Probabilidade. Prof. Hemílio Fernandes Campos Coêlho. Departamento de Estatística - Universidade Federal da Paraíba - UFPB

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Probabilidade. Prof. Hemílio Fernandes Campos Coêlho. Departamento de Estatística - Universidade Federal da Paraíba - UFPB"

Transcrição

1 Probabilidade Prof. Hemílio Fernandes Campos Coêlho Departamento de Estatística - Universidade Federal da Paraíba - UFPB

2 Introdução Encontramos na natureza dois tipos de fenômenos: Determinísticos e Não-determinísticos (probabilísticos ou aleatórios); 1. Determinísticos: Os resultados são sempre os mesmos e determinados pelas condições sob as quais o procedimento seja executado. Exemplos: Ponto de ebulição da água, ponto de congelamento da água, lançamento de uma pedra no vácuo, avaliação matemática da energia, força, etc. 2. Não-determinísticos: Normalmente utilizados em situações que envolvem incerteza. Ou seja, resultados que variam de uma observação para outra, mesmo em condições normais de experimentação. Exemplos: Fatores de risco (para ataque cardíaco, câncer, diabetes, etc.), As condições do experimento determinam apenas o comportamento probabilístico do resultado observável.

3 Experimentos aleatórios São aqueles onde o processo de experimentação está sujeito a inuências de fatores casuais que conduzem a resultados incertos. Exemplo: Lançar um dado, lançar uma moeda, retirar uma carta de um baralho, preço do dólar ao m do dia, aplicação de um novo medicamento em um grupo de pacientes com tuberculose, resultado da alteração de dose de um medicamento em pacientes com determinada doença crônica, etc.

4 Características de um evento aleatório Pode ser repetido indenidamente sob as mesmas condições; Podemos descrever todos os possíveis resultados, matematicamente ou não. Depois de um número grande de repetições de um experimento aleatório, ocorre uma regularidade na frequência relativa, denida anteriormente como f ri = f i n, onde f i é o número de ocorrências de um determinado resultado e n é o número total de repetições do experimento.

5 Conceitos Iniciais Espaço Amostral (Ω): É o conjunto de todos os possíveis resultados de um experimento aleatório. Exemplo: Lançamento de um dado: Ω = {1, 2, 3, 4, 5, 6} Evento: Dado um espaço amostral Ω, associado a um experimento E qualquer, denimos como evento qualquer subconjunto desse espaço amostral. Exemplo: No caso anterior, considere o evento A, sair um número par, ou seja: A = {2, 4, 6}

6 Esquema Ilustrativo

7 Tipos de Eventos Eventos Mutuamente Exclusivos: Dois eventos, A e B, serão mutuamente exclusivos se não puderem ocorrer na mesma tentativa, isto é, a ocorrência do evento A impede a ocorrência de B. Na teoria dos conjuntos representamos que dois eventos são mutuamente exclusivos por A B =. Exemplo: A = {2, 4, 6} e B = {1, 3, 5}. Temos que A B = Eventos Não-mutuamente Exclusivos: Quando os eventos possuem elementos comuns em relação à ocorrência, estes NÃO serão mutuamente exclusivos, ou seja A B.

8 Esquema Ilustrativo

9 Esquema Ilustrativo

10 Probabilidade É uma medida com a qual podemos esperar a chance de ocorrência de um determinado evento A, atribuindo-a um número (valor) entre 0 e 1. O que quer dizer? Signica dizer que se temos a certeza de que um evento ocorrerá, diremos que sua probabilidade é 1 (ou 100%). Se temos certeza de que um evento NÃO ocorrerá, diremos que sua probabilidade é 0 (ou 0%). Quando a probabilidade de um evento não for nem 0 nem 1, teremos um valor P(A) entre estes dois números, o que levará à conclusões favoráveis ou não à ocorrência de um evento, ou seja: 0 P(A) 1 ou 0% P(A) 100%

11 continuação Quando falamos que a probabilidade de um evento está SEMPRE entre 0 e 1, signica matematicamente que, dado um evento A qualquer, Número de casos favoráveis ao evento A P(A) = Número total de casos Note que o número total de casos é igual à quantidade de elementos pertencentes à Ω.

12 Operações com eventos A forma de determinar o espaço amostral é através de um dispositivo gráco, em que o espaço amostral (Ω ou S) é representado por retângulos e os eventos por círculos. Esse dispositivo é chamado de Diagrama de Venn:

13 Representação de operações União Situações em que A ocorre, B ocorre, ou ocorrem A e B simultaneamente são chamadadas união (A B):

14 continuação Interseção Há situações em que A ocorre e B ocorre nos permite dizer que A e B ocorrem simultaneamente. Esta situação, denotada por A B é chamada interseção:

15 continuação Diferença Fala-se em diferença entre eventos quando ocorre A e não ocorre B. A operação diferença é denotada por D = A B. Note que A e B têm pontos em comum, da diferença só fazem parte os pontos de A não pertencentes a B.

16 continuação Complemento Fala-se em complemento ou complementar quando temos a diferença entre todo o espaço amostral e um evento em particular. O complementar de um evento A, por exemplo, é denotado por A c.

17 EXEMPLOS DE OPERAÇÕES Espaço Amostral: Ω = {1, 2, 3, 4, 5, 6, 7, 8, 9, 10} Eventos: A = {1, 4, 7, 8, 9}, B = {2, 4, 6, 8, 10}, C = {valores maiores ou iguais a 7}, D = {3, 5} Temos que: A B = {1, 2, 4, 6, 7, 8, 9, 10} B C = {2, 4, 6, 7, 8, 9, 10} A B = {4, 8} B C = {8, 10} A B C = {8} A c = {2, 3, 5, 6, 10} B c = {1, 3, 5, 7, 9} C c = {1, 2, 3, 4, 5, 6} (A B) c = {1, 2, 3, 5, 6, 7, 9, 10} (B C) c = {1, 2, 3, 4, 5, 6, 7, 9} A B C D = Ω

18 Observações Importantes: Temos sempre certeza de que ocorrerá qualquer evento de um espaço amostral ao executarmos um experimento. A chance de ocorrer qualquer evento de Ω é o mesmo que escrever P(Ω) = 1. Se A e B são dois eventos mutuamente exclusivos (ou excludentes), então P(A B) = P(A) + P(B) Se A e B são dois eventos que NÃO são mutuamente exclusivos, então Se A =, então P(A) = 0 P(A B) = P(A) + P(B) P(A B)

19 continuação A e A c são eventos mutuamente exclusivos. Ou seja: A A c =. Além disso, A A c = Ω. A partir destas informações, temos uma propriedade importante sobre eventos complementares: P(A A c ) = P(A) + P(A c ) P(Ω) = P(A) + P(A c ) 1 = P(A) + P(A c ) = P(A c ) = 1 P(A) Podemos interpretar também a probabilidade como o valor correspondente à frequência relativa de um determinado resultado após a realização do experimento n vezes. A soma de todas as probabilidades de todos os n eventos n pertencentes ao espaço amostral é igual a 1, ou seja: P(A i ) = 1. i=1

20 EXEMPLO No exemplo anterior, Espaço Amostral: Ω = {1, 2, 3, 4, 5, 6, 7, 8, 9, 10} Eventos: A = {1, 4, 7, 8, 9}, B = {2, 4, 6, 8, 10}, C = {valores maiores ou iguais a 7} Temos que: P (A B) = P(A) + P(B) P(A B) = = 8 P (B C) = P(B) + P(C) P(B C) = = 7 P (A c ) = 1 P(A) = = 5 10 { P (A B) c} = 1 P (A B) = =

21 EXEMPLO Suponha o lançamento de uma moeda. Como avaliar a probabilidade de ocorrência de suas faces? O espaço amostral é dado por Ω = {C, K}, onde C =Cara e K =Coroa Note que o total de valores do espaço amostral é igual a 2. Note que cada ponto amostral (C ou K ) representam elementos pertencentes ao espaço amostral. Ou seja, temos uma descrição completa de tudo o que pode acontecer na ocorrência do experimento.

22 continuação Suponha que o nosso evento de interesse é: A = {sair cara} Portanto, se estamos interessados em avaliar a probabilidade de A, temos que Número de casos favoráveis ao evento A P(A) = = 1 Número total de casos 2 O evento B = {Sair coroa} também pode ser um evento de interesse. Note que. P(B) = 1 2 Note ainda que B = A c, pois A B = Ω. Dessa forma, aplicando a fórmula para eventos complementares P(B) = P(A c ) = 1 P(A) = 1 1 2

23 EXEMPLO Considere os dados do quadro a seguir, que mostra 15 indivíduos classicados quanto às variáveis obesidade e sedentarismo INDIVÍDUO OBESIDADE SEDENTARISMO 1 NÃO SIM 2 NÃO NÃO 3 SIM SIM 4 NÃO SIM 5 SIM NÃO 6 SIM SIM 7 NÃO NÃO 8 NÃO SIM 9 NÃO SIM 10 SIM SIM 11 NÃO NÃO 12 NÃO NÃO 13 SIM SIM 14 NÃO NÃO 15 NÃO SIM

24 continuação Seja A =OBESIDADE e B =SEDENTARISMO Então, uma estimativa de probabilidade de um indivíduo ser obeso, com base nos dados da amostra é: P(A) = 5 = 0, 3 = 30% 15 A probabilidade de um indivíduo ser sedentário, com base nos dados da amostra é: P(B) = 9 = 0, 6 = 60% 15

25 continuação A probabilidade de um indivíduo ser obeso E sedentário, com base nos dados da amostra é: P(A B) = 4 15 A probabilidade de um indivíduo ser obeso OU sedentário, com base nos dados da amostra é: P(A B) = P(A)+P(B) P(A B) = = 0, 6667 = 66, 67% 15

26 Mais sobre cálculo de probabilidades Com base no que foi visto, podemos estimar uma probabilidade com base na proporção de casos da ocorrência de interesse (frequência relativa). Entretanto, uma vez estabelecida a probabilidade de um ou vários eventos, existem diversos cálculos que podem ser feitos. Alguns destes casos serão vistos de acordo com situações clássicas apresentadas a seguir.

27 Lei Multiplicativa Dado um evento A, com probabilidade P(A), a probabilidade de que esse evento se repita n vezes pode ser do nosso interesse. Então: Para facilitar o entendimento, vamos descrever a situação mencionada ou seja: Evento: A sair na 1 a execução do experimento = A 1 Evento: A sair na 2 a execução do experimento = A 2 Evento: A sair na 3 a execução do experimento = A 3. Evento: A sair na n a execução do experimento = A n Logo, P (o evento A ocorrer n vezes) = P (A 1 A 2 A 3 A n ) P (A 1 A 2 A 3 A n ) = P(A 1 ) P(A 2 ) P(A 3 )... P(A n )

28 continuação Se a ocorrência do evento A em cada uma das vezes não for afetada pelas ocorrências anteriores, dizemos que os eventos descritos anteriormente são independentes. Dessa forma, a expressão anterior é dada por P(A 1 ) P(A 2 ) P(A 3 )... P(A n ) = [P (A)] n

29 EXEMPLO Suponha que existam cinco possibilidades de resultados em um experimento a ser realizado, sendo dois destes resultados favoráveis ao evento A e os demais são favoráveis à ocorrência de A c. Ou seja: Ω = {,,,, }, onde A = {, } e A c = {,, }. É fácil perceber que para UMA execução do experimento, P(A) = 2 5. Suponha que agora que o experimento é realizado DUAS vezes, e temos interesse em saber a chance de A ocorrer na primeira vez e na segunda vez. A ocorrência do primeiro resultado não interfere na ocorrência do segundo. O diagrama a seguir mostra todos os possíveis resultados do experimento.

30 continuação 1 a vez 2 a vez É possível notar que existem 25 resultados possíveis no experimento. Ainda, é possível notar que em 4 deles ocorre o nosso evento de interesse. Ou seja: P(A) = No de resultados do evento A na 1 a vez e A na 2 a vez Número de resultados possíveis = 4 25 = P(A 1) P(A 2 )

31 EXEMPLO Suponha que a probabilidade de que um embrião seja xado na parede do útero é de 5%, ou 0,05. Se uma mulher recebe o implante de três embriões, qual é a probabilidade de que todos os três embriões tenham êxito? Solução: Evento A = {Embrião xado} P(A) = 0, 05 Considerando que as probabilidades sejam independentes, P(A 1 A 2 A 3 ) = P(A 1 ) P(A 2 ) P(A 3 ) = (0, 05) 3 = 0, = 0, 0125% Interpretação: Supondo que todos os embriões implantados sobrevivam ao período de gestação, a probabilidade de trigêmeos seria, neste caso, de 1,25 em 10 mil. Ou seja, de cada 10 mil tentativas, 1 ou 2 destas vai resultar em gestação de trigêmeos.

32 EXEMPLO Suponha que uma gaiola contém 10 camundongos, cinco de cada sexo. Considere agora que é retirado ao acaso um camundongo de cada vez para ser submetido a um teste. Ao término do teste, o animal é reintroduzido na gaiola. Denominando os eventos: F = {Fêmea} e M = {Macho}, a probabilidade de retirar uma fêmea duas vezes seguidas é: P(F 1 F 2 ) = P(F 1 ) P(F 2 ) = 0, 5 0, 5 = 0, 25 = 25%. A probabilidade de retirar quatro fêmeas seguidas é igual a P(F 1 F 2 F 3 F 4 ) = P(F 1 ) P(F 2 ) P(F 3 ) P(F 4 ) = (0, 5) 4 = 0, 0125 = 1, 25%.

33 EXEMPLO A probabilidade de sortear duas vezes (sequencialmente) o mesmo camundongo (seja ele macho ou fêmea), com base no evento C i = {Camundongo i ser sorteado}, é igual a P(C i 1 C i 2 ) = P(C i 1 ) P(C i 2 ) = 0, 1 2 = 0, 01 = 1%

34 Eventos Dependentes Quando a ocorrência de um evento A depende da ocorrência prévia de um outro evento B, dizemos que A depende de B, e denota-se (A B) Em palavras, (A B) signica A dado B. Quando dois eventos são dependentes (ou seja, NÃO são independentes), P(A B) P(A) P(B) Em palavras, signica dizer que a probabilidade da interseção é diferente do produto das probabilidades.

35 EXEMPLO Suponha que um levantamento estatística efetuado em certa população vericou que: 23% de indivíduos do sexo masculino são hipertensos; 18% de indivíduos do sexo feminino são hipertensos; Nessa mesma população, 7% dos casais são hipertensos. Podemos observar neste caso que existe o que chamamos em estatística de dependência (ou associação) entre as variáveis sexo e presença de doença, pois denotando H = {O indivíduo é do sexo masculino} e M = {O indivíduo é do sexo feminino} como os eventos de interesse, P(H) = 0, 23 P(M) = 0, 18 P(H) P(M) = 0, 23 0, 18 = 0, 0414 = 4, 14% P(H M) = 0, 07 = 7% Logo: P(H M) P(H) P(M). Ou seja, H e M NÃO são independentes.

36 Probabilidade Condicional Quando existem dois eventos dependentes, a probabilidade de um deles é afetada pela ocorrência prévia ou não do outro. Quando a probabilidade de A um evento é afetada pela ocorrência prévia de B, dizemos que a probabilidade de A está condicionada à ocorrência de B. Ou seja, quando o evento B ocorre, há uma redução do espaço amostral, pois agora avaliamos todas as chances de ocorrência do evento A com base no evento ocorrido.

37 continuação De modo geral, P(A B) = P(A B) P(B) Observações: 1. Quando os eventos A e B são independentes, P(A B) = P(A) P(B A) = P(B) 2. Quando os eventos A e B NÃO são independentes, P(A B) = P(A) P(A B) = P(B) P(B A)

38 Esquema Ilustrativo

39 Esquema Ilustrativo

40 Esquema Ilustrativo

41 EXEMPLO Imagine dois eventos associados a um conjunto de indivíduos. O primeiro evento(a) é denido pela variável Presença de Cirrose e o segundo (B) pela variável É alcoólatra?. É possível estimar com estas informações, a probabilidade de um indivíduo ter cirrose dado que é alcóolatra. Para isto, é preciso vericar o número de indivíduos que apresentam simultaneamente as mesmas características, de modo a determinar P(A B), e depois disso, dividir pela probabilidade associado à B, P(B). Este tipo de situação costuma ser colocado em forma de tabelas (ou quadros), chamadas tabelas conjuntas, ou mais especicamente tabelas de contingência. Em relação ao exemplo, a tabela associada é apresentada a seguir.

42 continuação TÍTULO DA TABELA É alcoólatra? Eventos Totais SIM NÃO SIM a b a + b Cirrose NÃO c d c + d Totais a + c b + d a + b + c + d FONTE:

43 continuação Note que: a Número dos indivíduos que tem cirrose e são alcoólatras; b Número dos indivíduos que tem cirrose e NÃO são alcoólatras; c Número dos indivíduos que NÃO tem cirrose e são alcoólatras; d Número dos indivíduos que NÃO tem cirrose e NÃO são alcoólatras; a + b Total dos indivíduos que têm cirrose; c + d Total dos indivíduos que NÃO têm cirrose; a + c Total dos indivíduos que são alcoólatras; b + d Total dos indivíduos que NÃO são alcoólatras; a + b + c + d Total de indivíduos pesquisados.

44 continuação Logo: A ( probabilidade de um indivíduo alcoólatra ter cirrose é: P Ter cirrose É alcoólatra ) = a a + c A probabilidade de um indivíduo Não-alcoólatra ter cirrose é: P (Ter cirrose Não é alcoólatra) = b b + d A probabilidade de um indivíduo com cirrose ser alcoólatra é: P (Alcoólatra Cirrose) = a a + b

45 continuação A probabilidade de um indivíduo com cirrose não ser alcoólatra é: P (Não-alcoólatra Cirrose) = b c + d A probabilidade de um indivíduo sem cirrose ser alcoólatra é: P (Alcoólatra Não-Cirrose) = c c + d A probabilidade de um indivíduo sem cirrose não ser alcoólatra é: P (Não-alcoólatra Não-Cirrose) = d c + d

46 continuação Situação aplicada: TÍTULO DA TABELA É alcoólatra? Eventos Totais SIM NÃO SIM Cirrose NÃO Totais FONTE:

47 continuação Logo: ( P Ter cirrose É alcoólatra ) = 9 35 P (Ter cirrose Não é alcoólatra) = 2 45 P (Alcoólatra Cirrose) = 9 11 P (Não-alcoólatra Cirrose) = 2 11 P (Alcoólatra Não-Cirrose) = P (Não-alcoólatra Não-Cirrose) = 43 69

48 Risco Relativo (Odds Ratio) O risco relativo pode ser calculado a partir das tabelas de contingência apresentadas anteriormente. É uma condição bastante utilizada em saúde, pois avalia o risco adicional de apresentar uma condição A, devido ao fato de apresentar(possuir, ou estar) em uma condição B. Denotaremos essa expressão em destaque por RR AB. Com base na tabela geral descrita anteriormente, se A = cirrose e B = alcoólatra, esse risco é: RR AB = P(A B) P(A B c ) = a a + c b b + d = a b + d a + c b = a (b + d) b (a + c)

49 continuação Considerando também o exemplo anterior, TÍTULO DA TABELA É alcoólatra? Eventos Totais SIM NÃO SIM Cirrose NÃO Totais FONTE: Temos que, para A = cirrose e B = alcoólatra, RR AB = 9 45 = 5, Interpretação: Estatisticamente, o risco de um indivíduo alcoólatra desenvolver cirrose é 5 vezes maior em comparação com um indivíduo não-alcoólatra.

50 Coeciente de associação de Yule Admitindo que título e fonte serão colocados posteriormente, temos o caso geral de informação em uma tabela de contingência (2 2): Descrição Eventos(Variáveis) Totais B B c A a b a + b Descrição A c c d c + d Totais a + c b + d a + c + b + d Se o pesquisador desejar conhecer o nível de associação entre as duas variáveis estudas na tabela, é necessário calcular o chamado coeciente de associação de Yule: ad bc Y = ad + bc

51 Coeciente de associação de Yule Quanto mais próximo de 1 for o valor de Y, maior será a associação entre as variáveis estudadas, no sentido de que o aumento(diminuição) em uma implica no aumento(diminuição) da outra. Quanto mais próximo de -1, maior será a associação entre as variáveis estudadas, no sentido de que o aumento(diminuição) em uma implica na diminuição(aumento) da outra. Y = 0 indica total ausência de associação.

52 EXEMPLO Considere a seguinte tabela que apresenta informações sobre consumo de sal e pressão arterial sistólica(pas) PAS Variáveis Totais <= 120mm Hg > 120mm Hg <= 5g/dia Cons. de sal > 5g/dia Totais Logo, o nível de associação entre consumo de sal e PAS é Y = = 0, O valor 0,824 é positivo e próximo de 1, o que indica que um aumento no consumo de sal provoca também um aumento na PAS.

53 Noções de Epidemiologia Em algumas aplicações de saúde, a base do conhecimento é de natureza probabilística. Algumas aplicações envolvem o que chamamos em saúde de indicadores epidemiológicos Uma aplicação importante da teoria das probabilidades em saúde está relacionada à avaliação da capacidade que um determinado exame tem de acertar o verdadeiro diagnóstico. Isto acontece devido à limitação que o pesquisador possui para elaboração do exame. Ou seja, um diagnóstico é emitido de acordo com a capacidade de um exame clínico para detectar o evento de interesse. O quadro a seguir mostra de maneira esquemática os possíveis resultados associados à comparação do resultado de um exame que está sendo avaliado e o resultado denitivo ou diagnóstico denitivo ou diagnóstico de certeza.

54 continuação Resultado de um exame diagnóstico versus diagnóstico de certeza Diagnóstico de Certeza Doença(+) Doença( ) Totais Resultado do Exame(+) a(++) b(+ ) a + b Exame Exame( ) c( +) d( ) c + d Totais a + c b + d a + b + c + d

55 Conceitos Iniciais Falso-Positivo: Indivíduo sadio cujo exame resultou positivo. No quatro anterior, corresponde à letra b Para determinar a probabilidade do evento falso-positivo, basta dividir b pelo total de exames positivos, a + b. Falso-Negativo: Indivíduo doente cujo exame resultou negativo. No quatro anterior, corresponde à letra c Para determinar a probabilidade do evento falso-negativo, basta dividir c pelo total de exames negativos, c + d.

56 continuação Sensibilidade: É a proporção de indíviduos cujo exame revelou resultado positivo e que possuem a doença, no grupo de indivíduos doentes. Ou seja: Sensibilidade = S = a a + c A sensibilidade avalia o total de acertos do exame sobre o verdadeiro número de doentes. Quanto mais próximo de 1 estiver o valor da sensibilidade do teste, melhor será esse teste. Observação Importante: Ao fazer (1 S), o pesquisador está respondendo a seguinte pergunta: Qual a proporção de indivíduos doentes que o exame deixou de diagnosticar como tais? Essa proporção é a proporção de falso-negativos no total de pessoas doentes.

57 continuação Especicidade: É a proporção do número de indivíduos sadios cujo exame resultou negativo, no grupo de indivíduos sadios. Ou seja, Especicidade = E = d b + d A especicidade expressa o total de exames corretamente negativos sobre o total de indivíduos sadios. Quanto mais próxima de 1 estiver a especicadade, melhor será esse teste. Observação Importante: Ao fazer (1 E), temos a proporção é a proporção de falso-positivos no total de pessoas doentes.

58 continuação Valor preditivo positivo: É a proporção de indivíduos doentes com exame positivo no grupo de exames positivos. Valor Preditivo Positivo = VPD = a a + b Valor preditivo negativo: É a proporção de indivíduos sadios com exame negativo no grupo de exames negativos. Valor Preditivo Negativo = VPN = a a + b

59 continuação Acuidade ou Eciência Global do Teste: Verica o percentual de acerto do exame diagnóstico no grupo total de pacientes analisados. a + d Acuidade = A = a + b + c + d Prevalência: É a proporção de pacientes doentes no grupo total de pacientes analisados. a + c Prevalência = P = a + b + c + d

60 Observações Importantes Cienticamente já foi constatado que um teste com alta especicidade deve ser usado quando a prevalência da doença é relativamente baixa (doença rara), mesmo que o teste tenha relativamente baixa sensibilidade. O mesmo pode ser dito em relação a um teste com alta sensibilidade deve ser usado quando a prevalência da doença é alta (doença comum), mesmo que o teste tenha relativamente baixa especicidade.

61 Coeciente de Kappa (κ) Coeciente utilizado quando se tem interesse em testar a concordância entre dois diagnósticos diferentes, fornecidos por pesquisadores diferentes. Concordância de diagnóstico entre dois pesquisadores Diagnóstico 2 (+) ( ) Totais Diagnóstico (+) a(++) b(+ ) a + b 1 ( ) c( +) d( ) c + d Totais a + c b + d a + b + c + d A proporção da concordância observada é dada por a + d P CO = a + b + c + d Além disso, precisamos da chamada concordância causal: (a + b)(a + c) + (c + d)(b + d) P CC = (a + b + c + d) 2

62 Coeciente de Kappa (κ) Logo: κ = P CO P CC 1 P CC Quando há total concordância, o coeciente é igual a 1. Quando há discordância total, o coeciente é igual a 0. Para avaliar o grau de concordância, é possível avaliar a seguinte classicação: κ = 0 total discordância 0 < κ < 0, 4 concordância leve 0, 4 κ < 0, 8 concordância moderada 0, 8 κ < 1 concordância forte κ = 1 concordância perfeita

UNIVERSIDADE FEDERAL DA PARAÍBA

UNIVERSIDADE FEDERAL DA PARAÍBA UNIVERSIDADE FEDERAL DA PARAÍBA Probabilidade Departamento de Estatística UFPB Luiz Medeiros Introdução Encontramos na natureza dois tipos de fenômenos Determinísticos: Os resultados são sempre os mesmos

Leia mais

2 Conceitos Básicos de Probabilidade

2 Conceitos Básicos de Probabilidade CE003 1 1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento de técnicas estatísticas

Leia mais

Teoria das Probabilidades

Teoria das Probabilidades Capítulo 2 Teoria das Probabilidades 2.1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento

Leia mais

Estatística Empresarial. Fundamentos de Probabilidade

Estatística Empresarial. Fundamentos de Probabilidade Fundamentos de Probabilidade A probabilidade de chuva é de 90% A probabilidade de eu sair é de 5% Conceitos Básicos Conceitos Básicos 1. Experiência Aleatória (E) Processo de obtenção de uma observação

Leia mais

Métodos Estatísticos Básicos

Métodos Estatísticos Básicos Aula 6 - Introdução à probabilidade Departamento de Economia Universidade Federal de Pelotas (UFPel) Maio de 2014 Experimento Experimento aleatório (E ): é um experimento que pode ser repetido indenidamente

Leia mais

CE Estatística I

CE Estatística I CE 002 - Estatística I Agronomia - Turma B Professor Walmes Marques Zeviani Laboratório de Estatística e Geoinformação Departamento de Estatística Universidade Federal do Paraná 1º semestre de 2012 Zeviani,

Leia mais

INTRODUÇÃO À PROBABILIDADE

INTRODUÇÃO À PROBABILIDADE INTRODUÇÃO À PROBABILIDADE Foto extraída em http://www.alea.pt Profª Maria Eliane Universidade Estadual de Santa Cruz USO DE PROBABILIDADES EM SITUAÇÕES DO COTIDIANO Escolhas pessoais Previsão do tempo

Leia mais

Introdução à Probabilidade

Introdução à Probabilidade A Teoria de Probabilidade é responsável pelo estudo de fenômenos que envolvem a incerteza (é impossível prever antecipadamente o resultado) e teve origem na teoria de jogos, servindo como ferramenta para

Leia mais

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva Probabilidade e Estatística Prof. Dr. Narciso Gonçalves da Silva http://paginapessoal.utfpr.edu.br/ngsilva Probabilidade Probabilidade Experimento Aleatório Um experimento é dito aleatório quando satisfaz

Leia mais

T o e r o ia a da P oba ba i b lida d de

T o e r o ia a da P oba ba i b lida d de Teoria da Probabilidade Prof. Joni Fusinato Teoria da Probabilidade Consiste em utilizar a intuição humana para estudar os fenômenos do nosso cotidiano. Usa o princípio básico do aprendizado humano que

Leia mais

PROBABILIDADE. ENEM 2016 Prof. Marcela Naves

PROBABILIDADE. ENEM 2016 Prof. Marcela Naves PROBABILIDADE ENEM 2016 Prof. Marcela Naves PROBABILIDADE NO ENEM As questões de probabilidade no Enem podem cobrar conceitos relacionados com probabilidade condicional e probabilidade de eventos simultâneos.

Leia mais

Definição: É uma coleção bem definida de

Definição: É uma coleção bem definida de EST029 Cálculo de Probabilidade I Cap. 1: Introdução à Probabilidade Prof. Clécio da Silva Ferreira Depto Estatística - UFJF Conjuntos: Definição e notação Definição: É uma coleção bem definida de objetos,

Leia mais

Aula - Introdução a Teoria da Probabilidade

Aula - Introdução a Teoria da Probabilidade Introdução a Teoria da Probabilidade Prof. Magnos Martinello Aula - Introdução a Teoria da Probabilidade Universidade Federal do Espírito Santo - UFES Departamento de Informática - DI 5 de dezembro de

Leia mais

ESTATÍSTICA EXPLORATÓRIA

ESTATÍSTICA EXPLORATÓRIA ESTATÍSTICA EXPLORATÓRIA Prof Paulo Renato A. Firmino praf62@gmail.com Aulas 07-08 Probabilidade Apanhado Geral Seguimos nossas discussões sobre a Incerteza Decidir usualmente envolve incerteza Uma presa

Leia mais

Modelos de Probabilidade e Inferência Estatística

Modelos de Probabilidade e Inferência Estatística Modelos de Probabilidade e Inferência Estatística Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula 2 03/14 1 / 31 Prof. Tarciana Liberal (UFPB) Aula 2 03/14

Leia mais

Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS

Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS Cap. II EVENTOS MUTUAMENTE EXCLUSIVOS E EVENTOS NÃO- EXCLUSIVOS Dois ou mais eventos são mutuamente exclusivos, ou disjuntos, se os mesmos não podem ocorrer simultaneamente. Isto é, a ocorrência de um

Leia mais

Estatística Básica. Probabilidade. Renato Dourado Maia. Instituto de Ciências Agrárias. Universidade Federal de Minas Gerais

Estatística Básica. Probabilidade. Renato Dourado Maia. Instituto de Ciências Agrárias. Universidade Federal de Minas Gerais Estatística Básica Probabilidade Renato Dourado Maia Instituto de Ciências Agrárias Universidade Federal de Minas Gerais Probabilidade Condicional Dados dois eventos A e B, a probabilidade condicional

Leia mais

Noções sobre probabilidade

Noções sobre probabilidade Capítulo 3 Noções sobre probabilidade Um casal tem dois filhos. Qual é a probabilidade de: o primogênito ser homem? os dois filhos serem homens? pelo menos um dos filhos ser homem? A teoria das probabilidades

Leia mais

Será que vai chover amanhã? Quantificando a incerteza. Probabilidades Aula 1

Será que vai chover amanhã? Quantificando a incerteza. Probabilidades Aula 1 Será que vai chover amanhã? Quantificando a incerteza Probabilidades Aula 1 Nosso dia-a-dia está cheio de incertezas Vai chover amanhã? Quanto tempo levarei de casa até a universidade? Em quanto tempo

Leia mais

Intervalos de conança

Intervalos de conança Intervalos de conança Prof. Hemílio Fernandes Campos Coêlho Departamento de Estatística - Universidade Federal da Paraíba - UFPB Exemplo Suponha que se deseja estimar o diâmetro da pupila de coelhos adultos.

Leia mais

Noções de Probabilidade

Noções de Probabilidade Noções de Probabilidade Joel M. Corrêa da Rosa 2011 A estatística descritiva é ferramenta indispensável para extrair informação em um conjunto de dados. Entretanto, a tomada de decisões está fortemente

Leia mais

3. Probabilidade P(A) =

3. Probabilidade P(A) = 7 3. Probabilidade Probabilidade é uma medida numérica da plausibilidade de que um evento ocorrerá. Assim, as probabilidades podem ser usadas como medidas do grau de incerteza e podem ser expressas de

Leia mais

Noções sobre Probabilidade

Noções sobre Probabilidade Noções sobre Probabilidade Introdução Vimos anteriormente como apresentar dados em tabelas e gráficos, e também como calcular medidas que descrevem características específicas destes dados. Mas além de

Leia mais

Resumo. Parte 2 Introdução à Teoria da Probabilidade. Ramiro Brito Willmersdorf Introdução.

Resumo. Parte 2 Introdução à Teoria da Probabilidade. Ramiro Brito Willmersdorf Introdução. Parte 2 Introdução à Teoria da Probabilidade Ramiro Brito Willmersdorf ramiro@willmersdorf.net Departamento de Engenharia Mecânica Universidade Federal de Pernambuco 2011.2 Resumo 1 Introdução 2 Espaço

Leia mais

Capítulo 2 Probabilidades

Capítulo 2 Probabilidades Capítulo 2 Probabilidades Slide 1 Definições Slide 2 Acontecimento Qualquer colecção de resultados de uma experiência. Acontecimento elementar Um resultado que não pode ser simplificado ou reduzido. Espaço

Leia mais

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal.

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Estatística Probabilidade Profa. Ivonete Melo de Carvalho Conteúdo Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Objetivos Utilizar a probabilidade como estimador

Leia mais

Definição de Probabilidade

Definição de Probabilidade INTRODUÇÃO A TEORIA DAS PROBABILIDADES A teoria das probabilidade nada mais é do que o bom senso transformado em cálculo A probabilidade é uma medida da incerteza dos fenômenos. Traduz-se por um número

Leia mais

TEORIA DAS PROBABILIDADES

TEORIA DAS PROBABILIDADES TEORIA DAS PROBABILIDADES 1.1 Introdução Ao estudarmos um fenômeno coletivo, verificamos a necessidade de descrever o próprio fenômeno e o modelo matemático associado ao mesmo, que permita explicá-lo da

Leia mais

Bioestatística e Computação I

Bioestatística e Computação I ioestatística e Computação I Estatística Descritiva Maria Virginia P Dutra Eloane Ramos Vania Matos Fonseca Pós raduação em Saúde da Mulher e da Criança IFF FIOCRUZ Organizar e resumir dados Estatística

Leia mais

Fernando de Pol Mayer. Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR)

Fernando de Pol Mayer. Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR) Fernando de Pol Mayer Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR) Este conteúdo está disponível por meio da Licença Creative

Leia mais

Carlos Pedreira.

Carlos Pedreira. Bio-Estatística Carlos Pedreira pedreira@ufrj.br CAPÍTULO 1 Conceitos Básicos de Probabilidade Em qual resultado você apostaria em 1 jogada de uma moeda justa? porque? Agora vamos jogar a moeda 2 vezes,

Leia mais

ELEMENTOS DE PROBABILIDADE. Prof. Paulo Rafael Bösing 25/11/2015

ELEMENTOS DE PROBABILIDADE. Prof. Paulo Rafael Bösing 25/11/2015 ELEMENTOS DE PROBABILIDADE Prof. Paulo Rafael Bösing 25/11/2015 ELEMENTOS DE PROBABILIDADE Def.: Um experimento é dito aleatório quando o seu resultado não for previsível antes de sua realização, ou seja,

Leia mais

Tipos de Modelo. Exemplos. Modelo determinístico. Causas. Efeito. Exemplos. Modelo probabilístico. Causas. Efeito. Determinístico.

Tipos de Modelo. Exemplos. Modelo determinístico. Causas. Efeito. Exemplos. Modelo probabilístico. Causas. Efeito. Determinístico. Tipos de Modelo Sistema Real Determinístico Prof. Lorí Viali, Dr. viali@mat.ufrgs.br http://www.mat.ufrgs.br/~viali/ Probabilístico Modelo determinístico Exemplos Gravitação F GM 1 M 2 /r 2 Causas Efeito

Leia mais

Cap. 4 - Probabilidade

Cap. 4 - Probabilidade Estatística para Cursos de Engenharia e Informática Pedro Alberto Barbetta / Marcelo Menezes Reis / Antonio Cezar Bornia São Paulo: Atlas, 2004 Cap. 4 - Probabilidade APOIO: Fundação de Apoio à Pesquisa

Leia mais

NOÇÕES DE PROBABILIDADE

NOÇÕES DE PROBABILIDADE NOÇÕES DE PROBABILIDADE ALEATORIEDADE Menino ou Menina me? CARA OU COROA? 3 Qual será o rendimento da Caderneta de Poupança no final deste ano? E qual será a taxa de inflação acumulada em 014? Quem será

Leia mais

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω.

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω. PROBABILIDADE 1.0 Conceitos Gerais No caso em que os possíveis resultados de um experimento aleatório podem ser listados (caso discreto), um modelo probabilístico pode ser entendido como a listagem desses

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aulas passadas Motivação Exemplos de aplicação de probabilidade e estatística Informações do curso Aula de hoje Espaço amostral Álgebra de Eventos Eventos

Leia mais

PROBABILIDADE. É o conjunto de todos os resultados possíveis de um experimento aleatório. A letra que representa o espaço amostral, é S.

PROBABILIDADE. É o conjunto de todos os resultados possíveis de um experimento aleatório. A letra que representa o espaço amostral, é S. PROBABILIDADE A história da teoria das probabilidades, teve início com os jogos de cartas, dados e de roleta. Esse é o motivo da grande existência de exemplos de jogos de azar no estudo da probabilidade.

Leia mais

Probabilidade e Estatística

Probabilidade e Estatística Aula 3 Professora: Rosa M. M. Leão Probabilidade e Estatística Conteúdo: 1.1 Por que estudar? 1.2 O que é? 1.3 População e Amostra 1.4 Um exemplo 1.5 Teoria da Probabilidade 1.6 Análise Combinatória 3

Leia mais

Estatística Aplicada. Prof. Carlos Alberto Stechhahn PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL.

Estatística Aplicada. Prof. Carlos Alberto Stechhahn PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL. Estatística Aplicada Administração p(a) = n(a) / n(u) PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL Prof. Carlos Alberto Stechhahn 2014 1. Noções de Probabilidade Chama-se experimento

Leia mais

Experiências Aleatórias. Espaço de Resultados. Acontecimentos

Experiências Aleatórias. Espaço de Resultados. Acontecimentos Experiências Aleatórias. Espaço de Resultados. Acontecimentos Experiência Aleatória É uma experiência em que: não se sabe exactamente o resultado que se virá a observar; conhece-se o universo dos resultados

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aula passada Motivação Exemplos de aplicação de probabilidade e estatística Informações do curso Aula de hoje Espaço amostral Álgebra de Eventos Eventos Mutuamente

Leia mais

Lista de Exercícios de Probabilidades

Lista de Exercícios de Probabilidades Lista de Exercícios de Probabilidades Joel M. Corrêa da Rosa 2011 1. Lançam-se três moedas. Enumere o espaço amostral e os eventos : Ω = {(c, c, c); (k, k, k); (c, k, k); (k, c, k); (k, k, c); (k, c, c);

Leia mais

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba. Prof. Tarciana Liberal (UFPB) Aula Probabilidade I 07/16 1 / 23

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba. Prof. Tarciana Liberal (UFPB) Aula Probabilidade I 07/16 1 / 23 I Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Probabilidade I 07/16 1 / 23 Probabilidade As definições de probabilidade apresentadas anteriormente podem

Leia mais

PROBABILIDADE PROPRIEDADES E AXIOMAS

PROBABILIDADE PROPRIEDADES E AXIOMAS PROBABILIDADE ESPAÇO AMOSTRAL É o conjunto de todos os possíveis resultados de um experimento aleatório. A este conjunto de elementos denominamos de espaço amostral ou conjunto universo, simbolizado por

Leia mais

Introdução aos Proc. Estocásticos - ENG 430

Introdução aos Proc. Estocásticos - ENG 430 Introdução aos Proc. Estocásticos - ENG 430 Fabrício Simões IFBA 16 de novembro de 2015 Fabrício Simões (IFBA) Introdução aos Proc. Estocásticos - ENG 430 16 de novembro de 2015 1 / 34 1 Motivação 2 Conceitos

Leia mais

Aula 16 - Erivaldo. Probabilidade

Aula 16 - Erivaldo. Probabilidade Aula 16 - Erivaldo Probabilidade Probabilidade Experimento aleatório Experimento em que não pode-se afirmar com certeza o resultado final, mas sabe-se todos os seus possíveis resultados. Exemplos: 1) Lançar

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aulas passadas Motivação Espaço Amostral, Eventos, Álgebra de eventos Aula de hoje Probabilidade Análise Combinatória Independência Probabilidade Experimentos

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

Probabilidades. O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados.

Probabilidades. O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados. Probabilidades O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados. Quando lançamos um dado, os resultados possíveis são sempre um dos elementos

Leia mais

3 NOÇÕES DE PROBABILIDADE

3 NOÇÕES DE PROBABILIDADE 3 NOÇÕES DE PROILIDDE 3.1 Conjuntos Um conjunto pode ser considerado como uma coleção de objetos chamados elementos do conjunto. Em geral denota-se conjunto por letras maiúsculas,, C,... e a sua representação

Leia mais

Costa, S.C. 1. Universidade Estadual de Londrina Departamento de Estatística. Probabilidades. Silvano Cesar da Costa.

Costa, S.C. 1. Universidade Estadual de Londrina Departamento de Estatística. Probabilidades. Silvano Cesar da Costa. Costa, S.C. 1 Universidade Estadual de Londrina Departamento de Estatística Probabilidades Silvano Cesar da Costa Londrina - Paraná Costa, S.C. 2 Noções sobre a teoria das probabilidades Conceitos probabilísticos

Leia mais

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba Probabilidade I Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Probabilidade Condicional 08/16 1 / 56 Introdução É provável que você ganhe um aumento....

Leia mais

Probabilidade. Experiências aleatórias

Probabilidade. Experiências aleatórias Probabilidade Experiências aleatórias 1 Experiências aleatórias Acontecimento: Qualquer colecção de resultados de uma experiência. Acontecimento elementar: Um resultado que não pode ser simplificado ou

Leia mais

Unidade I ESTATÍSTICA APLICADA. Prof. Mauricio Fanno

Unidade I ESTATÍSTICA APLICADA. Prof. Mauricio Fanno Unidade I ESTATÍSTICA APLICADA Prof. Mauricio Fanno Estatística indutiva Estatística descritiva Dados no passado ou no presente e em pequena quantidade, portanto, reais e coletáveis. Campo de trabalho:

Leia mais

Processos Estocásticos. Introdução. Probabilidade. Introdução. Espaço Amostral. Luiz Affonso Guedes. Fenômenos Determinísticos

Processos Estocásticos. Introdução. Probabilidade. Introdução. Espaço Amostral. Luiz Affonso Guedes. Fenômenos Determinísticos Processos Estocásticos Luiz ffonso Guedes Sumário Probabilidade Variáveis leatórias Funções de Uma Variável leatória Funções de Várias Variáveis leatórias Momentos e Estatística Condicional Teorema do

Leia mais

Universidade Federal de Goiás Instituto de Matemática e Estatística

Universidade Federal de Goiás Instituto de Matemática e Estatística Universidade Federal de Goiás Instituto de Matemática e Estatística Prova 1 de Probabilidade I Prof.: Fabiano F. T. dos Santos Goiânia, 15 de setembro de 2014 Aluno: Nota: Descreva seu raciocínio e desenvolva

Leia mais

Processos Estocásticos. Luiz Affonso Guedes

Processos Estocásticos. Luiz Affonso Guedes Processos Estocásticos Luiz Affonso Guedes Sumário Probabilidade Variáveis Aleatórias Funções de Uma Variável Aleatória Funções de Várias Variáveis Aleatórias Momentos e Estatística Condicional Teorema

Leia mais

Universidade Federal de Goiás Instituto de Matemática e Estatística

Universidade Federal de Goiás Instituto de Matemática e Estatística Universidade Federal de Goiás Instituto de Matemática e Estatística Prova de Probabilidade Prof.: Fabiano F. T. dos Santos Goiânia, 31 de outubro de 014 Aluno: Nota: Descreva seu raciocínio e desenvolva

Leia mais

Unidade III ESTATÍSTICA. Prof. Fernando Rodrigues

Unidade III ESTATÍSTICA. Prof. Fernando Rodrigues Unidade III ESTATÍSTICA Prof. Fernando Rodrigues Medidas de dispersão Estudamos na unidade anterior as medidas de tendência central, que fornecem importantes informações sobre uma sequência numérica. Entretanto,

Leia mais

EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência

EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência EST029 Cálculo de Probabilidade I Cap. 3: Probabilidade Condicional e Independência Prof. Clécio da Silva Ferreira Depto Estatística - UFJF 1 Perguntas 1. Um novo aparelho para detectar um certo tipo de

Leia mais

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES 0 1 INTRODUÇÃO A teoria das probabilidades é utilizada para determinar as chances de um experimento aleatório acontecer. 1.1

Leia mais

Processos Estocásticos

Processos Estocásticos Processos Estocásticos Primeira Lista de Exercícios de junho de 0 Quantos códigos de quatro letras podem ser construídos usando-se as letras a, b, c, d, e, f se: a nenhuma letra puder ser repetida? b qualquer

Leia mais

Conceito de Estatística

Conceito de Estatística Conceito de Estatística Estatística Técnicas destinadas ao estudo quantitativo de fenômenos coletivos, observáveis. Unidade Estatística um fenômeno individual é uma unidade no conjunto que irá constituir

Leia mais

HEP-5800 BIOESTATÍSTICA. Capitulo 2

HEP-5800 BIOESTATÍSTICA. Capitulo 2 HEP-5800 BIOESTATÍSTICA Capitulo 2 NOÇÕES DE PROBABILIDADE, DISTRIBUIÇÃO BINOMIAL, DISTRIBUIÇÃO NORMAL Nilza Nunes da Silva Regina T. I. Bernal MARÇO DE 2012 2 1. NOÇÕES DE PROBABILIDADE 1. DEFINIÇÃO Considere

Leia mais

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS CENTRO UNIVERSITÁRIO FRANCISCANO Curso de Administração Disciplina: Estatística I Professora: Stefane L. Gaffuri RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS Sessão 1 Experimentos Aleatórios e

Leia mais

Efeito. Causas. Determinístico. Sistema Real. Probabilístico. Experiência para o qual o. modelo probabilístico é adequado.

Efeito. Causas. Determinístico. Sistema Real. Probabilístico. Experiência para o qual o. modelo probabilístico é adequado. Sistema Real Determinístico Probabilístico Causas Efeito X Causas Efeito Eperiência para o qual o modelo probabilístico é adequado. ❶ Não é possível prever um resultado particular, mas pode-se enumerar

Leia mais

3. (Apostila 1 - ex.1.4) Defina um espaço amostral para cada um dos seguintes experimentos

3. (Apostila 1 - ex.1.4) Defina um espaço amostral para cada um dos seguintes experimentos Primeira Lista de Exercícios Introdução à probabilidade e à estatística Prof Patrícia Lusié Assunto: Probabilidade. 1. (Apostila 1 - ex.1.1) Lançam-se três moedas. Enumerar o espaço amostral e os eventos

Leia mais

Aula 5 Probabilidade conceitos básicos

Aula 5 Probabilidade conceitos básicos AULA 5 Aula 5 Probabilidade conceitos básicos Nesta aula, você aprenderá os conceitos de: experimento aleatório; espaço amostral; evento aleatório e também as operações que podem ser feitas com os eventos

Leia mais

1.4.2 Probabilidade condicional

1.4.2 Probabilidade condicional M. Eisencraft 1.4 Probabilidades condicionais e conjuntas 9 Portanto, P(A B) = P(A)+P(B) P(A B) (1.2) Para eventos mutuamente exclusivos, P(A B) = e P(A)+P(B) = P(A B). 1.4.2 Probabilidade condicional

Leia mais

Eisencraft e Loiola 2.1 Probabilidade 37. Para resolver problemas de probabilidades são necessários 3 passos:

Eisencraft e Loiola 2.1 Probabilidade 37. Para resolver problemas de probabilidades são necessários 3 passos: Eisencraft e Loiola 2.1 Probabilidade 37 Modelo matemático de experimentos Para resolver problemas de probabilidades são necessários 3 passos: a Estabelecimento do espaço das amostras b Definição dos eventos

Leia mais

Para cada um dos experimentos abaixo, descreva o espaço amostral e dê o número de seus elementos.

Para cada um dos experimentos abaixo, descreva o espaço amostral e dê o número de seus elementos. 1 Exercício 1 Para cada um dos experimentos abaixo, descreva o espaço amostral e dê o número de seus elementos. (a) Numa linha de produção conta-se o número de peças defeituosas num intervalo de uma hora.

Leia mais

Prof. Luiz Alexandre Peternelli

Prof. Luiz Alexandre Peternelli Exercícios propostos 1. Numa prova há 7 questões do tipo verdadeiro-falso ( V ou F ). Calcule a probabilidade de acertarmos todas as 7 questões se: a) Escolhermos aleatoriamente as 7 respostas. b) Escolhermos

Leia mais

Uma estatística é uma característica da amostra. Ou seja, se

Uma estatística é uma característica da amostra. Ou seja, se Estatística Uma estatística é uma característica da amostra. Ou seja, se X 1,..., X n é uma amostra, T = função(x 1,..., X n é uma estatística. Exemplos X n = 1 n n i=1 X i = X 1+...+X n : a média amostral

Leia mais

Prof. Lorí Viali, Dr.

Prof. Lorí Viali, Dr. Prof. Lorí Viali, Dr. viali@mat.ufrgs.br http://www.mat.ufrgs.br/~viali/ Distribuição Conjunta Suponha que se queira analisar o comportamento conjunto das variáveis X = Grau de Instrução e Y = Região

Leia mais

DIAGNÓSTICO. Processo de decisão clínica que baseia-se, conscientemente ou não, em probabilidade. Uso dos testes diagnósticos

DIAGNÓSTICO. Processo de decisão clínica que baseia-se, conscientemente ou não, em probabilidade. Uso dos testes diagnósticos Universidade Federal do Rio de Janeiro Centro de Ciências da Saúde Faculdade de Medicina / Instituto de Estudos em Saúde Coletiva - IESC Departamento Medicina Preventiva Disciplina de Epidemiologia Testes

Leia mais

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade Magnos Martinello Universidade Federal do Espírito Santo - UFES Departamento de Informática DI Laboratório de Pesquisas em Redes Multimidia LPRM Objetivos 1. Definições: Experimento Espaço Amostral Evento

Leia mais

Exemplo (tabela um) distribuições marginais enquanto que. Distribuição Conjunta

Exemplo (tabela um) distribuições marginais enquanto que. Distribuição Conjunta Distribuição Conjunta Suponha que se queira analisar o comportamento conjunto das variáveis = de Instrução e = Região de procedência. Neste caso, a distribuição de freqüências é apresentada como uma tabela

Leia mais

BIOESTATÍSTICA. Parte 2 - Probabilidade

BIOESTATÍSTICA. Parte 2 - Probabilidade BIOESTATÍSTICA Parte 2 - Probabilidade Aulas Teóricas de 15/02/2011 a 24/03/2011 2.1. Experiência de Resultados. Espaço Amostra. Acontecimentos Frequentemente somos confrontados com situações em que está

Leia mais

Probabilidade e estatística

Probabilidade e estatística Probabilidade e estatística stica Genética BásicaB Licenciatura Victor Martin Quintana Flores Qual a utilidade de usar probabilidade e estatística em Genética? 1 Calcular a probabilidade de determinados

Leia mais

Estatística. Capítulo 4: Distribuições Teóricas de Probabilidades de Variáveis Aleatórias Discretas. Professor Fernando Porto

Estatística. Capítulo 4: Distribuições Teóricas de Probabilidades de Variáveis Aleatórias Discretas. Professor Fernando Porto Estatística Capítulo 4: Distribuições Teóricas de Probabilidades de Variáveis Aleatórias Discretas Professor Fernando Porto Capítulo 4 Baseado no Capítulo 4 do livro texto, Distribuições Teóricas de Probabilidades

Leia mais

ICMS/PE 2014 Resolução da Prova de Estatística Professor Fábio Amorim. ICMS PE 2014: Resolução da prova de Estatística Prof.

ICMS/PE 2014 Resolução da Prova de Estatística Professor Fábio Amorim. ICMS PE 2014: Resolução da prova de Estatística Prof. ICMS/PE 2014 Resolução da Prova de Estatística Professor Fábio Amorim 1 de 6 Pessoal, segue a resolução das questões de Estatística da prova realizada pela SEFAZ-PE, para o cargo de Auditor Fiscal do Tesouro

Leia mais

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios.

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios. PROBABILIDADE A teoria das Probabilidades é o ramo da Matemática que cria, desenvolve e em geral pesquisa modelos que podem ser utilizados para estudar experimentos ou fenômenos aleatórios. Os experimentos

Leia mais

Intervalos de Confiança

Intervalos de Confiança Intervalos de Confiança INTERVALOS DE CONFIANÇA.1 Conceitos básicos.1.1 Parâmetro e estatística Parâmetro é a descrição numérica de uma característica da população. Estatística é a descrição numérica de

Leia mais

Sequências Generalizando um pouco, podemos então dizer que sequências de elementos são grupos com elementos obedecendo a determinada ordem. Obteremos uma sequência diferente quando se altera a ordem. No

Leia mais

Técnicas de Contagem I II III IV V VI

Técnicas de Contagem I II III IV V VI Técnicas de Contagem Exemplo Para a Copa do Mundo 24 países são divididos em seis grupos, com 4 países cada um. Supondo que a escolha do grupo de cada país é feita ao acaso, calcular a probabilidade de

Leia mais

Nessa situação, a média dessa distribuição Normal (X ) é igual à média populacional, ou seja:

Nessa situação, a média dessa distribuição Normal (X ) é igual à média populacional, ou seja: Pessoal, trago a vocês a resolução da prova de Estatística do concurso para Auditor Fiscal aplicada pela FCC. Foram 10 questões de estatística! Não identifiquei possibilidade para recursos. Considero a

Leia mais

VARIÁVEL ALEATÓRIA e DISTRIBUIÇÃO BINOMIAL

VARIÁVEL ALEATÓRIA e DISTRIBUIÇÃO BINOMIAL VARIÁVEL ALEATÓRIA e DISTRIBUIÇÃO BINOMIAL 1 Variável Aleatória Uma função X que associa a cada elemento w do espaço amostral W um valor x R é denominada uma variável aleatória. Experimento: jogar 1 dado

Leia mais

Adição de probabilidades. O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e):

Adição de probabilidades. O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e): Adição de probabilidades O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e): Dois eventos A e B são ditos mutuamente exclusivos se, e somente se, A B

Leia mais

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski PROBABILIDADE E ESTATÍSTICA Aula 2 Professor Regina Meyer Branski Probabilidade 1. Conceitos básicos de probabilidade 2. Probabilidade condicional 3. Eventos Dependentes e Independentes 4. Regra da Multiplicação

Leia mais

Probabilidade. Evento (E) é o acontecimento que deve ser analisado.

Probabilidade. Evento (E) é o acontecimento que deve ser analisado. Probabilidade Definição: Probabilidade é uma razão(divisão) entre a quantidade de eventos e a quantidade de amostras. Amostra ou espaço amostral é o conjunto formado por todos os elementos que estão incluídos

Leia mais

Princípios de Modelagem Matemática Aula 09

Princípios de Modelagem Matemática Aula 09 Princípios de Modelagem Matemática Aula 09 Prof. José Geraldo DFM CEFET/MG 12 de maio de 2014 1 Modelos estatísticos e estimação de parâmetros A verificação de um modelo matemático demanda a realização

Leia mais

As três definições de probabilidades

As três definições de probabilidades As três definições de probabilidades Prof. Ilydio Pereira de Sá UERJ -USS INTRODUÇÃO ÀS PROBABILIDADES Para iniciar, vamos considerar algumas hipóteses: Rita espera ansiosamente o nascimento de seu filho,

Leia mais

Exercícios resolvidos sobre Teoremas de Probabilidade

Exercícios resolvidos sobre Teoremas de Probabilidade Exercícios resolvidos sobre Teoremas de Probabilidade Aqui você tem mais uma oportunidade de estudar os teoremas da probabilidade, por meio de um conjunto de exercícios resolvidos. Observe como as propriedades

Leia mais

Probabilidade. Definições e Conceitos

Probabilidade. Definições e Conceitos Probabilidade Definições e Conceitos Definições Probabilidade Medida das incertezas relacionadas a um evento chances de ocorrência de um evento Exemplos: Probabilidade de jogar um dado e cair o número

Leia mais

Lista 2 de exercícios

Lista 2 de exercícios Lista 2 de exercícios 1. (ANDRADE; OGLIARI, 2010) Defina um espaço amostral para os seguintes experimentos aleatórios: a. Investigam-se famílias com quatro crianças, anotando-se a configuração conforme

Leia mais

Variáveis Aleatórias. Prof. Tarciana Liberal Departamento de Estatística - UFPB

Variáveis Aleatórias. Prof. Tarciana Liberal Departamento de Estatística - UFPB Variáveis Aleatórias Prof. Tarciana Liberal Departamento de Estatística - UFPB Introdução Ao descrever o espaço amostral de um experimento aleatório, não especificamos que um resultado individual seja

Leia mais

Experiência Aleatória

Experiência Aleatória Probabilidades Experiência Aleatória Experiência aleatória é uma experiência em que: não se sabe exactamente o resultado que se virá a observar, mas conhece-se o universo dos resultados possíveis. Exemplo

Leia mais

UNIVERSIDADE FEDERAL DE UBERLÂNDIA FACULDADE DE MATEMÁTICA LISTA DE EXERCÍCIOS PROVA 2- BIOESTATÍSTICA

UNIVERSIDADE FEDERAL DE UBERLÂNDIA FACULDADE DE MATEMÁTICA LISTA DE EXERCÍCIOS PROVA 2- BIOESTATÍSTICA UNIVERSIDADE FEDERAL DE UBERLÂNDIA FACULDADE DE MATEMÁTICA LISTA DE EXERCÍCIOS PROVA - BIOESTATÍSTICA TURMA: ENFERMAGEM PROF.: EDNALDO CARVALHO GUIMARÃES Regressão e Correlação Linear 1) A contagem do

Leia mais

Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS

Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS INTRODUÇÃO O que é uma variável aleatória? Um tipo de variável que depende do resultado aleatório de um experimento aleatório. Diz-se que um experimento é

Leia mais