Ácidos nucleicos. Disponível em: < Acesso em: 21 fev

Save this PDF as:

Tamanho: px
Começar a partir da página:

Download "Ácidos nucleicos. Disponível em: <http://carmelourso.files.wordpress.com/2011/08/3d-dna-cover.jpg>. Acesso em: 21 fev"

Transcrição

1 Ácidos nucleicos

2 Ácidos nucleicos Disponível em: < Acesso em: 21 fev

3 Núcleo celular Define as características morfofisiológicas da célula e controla sua divisão celular 1869: Johann Friedrich Miescher descobre os ácidos nucleicos 1893: Eduardo Balbiani realiza a merotomia, mostrando a importância do núcleo Século XX: estudos sobre os ácidos nucleicos Disponível em: < Acesso em: 21 fev

4 Ácidos nucleicos DNA ou ADN ou ácido desoxirribonucleico RNA ou ARN ou ácido ribonucleico Base nitrogenada + pentose = nucleosídeo Grupo fosfato Pentose Base nitrogenada Base nitrogenada + pentose + fosfato = nucleotídeo Disponível em: < Acesso em: 21 fev

5 Pentose Ribose Desoxirribose Disponível em: < Acesso em: 21 fev

6 Púricas Bases nitrogenadas Adenina Guanina Pirimídicas Citosina Disponível em: < Acesso em: 21 fev Timina Uracila

7 Dogma da vida duplicação transcrição tradução DNA RNA Proteína Disponível em: < Acesso em: 21 fev

8 DNA Localização: citoplasma das células procarióticas núcleo, mitocôndrias e cloroplastos das células eucarióticas Disponível em: < Acesso em: 21 fev

9 Pentose: desoxirribose DNA Bases nitrogenadas: A, T, C e G Estrutura: dois filamentos polinucleotídicos, dispostos em α- hélice (Watson e Crick, 1953). Ligação entre nucleotídeos: entre grupamento fosfato e pentose Ligação entre filamentos: pontes de hidrogênio Relação de Chargaff A T G C A T G C 1

10 Filamentos: complementares antiparalelos Disponível em: < Vi4v_8ecrI/DNA_chemical_structure.png>. Acesso em: 21 fev

11 Disponível em: < Acesso em: 21 fev Disponível em: < Acesso em: 21 fev

12 Duplicação do DNA Enzimas envolvidas DNA-helicase: desmonta a estrutura α - hélice DNA-polimerase: promove o pareamento dos novos nucleotídeos DNA-ligase: catalisa as ligações entre os novos nucleotídeos Acervo CNEC

13 Disponível em: Robert K. Murray, et al. Harper s Illustrated Biochemistry, Twenty-Sixth Edition.

14 Síntese: sempre no sentido 5 3 Disponível em: William K. Purves. Vida a Ciência da Biologia, Volume I Disponível em: < Acesso em: 21 fev

15 Propostas para a duplicação do DNA Semiconservativa Conservativa Dispersiva Disponível em: < Acesso em: 21 fev

16 Duplicação semiconservativa Comprovada por Matthew Meselson e Franklin Stahl (1958) Disponível em: < Acesso em: 21 fev

17 Localização: Citoplasma das células procarióticas Núcleo, citoplasma, mitocôndrias e cloroplastos das células eucarióticas Pentose: ribose RNA Bases nitrogenadas: A, U, C e G Estrutura: um filamento polinucleotídico

18 Transcrição do DNA RNA-polimerase: promove o pareamento dos novos nucleotídeos Transcrito a partir do filamento ativo do DNA Acervo CNEC

19 Tipos de RNA RNA mensageiro (RNAm) RNA transportador (RNAt) RNA ribossômico (RNAr) Disponível em: < Acesso em: 21 fev

20 Tipos de RNA Disponível em: < Acesso em: 21 fev

21 Síntese proteica Disponível em: < Acesso em: 21 fev

22 Disponível em: < Acesso em: 21 fev

23 Códon de iniciação AUG metionina Códons de terminação UAA, UAG, UGA Disponível em: < Acesso em: 21 fev

24 Polissomos ou polirribossomos Disponível em: < Acesso em: 21 fev

25 Código genético 1 códon 1 aminoácido A C A C A C U G U G U G 4 x 4 x 4 = 64 códons 20 aminoácidos

26 Disponível em: < Acesso em: 21 fev

27 Mutações CUA Leucina CUU Mutação na 3ª base nitrogenada CUG Leucina Leucina CUC Leucina

28 Mutações CAU Histidina CUU Mutação na 2ª base nitrogenada CGU Arginina Leucina CCU Prolina

29 Aplicação em exercícios DNA molde RNA Proteína GCAATACCTATTAGTAGGAAATATTCTA CGUUAUGGAUAAUCAUCCUUUAUAAGAU Metionina ácido aspártico asparagina histidina prolina leucina DNA molde RNA Proteína GCAATACCTATTAGTCGGCAATATTCTA CGUUAUGGAUAAUCAGCCGUUAUAAGAU Metionina ácido aspártico asparagina glutamina prolina leucina

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

1 Elab.: Prof. : Gilmar

1 Elab.: Prof. : Gilmar 1 Elab.: Prof. : Gilmar 2 Elab.: Prof. : Gilmar Introdução Os ácidos nucléicos são responsáveis pelo controle de todas as atividades e pela manutenção da estrutura das células, além de estarem relacionados

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

BIOLOGIA. Moléculas, Células e Tecidos Transcrição e Tradução. Prof. Daniele Duó

BIOLOGIA. Moléculas, Células e Tecidos Transcrição e Tradução. Prof. Daniele Duó BIOLOGIA Moléculas, Células e Tecidos Prof. Daniele Duó O código genético É a relação entre a sequência de bases no DNA e a sequência correspondente de aminoácidos, na proteína; Guarda toda informação

Leia mais

Biologia. Código Genético. Professor Enrico Blota.

Biologia. Código Genético. Professor Enrico Blota. Biologia Código Genético Professor Enrico Blota www.acasadoconcurseiro.com.br Biologia CÓDIGO GENÉTICO NÚCLEO E SÍNTESE PROTEICA O núcleo é de fundamental importância para grande parte dos processos que

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Ácidos nucleicos (DNA e RNA) e os genes

Ácidos nucleicos (DNA e RNA) e os genes Disciplina: Biologia Humana Profa. Me. Vivian C. Langiano Ácidos nucleicos (DNA e RNA) e os genes De Robertis, E. Bases da Biologia Celular e Molecular. Rio de Janeiro, Guanabara Koogan, 4 ed. 2006. cap

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS

ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS Faculdade Ciência da Vida Disciplina: Genética Básica Aula 2 ESTRUTURA E FUNÇÃO DOS GENES E CROMOSSOMOS PROFESSORA: Fernanda Guimarães E-MAIL: guimaraes.biologia@gmail.com NÚCLEO Abriga do material genético

Leia mais

Núcleo celular. Responsável pela transmissão da hereditariedade e centro de comando das atividades celulares. Carioteca

Núcleo celular. Responsável pela transmissão da hereditariedade e centro de comando das atividades celulares. Carioteca Núcleo celular Responsável pela transmissão da hereditariedade e centro de comando das atividades celulares Carioteca Dupla camada de lipídios, contendo poros (passagem de grandes moléculas) Cariolinfa

Leia mais

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA) Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função

Leia mais

Genética de microrganismos. Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis

Genética de microrganismos. Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis Genética de microrganismos Disciplina: Princípios de Microbiologia Professor: José Belasque Junior Monitora: Gislâine Vicente dos Reis Piracicaba, outubro 2014 Histórico 1868- Primeiro a estudar o núcleo

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA Terceirão Biologia 1 Professor João CÓDIGO GENÉTICO E SÍNTESE PROTEICA Dogma central da Biologia Descreve o fluxo unidirecional de informações, do DNA à síntese de proteínas. Duplicação/Replicação Síntese

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

BIOLOGIA. Moléculas, células e tecidos. Transcrição e tradução Parte 1. Professor: Alex Santos

BIOLOGIA. Moléculas, células e tecidos. Transcrição e tradução Parte 1. Professor: Alex Santos BIOLOGIA Moléculas, células e tecidos Professor: Alex Santos Tópicos em abordagem : Parte 1 - Dogma central da biologia I Estrutura e funções dos ácidos nucleicos; II Replicação do DNA; II Transcrição;

Leia mais

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA.

ÁCIDOS NUCLÉICOS 15/6/2010. Universidade Federal de Mato Grosso Disciplina de Bioquímica. - Desoxirribose, presente no DNA; - Ribose, presente no RNA. Universidade Federal de Mato Grosso Disciplina de Bioquímica ÁCIDOS NUCLÉICOS Prof. Msc. Reginaldo Vicente Ribeiro Cuiabá Maio de 2010 São as biomoléculas com a função de armazenamento e expressão da informação

Leia mais

Genética Molecular Prof. Fernando Belan - BIOLOGIAMAIS

Genética Molecular Prof. Fernando Belan - BIOLOGIAMAIS Genética Molecular Prof. Fernando Belan - BIOLOGIAMAIS DNA O DNA é formado por 3 elementos básicos. Fosfato, Pentose (desoxirribose) e uma base nitrogenada. Essa unidade é chamada de nucleotídeo. As bases

Leia mais

- Ácidos Nucleicos e Síntese Proteica - Profª Samara

- Ácidos Nucleicos e Síntese Proteica - Profª Samara - Ácidos Nucleicos e Síntese Proteica - Profª Samara A verdade por trás da descoberta da estrutura do DNA Rosalind Franklin Mãe do DNA (1920-1958) Erwin Chargaff (1905-2002) FOTO 51 1953 James Watson e

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Estrutura do DNA. Macromoléculas Ácidos Nucleicos (DNA e RNA) Estrutura dos ácidos nucleicos. Estrutura dos ácidos nucleicos 09/03/2017

Estrutura do DNA. Macromoléculas Ácidos Nucleicos (DNA e RNA) Estrutura dos ácidos nucleicos. Estrutura dos ácidos nucleicos 09/03/2017 Macromoléculas Ácidos Nucleicos (DNA e RNA) Estrutura do DNA James Watson e Francis Crick (1953) Esclareceram a estrutura do DNA: dupla hélice composta de 2 filamentos de nucleotídeosque se enrolam em

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

TRANSCRIÇÕES GÊNICAS. BIOLOGIA Keffn Arantes

TRANSCRIÇÕES GÊNICAS. BIOLOGIA Keffn Arantes TRANSCRIÇÕES GÊNICAS BIOLOGIA Keffn Arantes Tipos de RNA RNA mensageiro (RNAm) A formação do RNAm chama-se transcrição e é semelhante à replicação do DNA. Tipos de RNA RNA transportador (RNAt) Também chamado

Leia mais

Aulas Multimídias Santa Cecília. Profa. Renata Coelho

Aulas Multimídias Santa Cecília. Profa. Renata Coelho Aulas Multimídias Santa Cecília Profa. Renata Coelho Duplicação, transcrição e tradução DNA Modelo de Watson e Crick, proposto em 2 de abril de 1953: DNA é formado por 2 fitas (dupla hélice) Cada filamento

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

Profº André Montillo

Profº André Montillo Profº André Montillo www.montillo.com.br Definição: É um polímero, ou seja, uma longa cadeia de nucleotídeos. Estrutura Molecular dos Nucleotídeos: Os nucleotídeos são constituídos por 3 unidades: Bases

Leia mais

Biologia 1E. Aula 02 e 03 Autoduplicação do DNA Transcrição e Tradução

Biologia 1E. Aula 02 e 03 Autoduplicação do DNA Transcrição e Tradução Biologia 1E Aula 02 e 03 Autoduplicação do DNA Transcrição e Tradução Divisão Celular Divisão das Células Para que? 1.Formar novos seres unicelulares. 2.Crescimento nos seres Pluricelulares. 3.Reposição

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Biologia Celular e Molecular:

Biologia Celular e Molecular: Disciplina: Biologia Celular e Molecular: Estrutura e Fisiologia da Célula Os Ácidos Nucleicos Os ácidos nucleicos são as maiores moléculas encontradas no mundo vivo e responsáveis pelo controle dos processos

Leia mais

Bio. Semana 16. Rubens Oda Alexandre Bandeira (Julio Souza Junior)

Bio. Semana 16. Rubens Oda Alexandre Bandeira (Julio Souza Junior) Semana 16 Rubens Oda Alexandre Bandeira (Julio Souza Junior) Este conteúdo pertence ao Descomplica. Está vedada a cópia ou a reprodução não autorizada previamente e por escrito. Todos os direitos reservados.

Leia mais

DNA - ATGCCGAAATTTGCG. O segmento de RNAm formado na transcrição terá a sequência de bases: RNA - UACGGCUUUAAACGC

DNA - ATGCCGAAATTTGCG. O segmento de RNAm formado na transcrição terá a sequência de bases: RNA - UACGGCUUUAAACGC Transcrição da informação genética A síntese de RNA (mensageiro, por exemplo) se inicia com a separação das duas fitas de DNA. Apenas uma das fitas do DNA serve de molde para a produção da molécula de

Leia mais

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes

Disciplina : Biologia Molecular: conceitos e Técnicas. Professora. Dra. Andrea Soares da Costa Fuentes Disciplina : Biologia Molecular: conceitos e Técnicas Professora. Dra. Andrea Soares da Costa Fuentes Revisão Geral Sumário História da Genética Molecular DNA e RNA Dogma Central Replicação Transcrição

Leia mais

GENÉTICA: DE MENDEL AO DNA. Como os genes influenciam as características?

GENÉTICA: DE MENDEL AO DNA. Como os genes influenciam as características? GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

M Ó D U L O S C O N T E M P L A D O S

M Ó D U L O S C O N T E M P L A D O S M Ó D U L O S C O N T E M P L A D O S IBML - Introdução à Biologia Molecular RETT - Replicação, Transcrição e Tradução SNPR - Síntese de Proteínas EXBL - Exercícios de Biologia Molecular C U R S O D I

Leia mais

BIOLOGIA EXERCÍCIOS. Anabolismo Nuclear

BIOLOGIA EXERCÍCIOS. Anabolismo Nuclear Anabolismo Nuclear EXERCÍCIOS 1. mesmo responsável pela decodificação do genoma humano em 2001, o presidente dos EUA, Barack Obama, pediu a seus conselheiros especializados em biotecnologia para analisarem

Leia mais

Com base nos conhecimentos sobre ácidos nucleicos e genética, pode-se afirmar:

Com base nos conhecimentos sobre ácidos nucleicos e genética, pode-se afirmar: LISTA DE EXERCÍCIOS DE RECUPERAÇÃO 01 - (Escola Bahiana de Medicina e Saúde Pública) O DNA é o material genético dos seres vivos. A molécula é uma dupla hélice formada pela união de nucleotídeos e sua

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

DNA e RNA Replicação do DNA

DNA e RNA Replicação do DNA DNA e RNA Replicação do DNA 1953 1952 1952 1944 1928 1869 À descoberta do Material Genético Watson e Crick Modelo do DNA dupla hélice Hershey-Chase experiências com bacteriófagos confirmam o DNA como suporte

Leia mais

LISTA DE RECUPERAÇÃO I ÁCIDOS NUCLEICOS

LISTA DE RECUPERAÇÃO I ÁCIDOS NUCLEICOS LISTA DE RECUPERAÇÃO I ÁCIDOS NUCLEICOS 1) (OSEC-SP) - Quanto à sua estrutura química, o DNA e o RNA são A) polipeptídeos. B) nucleoproteínas. C) polissacarídeos. D) fosfatídeos. E) polinucleotídeos. 2)

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

BIOLOGIA MOLECULAR. João Carlos Bespalhok Filho Professor Associado DFF/UFPR

BIOLOGIA MOLECULAR. João Carlos Bespalhok Filho Professor Associado DFF/UFPR BIOLOGIA MOLECULAR João Carlos Bespalhok Filho Professor Associado DFF/UFPR Definição Biologia Molecular é o campo da biologia que estuda a composição, estrutura e interações de moléculas celulares -tais

Leia mais

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL

Estrutura do DNA HISTÓRICO HISTÓRICO ÁCIDOS NUCLÉICOS JAMES WATSON e FRANCIS CRICK. 1953: Watson and Crick GREGOR MENDEL ISTÓI Estrutura do DA 1953: Watson and rick 1865 - GEG MEDEL Estudou cruzamento entre diferentes tipos de ervilhas demonstrando que certas características físicas dessas plantas eram transmitidas de geração

Leia mais

Qual o nome das bases pirimídicas?. R: Timina e Citosina. Quais os constituintes dos nucleótidos?

Qual o nome das bases pirimídicas?. R: Timina e Citosina. Quais os constituintes dos nucleótidos? O que significam as siglas? R: Ácido desoxirribonucleico. A molécula de tem mensagens codificadas em sequências de que contêm bases púricas e pirimídicas. R: nucleótidos Qual o nome das bases pirimídicas?.

Leia mais

Ácidos Nucleicos e suas propriedades

Ácidos Nucleicos e suas propriedades UNIVERSIDADE FEDERAL DO PARANÁ SETOR DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE FITOTECNIA E FITOSSANITARISMO AF 060- Biotecnologia Vegetal Ácidos Nucleicos e suas propriedades Professores: Bruno Portela Brasileiro

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA Terceirão Biologia 1 Professor João CÓDIGO GENÉTICO E SÍNTESE PROTEICA 1. Síntese de proteínas pelos ribossomos a partir do RNAm. a) RNAm: molécula de RNA que contem a informação genética necessária para

Leia mais

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES

ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES DNA ÁCIDOS NUCLÉICOS ESTRUTURA E FUNÇÕES Prof. Edimar Campos Antes de 1950 sabia-se apenas que qualquer que fosse a natureza do material genético, ele deveria possuir 3 características importantes: O MATERIAL

Leia mais

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo

Genética Molecular. Tema 1: Genética Molecular. Prof. Leandro Parussolo Instituto Federal de Santa Catarina Câmpus Florianópolis Unidade Curricular: Biologia I Tema 1: Genética Molecular Genética Molecular Prof. Leandro Parussolo leandro.parussolo@ifsc.edu.br Genética Estuda

Leia mais

RNA e DNA Parte II. Profª Renata 9º ano / 2018

RNA e DNA Parte II. Profª Renata 9º ano / 2018 RNA e DNA Parte II Profª Renata 9º ano / 2018 continuação TRANSCRIÇÃO E TRADUÇÃO RNA (ácido ribonucleico) Todas as moléculas de RNA são cópias de algum segmento de DNA, ou seja, de um gene; TRANSCRIÇÃO

Leia mais

Unidade 5 Crescimento e Renovação Celular

Unidade 5 Crescimento e Renovação Celular Unidade 5 Crescimento e Renovação Celular 5.1 Crescimento e Renovação Celular Aula nº2-17/set/08 Prof. Ana Reis ( ) uma dupla totalmente ignorante da química dos nucleótidos, desejosa de encaixar o DNA

Leia mais

Introdução à Bioquímica

Introdução à Bioquímica Introdução à Bioquímica Nucleotídeos e Ácidos Nucléicos Dra. Fernanda Canduri Laboratório de Sistemas BioMoleculares. Departamento de Física.. UNESP São José do Rio Preto - SP. Tópicos! Estrutura e função

Leia mais

IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down)

IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down) Aplicações: IMPORTÂNCIA DA GENÉTICA PARA ÁREA DA SAÚDE: Diagnóstico clínico: alteração no número ou estrutura dos cromossomos (síndrome de Down) Mapeamento genético e identificação: mapeamento de genes

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

Síntese de Proteínas. Professora: Luciana Ramalho 2017

Síntese de Proteínas. Professora: Luciana Ramalho 2017 Síntese de Proteínas Professora: Luciana Ramalho 2017 Introdução O que torna Você diferente do seu amigo? Ou de um fungo? R: É o DNA! Como o DNA influencia nas suas características? R: Ele codifica as

Leia mais

Decifrando o código genético: importância para o processo de tradução

Decifrando o código genético: importância para o processo de tradução Decifrando o código genético: importância para o processo de tradução Bioquímica II Prof. Dr. Júlio Borges Ana Carolina Donatelli Juliana Burato Lucas Mario Detille Thaís Souza Sumário 1. Introdução: 1.1.

Leia mais

GABARITO - TRANSCRIÇÃO E TRADUÇÃO

GABARITO - TRANSCRIÇÃO E TRADUÇÃO GABARITO - TRANSCRIÇÃO E TRADUÇÃO 9º ANO BIOLOGIA LUCIANA 3º BIM Lista de exercícios de vestibular PARA TREINAR ALGUNS CONCEITOS IMPORTANTES COPIE NO SEU CADERNO AS QUESTÕES: 1, 3, 4 E 13. 1.(UFERSA) Considere

Leia mais

BIOLOGIA. Biologia Molecular (segunda parte) Professora: Brenda Braga

BIOLOGIA. Biologia Molecular (segunda parte) Professora: Brenda Braga BIOLOGIA Biologia Molecular (segunda parte) Professora: Brenda Braga Ácidos Nuclêicos DNA RNA Ácido Desoxirribonuclêico Ácido Ribonuclêico Cadeias de Nucleotídeos Fosfato Pentose Base Nitrogenada A ligação

Leia mais

Ácidos Nucleicos: Nucleotídeos, DNA e RNA. Bianca Lobão - nº USP: Caio Lourenço - nº USP: Giulia Santos - nº USP:

Ácidos Nucleicos: Nucleotídeos, DNA e RNA. Bianca Lobão - nº USP: Caio Lourenço - nº USP: Giulia Santos - nº USP: Ácidos Nucleicos: Nucleotídeos, DNA e RNA Bianca Lobão - nº USP: 9370841 Caio Lourenço - nº USP: Giulia Santos - nº USP: 9370726 Nucleotídeos Compõem a estrutura das moléculas de DNA e RNA; São compostos

Leia mais

BIOLOGIA. Moléculas, células e tecidos. A química da vida Parte 6. Professor: Alex Santos

BIOLOGIA. Moléculas, células e tecidos. A química da vida Parte 6. Professor: Alex Santos BIOLOGIA Moléculas, células e tecidos A química da vida Parte 6 Professor: Alex Santos Tópicos em abordagem I Vitaminas: II Ácidos nucléicos: I Vitaminas: 1.1 Conceitos fundamentais: São compostos orgânicos

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

ÁCIDOS NUCLEICOS.

ÁCIDOS NUCLEICOS. ÁCIDOS NUCLEICOS ÁCIDOS NUCLEICOS ÁCIDOS NUCLEICOS, DNA e RNA, são moléculas que contêm as instruções de como fazer o organismo. Elas são formadas de nucleotídeos, que são uma base nitrogenada, um fosfato

Leia mais

CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA COMPOSIÇÃO MOLECULAR DAS CÉLULAS COMPOSIÇÃO QUÍMICA DAS CÉLULAS COMPOSIÇÃO MOLECULAR DAS CÉLULAS

CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA COMPOSIÇÃO MOLECULAR DAS CÉLULAS COMPOSIÇÃO QUÍMICA DAS CÉLULAS COMPOSIÇÃO MOLECULAR DAS CÉLULAS 2/14/2017 FACULDADE EDUCACIONAL DE MEDIANEIRA CÉLULAS Células são estruturas complexas e diversas; São capazes de autoreplicação; Realizam uma ampla variedade de papeis especializados em organismos multicelulares:

Leia mais

Ribose. Púricas (dois anéis): Adenina e Guanina. Bases nitrogenadas Pirimídicas (um anel): Timina, Citosina e Uracila

Ribose. Púricas (dois anéis): Adenina e Guanina. Bases nitrogenadas Pirimídicas (um anel): Timina, Citosina e Uracila DNA RNA 17/04/2017 Genes (ou Gen) é uma parte do DNA capaz de sintetizar uma proteína específica. O DNA (Ácido Desoxiribonucleico) é formado pela união de nucleotídeos. Fosfato Ribose Glicídio do grupo

Leia mais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais Substâncias Orgânicas - Formadas por átomos de carbono e hidrogênio Inorgânicas - Água e sais minerais - Carboidratos, lipídios, proteínas, ácidos nucleicos e vitaminas QUÍMICA CELULAR Água Funções: Solvente

Leia mais

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto

Nutrição. Prof. João Ronaldo Tavares de Vasconcellos Neto Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUN/2011 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena a síntese

Leia mais

PROVA DE BIOLOGIA DIA 12/09 QUARTA-FEIRA

PROVA DE BIOLOGIA DIA 12/09 QUARTA-FEIRA PROVA DE BIOLOGIA DIA 12/09 QUARTA-FEIRA CAPÍTULOS: 9, 10 e 11 (até p. 139) CONTEÚDOS: - Fotossíntese - Núcleo, Ácidos nucleicos e Clonagem - Cromatina e Cromossomos COLÉGIO ESTADUAL HELENA KOLODY E.M.P.

Leia mais

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA

ATIVIDADES. BC.06: Ácidos nucléicos e ação gênica BIOLOGIA ATIVIDADES 1. DNA e RNA são encontrados em quantidades apreciáveis, respectivamente: a) no núcleo; no citoplasma. b) no núcleo; no núcleo e no citoplasma. c) no núcleo; no núcleo. d) no núcleo e no citoplasma;

Leia mais

Sociedade, Tecnologia e Ciência. DR1 - O Elemento, Graça Mendonça. Núcleo Gerador 7 DNA

Sociedade, Tecnologia e Ciência. DR1 - O Elemento, Graça Mendonça. Núcleo Gerador 7 DNA DNA Trabalho realizado por: Rafael Lourenço Fábio Rodrigues Miguel Almeida Rodrigo Sambento 1 á g i n a Índice INTRODUÇÃO... 3 DNA... 4 Organização do DNA na célula... 4 Elementos básicos dos ácidos nucleicos...

Leia mais

Prof. Marcelo Langer. Curso de Biologia. Aula 16 Genética

Prof. Marcelo Langer. Curso de Biologia. Aula 16 Genética Prof. Marcelo Langer Curso de Biologia Aula 16 Genética FUNCIONAMENTO DO GENE Um gene não funciona em todas as células, mas somente em um tipo de célula, onde tem relação à sua função. Isso ocorre devido

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução

Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução Disciplina: Biologia Profa: Laure Turma: TR / / Tema da aula/lista de exercício: Aula 7 Replicação/Transcrição/Tradução 1. (Unicamp) Em um experimento, um segmento de DNA que contém a região codificadora

Leia mais

Ácidos Nucleicos e suas propriedades

Ácidos Nucleicos e suas propriedades UNIVERSIDADE FEDERAL DO PARANÁ SETOR DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE FITOTECNIA E FITOSSANITARISMO AF 060- Biotecnologia Vegetal Ácidos Nucleicos e suas propriedades Prof a. Renata FaierCalegario

Leia mais

Biologia Molecular. (Síntese Proteica e Replicação do DNA) a) molécula de RNAr. b) moléculas de RNAt. c) bases nitrogenadas. d) molécula de RNAm.

Biologia Molecular. (Síntese Proteica e Replicação do DNA) a) molécula de RNAr. b) moléculas de RNAt. c) bases nitrogenadas. d) molécula de RNAm. a) molécula de RNAr. b) moléculas de RNAt. c) bases nitrogenadas. d) molécula de RNAm. 4) (UFJF 2016) O anticódon é uma região específica de nucleotídeos encontrada: Professora: Camila Cruz Sábado, 14

Leia mais

3. (Unesp 2010) Observe a tirinha, que alude à gripe Influenza A (H1N1).

3. (Unesp 2010) Observe a tirinha, que alude à gripe Influenza A (H1N1). ÁCIDOS NUCLÉIOCOS E SÍNTESE DE PROTEÍNAS PRÉ-VESTIBULAR GEOGRAFIA PROF. MARCONI 1. (Ufal 2006)Como as células vivas não conseguem distinguir os elementos radioativos dos não radioativos, elas incorporam

Leia mais

A Estrutura do DNA e o sistema de Dupla Hélice.

A Estrutura do DNA e o sistema de Dupla Hélice. A Estrutura do DNA e o sistema de Dupla Hélice. A manipulação do DNA e de seus genes é uma revolução científica que permitiu a descoberta da ação de várias doenças e a produção de medicamentos específicos.

Leia mais

3 Nucleotídeos e Ácidos Nucléicos

3 Nucleotídeos e Ácidos Nucléicos 1 3 Nucleotídeos e Ácidos Nucléicos - São compostos ricos em energia - Funcionam como sinais químicos - São reservatórios moleculares da informação genética a) Nucleotídeos - São encontrados polimerizados

Leia mais

DNA. Dados relevantes para a compreensão da sua estrutura.

DNA. Dados relevantes para a compreensão da sua estrutura. DN Dados relevantes para a compreensão da sua estrutura. DN: dados relevantes para a compreensão da sua estrutura. Em 1950, Erwin hargaff, ao estudar amostras de DN de diversas espécies, constatou que

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação.

DNA RNA Proteínas. Organização estrutural e funcional do núcleo 04/04/2017. Processamento (Splicing) Tradução (citoplasma) Replicação. Organização estrutural e funcional do núcleo DNA RNA Proteínas Replicação Transcrição Processamento (Splicing) Tradução (citoplasma) Cromatina - Eucromatina - Heterocromatina Cromossomo - Mitose 1 DNA

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

ÁCIDOS NUCLEICOS. Existem dois tipos de ácidos nucleicos: - Ácido desoxirribonucleico (DNA) - Ácido ribonucleico (RNA)

ÁCIDOS NUCLEICOS. Existem dois tipos de ácidos nucleicos: - Ácido desoxirribonucleico (DNA) - Ácido ribonucleico (RNA) ÁCIDOS NUCLEICOS ÁCIDOS NUCLEICOS Em 1868, F. Miesher, num importante trabalho de citoquímica, isolou e analisou o núcleo das células. As substâncias constituintes do núcleo foram designadas nucleínas.

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

EXERCÍCIOS DE VESTIBULAR

EXERCÍCIOS DE VESTIBULAR EXERCÍCIOS DE VESTIBULAR PRÉ-VESTIBULAR BIOLOGIA PROF. MARCONI 1º Bimestre 01. (Ufal 2006) Como as células vivas não conseguem distinguir os elementos radioativos dos não radioativos, elas incorporam ambos

Leia mais

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera Lista de Exercícios Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Ciências da Natureza - Biologia Pré Universitário Uni-Anhanguera 1 1) (UFES-ES) O modelo abaixo representa a configuração

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

Estruturas Pedagógicas. Área disciplinar de Biologia e Geologia Ano letivo 2018/2019

Estruturas Pedagógicas. Área disciplinar de Biologia e Geologia Ano letivo 2018/2019 Estruturas Pedagógicas Direção-Geral dos Estabelecimentos Escolares Direção de Serviços da Região Centro Área disciplinar de Biologia e Geologia Ano letivo 2018/2019 QUESTÃO AULA DE BIOLOGIA E GEOLOGIA

Leia mais

Estruturas Pedagógicas. Área disciplinar de Biologia e Geologia Ano letivo 2018/2019

Estruturas Pedagógicas. Área disciplinar de Biologia e Geologia Ano letivo 2018/2019 Estruturas Pedagógicas Direção-Geral dos Estabelecimentos Escolares Direção de Serviços da Região Centro Área disciplinar de Biologia e Geologia Ano letivo 2018/2019 QUESTÃO AULA DE BIOLOGIA E GEOLOGIA

Leia mais

Plano de Aulas. Biologia. Módulo 22 Genética molecular e biotecnologia

Plano de Aulas. Biologia. Módulo 22 Genética molecular e biotecnologia Plano de Aulas Biologia Módulo 22 Genética molecular e biotecnologia Resolução dos exercícios propostos Retomada dos conceitos 10 CAPÍTULO 1 1 a As bases nitrogenadas são complementares por meio de pontes

Leia mais

CÓDIGO GENÉTICO Lista I 20 Questões Professor Charles Reis Curso Expoente

CÓDIGO GENÉTICO Lista I 20 Questões Professor Charles Reis Curso Expoente CÓDIGO GENÉTICO Lista I 20 Questões Professor Charles Reis Curso Expoente 01. (FUVEST) A seguir está representada a sequência dos 13 primeiros pares de nucleotídeos da região codificadora de um gene. A

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon.

21/08/2017 DOGMA DA BIOLOGIA MOLECULAR TRADUÇÃO TRADUÇÃO TRADUÇÃO FACULDADE EDUCACIONAL DE MEDIANEIRA. Profª. Dra. Patrícia Bellon. FACULDADE EDUCACIONAL DE MEDIANEIRA DOGMA DA BIOLOGIA MOLECULAR NÚCLEO Profª. Dra. Patrícia Bellon. CITOPLASMA Agosto/2017 O que é tradução? Processo pelo qual a informação genética transcrita em RNAm

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari

Do DNA à Proteína: Síntese proteica. Prof. Dr. Marcelo Ricardo Vicari Do DNA à Proteína: Síntese proteica Do DNA à proteína Resumo das etapas que vão do gene até a proteína Estrutura da proteína Fórmula geral dos aminoácidos Estrutura das proteínas Principais ligações Tradução

Leia mais

Resoluções das atividades

Resoluções das atividades Resoluções das atividades Aula 8 Ácidos nucleicos Atividades para sala 01 D 02 B No DNA, ocorrem duas fitas de polinucleotídios. As duas fitas são unidas por pontes de hidrogênio estabelecidas entre os

Leia mais

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira

Professoras responsáveis Profa. Dra. Maria Tercília. Vilela de Azeredo Oliveira Professoras responsáveis veis: : Profa. MSc.. Rosana Silistino de Souza Pós Graduanda: : Bruna Victorasso Jardim Profa. Dra. Maria Tercília Vilela de Azeredo Oliveira Nosso organismo é composto por células

Leia mais

A Estrutura dos Ácidos Nucléicos

A Estrutura dos Ácidos Nucléicos Universidade Federal de Pelotas CDTec - Graduação em Biotecnologia Disciplina de Biologia Molecular A Estrutura dos Ácidos Nucléicos Priscila M. M. de Leon Dra., Médica Veterinária Profa, PNDP Biotecnologia/UFPel

Leia mais