Evolução Molecular. "Nothing in Biology Makes Sense Except in the Light of Evolution. Theodosius Dobzhansky

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Evolução Molecular. "Nothing in Biology Makes Sense Except in the Light of Evolution. Theodosius Dobzhansky"

Transcrição

1 "Nothing in Biology Makes Sense Except in the Light of Evolution Theodosius Dobzhansky

2 Evolução

3 Evolução

4 Evolução Genótipo + Ambiente = Fenótipo Parental F1 F2

5 Evolução Evolução = mudança (características herdáveis em uma população de organismos) Explica... - A mudança das espécies ao longo do tempo; - Complexidade, similaridade e diferenças dos seres vivos; - A diversidade de vida. LIVRO: A Origem das Espécies (teoria da Seleção Natural) Charles Darwin Alfred Wallace

6 refere-se a vários processos evolutivos resultantes de alterações no DNA (genoma) Mutação (Recombinação*) Duplicação gênica Transferência horizontal de genes

7 Mutações Transição: Envolve mudança entre purinas (A e G) ou entre pirimidinas (T e C) Transversão: Envolve mudança entre purinas (A ou G) e pirimidinas (T ou C) Inserção / Deleção (Indels): ocorre pela adição / remoção de um ou mais nucleotídeos na sequência de DNA

8 Mutações Sinônimas: São mutações que não resultam em alterações no aminoácido Mutações neutras Não sinônimas: São mutações que resultam em alterações no aminoácido Mutações adaptativas

9 Recombinação Genética: a troca aleatória de material genético durante a meiose

10 Duplicação Gênica: é qualquer duplicação de uma região do DNA que contém um gene (ou duplicação de um cromossoma inteiro)

11 Transferência horizontal: ocorre a transferência de um gene, uma região reguladora ou até mesmo um conjunto de genes para outra célula que não sua descendente, principalmente, através de vírus e bactérias. Teoria Endossimbiose das Mitocôndrias Simbiontes celulares (Wolbachia)

12 Forças Evolutivas Seleção natural Deriva genética

13 Seleção Natural Seleção natural é o único mecanismo conhecido que causa a evolução de adaptações Adaptação Um característica que melhora a sobrevivência ou a reprodução dos organismos, em relação a estados de caráter alternativos Processo em que os membros de uma população se tornam mais apropriados para alguma característica de seu ambiente através da mudança em uma característica que afeta sua sobrevivência ou reprodução

14 Seleção Natural Em todas as espécies, se produz mais descendentes do que o número que pode sobreviver e principalmente se reproduzir Os organismos diferem em sua habilidade de sobreviver e reproduzir, em parte devido a diferenças nos seus genótipos A cada geração, os genótipos de maior sobrevivência e reprodução estão presentes em excesso na etapa reprodutiva e contribuem desproporcionalmente para a descendência da próxima geração aumentando gradualmente sua frequência de geração a geração, e a população se torna progressivamente mais capaz de sobreviver e reproduzir em um determinado ambiente

15 Seleção Natural Direcional: um extremo do fenótipo tem maior valor adaptativo Diversificadora (disruptiva): dois ou mais fenótipos apresentam um maior valor adaptativo Estabilizadora: o fenótipo intermediário tem maior valor adaptativo

16 Seleção Natural É a principal força na mudança da frequência alélica em populações com grande Ne; Pode aumentar ou diminuir a diversidade genética Seleção estabilizadora e direcional geralmente diminui diversidade genética Seleção disruptiva aumenta a diversidade genética

17 Deriva Genética Mudança na frequência gênica sem ação da seleção natural (provocada pelo acaso) Populações pequenas (baixo número de indivíduos) são afetadas em maior grau que populações com alto número de indivíduos

18 Deriva Genética Dois grupos de moedas 10 conjuntos com 20 moedas 10 conjuntos com 4000 moedas Resultado Na média, em ambos os casos, deu 50% de cara e 50% de coroa, mas a chance de ocorrer variação em torno desta média é maior na população pequena A probabilidade de ocorrer 12 caras e 8 coroas é maior do que acontecer 2400 caras e 1600 coroas

19 Efeito fundador o estabelecimento de uma nova população por uns poucos fundadores originais (em um caso extremo, por apenas uma única fêmea fertilizada), que contém somente uma pequena fração da variação genética total da população parental

20 Gargalo genético O efeito gargalo de garrafa (bottleneck effect) é um evento evolucionário causado por uma redução drástica do tamanho da população, onde há perda de variabilidade genética.

21 Gargalo genético vs Efeito fundador Efeito fundador: no momento da formação de uma nova população Gargalo genético: em um ou mais momento da história de visa de uma população Ambos aumentam a deriva genética numa população: a taxa da deriva genética é inversamente proporcional ao tamanho efetivo populacional. Gargalo genético Efeito fundador

22 O acumulo de processos evolutivos (alterações no DNA) é a base para diferença entre os organismos A 2 mutações 2 mutações 1 mutação A1 A2 2 mutações 1 mutação 3 mutações Somado ao isolamento + ambiente, define: - Indivíduos - Raças - Populações - Espécies... Acúmulo de Diferenças

23 Evolução Neutra X Seleção Natural O conceito de evolução neutra foi dado por Mooto Kimura na década 1960; Estudando isoenzimas, perceberam uma maior diversidade de dados em relação a parâmetros morfológicos; Mas as teorias vigentes é que a seleção natural é o mecanismo evolutivo mais importante. Como explicar, neste contexto, que houvesse tanta variação molecular? Kimura propôs que os aminoácidos poderiam variar em determinadas posições da enzima, sem necessariamente prejudicar seu funcionamento. Com isso, esta variação não seria detectada pela seleção natural, sendo, portanto, seletivamente neutra!

24 Evolução Neutra X Seleção Natural A teoria da seleção neutra se sustenta em: Mutações deletérias, pouco deletérias e neutras são comuns, vantajosas são raras Deletérias são rapidamente removidas das populações e as vantajosas rapidamente incorporadas O que sobra são as neutras. Cada uma dessas pode se fixar, por deriva e segregar, contribuindo para a variação entre os organismos

25 Evolução Neutra X Seleção Natural Kimura rejeita seleção natural? NÃO!!!!!!, apenas considera como seletivamente neutra a maior parte da variação existente (e que portanto não será eliminada pela seleção natural bruscamente); Assim: Na verdade as substituições neutras geram novos alelos na população. Estes alelos se mantêm ou não pela ação da deriva genética.

26 Evolução Neutra X Seleção Natural Cenário 1 - mutação surge; seleção natural faz ela aumentar de frequência; ela se fixa. Cenário 2 - mutação surge; deriva genética faz ela aumentar de frequência; ela se fixa Teoria da evolução quase neutra (Tomoko Ohta)

27 Teoria da evolução quase neutra A teoria quase neutra pode ser resumida da seguinte forma. Tanto a deriva genética como a seleção natural influenciam o comportamento de mutações fracamente selecionadas. A maioria das novas mutações são fracamente selecionadas. A deriva predomina em populações pequenas, e a seleção em populações grandes.

28 O acumulo de processos evolutivos (alterações no DNA) é a base para diferença entre os organismos Relógio Molecular À medida que duas espécies divergem de um ancestral comum, acumulam mutações em uma taxa regular, ficando progressivamente mais diferentes uma da outra... *Problemas com taxa evolutivas mais aceleradas de um organismo para outro: taxa metabólica (mutações no DNA), o tempo de geração, o ambiente e tamanho populacional

29 Homologia vs Homoplasia Homologia um carácter é homólogo em dois organismos se foi herdado por ambos a partir de seu ancestral comum Homoplasia/analogia um carácter é análogo em dois organismos quando possui a mesma função (influencia do ambiente).

30 Exemplos: Homologia asas de morcego e mãos de humanos (mesma origem embrionária) Homoplasia asas de morcego e asas de borboleta (mesma função)

31 Apenas as mutações explica a grande variação e complexidade dos organismos? Duplicação Gênica: responsável pelo aumento na quantidade de genes, e, assim, pela complexidade orgânica ao longo da evolução. Impactos da duplicação gênica no organismo *Genes aceitam maior taxa de mutação - Perda função (pseudogene ou íntrons) - Adquirir outra função com grande impacto no fitness do organismo (teoria da formação de organismos mais complexos)

32 Duplicação Gênica: Ortologia, Parologia e Xenologia Evento de duplicação gênica Os genes X1B e X1C são considerados ortólogos: provém da mesma cópia do ancestral Os genes X1B e X2C são considerados parálogos Xenologia: é a transferência horizontal de genes entre organismos

33 Atividades próxima aula Critica sobre teoria da Evolução Molecular (evolução neutra vs seleção natural (até 24/04) Especiação, Filogenia e Identificação Molecular ESPECIAÇÃO: Discussão artigo: Tsai et al., 2014 e Rabeling et al., 2014 FILOGENIA: Produzir arquivo.fasta com 10 sequencias alinhadas (MEGA) IDENTIFICAÇAO MOLECULAR: Discussão Hebert et al., 2003 e apresentação de artigo sobre identificação molecular Dois slides: problema, marcador molecular e resultados

Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4.

Leia mais

Tamanho populacional 31/08/2010. Evolução Estocasticidade (Acaso) e Determinismo (Seleção natural) Relação entre o Censo (N) e tamanho efetivo (Ne)

Tamanho populacional 31/08/2010. Evolução Estocasticidade (Acaso) e Determinismo (Seleção natural) Relação entre o Censo (N) e tamanho efetivo (Ne) Evolução Estocasticidade (Acaso) e Determinismo (Seleção natural) Equilíbrio de Hardy-Weinberg (EHW) Os fatores evolutivos e a dinâmica populacional (p + q) 2 = p 2 + 2pq + q 2 Professor Fabrício R. Santos

Leia mais

Ecologia de Populações e Comunidades

Ecologia de Populações e Comunidades Ecologia de Populações e Comunidades Profa. Isabel Belloni Schmidt Dept. Ecologia UnB isabels@unb.br Evolução Nada em biologia faz sentido a não ser à luz da evolução Theodosius Dobzhansky Jean Baptiste

Leia mais

EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS. Professor Fláudio

EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS. Professor Fláudio EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS Professor Fláudio EVIDÊNCIAS DE EVOLUÇÃO EVOLUÇÃO conjunto de processos que levam a modificações nos seres vivos ao longo do tempo, podendo dar origem a novas espécies Entender

Leia mais

Neodarwinismo ou Teoria sintética de evolução

Neodarwinismo ou Teoria sintética de evolução Neodarwinismo ou Teoria sintética de evolução O desenvolvimento dos conhecimentos de genética e as novas descobertas sobre hereditariedade, permitiram fazer uma nova interpretação da teoria da evolução

Leia mais

Definições. Interpretação ingênua de seleção natural: sobrevivência do mais apto ou a natureza com unhas dentes

Definições. Interpretação ingênua de seleção natural: sobrevivência do mais apto ou a natureza com unhas dentes Seleção Natural Definições Interpretação ingênua de seleção natural: sobrevivência do mais apto ou a natureza com unhas dentes Essas definições são inexatas e insuficientes Seleção Natural Para Huxley,

Leia mais

Biologia Evolutiva. A Biologia Evolutiva é o estudo da história da vida e dos processos que levam à sua diversidade.

Biologia Evolutiva. A Biologia Evolutiva é o estudo da história da vida e dos processos que levam à sua diversidade. 2017 Biologia Evolutiva A Biologia Evolutiva é o estudo da história da vida e dos processos que levam à sua diversidade. Biologia Evolutiva Análises e metodologias reducionistas e composicionistas (propriedades

Leia mais

Organismos em seus ambientes. Prof. Dr. Francisco Soares Santos Filho UESPI

Organismos em seus ambientes. Prof. Dr. Francisco Soares Santos Filho UESPI Organismos em seus ambientes Prof. Dr. Francisco Soares Santos Filho UESPI Em biologia, nada tem sentido, exceto à luz da evolução (Theodosius Dobzhansky) O significado da Adaptação É muito comum dizermos

Leia mais

Ecologia Evolutiva. Iamê Alves Guedes

Ecologia Evolutiva. Iamê Alves Guedes Ecologia Evolutiva Iamê Alves Guedes 1. Discuta as diferentes maneiras como a evidência ecológica pode ser obtida. Como você tentaria responder uma das questões de ecologia não resolvidas: Por que existem

Leia mais

PRINCÍPIOS DE ECOLOGIA EVOLUTIVA

PRINCÍPIOS DE ECOLOGIA EVOLUTIVA PRINCÍPIOS DE ECOLOGIA EVOLUTIVA RELEMBRANDO... O que é Ecologia? Biosfera Ecossistema Comunidade População Organismo PENSAMENTO EVOLUTIVO E ECOLÓGICO Em biologia, nada tem sentido, exceto à luz a evolução

Leia mais

Teoria e Prática de Sistemática Filogenética

Teoria e Prática de Sistemática Filogenética Disciplina BOT-99 PPG-BOT-INPA 2015 Teoria e Prática de Sistemática Filogenética Alberto Vicentini alberto.vicentini@inpa.gov.br Mário Henrique Terra Araujo araujo.mht@gmail.com Programa de Pós-Graduação

Leia mais

Neodarwinismo Teoria Sintética da Evolução

Neodarwinismo Teoria Sintética da Evolução Neodarwinismo Teoria Sintética da Evolução Aula nº45, 46 e 48 26 e 28 Jan e 2 Fev09 Prof. Ana Reis Principais críticas apontadas à Teoria de Darwin: não explicar o surgimento de variações naturais nos

Leia mais

Panspermia cósmica. hipercognicion.blogspot.com

Panspermia cósmica. hipercognicion.blogspot.com Origem da Vida Panspermia cósmica hipercognicion.blogspot.com Conseguiriam sobreviver? Como se formaram? Abiogênese (Geração espontânea) http://slideplayer.com.br/slide/387759/ slideplayer.com.br Antonie

Leia mais

LGN GENÉTICA. Aula 9 - Evolução. Antonio Augusto Franco Garcia Filipe Inácio Matias Marianella F. Quezada Macchiavello

LGN GENÉTICA. Aula 9 - Evolução. Antonio Augusto Franco Garcia Filipe Inácio Matias Marianella F. Quezada Macchiavello LGN 215 - GENÉTICA Aula 9 - Evolução Antonio Augusto Franco Garcia Filipe Inácio Matias Marianella F. Quezada Macchiavello Departamento de Genética Escola Superior de Agricultura Luiz de Queiroz Universidade

Leia mais

Modelando microevolução GENÉTICA DE POPULAÇÕES E EVOLUÇÃO

Modelando microevolução GENÉTICA DE POPULAÇÕES E EVOLUÇÃO Modelando microevolução GENÉTICA DE POPULAÇÕES E EVOLUÇÃO Modelando microevolução Evolução: mudança na frequência de alelos ou combinações de alelos no pool gênico. Modelos de evolução deve incluir a passagem

Leia mais

PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE

PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE CONCEITOS EM EPIDEMIOLOGIA E FILOGENIA MOLECULARES PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE DE

Leia mais

As bases evolutivas da Saúde Pública Teoria da evolução

As bases evolutivas da Saúde Pública Teoria da evolução As bases evolutivas da Saúde Pública Teoria da evolução Claudia Torres Codeço codeco@procc.fiocruz.br 22 de Julho de 2003 Página 1 de 24 1. Epidemiologia: dinâmica de doenças na população Genética de populações:

Leia mais

Seleção Natural. BIO0230 Genética e Evolução. Felipe Bastos Rocha

Seleção Natural. BIO0230 Genética e Evolução. Felipe Bastos Rocha Seleção Natural BIO0230 Genética e Evolução Felipe Bastos Rocha Charles Darwin Origem das adaptações: Seleção Natural Há fenótipos que conferem maior probabilidade de sobrevivência e/ou reprodução Gregor

Leia mais

Biologia Molecular Computacional Homologia

Biologia Molecular Computacional Homologia Biologia Molecular Computacional Homologia Luiz Thibério Rangel O que é homologia? Conceito básico para estudos de genômica comparativa; Passo inicial para estudos de filogenia(omica); Importante para

Leia mais

As Teorias Evolutivas. Princípios da Teoria de Lamarck. Fundamentos da Evolução Biológica. Ideias Evolucionistas - Lamarckismo

As Teorias Evolutivas. Princípios da Teoria de Lamarck. Fundamentos da Evolução Biológica. Ideias Evolucionistas - Lamarckismo Fundamentos da Evolução Biológica As Teorias Evolutivas Várias teorias evolutivas surgiram, mas destacam-se se as teorias de Lamarck e de Darwin. O EVOLUCIONISMO, OU TEORIA DA EVOLUÇÃO, É A EXPLICAÇÃO

Leia mais

Evolução determinística. Seleção Natural. Seleção Natural

Evolução determinística. Seleção Natural. Seleção Natural Equilíbrio de Hardy-Weinberg (EHW) Evolução determinística Natural Professor Fabrício R. Santos - UFMG Populações estão em EHW quando: tamanho populacional é infinito; acasalamento é totalmente ao acaso;

Leia mais

Origem da variação. Conceitos importantes. Variabilidade genética. Variabilidade Genética. Variação genética e Evolução

Origem da variação. Conceitos importantes. Variabilidade genética. Variabilidade Genética. Variação genética e Evolução Variabilidade genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2011 Conceitos importantes Variação genética: variantes alélicos originados

Leia mais

Aula3 FATORES GERADORES DE VARIABILIDDE GENÉTICA. Silmara de Moraes Pantaleão

Aula3 FATORES GERADORES DE VARIABILIDDE GENÉTICA. Silmara de Moraes Pantaleão Aula3 FATORES GERADORES DE VARIABILIDDE GENÉTICA META Discutir a importância dos fatores biológicos e ecológicos que atuam na evolução dos Seres Vivos. OBJETIVOS Ao fi nal desta aula, o aluno deverá: Compreender

Leia mais

LGN215 - Genética Geral Aula 9: Evolução

LGN215 - Genética Geral Aula 9: Evolução LGN215 - Genética Geral Aula 9: Evolução Antonio Augusto Franco Garcia Maria Marta Pastina Piracicaba - SP Evolução Teoria da Evolução formulada por Darwin Teoria Sintética da Evolução (Neodarwinismo)

Leia mais

21/11/2013 BIOLOGIA EVOLUÇÃO

21/11/2013 BIOLOGIA EVOLUÇÃO BIOLOGIA EVOLUÇÃO O que é a evolução? Evolução é o processo através no qual ocorrem as mudanças ou transformações nos seres vivos ao longo do tempo, dando origem a espécies novas. 1 Evidências da evolução

Leia mais

Forças evolutivas. Definição de Evolução. Deriva Genética. Desvios de Hardy-Weinberg

Forças evolutivas. Definição de Evolução. Deriva Genética. Desvios de Hardy-Weinberg Definição de Evolução A definição operacional de evolução em nível de deme é mudanças na freqüência alélica ou genotípica. Forças evolutivas Fatores ou processos que podem alterar a freqüência alélica

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

Exercícios de Especiação

Exercícios de Especiação Exercícios de Especiação 1. (UEPB) Vários conceitos são utilizados para definir uma espécie. De maneira geral podemos dizer que uma espécie representa um conjunto de indivíduos com potencial, em condições

Leia mais

Everton Amorim 14/11/2013. Biologia

Everton Amorim 14/11/2013. Biologia Biologia Tema: Everton Amorim 1) Introdução é o processo de transformações hereditárias e adaptações que vem ocorrendo nos seres vivos desde que surgiram no planeta Terra. o =Fato o Ciência que estuda

Leia mais

Considerando a origem e evolução da nossa espécie, nesse calendário, o homem teria surgido no mês de: a) Março. b) Junho. c) Agosto. d) Dezembro.

Considerando a origem e evolução da nossa espécie, nesse calendário, o homem teria surgido no mês de: a) Março. b) Junho. c) Agosto. d) Dezembro. Evolução 1. (UFERSA) Responda esta questão com base no calendário abaixo, que representa a história da Terra, desde o seu surgimento até os dias de hoje, descrita numa escala hipotética de 12 meses. Considerando

Leia mais

AULA Nº 4. Neste tópico começamos a falar dos aspectos quantitativos da coleta, uma vez

AULA Nº 4. Neste tópico começamos a falar dos aspectos quantitativos da coleta, uma vez AULA Nº 4 Neste tópico começamos a falar dos aspectos quantitativos da coleta, uma vez que até aqui tratamos dos aspectos qualitativos. Para tanto teremos que apreender alguns conceitos de genética de

Leia mais

Introdução a Algoritmos Genéticos

Introdução a Algoritmos Genéticos Introdução a Algoritmos Genéticos Tiago da Conceição Mota Laboratório de Inteligência Computacional Núcleo de Computação Eletrônica Universidade Federal do Rio de Janeiro Outubro de 2007 O Que São? Busca

Leia mais

EVOLUÇÃO. Evidências e Teorias. Professora Priscila F Binatto Biologia 3ª Série Ensino Médio

EVOLUÇÃO. Evidências e Teorias. Professora Priscila F Binatto Biologia 3ª Série Ensino Médio EVOLUÇÃO Evidências e Teorias Professora Priscila F Binatto Biologia 3ª Série Ensino Médio Evolução Homer Simpson Vídeos e animações\the Simpsons - Homer Evolution.flv Na natureza tudo se transforma...

Leia mais

BIODIVERSIDADE E V O L U Ç Ã O. Qual a origem de tamanha variedade de seres vivos?

BIODIVERSIDADE E V O L U Ç Ã O. Qual a origem de tamanha variedade de seres vivos? EVOLUÇÃO BIODIVERSIDADE Qual a origem de tamanha variedade de seres vivos? FIXISMO Teorias A Fixismo 9 As espécies surgiram independentemente umas das outras (tal como se conhecem hoje) e mantiveram-se

Leia mais

PROGRAMA DE PÓS-GRADUAÇÃO EM ECOLOGIA E CONSERVAÇÃO DA BIODIVERSIDADE

PROGRAMA DE PÓS-GRADUAÇÃO EM ECOLOGIA E CONSERVAÇÃO DA BIODIVERSIDADE Processo seletivo PPGECB - 2013 Prova de conhecimentos em Ecologia e Evolução CPF do candidato: MS ( ) DR ( ) Instruções para a prova: 1) Não coloque NOME nas folhas de prova em hipótese alguma. Sua única

Leia mais

O que é teoria??? Senso comum Apenas no campo das idéias. Ciência Conjunto de varias idéias baseadas em fatos e provas

O que é teoria??? Senso comum Apenas no campo das idéias. Ciência Conjunto de varias idéias baseadas em fatos e provas TEORIA DA EVOLUÇÃO O que é teoria??? Senso comum Apenas no campo das idéias Ciência Conjunto de varias idéias baseadas em fatos e provas Histórico Como Darwin explica? Os primeiros a falarem: Antiguidade/Idade

Leia mais

Evolução: As Teorias de Lamarck e Darwin

Evolução: As Teorias de Lamarck e Darwin Evolução: As Teorias de Lamarck e Darwin Evolução Ancestral comum Primeiras ideias: filósofos da Grécia Clássica Tales de Mileto (Séc. VI a.c.): água como princípio organizador dos seres vivos Xenófanes

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 62 EVIDÊNCIAS DA EVOLUÇÃO

BIOLOGIA - 2 o ANO MÓDULO 62 EVIDÊNCIAS DA EVOLUÇÃO BIOLOGIA - 2 o ANO MÓDULO 62 EVIDÊNCIAS DA EVOLUÇÃO Nosso último ancestral comum com os chimpanzés e gorilas viveu há menos de cinco milhões de anos. Fixação 1) (CESGRANRIO) Com relação à figura

Leia mais

Evolução Def. usual Biologicamente frequências gênicas populações

Evolução Def. usual Biologicamente frequências gênicas populações Evolução A palavra evolução vem do Latim evolvere que significa Desenvolver ou Estender. A Def. usual: progresso, desenvolvimento, melhora. Biologicamente: evolução é a mudança nas propriedades (frequências

Leia mais

Teoria da Evolução. Computação Evolucionária: Um pouco de biologia. Teoria da Evolução. Teoria da Evolução e os Genes. Cromossomos

Teoria da Evolução. Computação Evolucionária: Um pouco de biologia. Teoria da Evolução. Teoria da Evolução e os Genes. Cromossomos Computação Evolucionária: Um pouco biologia Teoria da Evolução Até o século XIX os cientistas mais proeminentes acreditavam em duas teorias principais: Criacionismo ( Deus criou o universo da forma que

Leia mais

Universidade Federal de Santa Maria PET - Biologia. Marcela Dambrowski dos Santos

Universidade Federal de Santa Maria PET - Biologia. Marcela Dambrowski dos Santos Universidade Federal de Santa Maria PET - Biologia Marcela Dambrowski dos Santos Introdução Hemoglobina A Hemoglobina S Anemia falciforme Traço falciforme Malária Hipótese da malária Origem e dispersão

Leia mais

Introdução à Genética da Conservação: Diversidade Genética e Evolução das Populações Naturais

Introdução à Genética da Conservação: Diversidade Genética e Evolução das Populações Naturais Biologia da Conservação: Genética Professor: Fabrício R. Santos Bibliografia: Fundamentos de Genética da Conservação [Frankham et al. 2008] e artigos científicos http://www.icb.ufmg.br/labs/lbem/aulas/grad/biolcons

Leia mais

SISTEMÁTICA VEGETAL. Aula 01: O Processo de Evolução

SISTEMÁTICA VEGETAL. Aula 01: O Processo de Evolução SISTEMÁTICA VEGETAL Aula 01: O Processo de Evolução INTRODUÇÃO Em 1831, Charles Darwin inicia sua viagem de cinco anos como naturalista do navio HMS Beagle. INTRODUÇÃO Por fornecer evidências meticulosamente

Leia mais

Lista de Recuperação Não rasure os testes, não use branquinho à tinta.

Lista de Recuperação Não rasure os testes, não use branquinho à tinta. Data: /10/14 Bim.: 3º Nome: 9 ANO Nº Disciplina: Biologia Professora: Ângela Valor da Prova / Atividade: 2,0 Nota: Objetivo / Instruções: Lista de Recuperação Não rasure os testes, não use branquinho à

Leia mais

Forças evolutivas. Definição de Evolução. Desvios de Hardy-Weinberg. Desvios de Hardy-Weinberg

Forças evolutivas. Definição de Evolução. Desvios de Hardy-Weinberg. Desvios de Hardy-Weinberg Definição de Evolução Forças evolutivas A definição operacional de evolução em nível de deme é mudança na freqüência alélica ou genotípica em gerações. Fatores ou processos que podem alterar a freqüência

Leia mais

Módulo 6: ESPECIAÇÃO. Profa. Ângela Dauch

Módulo 6: ESPECIAÇÃO. Profa. Ângela Dauch Módulo 6: ESPECIAÇÃO Profa. Ângela Dauch Ao longo dos tempos novas espécies têm surgido, enquanto outras se têm extinguido. Como se formam as novas espécies? Dois mecanismos fundamentais conduzem à especiação:

Leia mais

2 vertical: 5 letras, plural. 1 vertical: 11 letras

2 vertical: 5 letras, plural. 1 vertical: 11 letras 1 vertical: 11 letras São organismos originados da alteração molecular do DNA. 2 vertical: 5 letras, plural Fatores que condicionam as características genéticas de um organismo, sendo um proveniente do

Leia mais

MARCADORES MOLECULARES

MARCADORES MOLECULARES ESALQ/USP MARCADORES MOLECULARES Base genética dos marcadores e usos no melhoramento de plantas e em estudos de diversidade genética e conservação Departamento de Genética ESTUDO DIRIGIDO 1. O que são

Leia mais

Otimização. Unidade 6: Algoritmo Genético. Jaime Arturo Ramírez. 7. Teoria do processo evolutivo num GA. 8. Aspectos avançados

Otimização. Unidade 6: Algoritmo Genético. Jaime Arturo Ramírez. 7. Teoria do processo evolutivo num GA. 8. Aspectos avançados Otimização Jaime Arturo Ramírez Conteúdo 1. Introdução 2. Analogia de mecanismos de seleção natural com sistemas artificiais 3. Algoritmo genético modelo 4. Um GA simples 5. Representação, genes e cromossomos

Leia mais

Genética de Populações. Genética de Populações. Deriva 1/2N e. Mutações recentes. Alelos Neutros. Mutações recentes

Genética de Populações. Genética de Populações. Deriva 1/2N e. Mutações recentes. Alelos Neutros. Mutações recentes Deriva 1/2N e Por que então é também importante em grandes populações? Mutações recentes Mutações recentes Qual a prob de uma mutação que ocorreu pela 1 a vez passar para a próxima geração? Modelo aleatório,

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

Evolução Biológica - I. Prof. Pablo Paim Biologia

Evolução Biológica - I. Prof. Pablo Paim Biologia Evolução Biológica - I Prof. Pablo Paim Biologia Organismos se adaptam ao ambiente?! O homem veio do macaco?! Organismos mais evoluídos!? Ser evolucionista é ser ateu?! O processo de evolução biológica

Leia mais

Biologia Professor Leandro Gurgel de Medeiros

Biologia Professor Leandro Gurgel de Medeiros Biologia Professor Leandro Gurgel de Medeiros Genética Clássica 1. Conceito: É a ciência voltada para o estudo da hereditariedade, bem como da estrutura e função dos genes. Características Fundamentais

Leia mais

Departamento de Biodiversidade Evolução e Meio Ambiente Universidade Federal de Ouro Preto

Departamento de Biodiversidade Evolução e Meio Ambiente Universidade Federal de Ouro Preto Departamento de Biodiversidade Evolução e Meio Ambiente Universidade Federal de Ouro Preto Prof. Dr. Roberth Fagundes roberthfagundes@gmail.com FILOGENIA EVOLUÇÃO Evolução: mudança na variabilidade biológica

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

Biologia. Natália Aguiar Paludetto

Biologia. Natália Aguiar Paludetto Biologia Natália Aguiar Paludetto Aula de hoje: Introdução à Biologia O que é? O que estuda? Como se organiza? Referência bibliográfica: Bio Volume Único, Sônia Lopes, editora Saraiva. Biologia estudo

Leia mais

3) Usando seus conhecimentos de probabilidade, Mendel chegou às seguintes conclusões, com exceção de uma delas. Indique-a:

3) Usando seus conhecimentos de probabilidade, Mendel chegou às seguintes conclusões, com exceção de uma delas. Indique-a: LISTA REVISÃO BIOLOGIA DIVISÃO CELULAR E GENÉTICA 1) Em urtigas o caráter denteado das folhas domina o caráter liso. Numa experiência de polinização cruzada, foi obtido o seguinte resultado: 89 denteadas

Leia mais

Evolução Biológica Conceitos e pensamentos

Evolução Biológica Conceitos e pensamentos Profº Marcelo Morcegão Evolução Biológica Conceitos e pensamentos Fixismo Doutrina Filosófica que defende que desde o seu aparecimento as espécies são imutáveis e não sofrem transformações. Aristóteles

Leia mais

Evolução e etologia. Transparências apresentadas no curso de Psicobiologia. Prof. Mauro Lantzman

Evolução e etologia. Transparências apresentadas no curso de Psicobiologia. Prof. Mauro Lantzman Evolução e etologia Transparências apresentadas no curso de Psicobiologia Prof. Mauro Lantzman A perigosa idéia de Darwin Darwin demonstrou de maneira conclusiva que, ao contrario da tradição antiga, as

Leia mais

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial.

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial. GENÉTICA BACTERIANA GENOMA BACTERIANO Cromossoma (nucleóide) Informação genética essencial. Ácido desoxirribonucléico (DNA). Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello

Leia mais

COMO OCORRE A ESPECIAÇÃO?

COMO OCORRE A ESPECIAÇÃO? COMO OCORRE A ESPECIAÇÃO? 1 - aparecimento de variantes genéticas 2 - reprodução preferencial entre os seus possuidores (devido a barreiras ou selecção) 3 - isolamento reprodutivo 4 - diferenciação a vários

Leia mais

Ligação, permuta e mapas genéticos: ligação e permuta genética, estimativa da freqüência de permuta

Ligação, permuta e mapas genéticos: ligação e permuta genética, estimativa da freqüência de permuta Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal Ligação, permuta e mapas genéticos: ligação e permuta genética, estimativa da freqüência de permuta Após

Leia mais

Seleção Natural. Fundamentos de Ecologia e Modelagem Ambiental Aplicados à Conservação da Biodiversidade

Seleção Natural. Fundamentos de Ecologia e Modelagem Ambiental Aplicados à Conservação da Biodiversidade Seleção Natural Fundamentos de Ecologia e Modelagem Ambiental Aplicados à Conservação da Biodiversidade Aluna: Michelle Andrade Furtado Profº Dalton e Profª Silvana Definição Seleção Natural pode ser definida

Leia mais

Ligação e Recombinação Gênica Elaboração de Mapas Cromossômicos QTLs e sua detecção

Ligação e Recombinação Gênica Elaboração de Mapas Cromossômicos QTLs e sua detecção Ligação e Recombinação Gênica Miguel H.A. Santana mhasantana@usp.br Genética Básica e Evolução (ZVM 0215) Quarta, 21 de Setembro 2016 Visão geral Meta Importância dos princípios que regem a diversidade

Leia mais

Filogenia, Evolução e o Estudo de Patógenos Virais

Filogenia, Evolução e o Estudo de Patógenos Virais Filogenia, Evolução e o Estudo de Patógenos Virais Atila Iamarino atila@usp.br http://scienceblogs.com.br/rainha/ O que é evolução molecular Integração entre biologia molecular, biologia evolutiva e genética

Leia mais

Nada em Biologia faz sentido, senão à luz da evolução. Theodosius Dobzhansky

Nada em Biologia faz sentido, senão à luz da evolução. Theodosius Dobzhansky EVOLUÇÃO BIOLÓGICA Nada em Biologia faz sentido, senão à luz da evolução. Theodosius Dobzhansky Criacionismo Muitas vezes confundida com o Fixismo. Teoria segundo a qual as espécies vegetais e animais

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

Deriva Genética. (Genetic drift)

Deriva Genética. (Genetic drift) Deriva Genética (Genetic drift) => Primeiros trabalhos demonstrando a existência de deriva genética, em 1954, pelos Profs. Warwick Kerr e S. Wright: Um dos fundadores da Teoria Sintética da Evolução i)

Leia mais

A teoria sintética da evolução

A teoria sintética da evolução A teoria sintética da evolução De 1900 até cerca de 1920, os adeptos da genética mendeliana acreditavam que apenas as mutações eram responsáveis pela evolução e que a seleção natural não tinha importância

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

EVOLUÇÃO. Prof. Gilmar Marques

EVOLUÇÃO. Prof. Gilmar Marques EVOLUÇÃO 1 As teorias evolucionistas Nosso planeta apresenta uma imensa variedade de espécies, vivendo nos mais diferentes habitats. A Teoria da evolução tenta explicar como isso torno-se possível. 2 Fixismo

Leia mais

Fundamentos da Genética. Professor: Anderson Marques de Souza 2016

Fundamentos da Genética. Professor: Anderson Marques de Souza 2016 Fundamentos da Genética Professor: Anderson Marques de Souza 2016 Genética: Conceitos Básicos 1º estuda a transmissão de características da célula-mãe para a célula-filha; 2º estuda as características

Leia mais

Sistemas de Acasalamento. Acasalamento ao acaso. Acasalamento ao acaso. O ciclo de vida de uma população. Pressupostos de Hardy Weinberg.

Sistemas de Acasalamento. Acasalamento ao acaso. Acasalamento ao acaso. O ciclo de vida de uma população. Pressupostos de Hardy Weinberg. Pressupostos de Hardy Weinberg Produção de alelos: 1 locus autossômico 2 alelos sem mutação 1ª Lei de Mendel União de alelos: Sistema de acasalamento aleatório Tamanho populacional infinito Troca genética

Leia mais

Genética Bacteriana. Julliane Dutra Medeiros

Genética Bacteriana. Julliane Dutra Medeiros Genética Bacteriana Julliane Dutra Medeiros 1 A célula bacteriana 2 Relembrando conceitos... Genoma informação genética de uma célula (cromossomo e plasmídeos) Estruturas contendo DNA que transportam fisicamente

Leia mais

ESPECIAÇÃO. Professor Júlio César Arrué dos Santos

ESPECIAÇÃO. Professor Júlio César Arrué dos Santos ESPECIAÇÃO Professor Júlio César Arrué dos Santos Espécie Conceito: Conjunto de indivíduos que podem se intercruzar, livremente, produzindo descendentes férteis. Conjunto de indivíduos de uma mesma espécie.

Leia mais

BIOLOGIA QUESTÃO 01. Observe o esquema abaixo que apresenta as diferentes etapas do processo de coagulação sangüínea. Ca ++ e tromboplastina

BIOLOGIA QUESTÃO 01. Observe o esquema abaixo que apresenta as diferentes etapas do processo de coagulação sangüínea. Ca ++ e tromboplastina Processo Seletivo/UNIFAL- janeiro 008 - ª Prova Comum TIPO BIOLOGIA QUESTÃO 0 Observe o esquema abaixo que apresenta as diferentes etapas do processo de coagulação sangüínea. Fibrinogênio Coágulo Ca ++

Leia mais

a) T2 e T3. b) T1 e T3. c) T3 e T4. d) T1 e T4.

a) T2 e T3. b) T1 e T3. c) T3 e T4. d) T1 e T4. Lista de Exercícios (BIO-LEO) 1. (Faculdade Albert Einstein 2016) O gráfico abaixo refere-se ao processo de divisão celular que ocorre durante a espermatogênese humana: Nesse processo de divisão ocorre:

Leia mais

Curso de Licenciatura em Biologia Evolução Biológica

Curso de Licenciatura em Biologia Evolução Biológica INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DO RIO GRANDE DO NORTE Campus Macau Curso de Licenciatura em Biologia Evolução Biológica IFRN/Macau - Curso de Licenciatura em Biologia - Parasitologia

Leia mais

Genética de Populações. Prof. Ricardo Lehtonen R. de Souza

Genética de Populações. Prof. Ricardo Lehtonen R. de Souza Genética de Populações Prof. Ricardo Lehtonen R. de Souza E-mail: ricardo.lehtonen@gmail.com http://www.ufpr.br/~lehtonen VARIAÇÃO EM POPULAÇÕES NATURAIS A maioria das características varia pelo menos

Leia mais

Bases genéticas e a evolução do comportamento

Bases genéticas e a evolução do comportamento Bases genéticas e a evolução do comportamento Comportamento = FENÓTIPO Genótipo + Ambiente 1 Efeitos de genes individuais sobre o comportamento Mutante Icebox (Ibx) herança recessiva ligada ao cromossomo

Leia mais

Antes de Mim. Genética(fazer nascer) Qual a Especificidade do Ser humano?

Antes de Mim. Genética(fazer nascer) Qual a Especificidade do Ser humano? Psicologia B Antes de Mim Genética(fazer nascer) Qual a Especificidade do Ser humano? Nós e os outros Como se explicam as caraterísticas dos diferentes seres vivos? Porque razão os seres da mesma espécie

Leia mais

O MODELO DE HARDY-WEINBERG

O MODELO DE HARDY-WEINBERG Modelo simples de genética de populações: modelo de Hardy-Weinberg (Hardy 1908; Weinberg 1908). Embora faça vários pressupostos simplificadores que não são realistas, ele se mostra bastante útil para descrever

Leia mais

Seleção Natural. Seleção Natural. Seleção Natural. Valor Adaptativo ( Fitness )

Seleção Natural. Seleção Natural. Seleção Natural. Valor Adaptativo ( Fitness ) eleção Natural eleção Natural: obrevivência e reprodução diferencial de indivíduos na população Valor daptativo: progênie gerada que sobrevive e reproduz na próxima geração eleção natural requer variação

Leia mais

Alinhamento de seqüências

Alinhamento de seqüências Alinhamento de seqüências Qual a importância do alinhamento de seqüências Permite estabelecer identidades entre sequências Permite a dedução de função de proteínas baseado em similaridade Permite a definição

Leia mais

Teoria neutralista da evolução molecular

Teoria neutralista da evolução molecular Teoria neutralista da evolução molecular Polimorfsmos genétcos Um locus gênico é considerado polimórfco se a frequência de um dos alelos na população é menor que 99% O polimorfsmo, obviamente, é resultado

Leia mais

Ensino Médio - Unidade Parque Atheneu Professor (a): Emmanuella Rodrigues Aluno (a): Série: 3ª Data: / / LISTA DE BIOLOGIA II

Ensino Médio - Unidade Parque Atheneu Professor (a): Emmanuella Rodrigues Aluno (a): Série: 3ª Data: / / LISTA DE BIOLOGIA II Ensino Médio - Unidade Parque Atheneu Professor (a): Emmanuella Rodrigues Aluno (a): Série: 3ª Data: / / 2016. LISTA DE BIOLOGIA II Orientações: - A lista deverá ser respondida na própria folha impressa

Leia mais

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA ÍNDICE Introdução Evolução: mutação e recombinação do DNA Erros de Recombinação: Câncer? Engenharia Genética e Transgênicos Recombinação homóloga - Modelo Holliday

Leia mais

Evolução e Ecologia de Populações

Evolução e Ecologia de Populações Evolução e Ecologia de Populações O que é Ecologia?? A ciência capaz de compreender a relação do organismo com o seu ambiente (Ernst Haeckel, 1866) Estudo científico da distribuição e da abundância de

Leia mais

Lyria Mori 1, Cristina Yumi Miyaki 2 e Maria Cristina Arias 3

Lyria Mori 1, Cristina Yumi Miyaki 2 e Maria Cristina Arias 3 ISSN 1980-3540 04.02, 41-46 (2009) www.sbg.org.br A seleção natural em ação: o caso das joaninhas Lyria Mori 1, Cristina Yumi Miyaki 2 e Maria Cristina Arias 3 1- lmori@ib.usp.br, 2 - cymiyaki@ib.usp.br,

Leia mais

Meiose. Texto extraído do site:

Meiose. Texto extraído do site: Meiose Texto extraído do site: http://www.sobiologia.com.br/ Diferentemente da mitose, em que uma célula diplóide, por exemplo, se divide formando duas células também diplóides (divisão equacional), a

Leia mais

A CIÊNCIA BIOCLIMATOLOGIA ANIMAL. Eduardo Brum Schwengber

A CIÊNCIA BIOCLIMATOLOGIA ANIMAL. Eduardo Brum Schwengber A CIÊNCIA BIOCLIMATOLOGIA ANIMAL Eduardo Brum Schwengber eduardoschwengber@unipampa.edu.br A todo momento Novos conhecimentos Novos ingredientes Dinamismo Conceitos com caráter de transitoriedade Efeitos

Leia mais

QUESTÕES SOBRE MEIOSE/MITOSE

QUESTÕES SOBRE MEIOSE/MITOSE 1) Durante a meiose, o pareamento dos cromossomos homólogos é importante porque garante: (A) a separação dos cromossomos não homólogos. (B) a duplicação do DNA, indispensável a esse processo. (C) a formação

Leia mais

Ligação, Recombinação e Mapeamento gênico em eucariotas

Ligação, Recombinação e Mapeamento gênico em eucariotas Ligação, Recombinação e Mapeamento gênico em eucariotas A lei da segregação independente estelece que: Em um cruzamento envolvendo mais de um gene, os genes diferentes se separam ou segregam independentemente

Leia mais

Algoritmos genéticos Abordagem unificada de algoritmos evolutivos simples

Algoritmos genéticos Abordagem unificada de algoritmos evolutivos simples Introdução Inspiração biológica Histórico da computação evolutiva Algoritmo evolutivo simples Programação evolutiva Estratégias evolutivas Algoritmos genéticos Abordagem unificada de algoritmos evolutivos

Leia mais

Estudo da diversidade com sequências de DNA

Estudo da diversidade com sequências de DNA Estudo da diversidade com sequências de DNA estudo do DNA por sequenciação extracção de DNA PCR do fragmento desejado sequenciação estudo do DNA por sequenciação sequenciação 1 2 3 indivíduo A indivíduo

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 59 EVOLUÇÃO: TEORIAS EVOLUTIVAS

BIOLOGIA - 2 o ANO MÓDULO 59 EVOLUÇÃO: TEORIAS EVOLUTIVAS BIOLOGIA - 2 o ANO MÓDULO 59 EVOLUÇÃO: TEORIAS EVOLUTIVAS Como pode cair no enem (UFMG) De tanto comer vegetais, o intestino dos herbívoros aos poucos foi ficando longo. Essa farse está de acordo com

Leia mais

Dicas para o ENEM 2015 BIOLOGIA. Professora Priscila F Binatto

Dicas para o ENEM 2015 BIOLOGIA. Professora Priscila F Binatto Dicas para o ENEM 2015 BIOLOGIA Professora Priscila F Binatto TEMAS MAIS FREQUENTES Questões ambientais: temas atuais, como sustentabilidade, desmatamento, poluição, preservação e uso dos recursos hídricos,

Leia mais

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo Instituto Federal de Santa Catarina Câmpus Florianópolis Unidade Curricular: Biologia I Tema 1: Genética Molecular Genética Molecular Prof. Leandro Parussolo leandro.parussolo@ifsc.edu.br Genética Estuda

Leia mais