zootecnia da Universidade Estadual de Maringá. Extração de DNA e RNA de fígado e músculo em tilápia do Nilo Extraction of DNA and RNA from liver and muscle in Nile tilapia Extracción de ADN y ARN de hígado y músculo en tilapia del Nilo Eliane Gasparino

Leia mais

PCR. Transiluminador * Cubas de Eletroforese * Características

PCR. Transiluminador * Cubas de Eletroforese * Características PCR PCR A PCR - reação em cadeia da polimerase - é uma técnica de biologia molecular que permite a replicação in vitro do DNA de maneira eficiente, utilizando amostras que podem ser amplificadas milhões

Leia mais

Análise da Turbidez da Água em Diferentes Estados de Tratamento

Análise da Turbidez da Água em Diferentes Estados de Tratamento VIII ERMAC 8 o Encontro Regional de Matemática Aplicada e Computacional - de Novembro de 8 Universidade Federal do Rio Grande do Norte Natal/RN Análise da Turbidez da Água em Diferentes Estados de Tratamento

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

TRATAMENTO ÁGUA PEQUENAS COMUNIDADES CÂMARA TÉCNICA DE SANEAMENTO-CBHLN ABRIL-2OO9

TRATAMENTO ÁGUA PEQUENAS COMUNIDADES CÂMARA TÉCNICA DE SANEAMENTO-CBHLN ABRIL-2OO9 TRATAMENTO ÁGUA PEQUENAS COMUNIDADES CÂMARA TÉCNICA DE SANEAMENTO-CBHLN ABRIL-2OO9 CICLO HIDROLOGICO » POLUIÇÃO NATURAL » MANANCIAIS LITORAL NORTE » POLUIÇÃO NATURAL ( CONT ) » REALIDADE DE ABASTIMENTO

Leia mais

Rogério Pereira Xavier. Orientadora: Drª. Glícia Maria Torres Calazans. Co-orientadora: Drª. Francisca Janaína Soares Rocha

Rogério Pereira Xavier. Orientadora: Drª. Glícia Maria Torres Calazans. Co-orientadora: Drª. Francisca Janaína Soares Rocha Universidade Federal de Pernambuco Centro de Ciências Biológicas Curso de Biomedicina Co-orientadora: Drª. Francisca Janaína Soares Rocha Ocorrência de contaminação por bactérias e por protozoários patogênicos

Leia mais

Reunião Técnica Plano de Segurança da Água. 23 de novembro de 2010 - OPAS

Reunião Técnica Plano de Segurança da Água. 23 de novembro de 2010 - OPAS Reunião Técnica Plano de Segurança da Água 23 de novembro de 2010 - OPAS Introdução Qualidade da água e saneamento inadequados provocam 1,8 milhão de mortes infantis a cada ano no mundo (OMS, 2004), o

Leia mais

PESQUISA DE GENES DE VIRULÊNCIA DE Escherichia coli PATOGÊNICA EXTRA- INTESTINAL EM ISOLADOS DE QUEIJOS A BASE DE LEITE NÃO PASTEURIZADO

PESQUISA DE GENES DE VIRULÊNCIA DE Escherichia coli PATOGÊNICA EXTRA- INTESTINAL EM ISOLADOS DE QUEIJOS A BASE DE LEITE NÃO PASTEURIZADO PESQUISA DE GENES DE VIRULÊNCIA DE Escherichia coli PATOGÊNICA EXTRA- INTESTINAL EM ISOLADOS DE QUEIJOS A BASE DE LEITE NÃO PASTEURIZADO SEARCH OF VIRULENCE GENES FROM PATHOGENIC EXTRAINTESTINAL Escherichia

Leia mais

A eletroforese é uma técnica utilizada para separar, identificar e purificar

A eletroforese é uma técnica utilizada para separar, identificar e purificar 7. ELETROFORESE DE ÁCIDOS NUCLÉICOS João José de Simoni Gouveia Luciana Correia de Almeida Regitano A eletroforese é uma técnica utilizada para separar, identificar e purificar moléculas carregadas (como

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

ELETROFORESE APLICADA À ANÁLISE DE DNA

ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

(Actos não legislativos) REGULAMENTOS

(Actos não legislativos) REGULAMENTOS 3.3.2010 Jornal Oficial da União Europeia L 52/1 II (Actos não legislativos) REGULAMENTOS REGULAMENTO (UE) N. o 175/2010 DA COMISSÃO de 2 de Março de 2010 que dá execução à Directiva 2006/88/CE no que

Leia mais

ABASTECIMENTO DE ÁGUA SOLUÇÕES ALTERNATIVAS

ABASTECIMENTO DE ÁGUA SOLUÇÕES ALTERNATIVAS UFPR Ministério da Educação UNIVERSIDADE FEDERAL DO PARANÁ Setor de Ciências da Saúde Departamento de Saude Comunitária ABASTECIMENTO DE ÁGUA Profª. Eliane Carneiro Gomes Departamento de Saúde Comunitária

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

VI-004 MONITORAMENTO EM TEMPO REAL DA QUALIDADE DA ÁGUA DOS MANANCIAIS DA REGIÃO METROPOLITANA DE SÃO PAULO - RMSP

VI-004 MONITORAMENTO EM TEMPO REAL DA QUALIDADE DA ÁGUA DOS MANANCIAIS DA REGIÃO METROPOLITANA DE SÃO PAULO - RMSP VI-004 MONITORAMENTO EM TEMPO REAL DA QUALIDADE DA ÁGUA DOS MANANCIAIS DA REGIÃO METROPOLITANA DE SÃO PAULO - RMSP Armando Perez Flores (1) Bacharel em Química pela Faculdade de Filosofia Ciências e Letras

Leia mais

DATA DE APROVAÇÃO: 23/10/2015

DATA DE APROVAÇÃO: 23/10/2015 1/6 1. INTRODUÇÃO / FINALIDADE DO MÉTODO O Trichomonas vaginalis é um parasita flagelado e é o agente causador da tricomoníase. Existe em apenas em uma única forma (trofozoíto), que é simultaneamente infecciosa

Leia mais

CET 303 Química Aplicada. Relatório: Visita técnica Estação de tratamento de água ETA 3 Capim Fino, em Piracicaba. Data da visita: 02.04.

CET 303 Química Aplicada. Relatório: Visita técnica Estação de tratamento de água ETA 3 Capim Fino, em Piracicaba. Data da visita: 02.04. Universidade Estadual de Campinas Faculdade de Tecnologia - FT Curso de Especialização em Meio Ambiente e Desenvolvimento Sustentável CET 303 Química Aplicada Relatório: Visita técnica Estação de tratamento

Leia mais

WETLANDS CONSTRUÍDOS PARA O TRATAMENTO DE ÁGUA CINZA

WETLANDS CONSTRUÍDOS PARA O TRATAMENTO DE ÁGUA CINZA WETLANDS CONSTRUÍDOS PARA O TRATAMENTO DE ÁGUA CINZA Danielle Martins Cassiano de Oliveira (*), Ricardo Nagamine Costanzi * Universidade Tecnológica Federal do Paraná, danielle.martins.cassiano@gmail.com

Leia mais

Lílian Maria Lapa Montenegro Departamento de Imunologia Laboratório rio de Imunoepidemiologia

Lílian Maria Lapa Montenegro Departamento de Imunologia Laboratório rio de Imunoepidemiologia XVIII Congresso Mundial de Epidemiologia e VII Congresso Brasileiro de Epidemiologia Avaliação do desempenho da técnica de nested- PCR em amostras de sangue coletadas de pacientes pediátricos com suspeita

Leia mais

Universidade Federal de Rondônia UNIR Departamento de Engenharia Ambiental DEA Saúde Ambiental Contaminação biológica da água e saúde Acadêmicos: Anderson Rudke, Danilo Santos, Jussara de Paula e Leticia

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Wipe Test. Controlo de contaminação. Kit de teste para a deteção de contaminação numa base genética molecular REF 7091.

Wipe Test. Controlo de contaminação. Kit de teste para a deteção de contaminação numa base genética molecular REF 7091. PT Instruções de utilização Wipe Test Controlo de contaminação Kit de teste para a deteção de contaminação numa base genética molecular REF 7091 40 reacções 1. Descrição do produto O uso da Polymerase

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO LABORATÓRIO DE ANÁLISES CLÍNICAS POP n.º: I 29 Página 1 de 5 1. Sinonímia Pesquisa de anticorpos frios. 2. Aplicabilidade Bioquímicos e auxiliares de laboratório do setor de Imunologia. 3. Aplicação clínica As Crioaglutininas são anticorpos

Leia mais

Portaria de Potabilidade de Água Evolução e desafios contínuos

Portaria de Potabilidade de Água Evolução e desafios contínuos Portaria de Potabilidade de Água Evolução e desafios contínuos A evolução ao longo de anos das portarias sobre potabilidade de água tem sido um exemplo a ser seguido por outras legislações. A cada revisão

Leia mais

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO C.R. LABORATÓRIO DE ANÁLISES CLÍNICAS SETOR DE BIOQUÍMICA

GRUPO HOSPITALAR CONCEIÇÃO HOSPITAL NOSSA SENHORA DA CONCEIÇÃO C.R. LABORATÓRIO DE ANÁLISES CLÍNICAS SETOR DE BIOQUÍMICA POP n.º: B111 Página 1 de 8 1. Sinonímina: Eletroforese de Hemoglobina em ph ácido. 2. Aplicabilidade: Bioquímicos do setor de Bioquímica do LAC-HNSC. 3. Aplicação Clínica: A eletroforese de hemoglobina

Leia mais

DISTRIBUIÇÃO E IDENTIFICAÇÃO SOUSA, P. F. DE C. et Phakopsora al. pachyrhizi, AGENTE CAUSAL DA FERRUGEM DA SOJA NO ESTADO DE MINAS GERAIS 1

DISTRIBUIÇÃO E IDENTIFICAÇÃO SOUSA, P. F. DE C. et Phakopsora al. pachyrhizi, AGENTE CAUSAL DA FERRUGEM DA SOJA NO ESTADO DE MINAS GERAIS 1 672 DISTRIBUIÇÃO E IDENTIFICAÇÃO SOUSA, P. F. DE C. et Phakopsora al. pachyrhizi, AGENTE CAUSAL DA FERRUGEM DA SOJA NO ESTADO DE MINAS GERAIS 1 Identification and distribution of Phakopsora pachyrhizi

Leia mais

IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA

IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA Reação em Cadeia de Polimerase IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA MsC. Ingrid Thaís Beltrame Botelho doutoranda ingridthaisbb@hotmail.com O que é PCR? Amplificação de um segmento específico

Leia mais

MycXtra Conjunto de extracção de ADN fúngico

MycXtra Conjunto de extracção de ADN fúngico Para utilização diagnóstica in vitro: MycXtra MycXtra Conjunto de extracção de ADN fúngico REF 080-005 Utilização prevista O Conjunto de extracção de ADN fúngico MycXtra é concebido para o isolamento e

Leia mais

ANÁLISE DA PRESENÇA DE COLIFORMES TOTAIS E FECAIS ÁGUA DO LAGO IGAPÓ DO MUNICÍPIO DE LONDRINA- PR

ANÁLISE DA PRESENÇA DE COLIFORMES TOTAIS E FECAIS ÁGUA DO LAGO IGAPÓ DO MUNICÍPIO DE LONDRINA- PR ANÁLISE DA PRESENÇA DE COLIFORMES TOTAIS E FECAIS ÁGUA DO LAGO IGAPÓ DO MUNICÍPIO DE LONDRINA- PR VENANCIO, M. M 1.; FIORI, B. C 1.; DA SILVA, C. V 2. 1 Acadêmicas do Curso de Ciências Biológicas da Faculdade

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

CENTRO FEDERAL DE EDUCAÇÃO TECNOLÓGICA DE MINAS GERAIS DEPARTAMENTO DE QUÍMICA

CENTRO FEDERAL DE EDUCAÇÃO TECNOLÓGICA DE MINAS GERAIS DEPARTAMENTO DE QUÍMICA CENTRO FEDERAL DE EDUCAÇÃO TECNOLÓGICA DE MINAS GERAIS DEPARTAMENTO DE QUÍMICA PROCESSOS QUÍMICOS TECNOLÓGICOS Ângela de Mello Ferreira Belo Horizonte 2013 Prática 02 Processo de coagulação e floculação

Leia mais

Plásticos para Cultivo Celular

Plásticos para Cultivo Celular Linha Cultivo de Células e Tecidos Fabricada em poliestireno cristal virgem (GPPS), oferece produtos com alta transparência para ótima visualização e sem presença de contaminantes, assegurando integridade

Leia mais

Saneamento I Tratamento de água. Eduardo Cohim edcohim@gmail.com

Saneamento I Tratamento de água. Eduardo Cohim edcohim@gmail.com Saneamento I Tratamento de água Eduardo Cohim edcohim@gmail.com 1 Concepção de sistemas de abastecimento de água Estação de tratamento ETA Conjunto de unidades destinado a tratar a água, adequando suas

Leia mais

DIAGNÓSTICO DA QUALIDADE DE ÁGUA NO ENTORNO DE UM CEMITÉRIO EM JACI-PARANÁ (RO), AMAZÔNIA OCIDENTAL.

DIAGNÓSTICO DA QUALIDADE DE ÁGUA NO ENTORNO DE UM CEMITÉRIO EM JACI-PARANÁ (RO), AMAZÔNIA OCIDENTAL. DIAGNÓSTICO DA QUALIDADE DE ÁGUA NO ENTORNO DE UM CEMITÉRIO EM JACI-PARANÁ (RO), AMAZÔNIA OCIDENTAL. MAYAME MARTINS COSTA Instituto Federal de Educação, Ciência e Tecnologia de Rondônia Campus Colorado

Leia mais

A QUANTIDADE DE CÉLULAS DE LEVEDURAS DO GÊNERO Candida PODE INFLUENCIAR A INTEGRIDADE E QUANTIDADE DE DNA EXTRAÍDO? RESUMO

A QUANTIDADE DE CÉLULAS DE LEVEDURAS DO GÊNERO Candida PODE INFLUENCIAR A INTEGRIDADE E QUANTIDADE DE DNA EXTRAÍDO? RESUMO A QUANTIDADE DE CÉLULAS DE LEVEDURAS DO GÊNERO Candida PODE INFLUENCIAR A INTEGRIDADE E QUANTIDADE DE DNA EXTRAÍDO? Danielly Beraldo dos Santos Silva 1, Luana Mirele Carbonara Rodrigues 2, Bruno Crispim

Leia mais

Propriedades da matéria (Continuação)

Propriedades da matéria (Continuação) Propriedades da matéria (Continuação) Densidade m/v Experimentos / discussão Exercício 1) Um bloco de metal tem volume de 200 ml e massa de 1792 g. a) Qual a densidade desse metal, expressa em g / cm3?

Leia mais

AVALIAÇÃO DA EFICIÊNCIA DO TRATAMENTO DA ÁGUA NA ETA JOSÉ LOUREIRO DA SILVA ATRAVÉS DE PARÂMETROS BACTERIOLÓGICOS.

AVALIAÇÃO DA EFICIÊNCIA DO TRATAMENTO DA ÁGUA NA ETA JOSÉ LOUREIRO DA SILVA ATRAVÉS DE PARÂMETROS BACTERIOLÓGICOS. AVALIAÇÃO DA EFICIÊNCIA DO TRATAMENTO DA ÁGUA NA ETA JOSÉ LOUREIRO DA SILVA ATRAVÉS DE PARÂMETROS BACTERIOLÓGICOS. Cristina C. Andriotti, Luciane Balestrin Reda, Ana Rita Moriconi, Ilo César Garcia e Marcelo

Leia mais

DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED

DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED Alâna Costa de Oliveira 1, Marisa Chesky 2 Farmacêutica do Laboratório de Diagnóstico de Doenças

Leia mais

Estudo com tratamento de água para abastecimento PIBIC/2010-2011

Estudo com tratamento de água para abastecimento PIBIC/2010-2011 Estudo com tratamento de água para abastecimento PIBIC/2010-2011 Cryslara de Souza Lemes, Prof. Dr. Paulo Sérgio Scalize Universidade Federal de Goiás, 74605-220, Brasil cryslara_sl@hotmail.com; pscalize.ufg@gmail.com

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais

DISPOSIÇÃO DE RESÍDUOS DE ESTAÇÃO DE TRATAMENTO DE ÁGUA EM LAGOA FACULTATIVA DE ESGOTO: CARACTERIZAÇÃO DA ETA

DISPOSIÇÃO DE RESÍDUOS DE ESTAÇÃO DE TRATAMENTO DE ÁGUA EM LAGOA FACULTATIVA DE ESGOTO: CARACTERIZAÇÃO DA ETA 1 DISPOSIÇÃO DE RESÍDUOS DE ESTAÇÃO DE TRATAMENTO DE ÁGUA EM LAGOA FACULTATIVA DE ESGOTO: CARACTERIZAÇÃO DA ETA Susane Campos Mota ANGELIM Escola de Engenharia Civil, UFG. Aluna do curso de Mestrado em

Leia mais

SULFATO FERROSO HEPTAIDRATADO Ferrosi sulfas heptahydricus

SULFATO FERROSO HEPTAIDRATADO Ferrosi sulfas heptahydricus SULFATO FERROSO HEPTAIDRATADO Ferrosi sulfas heptahydricus FeSO 4.7H 2 O 278,01 06404.02-0 Fe 55,85 Sulfato ferroso heptaidratado Contém, no mínimo, 98,0% e, no máximo, 105,0% de FeSO 4.7H 2 O. DESCRIÇÃO

Leia mais

ANTI IgG (Soro de Coombs)

ANTI IgG (Soro de Coombs) ANTI IgG (Soro de Coombs) Soro Anti Gamaglobulinas Humanas PROTHEMO Produtos Hemoterápicos Ltda. PARA TESTES EM LÂMINA OU TUBO SOMENTE PARA USO DIAGNÓSTICO IN VITRO Conservar entre: 2º e 8ºC Não congelar

Leia mais

PREPARO DE SOLUÇÕES EM BIOLOGIA MOLECULAR

PREPARO DE SOLUÇÕES EM BIOLOGIA MOLECULAR UNIVERSIDADE FEDERAL DO PIAUÍ CAMPUS DE PARNAÍBA Mestrado em Biotecnologia Semestre 2011.2 PREPARO DE SOLUÇÕES EM BIOLOGIA MOLECULAR DATA: AULA PRÁTICA 2: preparo de soluções em biologia molecular. I.

Leia mais

AVALIAÇÃO DA FILTRAÇÃO LENTA NA ESTAÇÃO DE TRATAMENTO DE ÁGUA CAMPUS- SISTEMA SAMAMBAIA

AVALIAÇÃO DA FILTRAÇÃO LENTA NA ESTAÇÃO DE TRATAMENTO DE ÁGUA CAMPUS- SISTEMA SAMAMBAIA AVALIAÇÃO DA FILTRAÇÃO LENTA NA ESTAÇÃO DE TRATAMENTO DE ÁGUA CAMPUS- SISTEMA SAMAMBAIA MACHADO*, Luciana de Souza Melo; SCALIZE, Paulo Sérgio. Escola de Engenharia Civil - Programa de Pós-Graduação em

Leia mais

BIOQUÍMICA EXPERIMENTAL

BIOQUÍMICA EXPERIMENTAL BIOQUÍMICA EXPERIMENTAL QBQ-4025 Departamento de Bioquímica- Instituto de Química - USP Professores Fábio Luís Forti Carlos Takeshi Hotta Os protocolos que constam desta disciplina foram originalmente

Leia mais

Clonagem e expressão dos cdnas que codificam as subunidades catalíticas da PKA de Paracoccidioides brasiliensis

Clonagem e expressão dos cdnas que codificam as subunidades catalíticas da PKA de Paracoccidioides brasiliensis Clonagem e expressão dos cdnas que codificam as subunidades catalíticas da PKA de Paracoccidioides brasiliensis Camila Borges Mesquita 1, Silvia Maria Salem Izacc 2 Universidade Federal de Goiás,74690-903,

Leia mais

CARTÕES DE COLETA DE AMOSTRAS

CARTÕES DE COLETA DE AMOSTRAS CARDS CARTÕES DE COLETA DE AMOSTRAS Os cartões para extração Biopur proporcionam uma coleta simples, confiável e eficiente, garantindo a preservação de ácidos nucleicos a longo prazo. São ideais para o

Leia mais

Decantação sólido - líquido

Decantação sólido - líquido Processos de separação Decantação sólido - líquido Possível devido à diferença de densidades dos componentes da mistura. Permite a separação de líquidos imiscíveis (que não se misturam) ou um sólido precipitado

Leia mais

02/08/2015. Padrões de potabilidade TRATAMENTO DA ÁGUA. Tratamento da água. Tratamento da água. Tratamento da água

02/08/2015. Padrões de potabilidade TRATAMENTO DA ÁGUA. Tratamento da água. Tratamento da água. Tratamento da água Padrões de potabilidade A água própria para o consumo deve obedecer certos requisitos: TRATAMENTO DA ÁGUA Professor: André Luiz Montanheiro Rocha Disciplina: Gestão de Recursos Naturais 2ª COLÉGIO ESTADUAL

Leia mais

I-024 APROVEITAMENTO DE ÁGUA DE CHUVA: AVALIAÇÃO DO SEU TRATAMENTO PARA FINS POTÁVEIS

I-024 APROVEITAMENTO DE ÁGUA DE CHUVA: AVALIAÇÃO DO SEU TRATAMENTO PARA FINS POTÁVEIS I-024 APROVEITAMENTO DE ÁGUA DE CHUVA: AVALIAÇÃO DO SEU TRATAMENTO PARA FINS POTÁVEIS José Alexandre Borges Valle (1) Engenheiro Químico pela Universidade Regional de Blumenau; Mestre em Engenharia Química

Leia mais

Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia e hematologia.

Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia e hematologia. POP n.º: I70 Página 1 de 5 1. Sinonímia Teste rápido Anti-, VIKIA Biomeriéux. 2. Aplicabilidade Aos bioquímicos, técnicos de laboratório e estagiários do setor de imunologia e hematologia. 3. Aplicação

Leia mais