Ácidos nucleicos. Disponível em: < Acesso em: 21 fev

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Ácidos nucleicos. Disponível em: <http://carmelourso.files.wordpress.com/2011/08/3d-dna-cover.jpg>. Acesso em: 21 fev"

Transcrição

1 Ácidos nucleicos

2 Ácidos nucleicos Disponível em: < Acesso em: 21 fev

3 Núcleo celular Define as características morfofisiológicas da célula e controla sua divisão celular 1869: Johann Friedrich Miescher descobre os ácidos nucleicos 1893: Eduardo Balbiani realiza a merotomia, mostrando a importância do núcleo Século XX: estudos sobre os ácidos nucleicos Disponível em: < Acesso em: 21 fev

4 Ácidos nucleicos DNA ou ADN ou ácido desoxirribonucleico RNA ou ARN ou ácido ribonucleico Base nitrogenada + pentose = nucleosídeo Grupo fosfato Pentose Base nitrogenada Base nitrogenada + pentose + fosfato = nucleotídeo Disponível em: < Acesso em: 21 fev

5 Pentose Ribose Desoxirribose Disponível em: < Acesso em: 21 fev

6 Púricas Bases nitrogenadas Adenina Guanina Pirimídicas Citosina Disponível em: < Acesso em: 21 fev Timina Uracila

7 Dogma da vida duplicação transcrição tradução DNA RNA Proteína Disponível em: < Acesso em: 21 fev

8 DNA Localização: citoplasma das células procarióticas núcleo, mitocôndrias e cloroplastos das células eucarióticas Disponível em: < Acesso em: 21 fev

9 Pentose: desoxirribose DNA Bases nitrogenadas: A, T, C e G Estrutura: dois filamentos polinucleotídicos, dispostos em α- hélice (Watson e Crick, 1953). Ligação entre nucleotídeos: entre grupamento fosfato e pentose Ligação entre filamentos: pontes de hidrogênio Relação de Chargaff A T G C A T G C 1

10 Filamentos: complementares antiparalelos Disponível em: < Vi4v_8ecrI/DNA_chemical_structure.png>. Acesso em: 21 fev

11 Disponível em: < Acesso em: 21 fev Disponível em: < Acesso em: 21 fev

12 Duplicação do DNA Enzimas envolvidas DNA-helicase: desmonta a estrutura α - hélice DNA-polimerase: promove o pareamento dos novos nucleotídeos DNA-ligase: catalisa as ligações entre os novos nucleotídeos Acervo CNEC

13 Disponível em: Robert K. Murray, et al. Harper s Illustrated Biochemistry, Twenty-Sixth Edition.

14 Síntese: sempre no sentido 5 3 Disponível em: William K. Purves. Vida a Ciência da Biologia, Volume I Disponível em: < Acesso em: 21 fev

15 Propostas para a duplicação do DNA Semiconservativa Conservativa Dispersiva Disponível em: < Acesso em: 21 fev

16 Duplicação semiconservativa Comprovada por Matthew Meselson e Franklin Stahl (1958) Disponível em: < Acesso em: 21 fev

17 Localização: Citoplasma das células procarióticas Núcleo, citoplasma, mitocôndrias e cloroplastos das células eucarióticas Pentose: ribose RNA Bases nitrogenadas: A, U, C e G Estrutura: um filamento polinucleotídico

18 Transcrição do DNA RNA-polimerase: promove o pareamento dos novos nucleotídeos Transcrito a partir do filamento ativo do DNA Acervo CNEC

19 Tipos de RNA RNA mensageiro (RNAm) RNA transportador (RNAt) RNA ribossômico (RNAr) Disponível em: < Acesso em: 21 fev

20 Tipos de RNA Disponível em: < Acesso em: 21 fev

21 Síntese proteica Disponível em: < Acesso em: 21 fev

22 Disponível em: < Acesso em: 21 fev

23 Códon de iniciação AUG metionina Códons de terminação UAA, UAG, UGA Disponível em: < Acesso em: 21 fev

24 Polissomos ou polirribossomos Disponível em: < Acesso em: 21 fev

25 Código genético 1 códon 1 aminoácido A C A C A C U G U G U G 4 x 4 x 4 = 64 códons 20 aminoácidos

26 Disponível em: < Acesso em: 21 fev

27 Mutações CUA Leucina CUU Mutação na 3ª base nitrogenada CUG Leucina Leucina CUC Leucina

28 Mutações CAU Histidina CUU Mutação na 2ª base nitrogenada CGU Arginina Leucina CCU Prolina

29 Aplicação em exercícios DNA molde RNA Proteína GCAATACCTATTAGTAGGAAATATTCTA CGUUAUGGAUAAUCAUCCUUUAUAAGAU Metionina ácido aspártico asparagina histidina prolina leucina DNA molde RNA Proteína GCAATACCTATTAGTCGGCAATATTCTA CGUUAUGGAUAAUCAGCCGUUAUAAGAU Metionina ácido aspártico asparagina glutamina prolina leucina

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

OS ÁCIDOS NUCLÉICOS DNA / RNA

OS ÁCIDOS NUCLÉICOS DNA / RNA OS ÁCIDOS NUCLÉICOS DNA / RNA Prof. André Maia Considerações do Professor Os ácidos nucléicos são as maiores moléculas encontradas no mundo vivo. São responsáveis pelo controle dos processos vitais básicos

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Biologia Moléculas, células e tecidos - Código Genético O núcleo é de fundamental importância para grande parte

Leia mais

48 Como produzimos a insulina?

48 Como produzimos a insulina? A U A UL LA Como produzimos a insulina? Na aula passada você estudou a importância da insulina no nosso organismo. Dá para imaginar o que aconteceria conosco se não fabricássemos esse hormônio ou se o

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS CÓDIGO GENÉTICO UFRGS CÓDIGO GENÉTICO 1. (Ufrgs 2013) Sabe-se que a replicação do DNA é semiconservativa. Com base nesse mecanismo de replicação, assinale com V (verdadeiro) ou F (falso) as afirmações abaixo. ( ) O DNA

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

DNA, RNA E INFORMAÇÃO

DNA, RNA E INFORMAÇÃO DNA, RNA E INFORMAÇÃO OS ÁCIDOS NUCLEICOS Embora descobertos em 1869, por Miescher, no pus das bandagens de ferimentos, o papel dos ácidos nucleicos na hereditariedade e no controle da atividade celular

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por

Os conceitos I, II, III e IV podem ser substituídos, correta e respectivamente, por 01 - (FATEC SP) Mapas conceituais são diagramas que organizam informações sobre um determinado assunto por meio da interligação de conceitos através de frases de ligação. Os conceitos geralmente são destacados

Leia mais

Resumo de Biologia. No caso das células procarióticas o material genético encontra-se espalhado no citoplasma da célula, denominando-se nucleóide.

Resumo de Biologia. No caso das células procarióticas o material genético encontra-se espalhado no citoplasma da célula, denominando-se nucleóide. Resumo de Biologia Crescimento e renovação celular As células são unidades estruturais e funcionais dos organismos. Utilizando o seu programa genético, produzem moléculas específicos que permitem o crescimento

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Introdução à Biologia Celular e Molecular

Introdução à Biologia Celular e Molecular Introdução à Biologia Celular e Molecular Este texto foi retirado do anexo de [Lem00], revisado por [Bas00], e tem como objetivo principal apresentar alguns conceitos básicos de biologia celular e molecular.

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS Unidade básica dos Ácidos Nucleicos Existem apenas 4 bases em cada um dos ácidos nucleicos DNA DNA e RNA RNA Ácido fosfórico Ácido fosfórico Pentose Desoxirribose

Leia mais

São moléculas orgânicas, constituídas por unidades básicas

São moléculas orgânicas, constituídas por unidades básicas ompostos rgânicos: Ácidos ucléicos São moléculas orgânicas, constituídas por unidades básicas chamadas nucleotídeos. s ácidos nucléicos na verdade são polinucleotídeos. onstituição de um nucleotídeo ácido

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO Os genes são formados por DNA; Transmissão das características hereditárias DNA + RNA controle da produção de proteínas da célula; 2 1.A estrutura dos ácidos nucléicos

Leia mais

Geralmente é arredondado e único por célula, mas existem núcleos com outras formas e células com mais de um núcleo

Geralmente é arredondado e único por célula, mas existem núcleos com outras formas e células com mais de um núcleo Núcleo Celular Geralmente é arredondado e único por célula, mas existem núcleos com outras formas e células com mais de um núcleo Núcleo Celular Algumas células não têm núcleo (são anucleadas), como as

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II

COLÉGIO PEDRO II CAMPUS TIJUCA II COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007

EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 EXERCÍCIOS DE BIOLOGIA A PROF. MARCELO HÜBNER 01/08/2007 1. (Unicamp 2005) Em 25 de abril de 1953, um estudo de uma única página na revista inglesa Nature intitulado "A estrutura molecular dos ácidos nucléicos",

Leia mais

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano:

1ª eliminatória 2013. Ex.: A B C D E 1/6. Questões sobre matéria de 10º ano: 1ª eliminatória 2013 Este teste é constituído por 30 questões que abordam diversas temáticas da Biologia. Lê as questões atentamente e seleciona a opção correta unicamente na Folha de Respostas, marcando-a

Leia mais

4GENÉTICA MOLECULAR MIRNA DUARTE BARROS

4GENÉTICA MOLECULAR MIRNA DUARTE BARROS 4GENÉTICA MOLECULAR MIRNA DUARTE BARROS 190 Capítulo 4 191 GENÉTICA MOLECULAR MIRNA DUARTE BARROS INTRODUÇÃO O dogma central da Genética Molecular define um paradigma que envolve polímeros de nucleotídeos,

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Homem Vitruviano e DNA

Homem Vitruviano e DNA TÍTULO DO PROGRAMA Homem Vitruviano e DNA Série: A Beleza dos Diagramas SINOPSE DO PROGRAMA O documentário conta a história de dois diagramas que conseguiram a difícil tarefa de representar os seres humanos

Leia mais

Netxplica http://netxplica.com

Netxplica http://netxplica.com Teste de Avaliação de Biologia e Geologia 11.º Ano de Escolaridade Crescimento e Renovação Celular Duração do Teste: 90 minutos VERSÃO 1 Na folha de respostas, indica de forma legível a versão do Teste.

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Bases nitrogenadas púricas (A e G) e pirimídicas (T, C e U) Molécula de DNA (forma espacial)

Bases nitrogenadas púricas (A e G) e pirimídicas (T, C e U) Molécula de DNA (forma espacial) São moléculas formadas por unidades complexas chamadas nucleotídeos. Cada nucleotídeo é um grupamento molecular formado por três subunidades: uma base nitrogenada, uma pentose e um grupamento fosfato.

Leia mais

Biologia Professor Vianna 1ª série / 1º trimestre

Biologia Professor Vianna 1ª série / 1º trimestre Biologia Professor Vianna 1ª série / 1º trimestre Módulo 3 ÁCIDOS NUCLEICOS E CITOLOGIA 1 Os itens abaixo referem-se à estrutura, composição e função dos ácidos nucleicos. Estrutura: I) Dupla hélice; II)

Leia mais

Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS. Paulo Dutra

Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS. Paulo Dutra Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS Paulo Dutra ÁCIDOS NUCLEICOS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose

Leia mais

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira

Faculdade de Tecnologia de Araçatuba. Curso Superior de Tecnologia em Bioenergia Sucroalcooleira Faculdade de Tecnologia de Araçatuba Curso Superior de Tecnologia em Bioenergia Sucroalcooleira 1 ÁCIDOS NUCLÉICOS Estrutura e funções 2 Ácidos nucléicos são polímeros de nucleotídeos adenina citosina

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

Biologia e Geologia. Resumo da primeira parte da Matéria de Biologia 11º Ano O Essencial sobre o Crescimento e Renovação Celular.

Biologia e Geologia. Resumo da primeira parte da Matéria de Biologia 11º Ano O Essencial sobre o Crescimento e Renovação Celular. Biologia e Geologia (Ano II) Resumo da primeira parte da Matéria de Biologia 11º Ano O Essencial sobre o Crescimento e Renovação Celular Autor: Objectivo: Conhecer as características estruturais do DNA

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

23/03/2015. Moléculas orgânicas - Carboidratos

23/03/2015. Moléculas orgânicas - Carboidratos Moléculas orgânicas - Carboidratos São formados por C, H, O. São Conhecidos como: Hidratos de Carbono Glucídios Glicídios Açúcares Sacarídeos Funções: Energética (glicose); Glicogênio : reserva energética

Leia mais

Conceitos Básicos de Biologia Molecular

Conceitos Básicos de Biologia Molecular Conceitos Básicos de Biologia Molecular Marcílio C. P. de Souto DIMAp/UFRN Tópicos Introdução Célula e macro-moléculas Proteínas e Ácidos nucléicos Ácidos Nucléicos Componentes DNA x RNA Estabilidade do

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

Núcleo e Divisões Celulares

Núcleo e Divisões Celulares UNIDADE 2 ORIGEM DA VIDA E BIOLOGIA CELULAR CAPÍTULO 10 Aula 1 Núcleo: estrutura e composição Cromossomos, genes e DNA 1. NÚCLEO: NÚMERO E FORMA Células eucarióticas Cromossomos DNA + proteínas (histonas)

Leia mais

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE DEFINIÇÃO Palavra de origem grega gennos (fazer nascer- geração). Estudo dos mecanismos de transmissão de características de uma espécie,

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

James Watson, Francis Crick e o DNA

James Watson, Francis Crick e o DNA Pércio Augusto Mardini Farias Este documento tem nível de compartilhamento de acordo com a licença 2.5 do Creative Commons. http://creativecommons.org.br http://creativecommons.org/licenses/by/2.5/br/

Leia mais

MODELOS DIDÁTICOS DE DNA, RNA, RIBOSSOMOS E PROCESSOS MOLECULARES PARA O ENSINO DE GENÉTICA DO ENSINO MÉDIO

MODELOS DIDÁTICOS DE DNA, RNA, RIBOSSOMOS E PROCESSOS MOLECULARES PARA O ENSINO DE GENÉTICA DO ENSINO MÉDIO MODELOS DIDÁTICOS DE DNA, RNA, RIBOSSOMOS E PROCESSOS MOLECULARES PARA O ENSINO DE GENÉTICA DO ENSINO MÉDIO Álvaro Julio Pereira, Giselly da Silva Patricio, Francisco Germano Sousa Alves, Juliana Jessica

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica INBEQMeDI Instituto Nacional de Biotecnologia Estrutural e Química Medicinal em Doenças Infecciosas Coordenadoria de Educação e Difusão de Ciências Telefone: (16) 3373-9159 Rua 9 de julho, 1205 - Centro

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Lista de exercícios: Carboidratos, Proteína e Ácidos Nucleicos 1ºano/ Prof. Karina-BIO/ CFNP

Lista de exercícios: Carboidratos, Proteína e Ácidos Nucleicos 1ºano/ Prof. Karina-BIO/ CFNP 1. (Fuvest 2014) Observe a figura abaixo, que representa o emparelhamento de duas bases nitrogenadas. 3. (Unesp 2013) Em 2012, assim como em anos anteriores, o Ministério da Saúde promoveu a campanha para

Leia mais

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

ÁREA DE CIÊNCIAS DA NATUREZA / BIOLOGIA

ÁREA DE CIÊNCIAS DA NATUREZA / BIOLOGIA INTRODUÇÃO O Ácido Nucleico é um polímero celular em que as unidades básicas que o constituem são nucleótidos. Contêm uma base azotada, um açúcar e um ácido fosfórico sob a forma de éster. A sua descoberta

Leia mais

Biologia - Grupos A - B - Gabarito

Biologia - Grupos A - B - Gabarito 1 a QUESTÃO: (1, ponto) Avaliador Revisor Foram coletados 1. exemplares do mosquito Anopheles culifacies, de ambos os sexos, em cada uma de duas regiões denominadas A e B, bastante afastadas entre si.

Leia mais

CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA. Unidade 1 Genética Molecular

CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA. Unidade 1 Genética Molecular CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA 1. Introdução Unidade 1 Ao se analisar um indivíduo, seja uma planta, seja um animal, o que se vê é o

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI

INFORMAÇÃO, VIDA E DNA. Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI INFORMAÇÃO, VIDA E DNA Prof. João Henrique Kleinschmidt Material elaborado pelos professores de NI DEFINIÇÃO DE VIDA O que é a vida para você? DEFINIÇÃO DE VIDA Em 1943 Erwin Schroedinger (um dos pais

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Sabendo-se que: - a afidicolina inibe a enzima DNA polimerase. - a colchicina inibe a polimerização das subunidades que formam os microtubulos.

Sabendo-se que: - a afidicolina inibe a enzima DNA polimerase. - a colchicina inibe a polimerização das subunidades que formam os microtubulos. SECRETARIA DE SEGURANÇA PÚBLICA/SECRETARIA DE EDUCAÇÃO POLÍCIA MILITAR DO ESTADO DE GOIÁS COMANDO DE ENSINO POLICIAL MILITAR COLÉGIO DA POLÍCIA MILITAR SARGENTO NADER ALVES DOS SANTOS SÉRIE/ANO: 9º Ano

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais