O que é a Reacção em Cadeia da Polimerase (PCR)?

Tamanho: px
Começar a partir da página:

Download "O que é a Reacção em Cadeia da Polimerase (PCR)?"


1 O que é a Reacção em Cadeia da Polimerase (PCR)?

2 O que é a Reacção em Cadeia da Polimerase (PCR)? 3 5 F R 3 5 Um processo para multiplicar selectivamente um determinado segmento de DNA Esse segmento pode representar uma pequena parte de uma mistura complexa de DNAs (por ex. um determinado exão numa preparação de DNA genómico total) Através da PCR podemos obter uma quantidade abundante de DNA em cerca de 2 horas A preparação de DNA alvo não precisa ser pura Pode amplificar-se uma única cópia de DNA alvo (por ex. uma sequência específica em uma única célula haplóide)

3 Os componentes chave da Reacção em Cadeia da Polimerase (PCR) já eram todos conhecidos previamente, só faltando juntar as peças do puzzle

4 Os componentes chave da Reacção em Cadeia da Polimerase (PCR) já eram todos conhecidos previamente, só faltando juntar as peças do puzzle The eureka enzyme: the discovery of DNA polymerase Abstract The identification and partial purification by Arthur Kornberg and his colleagues in 1956 of an enzyme - DNA polymerase I of Escherichia coli - that catalyzed the stable incorporation of deoxyribonucleotides into DNA in vitro came as a surprise. At the time, most scientists in the field believed that DNA synthesis was too complicated to be accurately reflected outside the living cell.

5 Os componentes chave da Reacção em Cadeia da Polimerase (PCR) já eram todos conhecidos previamente, só faltando juntar as peças do puzzle In the early 1960s H. Gobind Khorana participates in the discovery of the Genetic Code. Afterwards, he initiates a large project to totally synthesize a functional human gene. To achieve this, he pioneers many of the techniques needed to make and use synthetic DNA oligonucleotides. Sequence-specific oligos are used both as building blocks for the gene, and as primers and templates for DNA polymerase. In 1968 Khorana is awarded the Nobel Prize for his work on the Genetic Code.

6 Os componentes chave da Reacção em Cadeia da Polimerase (PCR) já eram todos conhecidos previamente, só faltando juntar as peças do puzzle

7 Os componentes chave da Reacção em Cadeia da Polimerase (PCR) já eram todos conhecidos previamente, só faltando juntar as peças do puzzle In 1977 Frederick Sanger reports a method for determining the sequence of DNA. The technique involves an oligonucleotide primer, DNA polymerase, and modified nucleotide precursors that block further extension of the primer in sequence-dependent manner. He is awarded the Nobel Prize in 1980.

8 Os componentes chave da Reacção em Cadeia da Polimerase (PCR) já eram todos conhecidos previamente, só faltando juntar as peças do puzzle Later in 1983 Mullis begins to test his idea. His first experiment[2] does not involve thermal cycling - he hopes that the polymerase can perform continued replication on its own. Later experiments that year do involve repeated thermal cycling, and target small segments of a cloned gene. Mullis considers these experiments a success, but is unable to convince other researchers.



11 DNA polimerases Necessitam de uma cadeia molde Incorporam nucleótidos na direcção 5-3, nunca na direcção oposta. Incorporam nucleótidos numa cadeia já existente, mas não a iniciam

12 Duplicação DNA in vivo vs. PCR Para separar as duas cadeias: Helicases e 95 ºC Topoisomerases Para iniciar a nova cadeia: Primers de RNA sintetisados por uma RNA polimerase Primers de DNA sintéticos

13 PCR 1º Ciclo (1)

14 PCR 1º Ciclo (2)

15 PCR 2º Ciclo (1)

16 PCR 2º Ciclo (2)

17 PCR 3º Ciclo (1)

18 PCR 3º Ciclo (2)

19 PCR nº de moléculas ao 20º ciclo

20 Thermus aquaticus (Taq) DNA polimerase 95 ºC 95 ºC 2 min 2 min 55 ºC 72 ºC 1 min 72 ºC 5 min 1 min 4 ºC X

21 As primeiras experiências de PCR - 3 banhos e 1 cronómetro

22 Análise dos Produtos de PCR Em regra, por electroforese em gel de agarose (validação por tamanho; falível) Por vezes, por técnicas de hibridação com sondas (dotblot, etc.) Sequenciação

23 Componentes obrigatórios para uma reacção de PCR DNA DNA polimerase Primer direito ( reverse ) Primer esquerdo ( forward ) dntps Solução tampão Mg 2+

24 O sucesso de uma reacção de PCR depende de inúmeros factores Oligonucleótidos: especificidade, tamanho, etc. Conc. de cada oliginucleótido: 0,1-0,5 mm (0,2 mm) Conc. DNA molde: depende do tipo de DNA (genómico, plasmídeo, cdna) Conc. de dntps (datp, dctp, dgtp, dttp): (200 mm) DNA polimerase: conc. (0,5 U) e tipo (Taq) Mg 2+ : 1-4 mm (2 mm) Composição do tampão e aditivos: DMSO, glicerol, detergentes

25 Notas gerais para o desenho de primers Tamanho/Especificidade Tm Sequências internas de complementaridade Conteúdo em G/C Polipirimidinas (T,C) ou polipurinas (A,G) Terminação 3

26 Tamanho/Especificidade Tamanho e especificidade de um primer estão interligados normalmente oligonucleótidos de bases são extremamente específicos e apresentam eficiência de emparelhamente óptima (desde que a temperatura de emparelhamento seja adequada)

27 Tm (melting temperature) Os Tm de ambos os primers devem ser semelhantes A relação entre Tm e temperatura de emparelhamento não é muito clara. Regra geral usa-se uma temp. de emp. cerca de 3-5 ºC abaixo do valor do Tm, mas é boa prática determinar experimentalmente T m = 2(A+T) + 4(G+C) Fórmula empírica e aproximada Válida para oligonucleótidos de bases

28 Temperatura de emparelhamento Tm representa uma estimativa da estabilidade do híbrido DNA-DNA e é crítico para a temperatura de emparelhamento (Ta) Ta muito elevada > hibridação primer-molde insuficiente > produto de PCR (amplificado) baixo Ta muito baixa > produção de amplificados inespecíficos Deve testar-se experimentalmente em incrementos de 1-2 ºC para cima e para baixo do Ta estimado Alguns termocicladores têm função de gradiente de temperatura

29 Efeito da temperatura de emparelhamento na especificidade

30 Efeito da temperatura de emparelhamento na especificidade

31 Sequências internas de complementaridade Os primers devem ser desenhados sem complementaridades internas CGGTTCTACC GCCATGTCGC E sem complementaridades entre primers (para evitar dimerização) ATGCACGGTCTAGCTGTACCGCCCGTA ATGCCCGCCATGTCGATCTGGCACGTA

32 Conteúdo em G/C e Polipirimidinas (T,C) ou polipurinas (A,G) 45% -55% G/C Sem PoliC ou PoliG Sem polipirimidinas ou polipurinas

33 Desenho de primers - sumário Idealmente um primer deve ter uma mistura aleatória das 4 bases Ter cerca de 50% em G/C Ter aproximadamente 20 bases Isto assegura normalmente um Tm de 56 ºC - 62 ºC

34 Fidelidade da Taq. Os erros são importantes? A Taq DNA polymerase não possui actividade de revisão da cadeia 3 5 (frequentemente encontrada em outras DNA polimerases) A Taq tem uma taxa de erro na ordem dos (dependendo do método de aferição). Num amplificado de 400 bp, 33% das moléculas poderão conter 1 erro (após 20 ciclos). Outras DNA polimerases com actividade de revisão da cadeia apresentam taxas de erro até 10-7 (ex: Pfu, Tgo, Pwo, etc.)

35 Programação do termociclador Tamanho do amplificado Qualidade dos primers Tipo de polimerase Tamanho do amplificado Tamanho do DNA inicial 94 ºC 94 ºC 3 min 2 min 55 ºC 1 min 72 ºC 1 min 72 ºC 5 min 4 ºC Qualidade e quantidade de DNA inicial X

36 Organização - 3 áreas de trabalho I Preparação de soluções e reagentes II Extracção de DNA das amostras e de III falsas-amostras (controlos negativos) Distribuição da Master Mix pelos tubos de PCR Adição dos extractos aos tubos de PCR Abertura dos tubos de PCR para análise electroforese e/ou dot-blot


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction)

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) - Realiza a replicação selectiva e rápida de uma sequência específica de nucleotídeos a partir de uma mistura complexa de DNAs amplificação

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF www.ufrgs.br/labvir PCR Desenvolvida

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais


Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais


WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais


IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA Reação em Cadeia de Polimerase IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA MsC. Ingrid Thaís Beltrame Botelho doutoranda ingridthaisbb@hotmail.com O que é PCR? Amplificação de um segmento específico

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais


CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais


RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14 4/11/14 Aula 2 Sequenciamento de genomas procariotos utilizando tecnologia de nova geração Introdução ao sequenciamento de nova geração Ana Marcia de Sá Guimarães, Méd Vet, MSc, PhD Aula 2 Tópicos 1. Sequenciamento

Leia mais


LICENCIATURA EM MEDICINA LICENCIATURA EM MEDICINA Disciplina de Biologia Molecular (2º Ano) Ano Lectivo de 2006/2007 3º AULA PRÁTICA 1 - Introdução à tecnologia de PCR 1.1. A reacção de PCR Príncipios e variantes da técnica 2.

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Polymerase Chain Reaction Reação de polimerização em cadeia ou Polimerização em cadeia do DNA

Polymerase Chain Reaction Reação de polimerização em cadeia ou Polimerização em cadeia do DNA Polymerase Chain Reaction Reação de polimerização em cadeia ou Polimerização em cadeia do DNA PCR - consiste em fazer cópias de DNA in vitro, usando os elementos básicos do processo de replicação natural

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

Virologia em Laboratório Fase Pré- Analítica

Virologia em Laboratório Fase Pré- Analítica Virologia em Laboratório Fase Pré- Analítica Leonor Rebelo Lab Virologia i do IPOFGL EPE Novembro 2012 1º Curso de Virologia Molecular em Oncologia 1 ,, TÑÜxÇwxÜ t ØÇ vt vé át wx Öâx t ÅxÇàx ÇâÇvt áx vtçát?

Leia mais

Biologia Molecular. Técnicas Moleculares. Lucas Brandão

Biologia Molecular. Técnicas Moleculares. Lucas Brandão Biologia Molecular Técnicas Moleculares Lucas Brandão CONCEITOS BÁSICOS Núcleo - Célula Humana DENTRO DO DNA SE ENCONTRAM OS GENE Definição de Genes Estrutura Gênica n=23, X ou Y 5 UTR 1 Pai Introns 2

Leia mais



Leia mais

Genetic Resources and Biotechnology Cenargen

Genetic Resources and Biotechnology Cenargen Genetic Resources and Biotechnology Cenargen Curso PCR em Tempo Real Dr. Júlio Carlyle M. Rodrigues (Cenargen) XVIII MET Salvador, Outubro 2013 Introdução: Reação em Cadeia da Polimerase Mecanismo de replicação;

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Técnicas de análise de DNA e RNA

Técnicas de análise de DNA e RNA Técnicas de análise de DNA e RNA Fundamento e aplicação das técnicas de análise de DNA Extracção, purificação, quantificação e detecção de ácidos nucleicos Electroforese convencional em gel de agarose

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais


PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

Departamento de Biologia da Universidade do Minho

Departamento de Biologia da Universidade do Minho Departamento de Biologia da Universidade do Minho Mestrado em Genética Molecular Ano lectivo de 2004/2005, edição de 2004-2006 Estudo da regulação do gene STL1 codificando o sistema de simporte H + /glicerol

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Produção de Proteínas Recombinantes em Escherichia coli

Produção de Proteínas Recombinantes em Escherichia coli Produção de Proteínas Recombinantes em Escherichia coli Prof. Dr. Catarina Akiko Miyamoto 1 Resumo A produção de proteínas recombinantes para fins terapêuticos, veterinários, e agro-pecuários tem se mostrado

Leia mais


MAPA DO CROMOSSOMA DE E.coli REPLICAÇÃO DE DNA MAPA DO CROMOSSOMA DE E.coli TERMINOLOGIA Regras básicas para a designação de genes e proteínas: Genes bacterianos 3 letras minúsculas em itálico que reflectem a sua função aparente Ex:

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 4 - Recursos Computacionais: Programas e Sites Relacionados

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais


ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

Genética Molecular Técnicas aplicadas a produção animal


Leia mais

Paternidade Suínos 1.0 Typing Kit

Paternidade Suínos 1.0 Typing Kit Referências 1. Lee, C.L. (1980). Genetic control of two pre-albumins in pigs. Genetics. 48: 1059-1063. 2. Tagliaro CH,Franco MH, Schneider MP, Brito BG, Barbosa AS. (1999). BIOCHEMICAL POLYMORPHISMS AND

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes)

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes) PT Instruções de utilização CYCLER CHECK Kit de teste para a validação da uniformidade da temperatura em termocicladores pronto a usar, pré-aliquotado REF 7104 (10 testes) REF 71044 (4 testes) Índice 1.

Leia mais

Wipe Test. Controlo de contaminação. Kit de teste para a deteção de contaminação numa base genética molecular REF 7091.

Wipe Test. Controlo de contaminação. Kit de teste para a deteção de contaminação numa base genética molecular REF 7091. PT Instruções de utilização Wipe Test Controlo de contaminação Kit de teste para a deteção de contaminação numa base genética molecular REF 7091 40 reacções 1. Descrição do produto O uso da Polymerase

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 1 - PCR: Princípios e tipos de Reação Breve Histórico Desenvolvida

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais


BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

BIOLOGIA MOLECULAR AULAS PRÁTICAS. 3º ano, 1º semestre 2013-14

BIOLOGIA MOLECULAR AULAS PRÁTICAS. 3º ano, 1º semestre 2013-14 BIOLOGIA MOLECULAR AULAS PRÁTICAS 3º ano, 1º semestre 2013-14 EXERCÍCIO Nº 1 Considere que fez uma electroforese em gel de agarose, para verificar o mapa de restrição do plasmídeo pvu1, abaixo desenhado.

Leia mais

Código do Produto: 0107. Dispositivo para utilização in vitro. instituto pedro nunes, quinta da nora 3030-199 coimbra Portugal

Código do Produto: 0107. Dispositivo para utilização in vitro. instituto pedro nunes, quinta da nora 3030-199 coimbra Portugal Código do Produto: 0107 FACTOR V G1691A (leiden) Box 1.0 Typing Kit Dispositivo para utilização in vitro Manual de Instruções instituto pedro nunes, quinta da nora 3030-199 coimbra Portugal tel/fax + 351

Leia mais

Conceitos Básicos de Técnicas em Biologia Molecular

Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 1 2 Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 3 ISSN 0103-0205 Setembro, 2008 Empresa Brasileira

Leia mais


CONCEITOS DE BIOLOGIA MOLECULAR. Jorge Mondego CONCEITOS DE BIOLOGIA MOLECULAR Jorge Mondego Biologia Molecular Genome Transcriptome The OME -Era Proteome Metabolome - Entendimento da fisiologia e reprodução de microorganismos - Entendimento dos mecanismos

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

Transcriptase Reversa (DNA polimerase RNAdependente)

Transcriptase Reversa (DNA polimerase RNAdependente) RT (transcrição reversa)-pcr Transcriptases reversas dos vírus AMV ( Vírus da Mieloblastose Aviária ) ou M-MuLV ( Vírus de Moloney da Leucemia do Ratinho ) podem ser usadas para produzir uma cópia de DNA

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Embrapa Amazônia Oriental Belém, PA 2015 DIVERGÊNCIA GENÉTICA ENTRE MATRIZES DE

Leia mais


TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

Genómica e Análise Comparativa de Genomas

Genómica e Análise Comparativa de Genomas Genómica e Análise Comparativa de Genomas Genómica Genómica é o estudo do genoma, genes e das suas funções. Permite o conhecimento dos mecanismos moleculares da expressão génica incluindo as relações genes/ambiente.

Leia mais

Rev. 04 Out/2013. Amostras

Rev. 04 Out/2013. Amostras BANG07-02 BANG07-05 Philadelphia Oligomix Alert Kit Instruções de Uso USO PRETENDIDO O produto «PHILADELPHIA oligomix Alert kit» é um teste qualitativo de amplificação dos ácidos nucleicos para a pesquisa

Leia mais

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR:

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR: RTSD01-II Fator II G20210A Q PCR Alert Kit Rev. 04 Out/2013 Instruções de Uso USO PRETENDIDO O produto FATOR II Q-PCR Alert é um kit para teste de amplificação quantitativa de ácidos nucleicos para a determinação

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais

Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses. Instruções específicas

Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses. Instruções específicas Exercício colaborativo GHEP-ISFG SPInDel Identificação taxonómica de amostras forenses Instruções específicas Genotipagem de amostras A metodologia descrita corresponde à versão que foi optimizada no nosso

Leia mais

Coleta de Cartões de Amostras

Coleta de Cartões de Amostras CARDS Coleta de Cartões de Amostras Os cartões para extração Biopur proporcionam uma coleta simples, confiável e eficiente, garantindo a preservação de ácidos nucleicos a longo prazo. São ideais para o

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Bordetella pertussis Qual PCR Box 1.0

Bordetella pertussis Qual PCR Box 1.0 Código do Produto: 5610 Bordetella pertussis Qual PCR Box 1.0 Dispositivo para utilização in vitro Manual de Instruções genebox - R&D Diagnostic Tests, biocant, centro de inovação em biotecnologia núcleo

Leia mais

O complexo maquinário de replicação e suas enzimas

O complexo maquinário de replicação e suas enzimas O complexo maquinário de replicação e suas enzimas AULA 10 objetivos Ao final desta aula, você deverá ser capaz de: Apresentar os diferentes componentes do maquinário de replicação. Conhecer as diferentes

Leia mais

Gene é um segmento de DNA que contém informações para codificar uma ou mais funções

Gene é um segmento de DNA que contém informações para codificar uma ou mais funções Gene é um segmento de DNA que contém informações para codificar uma ou mais funções Espécie Espécie = mesma carga genética Biodiversidade 10.000.000 espécies Ecossistema várias espécies vivendo em um mesmo

Leia mais

Legionella sp Qual PCR Box 1.0

Legionella sp Qual PCR Box 1.0 Código do Produto: 5910 Legionella sp Qual PCR Box 1.0 Dispositivo para utilização in vitro Manual de Instruções genebox - R&D Diagnostic Tests, biocant, centro de inovação em biotecnologia núcleo 4, lote

Leia mais

Genes e Genomas Protocolos das aulas práticas

Genes e Genomas Protocolos das aulas práticas Genes e Genomas Protocolos das aulas práticas Licenciatura em Biologia Aplicada, 3º ano Ano lectivo de 2012/2013 Docente coordenador: Rui Oliveira Precauções em laboratório de biologia molecular Segurança

Leia mais

Química de Ácidos Nucleicos

Química de Ácidos Nucleicos Biologia Molecular O termo Biologia Molecular é usualmente aplicado à Química de Ácidos Nucleicos Ácido Deoxirribonucleico - DNA Ácido Ribonucleico RNA Ciência Genômica A informação genética de todos os

Leia mais

Toxigenomics: Principles and aplication. Dr. André D. Luchessi andre.luchessi@outlook.com

Toxigenomics: Principles and aplication. Dr. André D. Luchessi andre.luchessi@outlook.com Toxigenomics: Principles and aplication Dr. André D. Luchessi andre.luchessi@outlook.com NATAL DACT - PPgCF PROGRAMA DO CURSO TOXIGENÔMICA DEFINIÇÃO Em termos gerais toxigenômica são os estudos que envolvem

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais


APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Salmonella enteritidis. Qual PCR Box 1.0. Dispositivo para utilização in vitro. Manual de Instruções. Código do Produto: 1910

Salmonella enteritidis. Qual PCR Box 1.0. Dispositivo para utilização in vitro. Manual de Instruções. Código do Produto: 1910 Código do Produto: 1910 Salmonella enteritidis Qual PCR Box 1.0 Dispositivo para utilização in vitro Manual de Instruções genebox - R&D Diagnostic Tests, biocant, centro de inovação em biotecnologia núcleo

Leia mais

Termos para indexação: diversidade genética, pequi, Caryocar brasiliense, RAPD, recursos genéticos, germoplasma

Termos para indexação: diversidade genética, pequi, Caryocar brasiliense, RAPD, recursos genéticos, germoplasma VARIABILIDADE GENÉTICA DE COLEÇÃO DE TRABALHO DE PEQUIZEIRO COM BASE EM MARCADORES MOLECULARES Fábio Gelape Faleiro 1, Graciele Bellon 1, Ailton Vítor Pereira 2, Elainy Botelho C. Pereira 3, Nilton Tadeu

Leia mais

O pbr322 foi o primeiro plasmídeo a ser largamente usado pela comunidade científica, tendo permitido identificar recombinantes por selecção negativa

O pbr322 foi o primeiro plasmídeo a ser largamente usado pela comunidade científica, tendo permitido identificar recombinantes por selecção negativa O pbr322 foi o primeiro plasmídeo a ser largamente usado pela comunidade científica, tendo permitido identificar recombinantes por selecção negativa puc Validação de colónias seleccionadas - Miniprep (Extracção

Leia mais

Mycobacterium tuberculosis Qual qpcr Box 1.0

Mycobacterium tuberculosis Qual qpcr Box 1.0 Código do Produto: 0608 Mycobacterium tuberculosis Qual qpcr Box 1.0 Dispositivo para utilização in vitro Manual de Instruções Versão1.1; Maio de 2010. 1 Apresentação Mycobacterium tuberculosis, bacilo

Leia mais



Leia mais


ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais