Desenvolvimento de um Sistema para Armazenamento de Seqüências Nucléicas

Tamanho: px
Começar a partir da página:

Download "Desenvolvimento de um Sistema para Armazenamento de Seqüências Nucléicas"

Transcrição

1 Desenvolvimento de um Sistema para Armazenamento de Seqüências Nucléicas D. Castravechi, e A. A. Shinoda, Dr. Abstract -- Currently, one of the most significant problems of the bioinformatics mentions the great accumulation of data. Despite the great amount of generated data, these show themselves constantly insufficient or inadequate due to one better treatment. The present report has as objective to describe the development of a system of database for management of data proceeding from research of genetic sequencing, providing one better arrangement with of them. The system has as function to organize these data, becoming them accessible and understandable to the users, and this way to make possible taken of rational decisions for the achievement of projects. Key-words Biological Database, Database of Nucleic Sequences, Bioinformatics. Resumo -- Atualmente, um dos mais significativos problemas da bioinformática refere-se ao grande acúmulo de dados. Apesar da grande quantidade de dados gerados, estes se mostram constantemente insuficientes ou inadequados por falta de um melhor tratamento. O presente artigo tem como objetivo especificar o desenvolvimento de um sistema de banco de dados para gerenciamento de dados provenientes de pesquisas de seqüenciamento genético, provendo uma melhor disponibilização dos mesmos. O sistema tem como função organizar estes dados, tornando-os mais facilmente acessíveis e compreensíveis aos usuários, e desta forma possibilitar tomada de decisões racionais para a consecução de projetos. Palavras Chaves -- Banco de Dados Biológico, Banco de Dados de Seqüências Nucléicas, Bioinformática. I. INTRODUÇÃO A bioinformática é uma nova área do conhecimento diretamente relacionada com o tratamento da enorme quantidade de dados biológicos manipulados diariamente por toda a comunidade científica, podendo ser definida como a área da ciência que envolve todos os aspectos da aquisição, processamento, armazenamento, distribuição, análise e interpretação de informação biológica [20]. Em conseqüência da grande quantidade de informações biológicas produzidas atualmente, o uso dos bancos de dados vem assumindo uma importância crescente na bioinformática. Apesar da grande quantidade de dados gerados, estes se mostram constantemente insuficientes ou inadequados por falta de um melhor tratamento. O problema está em organizar estes dados de forma eficiente, a fim de torná-los mais facilmente acessíveis e compreensíveis. O presente trabalho consistiu no desenvolvimento de um sistema de Banco de Dados composto por uma aplicação web apoiada por um banco de dados em MySQL, onde a ênfase reflete-se na questão de armazenamento e gerenciamento de seqüências de nucleotídeos. A aplicação atua sobre o Banco de Dados desenvolvido, permitindo aos usuários o acesso às informações e possibilitando aos administradores do sistema a realização de novas inserções de dados, bem como possíveis alterações. Para desenvolver a modelagem dos dados foi utilizada a abordagem conhecida por Modelo Entidade-Relacionamento (ER) [13]. A partir do modelo desenvolvido a implementação do Banco de Dados foi realizada sem grandes problemas, utilizando o MySQL como Sistema Gerenciador de Banco de Dados (SGBD). A aplicação foi desenvolvida utilizando a linguagem PHP. II. GERENCIAMENTO DE DADOS EM BIOINFORMÁTICA Na segunda metade da década de 90, com o surgimento dos seqüenciadores automáticos de DNA, houve uma explosão na quantidade de seqüências a serem armazenadas, exigindo recursos computacionais cada vez mais eficientes para armazenamento, gerenciamento, uso e compartilhamento destes dados [5]. Além das seqüências de nucleotídeos, inúmeros outros tipos de dados biológicos têm sido gerados em quantidades cada vez maiores em decorrência de avanços tecnológicos em setores como computação, engenharia e biomedicina. Em conseqüência da grande quantidade de informações biológicas produzidas atualmente, o uso dos bancos de dados vem assumindo uma importância crescente na bioinformática. Contudo, o armazenamento e manipulação de dados biológicos constituem-se em problemas bastante desafiadores, pois estes dados apresentam diversas características particulares. Um banco de dados é uma coleção de dados relacionados. Entende-se por dados, fatos conhecidos que podem ser gravados e possuem significado implícito [16]. É projetado para suprir as necessidades de um grupo específico de aplicações e usuários, organizando e estruturando as informações de modo a facilitar atualizações, consultas e exclusões de dados. A grande maioria dos bancos de dados é atrelado a um sistema denominado SGBD (Sistema de Gerenciamento de Banco de Dados). Este sistema é responsável por intermediar os processos de definição, construção, manipulação e administração do banco de dados solicitados pelos usuários ou por outras aplicações, facilitando a execução destes processos. Antes do surgimento de bancos de dados gerenciados por SGBDs, era comum o uso de arquivos seqüenciais para armazenamento de dados. Arquivos seqüenciais apresentavam poucos recursos para gerenciar dados. Era quase impossível realizar operações complexas de forma que eles raramente 706

2 eram utilizados para aplicações em larga escala. No entanto, ainda são muito utilizados por bancos de seqüenciamento genético. A razão disso deve-se ao fato de que este tipo de arquivo pode ser facilmente distribuído e compreendido [14]. Um dos maiores benefícios de usar bancos de dados para armazenamento de dados é o compartilhamento dos mesmos. Isto se aplica aos bancos de dados biológicos devido sua complexidade, hierarquia, heterogeneidade e dinâmica [14]. O investimento contínuo na construção de bancos de dados públicos é um dos grandes motivos do sucesso dos projetos genoma e, em especial, do Projeto Genoma Humano. Devido à magnitude do conjunto de dados produzidos torna-se fundamental a organização desses dados em bancos que permitam acesso on-line. III. MODELAGEM DE DADOS Dependendo do projeto, o desenvolvimento de um banco de dados pode ser o problema principal ou apenas uma simples tarefa. Por exemplo, um banco de dados genômico comercial pode custar milhões e levar alguns anos para tornálo funcional. Por outro lado, um desenvolvedor habilidoso pode desenvolver um pequeno banco de dados de biodiversidade regional dentro de um mês, assumindo que os dados de campo estão disponíveis [14]. Uma das primeiras ações no estágio inicial do desenvolvimento de um banco de dados compreende a escolha de um adequado SGBD. Normalmente a escolha é baseada na experiência e no conhecimento do pesquisador. Uma vez escolhido o SGBD, o próximo passo é determinar exatamente quais dados serão armazenados e como eles serão organizados. A organização dos dados é importante pois, entre outras coisas, isto de termina como facilmente o banco de dados pode ser expandido e atualizado no futuro. Um modelo de dados é uma coleção de conceitos que podem ser usados para descrever a estrutura de um banco de dados [16]. Esta estrutura compreende os tipos de dados, relacionamentos e restrições inerentes a estes dados. O modelo busca sistematizar o entendimento que é desenvolvido a respeito de objetos e fenômenos que serão representados em um sistema informatizado. Os objetos e fenômenos reais, no entanto, são complexos demais para permitir uma representação completa, considerando os recursos à disposição dos sistemas gerenciadores de bancos de dados atuais, sobretudo no domínio biológico. Desta forma, é necessário construir uma abstração dos objetos e fenômenos do domínio em questão, de modo a obter uma forma de representação conveniente, embora simplificada, que seja adequada às finalidades das aplicações do banco de dados. A abstração de conceitos e entidades existentes em qualquer subconjunto do mundo real a ser representado é uma parte importante da criação de sistemas de informação. Além disso, o sucesso da implementação de um banco de dados é dependente da qualidade da transposição de entidades do mundo real e suas interações para o banco de dados. O processo de abstração funciona como uma ferramenta, auxiliando na compreensão do sistema, dividindo-o em componentes separados. Atualmente, os modelos de dados tradicionais mais referenciados para desenvolvimento de bancos de dados de biologia molecular incluem: arquivos seqüenciais estruturados [8]; ASN.1 [2], [3]; modelo semi-estruturado (baseados em XML); modelo relacional [1], [11]; modelo objeto-relacional [7], [9]; e modelo orientado a objetos [10], [18]. Estas técnicas são definidas e discutidas em [4]. Além destes modelos tradicionais, há importantes bancos de dados de biologia molecular utilizando outras tecnologias como o uso do ACEDB [15], um sistema de gerenciamento de banco de dados originalmente desenvolvido para banco de dados de biologia molecular; além do modelo Protocolo-Objeto (OPM) [6]. Para o desenvolvimento do banco de dados proposto, optou-se por trabalhar com o SGBD relacional MySQL. Os motivos para essa escolha foram: - Trata-se de um SGBD de código aberto e licença gratuita para uso acadêmico, sendo bastante utilizado nesse meio. - Trata-se de um SGBD leve e rápido (principalmente na plataforma linux), sendo muito utilizado em aplicações web. - Conhecimento prévio sobre o SGBD. Cada vez mais bancos de dados com diferentes conteúdos do domínio abordado estão utilizando um SGBD relacional. Por exemplo, o Genome Sequence Database (GSDB), um banco de dados de seqüências de nucleotídeos, é implementado usando o SGBD Relacional Sybase. O CyanoBase, um banco de dados genético, também está implementado usando o Sybase e o banco de dados proteômico YPD é gerenciado por um SGBD relacional Oracle [21]. O modelo relacional evita redundância de dados através de uma técnica conhecida por normalização. Além disso, um SGBD comercial proporciona um numero de características valiosas, como procedimentos de consultas eficientes, e ferramentas de administração de bancos de dados úteis. Estes atributos tornam mais fácil o desenvolvimento e manutenção de bancos de dados. O armazenamento dos dados em um banco de dados relacional é importante devido ao fato de que um sistema gerenciador de banco de dados relacional (SGBDR) representa um meio seguro e robusto para o armazenamento de grandes volumes de dados e esse tipo de SGBD está largamente difundido comercialmente. Contudo, sistemas relacionais são melhores quando o esquema é simples, o dado é regular e consultas sucessivas são independentes [12]. Apesar disso, SGBDs relacionais são utilizados para gerenciar todo tipo de dado biológico A força do modelo relacional é sua total provisão por SQL. Mas sua principal fraqueza é a ineficiência para modelagem de objetos genômicos complexos [17]. IV. AQUISIÇÃO E DEPOSIÇÃO DE DADOS A forma como novos dados são adquiridos constitui um importante aspecto dos banco de dados em geral. Novos dados são constantemente inseridos em bancos de dados de biologia molecular de acordo com o esquema do banco. O objetivo básico é coletar tantos dados quanto possível, e por conseguinte produzir métodos de deposição de dados de 707

3 fácil acesso e uso. Além disso, há necessidade de que estes dados sejam de qualidade. De acordo com [21] os bancos de dados de biologia molecular podem ser classificados de acordo com a forma de aquisição de dados da seguinte forma: - Dados adquiridos através de uma comunidade de pesquisadores que submetem dados provenientes de suas pesquisas. Algumas vezes, o direito de submeter dados é restrito a um conjunto de laboratórios. - Dados adquiridos a partir de outros bancos de dados. Isto indica que o formato ou modelo de um dado incomum eventualmente tem de ser transformado. - Dados adquiridos através da literatura. Freqüentemente esta aquisição é realizada manualmente e requer um grande contingente de profissionais bem treinados. Em [5] os bancos de dados cuja aquisição de dados se deve a submissão de dados por uma comunidade de pesquisadores são chamados de primários. Entre os principais bancos de dados primários estão o GenBank, o EBI (European Bioinformatics Institute), o DDBJ (DNA Data Bank of Japan), o GDB (The Human Genome Database) e o PDB (Protein Data Bank). Com o intuito de se manterem atualizados, os três primeiros banco de dados citados trocam informações entre si diariamente. Ainda segundo [5], os bancos de dados derivados a partir das informações depositadas nos bancos primários são chamados de secundários. O SWISS-PROT é um exemplo de banco secundário onde as informações sobre seqüências de proteínas foram anotadas e associadas a informações sobre função, domínios funcionais, proteínas homólogas e outros. No projeto desenvolvido, o armazenamento de novos dados pode ser realizado apenas por um grupo restrito de usuários. A inserção de novos dados é efetuada através de um formulário online. Estes dados podem ser obtidos pelo próprio usuário no formato de cromatogramas 1 ou ainda através de pesquisas em banco de dados de livre acesso na Internet, como GenBank, estando estes em formato fasta (Anexo A). Os dados serão armazenados em projetos que poderão conter dados somente no formato cromatograma, somente no formato fasta, ou ainda em ambos. A inserção de diversos arquivos fasta pode ser requisitada de uma única vez, basta que estes arquivos sejam colocados em um único arquivo texto (.txt) e este arquivo seja enviado para armazenamento. O sistema tratará de abrir este arquivo, separar as seqüências e, por fim, armazená-las no banco de dados. Ao armazenar um arquivo cromatograma, o nome do arquivo é alterado, concatenando o nome do diretório, no qual o arquivo a ser enviado se encontra, à frente do nome do arquivo. Este processo é necessário para diferenciar os arquivos pelo nome, pois os arquivos cromatogramas gerados por um seqüenciador automático apresentam sempre o mesmo padrão de nomes. Este novo nome, também é informado na primeira linha de um arquivo fasta que represente a mesma seqüência, permitindo a associação destes arquivos através deste nome. 1 Cromatogramas são arquivos com extensão.esd, provenientes de um seqüenciador automático. Estes arquivos podem ser abertos somente por alguns programas específicos. Para codificá-lo em um arquivo fasta pode-se usar o software Phred Phrap. V. CONSULTAS E RECUPERAÇÃO DE DADOS Talvez a razão principal para se desenvolver um banco de dados é facilitar a recuperação de um dado especifico que cada usuário precisa. O ideal é que uma variedade de métodos de consultas sejam suportados. No projeto desenvolvido, a pesquisa de dados pode ser realizada utilizando algumas opções pré-definidas em formulário fixo da interface de pesquisa, como: nome do arquivo, identificador do arquivo, nome do projeto, nome do usuário responsável pelo projeto e intervalo de datas. Além disso, o software desenvolvido permite que uma outra pesquisa seja realizada diretamente em SQL. Para que seja possível tirar proveito desta funcionalidade, o usuário deve conhecer o esquema do banco de dados e ter uma boa noção de SQL. É importante ressaltar que neste último caso, alguns dados que poderiam ser requisitados através deste tipo de pesquisa mereceram tratamento especial, como os campos definidos no banco de dados: senha, cromat e sequencia. O campo senha, por exemplo, a ser requisitado não pode ser visualizado, caso contrário qualquer usuário poderia facilmente obter a senha de outros usuários através desta pesquisa. No caso dos campos cromat e sequencia, a visualização destes dados na tela seria problemática. O campo cromat é utilizado para armazenamento binário dos arquivos cromatogramas, enquanto o campo sequencia é utilizado para armazenar as seqüências em um campo texto. Dessa forma, a requisição por um campo cromat gera a criação de um link que permite copiar o arquivo armazenado por este campo em disco, enquanto a requisição do campo sequencia gera a criação de um link que permite a visualização do arquivo em uma outra tela. VI. VALIDAÇÃO DO SISTEMA Para validação do sistema desenvolvido foram realizados testes de unidade e testes de integração. Os testes de unidade tiveram como objetivo verificar a corretude de cada um dos módulos do sistema isoladamente, sendo realizados tão logo esses módulos foram desenvolvidos. Alguns dos problemas tratados nessa etapa foram: verificar compatibilidade de parâmetros e argumentos da interface, digitação inconsistente, iniciação ou valores default errôneos, nomes de variáveis ou tipos de dados incorretos, entre outros. Os testes de integração foram realizados a fim de verificar a integração entre os módulos componentes que foram testados isoladamente. Estes testes foram desenvolvidos a partir da especificação do sistema e tiveram início logo que as primeiras versões dos módulos ficaram prontas. Após essas etapas uma nova verificação foi iniciada, a fim de verificar se as alterações efetuadas ocasionaram novos erros. VII. CONCLUSÃO A biologia molecular é uma disciplina em rápido desenvolvimento, trabalhando com grandes volumes de dados. O uso de técnicas da ciência da computação para armazenamento, recuperação e análise de dados biológicos é indispensável. 708

4 O modelo relacional é orientado em direção a um eficiente armazenamento e gerenciamento de dados, mas não provê construtores para uma boa captura da semântica dos dados: a representação de um objeto conceitual complexo em um banco de dados relacional pode se estender por muitos registros em várias tabelas distintas, fazendo do esquema relacional um pobre veículo para comunicação semântica de um banco de dados [19]. Contudo, com relação ao desempenho pode se destacar que SGBDs relacionais apresentam melhor desempenho em operações de pesquisa para bases de dados de grande dimensão. Devido à simplicidade do esquema proposto, o modelo relacional se mostrou satisfatório. Através da implementação da aplicação proposta, conseguiu-se desenvolver um sistema de banco de dados para gerenciamento de dados provenientes de pesquisas de seqüenciamento genético, atendendo aos requisitos básicos especificados e proporcionando uma melhor disponibilização dos mesmos. Os dados do sistema foram organizados, tornando-os mais acessíveis e compreensíveis aos usuários. Contudo, diversas melhorias podem e devem ser efetuadas. Por exemplo: melhorias de interface quanto a sua clareza, estética e desenvolvimento de novas opções de pesquisa prédefinidas. Além disso, alguns trabalhos futuros foram propostos como o desenvolvimento de uma função para backup do banco de dados e a integração com o software Phred Phrap, que realiza a codificação dos cromatogramas em arquivos fasta, automatizando este processo. Nota-se que dessa forma, o arquivo fasta referente a uma seqüência sempre será armazenado. VIII. ANEXO A Exemplo de Arquivo Fasta >gi gb U SAU33846 Sulfolobus acidocaldarius DNA polymerase gene, complete cds TCTAGAGCCTTAAAGGAACCATAAAATTTAATCAGT CATCAACTTCTATACAGTCTAACACAACTACATATTC ATATAGCCAATATTTAAGTTTGTGGAAGGAAAATAA GAGAAATCAGTAATTATAAGTAATCTACCATTTATAT CAAGTCAAAGGTATTAAATAAAAATTTTATCATTATT CTGAATAAATTTCCTAAAAATACGCCTGCTTTGTCTC CAAGCAGAGCCCTTCAAGTTTATATCGTAATTCTACT TAATTTATATATTGTATATGTCCAAACAAGCAACACT CTTTGATTTTTCCATAAAGAAGAATGAGAGTAAAGA GCAGACTAATCAAGAGAGTGTAGAGGTACCTAAACA AACCGCTAATAGGACGAAAATAGAGTGGATAAAGG AAGCTGAAGACGGAAAAGTGTATTTCTTGTTACAAG TTGATTATGATGGTAAAAAGTCACGTGCAGTTTGTAA GCTTTATGATAAAGAGGGTAAGAAAATTTACATTAT GCAAGATGAATCAGGTCACAAACCCTACTTTCTCACT GATATTGACCCAGATAAGGTTAACAAAATAACTAAG GTTGTAAGGGATCCTTCATTTGATCATCTCGAGCTCA TAAACAAAGTTGATCCTTATACGGGAAAGAAGATTA GACTTACTAAAATTGTTGTTAAAGACCCATTAGCTGT ACGAAGAATGAGGAGCTCTTTGCCCAAGGCATATGA AGCTCACATAAAATACTATAACAATTACGTATACGA TAATGGCTTAATTCCAGGGCTAATATATAAGGTTAAT AAGGGAAAGCTTACACAGCTTAATCCTGAACTTAAA GGAGAGGAAATTAATGAAATTAAGAAACTTTCTGAC GCTTATGAGATGACAAAAGAGACGGTAAATGATTGG ATACCTATCCTAGAGACTGAGGTACCTGATATAAAG AGAGTATCATTAGATATAGAGGTTTACACTCCA AATAGGGGAAGAATACCCGATCCTGAAAGGGCTGA ATTTCCTATAATTAGTGTTGCATTAGCTGGTAATGAT GGTAGCAAGATCGTTTTAGCGTTAAAAAGAGAGGAC GTAAATTCTGATTTTAGTAAGAAAGACGGCGTCCAA GTAGAGATTTTCGATTCTGAAAAGAAACTTCTAGCTA GATTATTCGAGATAATCCGAGAATATCCAATGCTACT AACCTTTAACGGCGATGATTTTGACATACCATACATA TATTTTAGAGCCTTGAGACTTAATTTCAGCCCTGAGG AGGTTCCACTGGATGTTGTAAGTGGTGAGGGTAAGT TTTTAGCAGGTATTCATATAGACCTCTACAAATTTTT CTTTAACAGGGCAGTGAGTATATATGCTTTTGAAGGC AAGTATAGTGAATACAGCCTATACGCAGTTGCTACA GCCTTGCTGGGCATTTCTAAGGTTAAGCTTGATACGT TCATTAGCTTTATGGACATAGATAAGTTAATCGAGTA TAA IX. REFERÊNCIAS Periódicos: [1] A. Kumar; K. H. Cheung; P. Ross-Macdonald; P. S. Coelho; P. Miller; M. Snyder, "TRIPLES: a database of gene function in Saccharomyces cerevisiae". Nucleic Acids Res., 28, 81-84, [2] D. Steedman, "ASN.1 The Tutorial and Reference". Technology Appraisals. Twickenham, UK, [3] D. A. Benson; M. S. Boguski; D. J. Lipman; J. Ostell; B. F. Ouellettee; B. A. Rapp; D. L. Wheeler, "Genbank. Nucleic Acids Res., 27, 12-17, [4] F. Achard; G. Vaysseix; E. Barillot, "XML, bioinformatics and data integration", Bioinformatics, 17, , [5] F. Prosdocimi, et al. "Bioinformática: Manual do Usuário. Biotecnologia", Ciência e Desenvolvimento, Nº 29, [6] I. A. Chen; V. M. Markowitz, "An Overview of the Object Protocol Model (OPM) and the OPM Data Management Tools". Information Systems, vol. 20, Nº 5, , [7] J. Zhu; M. Q. Zhang, "SCPD: a promoter database of the yeast Saccharomyces cerevisiae". Bioinformatics, 15, , [8] J. D. Westbrook; P. E. Bourne, "STAR/mmCIF: an ontology for macromolecular structure". Bioinformatics, 16, , [9] J. M. Carazo; E. H. Stelzer, "The BioImage Database Project: organizing multidimensional biological images in an object-relational database". J. Struct Biol., 125, , [10] K. Nakata; T. Takai; T. Kaminuma, "Development of the Receptor Database (RDB): application to the endocrine disruptor problem". Bioinformatics, 15, , [11] M. Hutsman; J. Richelle; S. J. Wodak, "SESAM: a relational database for structure and sequence of macromolecule". Proteins, 11, 59-76, [12] M. C. Keet, "Biological Data and Conceptual Modeling Methods". Journal of Conceptual Modeling, Vol. 29, [13] P. P. Chen, "The Entity-Relationship Model: Toward a Unified View of Data". ACM Press, New York, USA, [14] Y. Xia; R. E. Stinner; P. C. Chu, "Database Integration with the Web for Biologists to Share Data and Information". EJB - Electronic Journal of Biotechnology, ISSN: , Vol. 5 No. 2, Issue of August 15, North Carolina State University. Livros: [15] R. Durbin; J. Thierry-Mieg, "The ACEDB Genome Database". In Suhai, S. (ed.) Computational Methods in Genome Research. Plenum, NY, USA, [16] R. Elmasri; S. B. Navathe, "Fundamentals of Database Systems". 3a. Ed. USA: Addison-Wesley, Artigos Apresentados em Conferências: [17] D. Shin, "Comparative Study of Relational and Object-Oriented Modelings of Genomic Data". Hawaii International Conference on 709

5 System Sciences (HICSS), Hawaii, USA. Institute of Electrical and Electronics Engineers, Inc., [18] K. Aberer, "The use of object-oriented data models in biomolecular databases", Conference on Object-oriented Computing in the Natural Sciences. Heidelberg, Germany, pp [19] V. M. Markowitz; I. A. Chen; A. S. Kosky; E. Szeto, "Facilities for Exploring Molecular Biology Databases on the Web: A Comparative Study", 2 nd Pacific Symposium on Biocomputing. Santa Fe, New Mexico, Dissertações: [20] D. C. Resende; D. S. Lima; R. C. Mira, "Genome System", Trabalho de Conclusão de Curso, Universidade Católica de Goiás, [21] P. Kröger, "Molecular Biology Data: Database Overview, Modeling Issues, and Perspectives". Diplomarbeit Draft, vom 18. Maio de

Para construção dos modelos físicos, será estudado o modelo Relacional como originalmente proposto por Codd.

Para construção dos modelos físicos, será estudado o modelo Relacional como originalmente proposto por Codd. Apresentação Este curso tem como objetivo, oferecer uma noção geral sobre a construção de sistemas de banco de dados. Para isto, é necessário estudar modelos para a construção de projetos lógicos de bancos

Leia mais

Dado: Fatos conhecidos que podem ser registrados e têm um significado implícito. Banco de Dados:

Dado: Fatos conhecidos que podem ser registrados e têm um significado implícito. Banco de Dados: MC536 Introdução Sumário Conceitos preliminares Funcionalidades Características principais Usuários Vantagens do uso de BDs Tendências mais recentes em SGBDs Algumas desvantagens Modelos de dados Classificação

Leia mais

Prof. Marcelo Machado Cunha www.marcelomachado.com mcelobr@yahoo.com.br

Prof. Marcelo Machado Cunha www.marcelomachado.com mcelobr@yahoo.com.br Prof. Marcelo Machado Cunha www.marcelomachado.com mcelobr@yahoo.com.br Ementa Introdução a Banco de Dados (Conceito, propriedades), Arquivos de dados x Bancos de dados, Profissionais de Banco de dados,

Leia mais

Programação com acesso a BD. Prof.: Clayton Maciel Costa clayton.maciel@ifrn.edu.br

Programação com acesso a BD. Prof.: Clayton Maciel Costa clayton.maciel@ifrn.edu.br Programação com acesso a BD Prof.: Clayton Maciel Costa clayton.maciel@ifrn.edu.br 1 Introdução BD desempenha papel crítico em todas as áreas em que computadores são utilizados: Banco: Depositar ou retirar

Leia mais

FACULDADE INTEGRADAS DE PARANAÍBA ADMINISTRAÇÃO DE EMPRESAS. Bancos de Dados Conceitos Fundamentais

FACULDADE INTEGRADAS DE PARANAÍBA ADMINISTRAÇÃO DE EMPRESAS. Bancos de Dados Conceitos Fundamentais FACULDADE INTEGRADAS DE PARANAÍBA ADMINISTRAÇÃO DE EMPRESAS Bancos de Dados Conceitos Fundamentais Tópicos Conceitos Básicos Bancos de Dados Sistemas de Bancos de Dados Sistemas de Gerenciamento de Bancos

Leia mais

Conceitos de Banco de Dados

Conceitos de Banco de Dados Conceitos de Banco de Dados Autor: Luiz Antonio Junior 1 INTRODUÇÃO Objetivos Introduzir conceitos básicos de Modelo de dados Introduzir conceitos básicos de Banco de dados Capacitar o aluno a construir

Leia mais

04/08/2012 MODELAGEM DE DADOS. PROF. RAFAEL DIAS RIBEIRO, M.Sc. @ribeirord MODELAGEM DE DADOS. Aula 2. Prof. Rafael Dias Ribeiro. M.Sc.

04/08/2012 MODELAGEM DE DADOS. PROF. RAFAEL DIAS RIBEIRO, M.Sc. @ribeirord MODELAGEM DE DADOS. Aula 2. Prof. Rafael Dias Ribeiro. M.Sc. MODELAGEM DE DADOS PROF. RAFAEL DIAS RIBEIRO, M.Sc. @ribeirord MODELAGEM DE DADOS Aula 2 Prof. Rafael Dias Ribeiro. M.Sc. @ribeirord 1 Objetivos: Revisão sobre Banco de Dados e SGBDs Aprender as principais

Leia mais

Administração de Banco de Dados

Administração de Banco de Dados Administração de Banco de Dados Professora conteudista: Cida Atum Sumário Administração de Banco de Dados Unidade I 1 INTRODUÇÃO A BANCO DE DADOS...1 1.1 Histórico...1 1.2 Definições...2 1.3 Importância

Leia mais

Roteiro. BCC321 - Banco de Dados I. Conceitos Básicos. Conceitos Básicos. O que é um banco de dados (BD)?

Roteiro. BCC321 - Banco de Dados I. Conceitos Básicos. Conceitos Básicos. O que é um banco de dados (BD)? Roteiro BCC321 - Banco de Dados I Luiz Henrique de Campos Merschmann Departamento de Computação Universidade Federal de Ouro Preto luizhenrique@iceb.ufop.br www.decom.ufop.br/luiz Conceitos Básicos Banco

Leia mais

Bancos de Dados. Conceitos F undamentais em S is temas de B ancos de Dados e s uas Aplicações

Bancos de Dados. Conceitos F undamentais em S is temas de B ancos de Dados e s uas Aplicações Conceitos F undamentais em S is temas de B ancos de Dados e s uas Aplicações Tópicos Conceitos Básicos Bancos de Dados Sistemas de Bancos de Dados Sistemas de Gerenciamento de Bancos de Dados Abstração

Leia mais

PROJETO DE BANCO DE DADOS -INTRODUÇÃO. Prof. Angelo Augusto Frozza, M.Sc.

PROJETO DE BANCO DE DADOS -INTRODUÇÃO. Prof. Angelo Augusto Frozza, M.Sc. 1 PROJETO DE BANCO DE DADOS -INTRODUÇÃO Prof. Angelo Augusto Frozza, M.Sc. FUNDAMENTOS Dados Representação de fatos, conceitos ou instruções de maneira formalizada; Informação Significado que pessoas associam

Leia mais

Banco de Dados. Introdução. João Eduardo Ferreira Osvaldo Kotaro Takai. jef@ime.usp.br DCC-IME-USP

Banco de Dados. Introdução. João Eduardo Ferreira Osvaldo Kotaro Takai. jef@ime.usp.br DCC-IME-USP Banco de Dados Introdução João Eduardo Ferreira Osvaldo Kotaro Takai jef@ime.usp.br DCC-IME-USP Importância dos Bancos de Dados A competitividade das empresas depende de dados precisos e atualizados. Conforme

Leia mais

Curso de Verão 2012 - Bioinformática

Curso de Verão 2012 - Bioinformática Curso de Verão 2012 - Bioinformática Bancos de Dados Biológicos Márcio K. Oikawa - UFABC marcio.oikawa@ufabc.edu.br Agenda Introdução: O que são bancos de dados? Por que são importantes? Bancos de dados

Leia mais

Introdução. Conceitos Básicos. Conceitos Básicos. Conceitos Básicos

Introdução. Conceitos Básicos. Conceitos Básicos. Conceitos Básicos Conceitos Básicos Introdução Banco de Dados I Prof. Guilherme Tavares de Assis Universidade Federal de Ouro Preto UFOP Instituto de Ciências Exatas e Biológicas ICEB Departamento de Computação DECOM Dados

Leia mais

ADMINISTRAÇÃO DOS RECURSOS DE DADOS

ADMINISTRAÇÃO DOS RECURSOS DE DADOS Capítulo 7 ADMINISTRAÇÃO DOS RECURSOS DE DADOS 7.1 2003 by Prentice Hall OBJETIVOS Por que as empresas sentem dificuldades para descobrir que tipo de informação precisam ter em seus sistemas de informação?

Leia mais

Introdução à Banco de Dados. Definição

Introdução à Banco de Dados. Definição Universidade Federal da Bahia Departamento de Ciência da Computação (DCC) Disciplina: Banco de Dados Profª. Daniela Barreiro Claro Introdução à Banco de Dados Definição Um banco de dados é uma coleção

Leia mais

MC536 Bancos de Dados: Teoria e Prática

MC536 Bancos de Dados: Teoria e Prática Universidade Estadual de Campinas - UNICAMP Instituto de Computação - IC MC536 Bancos de Dados: Teoria e Prática Aula #1 Arquitetura de Banco de Dados Profs. Anderson Rocha e André Santanchè Campinas,

Leia mais

Docente: Éberton da Silva Marinho e-mail: ebertonsm@gmail.com

Docente: Éberton da Silva Marinho e-mail: ebertonsm@gmail.com INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DO RIO GRANDE DO NORTE Introdução a Banco de Dados Docente: Éberton da Silva Marinho e-mail: ebertonsm@gmail.com 12/06/2013 Sumário Motivação da Disciplina

Leia mais

Banco de Dados. CursoTécnico em Informática Modalidade Integrado. Professora Michelle Nery. Instituto Federal do Sul de Minas, câmpus Pouso Alegre

Banco de Dados. CursoTécnico em Informática Modalidade Integrado. Professora Michelle Nery. Instituto Federal do Sul de Minas, câmpus Pouso Alegre Banco de Dados CursoTécnico em Informática Modalidade Integrado Instituto Federal do Sul de Minas, câmpus PousoAlegre Professora Michelle Nery Conteúdo Programático Introdução O que é Banco de Dados O

Leia mais

Roteiro 2 Conceitos Gerais

Roteiro 2 Conceitos Gerais Roteiro 2 Conceitos Gerais Objetivos: UC Projeto de Banco de Dados Explorar conceitos gerais de bancos de dados; o Arquitetura de bancos de dados: esquemas, categorias de modelos de dados, linguagens e

Leia mais

Revisão de Banco de Dados

Revisão de Banco de Dados Revisão de Banco de Dados Fabiano Baldo 1 Sistema de Processamento de Arquivos Antes da concepção dos BDs o registro das informações eram feitos através de arquivos. Desvantagens: Redundância e Inconsistência

Leia mais

Evolução. Tópicos. Bancos de Dados - Introdução. Melissa Lemos. Evolução dos Sistemas de Informação Esquemas Modelos. Características de SGBDs

Evolução. Tópicos. Bancos de Dados - Introdução. Melissa Lemos. Evolução dos Sistemas de Informação Esquemas Modelos. Características de SGBDs 1 Bancos de Dados - Introdução Melissa Lemos melissa@inf.puc-rio.br Tópicos Evolução dos Sistemas de Informação Esquemas Modelos Conceitual Lógico Características de SGBDs 2 Evolução tempo Programas e

Leia mais

Disciplina: Tecnologias de Banco de Dados para SI s

Disciplina: Tecnologias de Banco de Dados para SI s Curso de Gestão em SI Disciplina: Tecnologias de Banco de Dados para SI s Rodrigo da Silva Gomes (Extraído do material do prof. Ronaldo Melo - UFSC) Banco de Dados (BD) BD fazem parte do nosso dia-a-dia!

Leia mais

Introdução Banco de Dados

Introdução Banco de Dados Introdução Banco de Dados Vitor Valerio de Souza Campos Adaptado de Vania Bogorny Por que estudar BD? Os Bancos de Dados fazem parte do nosso dia-a-dia: operação bancária reserva de hotel matrícula em

Leia mais

PROJETO DE BANCO DE DADOS -INTRODUÇÃO. Prof. Angelo Augusto Frozza, M.Sc. http://about.me/tilfrozza

PROJETO DE BANCO DE DADOS -INTRODUÇÃO. Prof. Angelo Augusto Frozza, M.Sc. http://about.me/tilfrozza 1 PROJETO DE BANCO DE DADOS -INTRODUÇÃO Prof. Angelo Augusto Frozza, M.Sc. http://about.me/tilfrozza FUNDAMENTOS Dados Representação de fatos, conceitos ou instruções de maneira formalizada; Informação

Leia mais

04/08/2012 MODELAGEM DE DADOS. PROF. RAFAEL DIAS RIBEIRO, M.Sc. @ribeirord MODELAGEM DE DADOS. Aula 1. Prof. Rafael Dias Ribeiro. M.Sc.

04/08/2012 MODELAGEM DE DADOS. PROF. RAFAEL DIAS RIBEIRO, M.Sc. @ribeirord MODELAGEM DE DADOS. Aula 1. Prof. Rafael Dias Ribeiro. M.Sc. MODELAGEM DE DADOS PROF. RAFAEL DIAS RIBEIRO, M.Sc. @ribeirord MODELAGEM DE DADOS Aula 1 Prof. Rafael Dias Ribeiro. M.Sc. @ribeirord 1 Objetivos: Apresenta a diferença entre dado e informação e a importância

Leia mais

Sistemas de Banco de Dados Aspectos Gerais de Banco de Dados

Sistemas de Banco de Dados Aspectos Gerais de Banco de Dados Sistemas de Banco de Dados Aspectos Gerais de Banco de Dados 1. Conceitos Básicos No contexto de sistemas de banco de dados as palavras dado e informação possuem o mesmo significado, representando uma

Leia mais

GBC043 Sistemas de Banco de Dados. Introdução. Ilmério Reis da Silva ilmerio@facom.ufu.br www.facom.ufu.br/~ilmerio/sbd UFU/FACOM

GBC043 Sistemas de Banco de Dados. Introdução. Ilmério Reis da Silva ilmerio@facom.ufu.br www.facom.ufu.br/~ilmerio/sbd UFU/FACOM GBC043 Sistemas de Banco de Dados Introdução Ilmério Reis da Silva ilmerio@facom.ufu.br www.facom.ufu.br/~ilmerio/sbd UFU/FACOM Página 2 Definição BD Def. Banco de Dados é uma coleção de itens de dados

Leia mais

Sistemas Gerenciadores de Bancos de Dados

Sistemas Gerenciadores de Bancos de Dados Sistemas Gerenciadores de Bancos de Dados Orivaldo V. Santana Jr A partir de slides elaborados por Ivan G. Costa Filho Fernando Fonseca & Robson Fidalgo 1 Sistemas de Arquivos Sistemas de arquivos Principal

Leia mais

Plano de Ensino. Apresentação da Unidade Curricular

Plano de Ensino. Apresentação da Unidade Curricular Plano de Ensino Plano de Ensino Apresentação da Unidade Curricular o Funcionamento, arquitetura e conceitos fundamentais dos bancos de dados relacionais e objeto relacionais. Utilização de linguagem DDL

Leia mais

Banco de Dados Aula 1 Introdução a Banco de Dados Introdução Sistema Gerenciador de Banco de Dados

Banco de Dados Aula 1 Introdução a Banco de Dados Introdução Sistema Gerenciador de Banco de Dados Banco de Dados Aula 1 Introdução a Banco de Dados Introdução Um Sistema Gerenciador de Banco de Dados (SGBD) é constituído por um conjunto de dados associados a um conjunto de programas para acesso a esses

Leia mais

SISTEMA GERENCIADOR DE BANCO DE DADOS

SISTEMA GERENCIADOR DE BANCO DE DADOS BANCO DE DADOS Universidade do Estado de Santa Catarina Centro de Ciências Tecnológicas Departamento de Ciência da Computação Prof. Alexandre Veloso de Matos alexandre.matos@udesc.br SISTEMA GERENCIADOR

Leia mais

Banco de Dados I Introdução

Banco de Dados I Introdução Banco de Dados I Introdução Prof. Moser Fagundes Curso Técnico em Informática (Modalidade Integrada) IFSul Campus Charqueadas Sumário da aula Avaliações Visão geral da disciplina Introdução Histórico Porque

Leia mais

Persistência e Banco de Dados em Jogos Digitais

Persistência e Banco de Dados em Jogos Digitais Persistência e Banco de Dados em Jogos Digitais Prof. Marcos Francisco Pereira da Silva Especialista em Engenharia de Software Jogos Digitais - Computação Gráfica 1 Agenda Vantagens de usar a abordagem

Leia mais

TEMPTOOL UMA FERRAMENTA PARA A MODELAGEM TEMPORAL DOS DADOS

TEMPTOOL UMA FERRAMENTA PARA A MODELAGEM TEMPORAL DOS DADOS TEMPTOOL UMA FERRAMENTA PARA A MODELAGEM TEMPORAL DOS DADOS Eugênio de O. Simonetto 1, Cristiano R. Moreira, Duncan D. A. Ruiz 2, Luciano C. Ost 1, Glauco B.V.Santos 1 RESUMO O trabalho apresenta uma ferramenta

Leia mais

UFG - Instituto de Informática

UFG - Instituto de Informática UFG - Instituto de Informática Especialização em Desenvolvimento de Aplicações Web com Interfaces Ricas EJB 3.0 Prof.: Fabrízzio A A M N Soares professor.fabrizzio@gmail.com Aula 10 Persistência de Dados

Leia mais

INTRODUÇÃO E CONCEITOS BÁSICOS. Prof. Ronaldo R. Goldschmidt

INTRODUÇÃO E CONCEITOS BÁSICOS. Prof. Ronaldo R. Goldschmidt INTRODUÇÃO E CONCEITOS BÁSICOS Prof. Ronaldo R. Goldschmidt Hierarquia Dado - Informação - Conhecimento: Dados são fatos com significado implícito. Podem ser armazenados. Dados Processamento Informação

Leia mais

DESENVOLVIMENTO DE SISTEMA DE APOIO À GESTÃO DE EVENTO DO PROGRAMA DE EDUCAÇÃO TUTORIAL

DESENVOLVIMENTO DE SISTEMA DE APOIO À GESTÃO DE EVENTO DO PROGRAMA DE EDUCAÇÃO TUTORIAL DESENVOLVIMENTO DE SISTEMA DE APOIO À GESTÃO DE EVENTO DO PROGRAMA DE EDUCAÇÃO TUTORIAL Adler H. Schmidt, Caroline F. Vicentini, Patrick P. Viera, Ronaldo C. M. dos Santos, Andrea S. Charão Universidade

Leia mais

Introdução. Banco de dados. Por que usar BD? Por que estudar BD? Exemplo de um BD. Conceitos básicos

Introdução. Banco de dados. Por que usar BD? Por que estudar BD? Exemplo de um BD. Conceitos básicos Introdução Banco de Dados Por que usar BD? Vitor Valerio de Souza Campos Adaptado de Vania Bogorny 4 Por que estudar BD? Exemplo de um BD Os Bancos de Dados fazem parte do nosso dia-a-dia: operação bancária

Leia mais

Disciplina: Unidade I: Prof.: E-mail: Período:

Disciplina: Unidade I: Prof.: E-mail: Período: Encontro 02 Disciplina: Sistemas de Banco de Dados Unidade I: Introdução aos Sistemas de Banco de Dados Prof.: Mario Filho E-mail: pro@mariofilho.com.br Período: 5º. SIG - ADM 1. Introdução aos Sistemas

Leia mais

Banco de Dados. Aula 1 - Prof. Bruno Moreno 16/08/2011

Banco de Dados. Aula 1 - Prof. Bruno Moreno 16/08/2011 Banco de Dados Aula 1 - Prof. Bruno Moreno 16/08/2011 Roteiro Apresentação do professor e disciplina Definição de Banco de Dados Sistema de BD vs Tradicional Principais características de BD Natureza autodescritiva

Leia mais

Roteiro. Modelo de Dados Relacional. Processo de Projeto de Banco de Dados. BCC321 - Banco de Dados I. Ementa. Posicionamento.

Roteiro. Modelo de Dados Relacional. Processo de Projeto de Banco de Dados. BCC321 - Banco de Dados I. Ementa. Posicionamento. Roteiro Modelo de Dados Relacional Posicionamento Luiz Henrique de Campos Merschmann Departamento de Computação Universidade Federal de Ouro Preto luizhenrique@iceb.ufop.br www.decom.ufop.br/luiz Introdução

Leia mais

Modelagem de dados e uso do SGBD MySQL

Modelagem de dados e uso do SGBD MySQL CURSO DE VERÃO EM BIOINFORMÁTICA ESTRUTURAL Modelagem de dados e uso do SGBD MySQL Modelagem e projeto de banco de dados Arquitetura de três esquemas [1] USUÁRIOS Nível externo Visão externa Mapeamento

Leia mais

1. CONCEITOS BÁSICOS DE BD, SBD E SGBD

1. CONCEITOS BÁSICOS DE BD, SBD E SGBD Introdução 1. CONCEITOS BÁSICOS DE BD, SBD E SGBD A importância da informação para a tomada de decisões nas organizações tem impulsionado o desenvolvimento dos sistemas de processamento de informações.

Leia mais

ALESSANDRO RODRIGO FRANCO FERNANDO MARTINS RAFAEL ALMEIDA DE OLIVEIRA

ALESSANDRO RODRIGO FRANCO FERNANDO MARTINS RAFAEL ALMEIDA DE OLIVEIRA ALESSANDRO RODRIGO FRANCO FERNANDO MARTINS RAFAEL ALMEIDA DE OLIVEIRA INTRODUÇÃO O projeto de um banco de dados é realizado sob um processo sistemático denominado metodologia de projeto. O processo do

Leia mais

AULA 01-02-03 SISTEMAS DE GERENCIAMENTO DE BANCO DE DADOS

AULA 01-02-03 SISTEMAS DE GERENCIAMENTO DE BANCO DE DADOS AULA 01-02-03 SISTEMAS DE GERENCIAMENTO DE BANCO DE DADOS Curso: Sistemas de Informação (Subseqüente) Disciplina: Administração de Banco de Dados Prof. Abrahão Lopes abrahao.lopes@ifrn.edu.br História

Leia mais

BANCO DE DADOS AULA 02 INTRODUÇÃO AOS BANCOS DE DADOS PROF. FELIPE TÚLIO DE CASTRO 2015

BANCO DE DADOS AULA 02 INTRODUÇÃO AOS BANCOS DE DADOS PROF. FELIPE TÚLIO DE CASTRO 2015 BANCO DE DADOS AULA 02 INTRODUÇÃO AOS BANCOS DE DADOS PROF. FELIPE TÚLIO DE CASTRO 2015 NA AULA PASSADA... 1. Apresentamos a proposta de ementa para a disciplina; 2. Discutimos quais as ferramentas computacionais

Leia mais

Banco de Dados aplicado a Sistemas Biológicos

Banco de Dados aplicado a Sistemas Biológicos Dados Biológicos Banco de Dados aplicado a Sistemas Biológicos A internet mudou a maneira como os cientistas compartilham os dados e possibilitou que um depósito central de informações atendesse totalmente

Leia mais

DSI é o processo cujo objetivo é introduzir mudanças num sistema de informação, com objetivo de melhorar o seu desempenho.

DSI é o processo cujo objetivo é introduzir mudanças num sistema de informação, com objetivo de melhorar o seu desempenho. - DSI DSI é o processo cujo objetivo é introduzir mudanças num sistema de informação, com objetivo de melhorar o seu desempenho. Preocupação: Problema técnicos Mudança na natureza e conteúdo do trabalho

Leia mais

Introdução e conceitos. Capítulo 1

Introdução e conceitos. Capítulo 1 Introdução e conceitos Capítulo 1 1 Temário Banco de Dados Compartilhamento de dados Sistema de Gerência de Banco de Dados Modelos de Banco de Dados Modelo conceitual Modelo lógico Modelo conceitual como

Leia mais

Banco de Dados I. Introdução. Fabricio Breve

Banco de Dados I. Introdução. Fabricio Breve Banco de Dados I Introdução Fabricio Breve Introdução SGBD (Sistema Gerenciador de Banco de Dados): coleção de dados interrelacionados e um conjunto de programas para acessar esses dados Coleção de dados

Leia mais

Prof.: Clayton Maciel Costa clayton.maciel@ifrn.edu.br

Prof.: Clayton Maciel Costa clayton.maciel@ifrn.edu.br Programação com acesso a BD Prof.: Clayton Maciel Costa clayton.maciel@ifrn.edu.br 1 Modelos de Dados, Esquemas e Instâncias 2 Modelos de Dados, Esquemas e Instâncias Modelo de dados: Conjunto de conceitos

Leia mais

Dados. Qualquer elemento (aspecto, fato, medida etc.) representativo, disponível e coletável na realidade. fatos no estado bruto, conforme Platão;

Dados. Qualquer elemento (aspecto, fato, medida etc.) representativo, disponível e coletável na realidade. fatos no estado bruto, conforme Platão; Dados Os Dados são os fatos em sua forma primária, como observamos no mundo. Qualquer elemento (aspecto, fato, medida etc.) representativo, disponível e coletável na realidade. fatos no estado bruto, conforme

Leia mais

Sistemas Gerenciadores de Bancos de Dados

Sistemas Gerenciadores de Bancos de Dados Sistemas Gerenciadores de Bancos de Dados Fernando Castor A partir de slides elaborados por Fernando Fonseca & Robson Fidalgo 1 Sistemas de Arquivos Sistemas de arquivos Principal característica é a replicação

Leia mais

INTRODUÇÃO. Diferente de Bando de Dados

INTRODUÇÃO. Diferente de Bando de Dados INTRODUÇÃO Diferente de Bando de Dados 1 INTRODUÇÃO DADOS São fatos conhecidos que podem ser registrados e que possuem significado. Ex: venda de gasolina gera alguns dados: data da compra, preço, qtd.

Leia mais

Anotação de Genomas. Fabiana G. S. Pinto

Anotação de Genomas. Fabiana G. S. Pinto Anotação de Genomas Fabiana G. S. Pinto Obtenção de Seqüências geradas pelo MegaBace 1000 Dados brutos (medidas analógicas) de saída do seqüênciamento Base calling BIOINFORMÁTICA * PHRED: - Transforma

Leia mais

SGBD ITB 1.INTRODUÇÃO 1.INTRODUÇÃO. 1.1. Conceito SGBD: Sistema gerenciador de banco de dados. 1.2. Constituição SGBD

SGBD ITB 1.INTRODUÇÃO 1.INTRODUÇÃO. 1.1. Conceito SGBD: Sistema gerenciador de banco de dados. 1.2. Constituição SGBD ITB SGBD Aurélio Candido Jr 1 1.INTRODUÇÃO 1.1. Conceito SGBD: Sistema gerenciador de banco de dados Um SGBD é uma coleção de programas que permitem ao usuário definir, construir e manipular Bases de Dados

Leia mais

Roteiro. Conceitos e Arquitetura de Sistemas de Banco de Dados. Conceitos e Arquiteturas de Sistemas de Banco de Dados. BCC321 - Banco de Dados I

Roteiro. Conceitos e Arquitetura de Sistemas de Banco de Dados. Conceitos e Arquiteturas de Sistemas de Banco de Dados. BCC321 - Banco de Dados I Roteiro Conceitos e Arquitetura de Sistemas de Banco de Dados Luiz Henrique de Campos Merschmann Departamento de Computação Universidade Federal de Ouro Preto luizhenrique@iceb.ufop.br www.decom.ufop.br/luiz

Leia mais

Etc & Tal. Volume 2 - Número 1 - Abril 2009 SBC HORIZONTES 44

Etc & Tal. Volume 2 - Número 1 - Abril 2009 SBC HORIZONTES 44 Armazenando Dados em Aplicações Java Parte 2 de 3: Apresentando as opções Hua Lin Chang Costa, hualin@cos.ufrj.br, COPPE/UFRJ. Leonardo Gresta Paulino Murta, leomurta@ic.uff.br, IC/UFF. Vanessa Braganholo,

Leia mais

Disciplina de Banco de Dados Introdução

Disciplina de Banco de Dados Introdução Disciplina de Banco de Dados Introdução Prof. Elisa Maria Pivetta CAFW - UFSM Banco de Dados: Conceitos A empresa JJ. Gomes tem uma lista com mais ou menos 4.000 nomes de clientes bem como seus dados pessoais.

Leia mais

Hoje é inegável que a sobrevivência das organizações depende de dados precisos e atualizados.

Hoje é inegável que a sobrevivência das organizações depende de dados precisos e atualizados. BANCO DE DADOS Universidade do Estado de Santa Catarina Centro de Ciências Tecnológicas Departamento de Ciência da Computação Prof. Alexandre Veloso de Matos alexandre.matos@udesc.br INTRODUÇÃO Hoje é

Leia mais

Banco de Dados, Integração e Qualidade de Dados. Ceça Moraes cecafac@gmail.com

Banco de Dados, Integração e Qualidade de Dados. Ceça Moraes cecafac@gmail.com Banco de Dados, Integração e Qualidade de Dados Ceça Moraes cecafac@gmail.com Sobre a professora CeçaMoraes Doutora em Computação (UFPE) Áreas de atuação Desenvolvimento de Software e Banco de Dados Experiência

Leia mais

MODELO RELACIONAL - UFMA

MODELO RELACIONAL - UFMA MODELO RELACIONAL Universidade Federal do Maranhão - UFMA Departamento de Informática Projeto de Banco de Dados Profª.MSc Simara Rocha simararocha@gmail.com/simara@deinf.ufma.br www.deinf.ufma.br/~simara

Leia mais

Projeto de Banco de Dados. Disciplina: Banco de Dados I José Antônio da Cunha

Projeto de Banco de Dados. Disciplina: Banco de Dados I José Antônio da Cunha Projeto de Banco de Dados Disciplina: Banco de Dados I José Antônio da Cunha Introdução Banco de Dados Esta aula apresenta os conceitos da área de banco de dados, que são necessários à compreensão do projeto

Leia mais

Introdução e conceitos. Capítulo 1

Introdução e conceitos. Capítulo 1 Introdução e conceitos Capítulo 1 Temário Banco de Dados Compartilhamento de dados Sistema de Gerência de Banco de Dados Modelos de Banco de Dados Modelo conceitual Modelo lógico Modelo conceitual como

Leia mais

PROPOSTA DE SOFTWARE DE INSTALAÇÃO PARA UM AMBIENTE INTEGRADO DE GERÊNCIA DE PROJETOS E DE PROCESSOS DE NEGÓCIOS

PROPOSTA DE SOFTWARE DE INSTALAÇÃO PARA UM AMBIENTE INTEGRADO DE GERÊNCIA DE PROJETOS E DE PROCESSOS DE NEGÓCIOS PROPOSTA DE SOFTWARE DE INSTALAÇÃO PARA UM AMBIENTE INTEGRADO DE GERÊNCIA DE PROJETOS E DE PROCESSOS DE NEGÓCIOS Élysson Mendes Rezende Bacharelando em Sistemas de Informação Bolsista de Iniciação Científica

Leia mais

Conceitos básicos. Aplicações de banco de dados. Conceitos básicos (cont.) Dado: Um fato, alguma coisa sobre a qual uma inferência é baseada.

Conceitos básicos. Aplicações de banco de dados. Conceitos básicos (cont.) Dado: Um fato, alguma coisa sobre a qual uma inferência é baseada. Conceitos básicos Angélica Toffano Seidel Calazans E-mail: angelica_toffano@yahoo.com.br Conceitos introdutórios de Modelagem de dados Dado: Um fato, alguma coisa sobre a qual uma inferência é baseada.

Leia mais

Banco de Dados I. Apresentação (mini-currículo) Conceitos. Disciplina Banco de Dados. Cont... Cont... Edson Thizon (edson@esucri.com.

Banco de Dados I. Apresentação (mini-currículo) Conceitos. Disciplina Banco de Dados. Cont... Cont... Edson Thizon (edson@esucri.com. Sistemas da Informação Banco de Dados I Edson Thizon (edson@esucri.com.br) 2008 Apresentação (mini-currículo) Formação Acadêmica Mestrando em Ciência da Computação (UFSC/ ) Créditos Concluídos. Bacharel

Leia mais

Banco de Dados. Uma coleção de dados relacionados [ELMASRI/NAVATHE]

Banco de Dados. Uma coleção de dados relacionados [ELMASRI/NAVATHE] 1/6 Banco de Dados O que é um Banco de Dados? Uma coleção de dados relacionados [ELMASRI/NAVATHE] Conjunto de dados integrados que tem por objetivo atender a uma comunidade específica [HEUSER] Um conjunto

Leia mais

Prevayler. Perola. André Luís Sales de Moraes Juliana Keiko Yamaguchi Tatiana Yuka Takaki

Prevayler. Perola. André Luís Sales de Moraes Juliana Keiko Yamaguchi Tatiana Yuka Takaki Prevayler Perola André Luís Sales de Moraes Juliana Keiko Yamaguchi Tatiana Yuka Takaki Prevayler Prevayler é a implementação em Java do conceito de Prevalência. É um framework que prega uma JVM invulnerável

Leia mais

GEE051 - Banco de Dados (BD) Plano de Curso. Ilmério Reis da Silva ilmerio@facom.ufu.br www.facom.ufu.br/~ilmerio/bd UFU/FACOM - 2011/2

GEE051 - Banco de Dados (BD) Plano de Curso. Ilmério Reis da Silva ilmerio@facom.ufu.br www.facom.ufu.br/~ilmerio/bd UFU/FACOM - 2011/2 GEE051 - Banco de Dados (BD) Plano de Curso Ilmério Reis da Silva ilmerio@facom.ufu.br www.facom.ufu.br/~ilmerio/bd UFU/FACOM - 2011/2 Motivação Problemas reais encontrados por engenheiros exigem uma visão

Leia mais

Objetivos Específico

Objetivos Específico Banco de Dados Ementa (DBA) Conceitos Gerais sobre Banco de Dados Instalação e configuração da Ferramenta de Banco de Dados. Elaboração de projeto de Banco de Dados. Implementação do projeto de Banco de

Leia mais

Curso Superior de Tecnologia em BD Curso Superior de Tecnologia em DAI

Curso Superior de Tecnologia em BD Curso Superior de Tecnologia em DAI Curso Superior de Tecnologia em BD Curso Superior de Tecnologia em DAI Fundamentos de Banco de Dados Aula 01 Introdução aos Sistemas de Bancos de Dados Introdução aos Sistemas de BD Objetivo Apresentar

Leia mais

INTRODUÇÃO. Enfoque abstrato. Enfoque Intermediário

INTRODUÇÃO. Enfoque abstrato. Enfoque Intermediário BANCO DE DADOS Universidade do Estado de Santa Catarina Centro de Ciências Tecnológicas Departamento de Ciência da Computação Prof. Alexandre Veloso de Matos alexandre.matos@udesc.br INTRODUÇÃO Enfoque

Leia mais

ABORDAGEM DE FRAMEWORKS PARA JSF QUE AUXILIAM O DESENVOLVIMENTO DE SOFTWARE

ABORDAGEM DE FRAMEWORKS PARA JSF QUE AUXILIAM O DESENVOLVIMENTO DE SOFTWARE ABORDAGEM DE FRAMEWORKS PARA JSF QUE AUXILIAM O DESENVOLVIMENTO DE SOFTWARE Amarildo Aparecido Ferreira Junior 1, Ricardo Ribeiro Rufino 1 ¹Universidade Paranaense (Unipar) Paranavaí PR Brasil aapfjr@gmail.com

Leia mais

Bancos de dados distribuídos Prof. Tiago Eugenio de Melo tiagodemelo@gmail.com. http://www.tiagodemelo.info

Bancos de dados distribuídos Prof. Tiago Eugenio de Melo tiagodemelo@gmail.com. http://www.tiagodemelo.info Bancos de dados distribuídos Prof. Tiago Eugenio de Melo tiagodemelo@gmail.com Última atualização: 20.03.2013 Conceitos Banco de dados distribuídos pode ser entendido como uma coleção de múltiplos bds

Leia mais

Curso Superior de Tecnologia em BD

Curso Superior de Tecnologia em BD Curso Superior de Tecnologia em BD Modelagem de Dados Aula 01 Revisão Modelos de Dados Existem modelos para diferentes níveis de abstração de representação de dados modelos conceituais modelos lógicos

Leia mais

Banco de Dados Aula 02. Colégio Estadual Padre Carmelo Perrone Profº: Willian

Banco de Dados Aula 02. Colégio Estadual Padre Carmelo Perrone Profº: Willian Banco de Dados Aula 02 Colégio Estadual Padre Carmelo Perrone Profº: Willian Conceitos básicos Dado: Valor do campo quando é armazenado dento do BD; Tabela Lógica: Representa a estrutura de armazenamento

Leia mais

INTRODUÇÃO BANCO DE DADOS. Prof. Msc. Hélio Esperidião

INTRODUÇÃO BANCO DE DADOS. Prof. Msc. Hélio Esperidião INTRODUÇÃO BANCO DE DADOS Prof. Msc. Hélio Esperidião BANCO DE DADOS Podemos entender por banco de dados qualquer sistema que reúna e mantenha organizada uma série de informações relacionadas a um determinado

Leia mais

Aula 02 Modelagem de Dados. Banco de Dados. Aula 02 Modelagem de Dados. Superior /2011 Redes Computadores - Disciplina: Banco de Dados -

Aula 02 Modelagem de Dados. Banco de Dados. Aula 02 Modelagem de Dados. Superior /2011 Redes Computadores - Disciplina: Banco de Dados - Banco de Dados Aula 02 Modelagem de Dados Roteiro Definição Evolução Projeto de BD Abstração Esquema e Instância Definição É uma representação, normalmente gráfica, de estruturas de dados reais. Auxilia

Leia mais

SISTEMAS DE INFORMAÇÃO GERENCIAIS

SISTEMAS DE INFORMAÇÃO GERENCIAIS SISTEMAS DE INFORMAÇÃO GERENCIAIS Aluno: Luiza Cavalcanti Marques Orientador: Silvio Hamacher Introdução A modelagem e a utilização de bancos de dados em atividades gerenciais têm sofrido um aumento significativo

Leia mais

UNIVERSIDADE ESTADUAL DO CENTRO-OESTE UNICENTRO CURSO DE ESPECIALIZAÇÃO EM MÍDIAS EM EDUCAÇÃO

UNIVERSIDADE ESTADUAL DO CENTRO-OESTE UNICENTRO CURSO DE ESPECIALIZAÇÃO EM MÍDIAS EM EDUCAÇÃO UNIVERSIDADE ESTADUAL DO CENTRO-OESTE UNICENTRO CURSO DE ESPECIALIZAÇÃO EM MÍDIAS EM EDUCAÇÃO Jader dos Santos Teles Cordeiro Orientador Prof. Paulo Guilhermeti PERSISTÊNCIA EM OBJETOS JAVA: UMA ANÁLISE

Leia mais

Conteúdo. Disciplina: INF 02810 Engenharia de Software. Monalessa Perini Barcellos. Centro Tecnológico. Universidade Federal do Espírito Santo

Conteúdo. Disciplina: INF 02810 Engenharia de Software. Monalessa Perini Barcellos. Centro Tecnológico. Universidade Federal do Espírito Santo Universidade Federal do Espírito Santo Centro Tecnológico Departamento de Informática Disciplina: INF 02810 Prof.: (monalessa@inf.ufes.br) Conteúdo 1. Introdução 2. Processo de Software 3. Gerência de

Leia mais

Conceitos Básicos. Conceitos Básicos. Sistema de Arquivos. Prof. Edilberto Silva - edilms@yahoo.com. Sistemas de Informação Brasília/DF

Conceitos Básicos. Conceitos Básicos. Sistema de Arquivos. Prof. Edilberto Silva - edilms@yahoo.com. Sistemas de Informação Brasília/DF 2 Conceitos Básicos Material baseado nas notas de aula: Maria Luiza M. Campos IME/2005 Carlos Heuser - livro Projeto de Banco de Dados CasaNova / PUC/RJ Prof. MSc. Edilberto Silva edilms@yahoo.com Sistemas

Leia mais

Banco de Dados. Conceitos e Arquitetura de Sistemas de Banco de Dados. Profa. Flávia Cristina Bernardini

Banco de Dados. Conceitos e Arquitetura de Sistemas de Banco de Dados. Profa. Flávia Cristina Bernardini Banco de Dados Conceitos e Arquitetura de Sistemas de Banco de Dados Profa. Flávia Cristina Bernardini Relembrando... Vantagens da Utilização de SGBD Redundância controlada Consistência dos dados armazenados

Leia mais

INF220 - Banco de Dados I

INF220 - Banco de Dados I Banco de Dados - Introdução Bibliografia INF220 - Banco de Dados I Prof. Jugurta Lisboa Filho Departamento de Informática - UFV Notas de Aula (jugurta@dpi.ufv.br) ELMASRI, R; NAVATHE, S. Fundamentals of

Leia mais

2. Sistemas Multi-Agentes (Multi-Agent System - MAS)

2. Sistemas Multi-Agentes (Multi-Agent System - MAS) AORML uma linguagem para modelagem de uma aplicação Multiagentes: Uma Aplicação no Sistema Expertcop. Hebert de Aquino Nery, Daniel Gonçalves de Oliveira e Vasco Furtado. Universidade de Fortaleza UNIFOR

Leia mais

Microsoft Access XP Módulo Um

Microsoft Access XP Módulo Um Microsoft Access XP Módulo Um Neste primeiro módulo de aula do curso completo de Access XP vamos nos dedicar ao estudo de alguns termos relacionados com banco de dados e as principais novidades do novo

Leia mais

Noções de. Microsoft SQL Server. Microsoft SQL Server

Noções de. Microsoft SQL Server. Microsoft SQL Server Noções de 1 Considerações Iniciais Basicamente existem dois tipos de usuários do SQL Server: Implementadores Administradores 2 1 Implementadores Utilizam o SQL Server para criar e alterar base de dados

Leia mais

Introdução à Computação

Introdução à Computação Aspectos Importantes - Desenvolvimento de Software Motivação A economia de todos países dependem do uso de software. Cada vez mais, o controle dos processos tem sido feito por software. Atualmente, os

Leia mais

20/05/2013. Sistemas de Arquivos Sistemas de arquivos. Sistemas de Gerenciamento de Banco de Dados (SGBD) Banco de Dados. Estrutura de um BD SGBD

20/05/2013. Sistemas de Arquivos Sistemas de arquivos. Sistemas de Gerenciamento de Banco de Dados (SGBD) Banco de Dados. Estrutura de um BD SGBD Gerenciamento de Dados e Informação Fernando Fonseca Ana Carolina Robson Fidalgo Sistemas de Arquivos Sistemas de arquivos Principal característica é a replicação e isolamento de dados (ilhas de informações)

Leia mais

Etapas da evolução rumo a tomada de decisão: Aplicações Isoladas: dados duplicados, dados inconsistentes, processos duplicados.

Etapas da evolução rumo a tomada de decisão: Aplicações Isoladas: dados duplicados, dados inconsistentes, processos duplicados. Histórico Etapas da evolução rumo a tomada de decisão: Aplicações Isoladas: dados duplicados, dados inconsistentes, processos duplicados. Sistemas Integrados: racionalização de processos, manutenção dos

Leia mais

Requisitos de Software

Requisitos de Software Requisitos de Software Ian Sommerville 2006 Engenharia de Software, 8ª. edição. Capítulo 6 Slide 1 Objetivos Apresentar os conceitos de requisitos de usuário e de sistema Descrever requisitos funcionais

Leia mais

Aplicação Prática de Lua para Web

Aplicação Prática de Lua para Web Aplicação Prática de Lua para Web Aluno: Diego Malone Orientador: Sérgio Lifschitz Introdução A linguagem Lua vem sendo desenvolvida desde 1993 por pesquisadores do Departamento de Informática da PUC-Rio

Leia mais

BANCO DE DADOS 1 AULA 1. estrutura do curso e conceitos fundamentais. Professor Luciano Roberto Rocha. www.lrocha.com contato@lrocha.

BANCO DE DADOS 1 AULA 1. estrutura do curso e conceitos fundamentais. Professor Luciano Roberto Rocha. www.lrocha.com contato@lrocha. BANCO DE DADOS 1 AULA 1 estrutura do curso e conceitos fundamentais Professor Luciano Roberto Rocha www.lrocha.com contato@lrocha.com 1 ROTEIRO Apresentação do Docente; Apresentação da Ementa da Disciplina;

Leia mais

Disciplina de Banco de Dados Parte V

Disciplina de Banco de Dados Parte V Disciplina de Banco de Dados Parte V Prof. Elisa Maria Pivetta CAFW - UFSM Modelo de Dado Relacional O Modelo Relacional O Modelo ER é independente do SGDB portanto, deve ser o primeiro modelo gerado após

Leia mais

Guia de Acesso Rápido AVA Ambiente Virtual de Aprendizagem Aluno

Guia de Acesso Rápido AVA Ambiente Virtual de Aprendizagem Aluno Guia de Acesso Rápido AVA Ambiente Virtual de Aprendizagem Aluno Introdução O Ambiente de Aprendizagem, ou AVA, é um aplicativo web onde os educadores e alunos podem disponibilizar materiais didáticos,

Leia mais

ANEXO 11. Framework é um conjunto de classes que colaboram para realizar uma responsabilidade para um domínio de um subsistema da aplicação.

ANEXO 11. Framework é um conjunto de classes que colaboram para realizar uma responsabilidade para um domínio de um subsistema da aplicação. ANEXO 11 O MATRIZ Para o desenvolvimento de sites, objeto deste edital, a empresa contratada obrigatoriamente utilizará o framework MATRIZ desenvolvido pela PROCERGS e disponibilizado no início do trabalho.

Leia mais

Laboratório de Banco de Dados

Laboratório de Banco de Dados Universidade Federal de Mato Grosso-UFMT Sistemas de Informação Laboratório de Banco de Dados Prof. Clóvis Júnior Laboratório de Banco de Dados Conteúdo Administração de Usuários de Papéis; Linguagens

Leia mais