ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs"

Transcrição

1 ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005

2 MINI-CURSO - AGENDA 1. Primeiro Dia (10/05) 1. Genética Clássica e Genômica 2. Seqüenciamento de Genomas 2. Segundo Dia (11/05) 1. Análise de Genomas 2. Marcadores Moleculares 3. Terceiro Dia (12/05) 1. QTLs 2. Mapas Genéticos 3. Mapeamento de QTLs

3 GENÉTICA CLÁSSICA 1. Grande impulso no século XX 2. Poderoso instrumental estatístico 3. Aplicações ao melhoramento de plantas: 1. Planejamento de cruzamentos 2. Seleção de indivíduos superiores

4 GENÔMICA 1. Seqüenciamento de DNA 2. Marcadores Moleculares 3. Em adição ao seqüenciamento, precisamos: 1. Posições e estrutura dos genes 2. Influências dos Genes em Vias Metabólicas e Processos Celulares 3. Variações individuais: alelos, polimorfismos 4. Influência do ambiente 4. Possibilidades: 1. Transgenia: incluir genes de outra espécie 2. Futuro: construção de novo genótipo do zero?

5 SEQÜENCIAMENTO DE GENOMAS 1. Dois tipos de projeto: 1. Seqüenciamento completo (genoma estrutural) 2. Seqüenciamento amostral de regiões expressas EST (genoma funcional) 2. Para ambos os processos: 1. Coleta de grande quantidade de dados 2. Montagem / clusterização das seqüências 3. Anotação

6 SEQÜENCIAMENTO DE DNA Método de terminação de cadeia Animação: Clique em The Project Clique em Pieces of the Puzzle Clique em Sequence DNA Fonte: DNA Interactive, dnai.org, Fonte: M. Galves, Scylla, 2005.

7 SEQÜENCIAMENTO DE DNA 1. Alguns recordes mundiais de maior trecho consecutivo já obtido, na sua época: Trecho Tamanho (bp) Ano Bacteriófago phix Mitocôndria humana Vírus de Epstein-Barr (continua)

8 SEQÜENCIAMENTO DE DNA 1. Recordes mundiais (continuação): Trecho Tamanho (bp) Ano Citomegalovirus humano Cromossomo 3 da levedura (S. cerevisiae) Haemophilus influenzae (continua)

9 SEQÜENCIAMENTO DE DNA 1. Recordes mundiais (continuação): Trecho Tamanho (bp) Ano Synechocystis sp E. coli Cromossomo 5 de C. elegans (continua)

10 SEQÜENCIAMENTO DE DNA 1. Recordes mundiais (continuação): Trecho Tamanho (bp) Ano Cromossomo 2 de Arabidopsis thaliana Cromossomo 21q humano Cromossomo 14 humano Fonte: The Institute of Genomic Research TIGR, website, 2005.

11 SEQÜENCIAMENTO DE DNA Máquinas modernas produzem eletroferogramas e seqüências diretamente em formato digital Fonte: M. Galves, Scylla, 2005.

12 SEQÜENCIAMENTO DE GENOMAS COMPLETOS National Center for Biotechnology Information - NCBI Consultado em 11/04/2005 Classe de organismo Arqueobactérias Eubactérias Eucariotos Vírus TOTAL Genomas completos

13 SEQÜENCIAMENTO DE GENOMAS COMPLETOS: PLANTAS National Center for Biotechnology Information - NCBI Consultado em 11/04/2005 Planta Arabidopsis thaliana Lotus corniculatus v. jap. Lycopersicon esculentum Mendicago truncatula Oryza sativa Estado Completo Em progresso Em progresso Em progresso Completo

14 SEQÜENCIAMENTO DE GENOMAS COMPLETOS: ESTRATÉGIAS 1. Por partes 1. Escolher pedaços contíguos (clones) que cubram o genoma, com alguma sobreposição entre eles, mas não muita 2. Para cada pedaço, aplicar uma das duas estratégias 3. Juntar as seqüências dos pedaços via sobreposições entre eles 2. Shotgun 1. Quebrar o genoma aleatoriamente em um número muito grande de pedaços 2. Sequenciar cada pedaço 3. Usar um software montador para juntar as seqüências dos pedaços

15 SEQÜENCIAMENTO DE GENOMAS COMPLETOS Trecho a seqüenciar Multiplicar Fragmentar

16 SEQÜENCIAMENTO DE GENOMAS COMPLETOS Seqüenciar alguns fragmentos ACGATGCTCGCTAGTCGTA CGTAGCATGCTAGCACACGATC CGCATGCATCGACTAGC TGATCGACTAGCTACGACT CGACATCGATCAGCATCGACTA CGACGACTAGCATCGATCGACCTA ATCGACTACGATCTATCGACTATC TAGCTGATCGATGCTAGCT ATGCGCTCGCGATTCATCGTATCGT AGCTATGCTGATCTGATCAGC AGTATCAGCATCGTAGCTAGCTA CGATCAGCAGCTATCGATCGT TAGCGCGTTATGCGATCGT TAGATCGATCGACTATCTACAGCTA CGCTTATATCGTATCATCTGAT GGGTATCGTATGCATCGTA TGGATCGATCGTGTATTCGTTA CGGCGATCGTATCTGATCGTCTAT AGGCGCTCTGTGCGTTATTATGGTA GGCTGCTCCGTCGCTTATAGAGAT CGTAGCTGTCTCGATCTGT Montar os fragmentos ACGATGCTCGCTAGTCGTACG TATATCGTATCTGTGATCAT GATGCTCGCTAGTCG TGTGATCATCTACGTATG TCGCTAGTCGTACGCTATTATCG GATCATCTACGTATGC TAGTCCTACGCTATTA TACGTATGCATCGATCTGAT TACTGACTGATCGT GTACGCTATTATCGATCT GTAGGCATCGATCTGATCTA ATTGATCTGCTGTATCTATCATCGCAT ATCGATCTGATCTACTGACTG CTGTATCTATCATCGTATCTGTGATCAT CTGATCTACTGACTGATCGT ACGATGCTCGCTAGTCGTACGCTATTATCGATCTGCTGTATCTATCATCGTATCTGTGATCATCTACGTATGCATCGATCTGATCTACTGACTGATCGT

17 SEQÜENCIAMENTO DE GENOMAS COMPLETOS Animação: Clique em Putting it together Clique em Animations Os links Whole genome shotgun e Hierarchical shogtun são animações sobre seqüenciamento de genomas completos Fonte: DNA Interactive, dnai.org, 2005.

18 SEQÜENCIAMENTO AMOSTRAL - EST Síntese de proteínas na célula Fonte: C. Baudet, Scylla, 2005.

19 SEQÜENCIAMENTO AMOSTRAL - EST Síntese de proteínas na célula gene mrna mrna maduro peptídeo proteína 1. mrna maduros são capturados e transformados em cdna 2. Vários cdnas são seqüenciados (às vezes parcial) 3. Clusterização para alinhar seqüências de origem comum

20 SEQÜENCIAMENTO AMOSTRAL - EST 1. Opção por seqüenciar 3 (final) ou 5 (começo) do cdna 2. Genes mais expressos vão contribuir mais seqüências 3. Para evitar isto, uma alternativa é normalizar bibliotecas 4. Técnica ORESTES (inventada no Brasil) pega o meio do cdna e também tem um efeito normalizador 5. Permite amostrar parte da variação individual que está na parte codificadora do genoma 6. Permite avaliação inicial de níveis de expressão projetos públicos em plantas listados no NCBI (12/04/2005)

21 SEQÜENCIAMENTO AMOSTRAL - EST National Center for Biotechnology Information - NCBI Consultado em 12/04/2005 Planta Triticum aestivum Zea mays Arabidopsis thaliana Hordeum vulgare Oryza sativa Glycine max Saccharum officinarum Número de ESTs

22 SEQÜENCIAMENTO AMOSTRAL - EST 1. Ajuda a estabelecer estrutura dos genes genômico íntron íntron íntron cdna éxons

23 Contato website: fone: fax: endereço: Rod. Anhanguera km 104 (Techno Park) R. James Clerk Maxwell, 360 Campinas São Paulo Brasil Scylla recebeu investimentos de Parceiros

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Introdução à Bioinformática Professores: Luciano Maia Antonio

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Resumos do 56º Congresso Nacional de Botânica.

Resumos do 56º Congresso Nacional de Botânica. Genômica Florestal: Oportunidades e Desafios DARIO GRATTAPAGLIA - EMBRAPA RECURSOS GENÉTICOS E BIOTECNOLOGIA/UNIVERSIDADE CATÓLICA DE BRASÍLIA dario@cenargen.embrapa.br Introdução Plantações florestais

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

Dezembro - 2006. Bioinformática. e Anotação. Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP

Dezembro - 2006. Bioinformática. e Anotação. Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP Dezembro - 2006 Bioinformática e Anotação Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP Hoje 1. Introdução à Genômica 2. Introdução à Bioinformática 3. Introdução à Anotação

Leia mais

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal Fepagro em foco Samuel Mazzinghy Alvarenga Histórico recente da Agropecuária Era científica: a partir de ~ 1.700 Rotação de culturas e métodos de cultivo intensivo Drenagem Utilização de arado, máquinas

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71)

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71) DELIBERAÇÃO Câmara de Pós-Graduação Nº 32/2012 Reestrutura o Programa de Pós-Graduação em Genética e Biologia Molecular, em nível de Mestrado e Doutorado. CONSIDERANDO a solicitação da Comissão Coordenadora

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Introdução à Bioinformática Professores: Luciano Maia Antonio

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

h>p://www.biology.gatech.edu/professors/labsites/goodisman Genômica Evolu/va Prof. Yuri Leite Evolução UFES

h>p://www.biology.gatech.edu/professors/labsites/goodisman Genômica Evolu/va Prof. Yuri Leite Evolução UFES h>p://www.biology.gatech.edu/professors/labsites/goodisman Genômica Evolu/va Prof. Yuri Leite Evolução UFES Genômica Genômica: estudo de genomas completos (cromossomos, organelas, plasmídeos) Seqüências

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

Sequenciamento de genoma e transcriptomas

Sequenciamento de genoma e transcriptomas Sequenciamento de genoma e transcriptomas Por que seqüenciar genomas? O seqüenciamento de genomas é o primeiro passo para obter uma descrição completa da composição molecular de cada organismo, pois todas

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Busca em banco de dados

Busca em banco de dados Busca em banco de dados Busca em banco de dados A quantidade imensa de dados existentes nos bancos públicos torna critica a existência de ferramentas eficientes que permitam a recuperação de dados desejados

Leia mais

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Darwin Voltar Filogenia anatômica e fisiológica Filogênia Molecular A teoria da evolução de Darwin gerou o conceito

Leia mais

Departamento de Genética Nilce M. Martinez Rossi

Departamento de Genética Nilce M. Martinez Rossi ORGANIZAÇÃO E FUNCIONALIDADE DO GENOMA HUMANO Departamento de Genética Nilce M. Martinez Rossi Fenótipo = GENÓTIPO + Ambiente O que é o genoma? Projetos Genoma Genoma: sequencia de DNA de todos os cromossomos

Leia mais

Introdução à Bioinformática. Prof. IVAné@

Introdução à Bioinformática. Prof. IVAné@ Introdução à Bioinformática Prof. IVAné@ Bioinformática União da ciência da computação com a biologia molecular É uma área nova Há 10 anos atrás o termo nem existia Depois da descoberta de Watson e Crick

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade

Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade A A Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade 2 A A Habilidade: Conhecer sobre células- troncos, projeto genoma e engenharia genética. 3 A A Células-tronco Autorrenovação e diferenciação

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

Modelos BioMatemáticos

Modelos BioMatemáticos Modelos BioMatemáticos http://correio.fc.ul.pt/~mcg/aulas/biopop/ Pedro J.N. Silva Sala 4.1.16 Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Pedro.Silva@fc.ul.pt Genética

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº . 3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº Valor: 10 Nota:. 1. (Uel 2015) Leia o texto a seguir. Quando se fala em divisão celular, não

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Programa Interunidades de Pós-Graduação em Bioinformática - Universidade de São Paulo

Programa Interunidades de Pós-Graduação em Bioinformática - Universidade de São Paulo *Tópicos e Bibliografia da Prova de Seleção em Bioinformática Área: Biológicas 1 Estrutura e Função de ácidos nucleicos 1.1 Fluxo da Informação genética 1.2 Blocos estruturais do DNA e RNA 1.3 Níveis de

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Biologia: Genética e Mendel

Biologia: Genética e Mendel Biologia: Genética e Mendel Questão 1 A complexa organização social das formigas pode ser explicada pelas relações de parentesco genético entre os indivíduos da colônia. É geneticamente mais vantajoso

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Sequenciamento de genoma e transcriptomas

Sequenciamento de genoma e transcriptomas Sequenciamento de genoma e transcriptomas Durante décadas o método de Sanger foi praticamente a única opção utilizada para sequenciamento de DNA Nos últimos anos surgiram novas tecnologias de sequenciamento

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Banco de Dados aplicado a Sistemas Biológicos

Banco de Dados aplicado a Sistemas Biológicos Dados Biológicos Banco de Dados aplicado a Sistemas Biológicos A internet mudou a maneira como os cientistas compartilham os dados e possibilitou que um depósito central de informações atendesse totalmente

Leia mais

GENÉTICA E BIOLOGIA MOLECULAR. Prof. Dra. Luciana Maria de Hollanda

GENÉTICA E BIOLOGIA MOLECULAR. Prof. Dra. Luciana Maria de Hollanda GENÉTICA E BIOLOGIA MOLECULAR Prof. Dra. Luciana Maria de Hollanda Quem é vc Professora? A primeira dúvida que surge Quando a gente inicia um semestre é Eu sou o que sou! Sou o capitão da minha alma e

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg.

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg. Bioinformática Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica João Varela jvarela@ualg.pt Docentes Paulo Martel (alinhamentos, pesquisas de sequências em

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

CURSO SOBRE ACESSO ÀS BIBLIOTECAS ON-LINE DA MEDLINE/PubMed

CURSO SOBRE ACESSO ÀS BIBLIOTECAS ON-LINE DA MEDLINE/PubMed TUTORIAL PARA ACESSO BIBLIOTECA ON-LINE da MEDLINE/PUBMED CURSO SOBRE ACESSO ÀS BIBLIOTECAS ON-LINE DA MEDLINE/PubMed Este tutorial faz parte do curso de extensão da UNIFESP sobre acesso on-line às publicações

Leia mais

Análise de Dados de Expressão Gênica

Análise de Dados de Expressão Gênica Análise de Dados de Expressão Gênica Ivan G. Costa Filho igcf@cin.ufpe.br Centro de Informática Universidade Federal de Pernambuco Tópicos O que e expressão gênica? Como medir expressão gênica? Aspectos

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

CONHECIMENTOS ESPECÍFICOS

CONHECIMENTOS ESPECÍFICOS Acerca da bioinformática em geral, julgue os itens subsequentes. 41 A bioinformática pode ser definida como uma área multidisciplinar que envolve principalmente a Biologia, a Ciência da Computação, a Matemática

Leia mais

COMPARAÇÃO DE SEQÜÊNCIAS DE DNA

COMPARAÇÃO DE SEQÜÊNCIAS DE DNA 144 COMPARAÇÃO DE SEQÜÊNCIAS DE DNA PUCCI NETO, João 1 Resumo: A comparação de seqüências é uma operação básica muito importante na área de biologia computacional. Neste trabalho, é implementado um algoritmo

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

DOMESTICAÇÃO DAS PLANTAS CULTIVADAS

DOMESTICAÇÃO DAS PLANTAS CULTIVADAS DOMESTICAÇÃO DAS 2 PLANTAS CULTIVADAS INTRODUÇÃO A domesticação é um processo evolucionário conduzido pelo homem visando adaptar plantas e animais às necessidades humanas. Plantas domesticadas são geneticamente

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Anotação de Genomas. Fabiana G. S. Pinto

Anotação de Genomas. Fabiana G. S. Pinto Anotação de Genomas Fabiana G. S. Pinto Obtenção de Seqüências geradas pelo MegaBace 1000 Dados brutos (medidas analógicas) de saída do seqüênciamento Base calling BIOINFORMÁTICA * PHRED: - Transforma

Leia mais

TÍTULO: CARACTERIZAÇÃO DO COMPLEXO RAPAMICINA-FKBP12-TOR EM PLANTAS C4

TÍTULO: CARACTERIZAÇÃO DO COMPLEXO RAPAMICINA-FKBP12-TOR EM PLANTAS C4 TÍTULO: CARACTERIZAÇÃO DO COMPLEXO RAPAMICINA-FKBP12-TOR EM PLANTAS C4 CATEGORIA: EM ANDAMENTO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: CIÊNCIAS BIOLÓGICAS INSTITUIÇÃO: UNIVERSIDADE FEDERAL DE SÃO CARLOS

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Conexões entre matemática e biologia

Conexões entre matemática e biologia EB-207 Matemática Biológica 1 Conexões entre matemática e biologia Prof. Rodrigo Sávio Pessoa Sumário 2 1. Introdução 2. A nanotecnologia aplicada as ciências biológicas 3. Algumas questões biológicas

Leia mais

Bioinformática aplicada à Genômica

Bioinformática aplicada à Genômica Manuscrito para capítulo do Biowork IV Bioinformática aplicada à Genômica Fabrício R. Santos 1 e José Miguel Ortega 2 1 Departamento de Biologia Geral e 2 Departamento de Bioquímica e Imunologia da Universidade

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

PROSPECÇÃO DE GENES REGULATÓRIOS E ESTRUTURAIS DE BOTÃO FLORAL DE ALGODOEIRO MORGANNA POLLYNNE N. PINHEIRO

PROSPECÇÃO DE GENES REGULATÓRIOS E ESTRUTURAIS DE BOTÃO FLORAL DE ALGODOEIRO MORGANNA POLLYNNE N. PINHEIRO UFRPE - Universidade Federal Rural de Pernambuco Programa de Pós Graduação em Melhoramento Genético de Plantas PROSPECÇÃO DE GENES REGULATÓRIOS E ESTRUTURAIS DE BOTÃO FLORAL DE ALGODOEIRO MORGANNA POLLYNNE

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Bacteria Archaea Eukarya

Bacteria Archaea Eukarya PROVA PARA AVALIAÇÃO DE CAPACIDADE PARA FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS 2014/2015 Instituto Superior de Engenharia Licenciatura em Tecnologia e Segurança Alimentar Componente específica

Leia mais

DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS. Prof. Olayr Modesto Jr.

DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS. Prof. Olayr Modesto Jr. DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS Prof. Olayr Modesto Jr. INTRODUÇÃO A domesticação é um processo evolucionário conduzido pelo homem visando adaptar plantas e animais às necessidades humanas. Plantas

Leia mais

TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata

TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata Quim. Nova, Vol. XY, No. 00, S1-S5, 200_ TRIAGEM METABÓLICA POR PKS E NRPS EM ACTINOBACTÉRIAS ENDOFÍTICAS DE Citrus reticulata Pedro L. R. da Cruz a, Leila R. Giarola b, Suellen da Silva Moraes a, Déborah

Leia mais

ALGORITMOS GENÉTICOS APLICADOS A MAPEAMENTO FÍSICO DE DNA

ALGORITMOS GENÉTICOS APLICADOS A MAPEAMENTO FÍSICO DE DNA ALGORITMOS GENÉTICOS APLICADOS A MAPEAMENTO FÍSICO DE DNA Fábio Ribeiro Cerqueira e Renarde Bergamo Paiva Stelzer Departamento de Ciência da Computação e Informática Faculdade de de Aracruz (UNIARACRUZ)

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Seleção Artificial. "A seleção feita pelo homem visa apenas seu próprio bem; a da natureza visa, de forma exclusiva, o bem do indivíduo modificado".

Seleção Artificial. A seleção feita pelo homem visa apenas seu próprio bem; a da natureza visa, de forma exclusiva, o bem do indivíduo modificado. Biotecnologia Seleção Artificial Processo conduzido pelo ser humano de cruzamentos seletivos com o objetivo de selecionar características desejáveis em animais, plantas e outros seres vivos. "A seleção

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

O PROJETO GENOMA DO CÂNCER HUMANO

O PROJETO GENOMA DO CÂNCER HUMANO O PROJETO GENOMA DO CÂNCER HUMANO ESPECIAL LUDWIG/FAPESP O Projeto Genoma e a Estratégia Orestes Emmanuel Dias Neto, PhD Laboratório de Genética do Câncer, Ludwig Institute for Cancer Research emmanuel@compbio.ludwig.org.br

Leia mais

Pesquisador em Saúde Pública Prova Discursiva INSTRUÇÕES

Pesquisador em Saúde Pública Prova Discursiva INSTRUÇÕES Bioinformática Pesquisador em Saúde Pública Prova Discursiva 1. Você recebeu do fiscal o seguinte material: INSTRUÇÕES a) Este Caderno de Questões contendo o enunciado das 2 (duas) questões da prova discursiva.

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade Estrutura do RNA: um mundo de diferenças & extrema plasticidade Estrutura do RNA: extrema plasticidade RNA: extrema plasticidade... funcional RNA: funções múltiplas rrna, mrna, trna, RNAs de funções especiais

Leia mais

CAP 03 GENÉTICA MOLECULAR

CAP 03 GENÉTICA MOLECULAR UNIVERSIDADE FEDERAL DE LAVRAS DEPARTAMENTO DE BIOLOGIA CAP 03 GENÉTICA MOLECULAR (PARTE II) FUNÇÕES DO MATERIAL GENÉTICO DOGMA CENTRAL DA BIOLOGIA (Francis Crick) REPLICAÇÃO TRANSCRIÇÃO TRADUÇÃO DNA mrna

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

Dia da Propriedade Industrial. Patentes de Genes. Vanessa Fatal Examinadora de Patentes. Universidade de Évora 21.09.2010

Dia da Propriedade Industrial. Patentes de Genes. Vanessa Fatal Examinadora de Patentes. Universidade de Évora 21.09.2010 Dia da Propriedade Industrial Patentes de Genes Vanessa Fatal Examinadora de Patentes Universidade de Évora 21.09.2010 Europa 1973 EPC define que processos essencialmente biológicos não são patenteáveis

Leia mais

Disciplina Genética Mendeliana

Disciplina Genética Mendeliana Disciplina Genética Mendeliana Semestre 2008.1 Coordenação: Prof a Neide Santos e-mail: santos_neide@yahoo.com.br Prof a Dr a Ana Maria Benko- Iseppon Laboratório de Genética e Biotecnologia Vegetal Universidade

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Introdução à genética quantitativa usando os recursos do R

Introdução à genética quantitativa usando os recursos do R Introdução à genética quantitativa usando os recursos do R Marisa R. Cantarino 1 Julia M. P. Soler (orientadora) 2 1 Introdução Um dos principais desafios da pesquisa genética atualmente é estabelecer

Leia mais

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Biologia Princípios Básicos de Genética A genética é a parte da biologia que trata do estudo dos genes e de suas manifestações,

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi

Tradução Modificando o alfabeto molecular. Prof. Dr. Francisco Prosdocimi Tradução Modificando o alfabeto molecular Prof. Dr. Francisco Prosdocimi Tradução em eukarya e prokarya Eventos pós-transcricionais Processo de síntese de proteínas RNAm contém o código do gene RNAt é

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

Introdução ao SRS Sequence Retrieval System. Marcelo Falsarella Carazzolle

Introdução ao SRS Sequence Retrieval System. Marcelo Falsarella Carazzolle Introdução ao SRS Sequence Retrieval System Marcelo Falsarella Carazzolle Resumo Motivação Introdução Bancos de Dados Ferramentas de bioinformática SRS Exemplos Motivação Existem muitos bancos de dados

Leia mais

Genômica. O que chamou mais atenção no filme?

Genômica. O que chamou mais atenção no filme? Genômica O que chamou mais atenção no filme? Tempo para sequenciamento do genoma Predição do fenótipo com base no genótipo Como este conhecimento pode ser usado para gerar novas tecnologias? Sequenciamento

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais