Alinhamento de seqüências

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Alinhamento de seqüências"

Transcrição

1 Alinhamento de seqüências

2 Qual a importância do alinhamento de seqüências Permite estabelecer identidades entre sequências Permite a dedução de função de proteínas baseado em similaridade Permite a definição de domínios protéicos conservados Permite o estudo da evolução de proteínas (evolução de organismos?)

3 Introdução: princípios de alinhamento de nucleotídeos

4 Dot matrix Cria-se uma matriz onde são marcadas regiões com nucleotídeos coincidentes entre as duas seqüências comparadas Linhas diagonais formadas representariam regiões que apresentam conservação entre as duas seqüências

5 Dynamic programing Consegue prever o melhor alinhamento possível Requer muito recurso computacional, não sendo aplicável para comparações extensivas Algoritmos mais utilizados Needleman-Wunsch (global) e Smith-Waterman (local)

6 Exemplo do algoritimo Scores= +5 match, -2 mismatch e -6 gap

7 Resolução da matriz Scores= +5 match -2 mismatch -6 gap Traceback- a partir do melhor escore se refaz o caminho para dedução do alinhamento

8 Alinhamento local X alinhamento global

9 Alinhamento local X alinhamento global Alinhamento global- Busca o melhor alinhamento em toda a extensão das duas seqüências sendo comparadas Alinhamento local- busca somente alinhamento de regiões de alta similaridade, não importando as seqüências adjacentes a estas regiões

10 Ferramenta de busca em bancos de dados

11 Algoritmo do BLAST Seqüência é dividida em fragmentos de 11 nucleotídeos e estes passam a ser procurados em todo o banco de dados. ATCGTACAATAACGTG ATCGTACAATA TCGTACAATAA CGTACAATAAC GTACAATAACG TACAATAACGT ACAATAACGTG

12 Algoritmo do BLAST ATCGTACAATA TCGTACAATAA CGTACAATAAC GTACAATAACG TACAATAACGT ACAATAACGTG AAATGTGTGTATCGTACAATATCGTG Trecho encontrado em seqüências alvo é utilizado como seed

13 Algoritmo do BLAST ATCGTACAATAACGTG AAATGTGTGTATCGTACAATATCGTG Extensão do alinhamento utilizando os métodos para encontrar o alinhamento ótimo Como é uma ferramenta de alinhamento local só será alinhado trechos que produzam um escore elevado

14 Alinhamento de seqüências protéicas

15 Considerações evolucionarias Proteínas evoluem juntamente com o organismo Após a divergência de duas espécies há uma diversificação da seqüência de proteínas ortologas (isto é com uma origem evolutiva em comum) devido a mutações sofridas no código genético do individuo Após a ocorrência de mutações tenderão a serem selecionadas negativamente aquelas que causarem alterações drásticas na estrutura da proteína

16 Considerações evolucionarias Os fenômenos de mutações não são totalmente randômicos havendo uma preferência por eventos de transição em relação a eventos de transversão. Purinas Pirimidinas

17 Considerações evolucionarias Considerando a freqüência de mutações de nucleotídeos a mutação Isoleucina-> Valina seria mais freqüente que Isoleucina-> Leucina

18 Considerações evolucionarias Considerando o código genético é possível notar que nem todas as mutações de aminoácido podem ser obtidas a partir de uma única mutação de nucleotídeo Deste modo teremos algumas mutações mais freqüentes que as outras Considerando este aspecto a mutação Isoleucina-> Valina seria mais freqüente que Isoleucina->Alanina

19 Considerações evolucionarias Cadeia lateral apolar ATA->AGA ATA->CTA Cadeia lateral polar Neste caso apesar da probabilidade da mutação ocorrer ser a mesma é muito mais provável que a primeira mutação seja selecionada negativamente, pois introduz um aminoácido de cadeia lateral de caráter muito diferente da original. Cadeia lateral apolar

20 Considerações evolucionarias Considerando todos estes fatores é concluir que a partir de um evento ancestral de divergência de duas proteínas ortologas, a taxa de conversão de um determinado aminoácido para outro não será igual e sim dependente do par que iremos avaliar Além disso a abundancia relativa dos aminoácidos é diferente, influenciando o resultado

21 Matriz de comparação Matrizes de comparação analisam as freqüências relativas com que ocorrem as diferentes substituições de aminoácidos Com bases nestas freqüências e com a abundancia relativa de cada aminoácido na proteína é possível atribuir um escore que reflete a probabilidade daquela mutação ocorrer (prováveis escore positivo) Os dois tipos mais utilizados de matrizes são a PAM (Point Accepted Mutation) e a Blossum (Blocks Substitution Matrix)

22 Matriz do tipo PAM Analise de evolução de seqüências (por métodos de parcimônia) Calculo de uma matriz baseado nas taxas de substituições dos aminoácidos

23 Matriz do tipo PAM A matriz PAM 1foi produzida baseados um determinado tempo de evolução (PAM unit- tempo em que 1% dos aminoacidos mudam). Outras matrizes (PAM 100, PAM 250) foram derivadas a partir desta primeira matriz. Quanto maior a unidade de PAM a matriz seria mais adequada para comparar seqüências mais divergentes. Matriz tipo PAM250 é representada acima mostra acima da diagonal o numero de substituições observadas e a diagonal e abaixo representam escores derivados. Caixas em cinza tem escore positivo e aquelas em preto são as mutações possíveis via a substituição de um único nucleotídeo

24 Matriz do tipo Blosum Ao contrario da matriz PAM não se baseia em um modelo evolucionário explicito, mas sim em analise de seqüências alinhadas par a par. Matriz PAM Considerando a primeira coluna teríamos 6X5= 30 conservações de T 6 mudanças T->I e seis mudanças I->T Matriz Blossum

25 Matriz do tipo Blosum Entretanto este tipo de abordagem é muito sensível a presença de seqüências muito semelhantes na comparação Para solucionar isso as seqüências são agrupadas em blocos baseado em seu nível de identidade e cada bloco terá o mesmo peso independente do numero de seqüências que o compõe Deste modo temos diferentes matrizes baseados no nível de identidade utilizado para construir os blocos (por exemplo a matriz blosum80 criou blocos com proteínas que são 80% idênticas)

26 Equivalência entre matrizes Apesar de serem construídas com metodologias diferentes e portanto produzirem matrizes não equivalentes é possível dizer que de modo genérico as matrizes Blosum e PAM teriam as seguintes equivalências PAM100 ==> Blosum90 PAM120 ==> Blosum80 PAM160 ==> Blosum60 PAM200 ==> Blosum52 PAM250 ==> Blosum45

Alinhamento de sequências

Alinhamento de sequências Pontifícia Universidade Católica de Goiás Departamento de Biologia Alinhamento de sequências Prof. Macks Wendhell Gonçalves, Msc mackswendhell@gmail.com Definição O alinhamento de sequências consiste no

Leia mais

Alinhamento local- Utilização do BLAST

Alinhamento local- Utilização do BLAST Alinhamento local- Utilização do BLAST BLAST Tipos de BLAST (blastn) Compara nucleotídeos (blastp) Compara proteínas Utiliza nucleotídeo como query, este é traduzido nos seus 6 quadros de leitura e é comparado

Leia mais

alinhamento global-alinhamento múltiplo de seqüências

alinhamento global-alinhamento múltiplo de seqüências alinhamento global-alinhamento múltiplo de seqüências Alinhamento múltiplos de seqüências Qual a importância de se realizar alinhamentos múltiplos em oposição a alinhamentos em pares? Alinhamento múltiplos

Leia mais

Métodos de alinhamento de sequências biológicas. Marcelo Falsarella Carazzolle

Métodos de alinhamento de sequências biológicas. Marcelo Falsarella Carazzolle Métodos de alinhamento de sequências biológicas Marcelo Falsarella Carazzolle Resumo - Introdução - Alinhamentos ótimos - Global - Local (Smith-Waterman) - Semi global - Matrizes de alinhamento (BLOSUM)

Leia mais

Alinhamentos de sequências e Busca de Similaridade

Alinhamentos de sequências e Busca de Similaridade Alinhamentos de sequências e Busca de Similaridade Ariane Machado Lima ariane.machado@usp.br Escola de Artes, Ciências e Humanidades - USP Contexto http://www.ekac.org/gene.html http://www.fuzzco.com/news/wp-content/uploads/27//genome.jpg

Leia mais

Alinhamentos e Busca de Similaridade. Ariane Machado Lima

Alinhamentos e Busca de Similaridade. Ariane Machado Lima Alinhamentos e Busca de Similaridade Ariane Machado Lima Busca de identidade Identificar o que é determinada seqüência Ex.acabou de seqüenciar, seria contaminante? Outras fases de um projeto de seqüenciamento

Leia mais

Alinhamento de Sequências e Genômica Comparativa

Alinhamento de Sequências e Genômica Comparativa Encontro França-Brasil de Bioinformática Universidade Estadual de Santa Cruz (UESC) Ilhéus-BA - Brasil Alinhamento de Sequências e Genômica Comparativa Maria Emília M. T. Walter Departamento de Ciência

Leia mais

PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE

PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE CONCEITOS EM EPIDEMIOLOGIA E FILOGENIA MOLECULARES PAULO EDUARDO BRANDÃO, PhD DEPARTAMENTO DE MEDICINA VETERINÁRIA PREVENTIVA E SAÚDE ANIMAL FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA UNIVERSIDADE DE

Leia mais

Comparação e alinhamento de sequências

Comparação e alinhamento de sequências Comparação e alinhamento de sequências Comparar sequências A comparação de sequências de proteínas ou DNA/RNA é uma ferramenta essencial na procura da existência de relações de semelhança entre o todo

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

ALINHAMENTO DE SEQUÊNCIAS

ALINHAMENTO DE SEQUÊNCIAS Disciplina de BIOLOGIA COMPUTACIONAL Mestrado em ENGENHARIA BIOMÉDICA 4º Ano, 1º Semestre 2007/08 ALINHAMENTO DE SEQUÊNCIAS Relatório 2 Ana Calhau Ângela Pisco Nuno Santos 54605 55748 55746 Palavras-Chave:

Leia mais

Resumo - capítulo 3 - Alinhamento de pares de sequências

Resumo - capítulo 3 - Alinhamento de pares de sequências Resumo - capítulo 3 - Alinhamento de pares de sequências Pedro Ivo Gomes de Faria Sumário 1 Introdução 3 1.1 Definição de alinhamento de sequências............. 3 1.1.1 Alinhamento global....................

Leia mais

Alinhamentos de Múltiplas Seqüências. Rogério T. Brito Orientador: José A. R. Soares

Alinhamentos de Múltiplas Seqüências. Rogério T. Brito Orientador: José A. R. Soares 1 Alinhamentos de Múltiplas Seqüências Rogério T. Brito Orientador: José A. R. Soares 2 Motivação Problema em Biologia: saber qual é o grau de parentesco entre um conjunto de espécies (construção de árvores

Leia mais

3 Algoritmos Genéticos

3 Algoritmos Genéticos Técnicas de Inteligência Computacional 33 3 Algoritmos Genéticos Este capítulo resume os principais conceitos sobre o algoritmo evolucionário empregado nesta dissertação. É apresentada uma breve explicação

Leia mais

Evolução Molecular. "Nothing in Biology Makes Sense Except in the Light of Evolution. Theodosius Dobzhansky

Evolução Molecular. Nothing in Biology Makes Sense Except in the Light of Evolution. Theodosius Dobzhansky "Nothing in Biology Makes Sense Except in the Light of Evolution Theodosius Dobzhansky Evolução Evolução Evolução Genótipo + Ambiente = Fenótipo Parental F1 F2 Evolução Evolução = mudança (características

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

Alinhamento de Sequências de Proteínas. Modelagem por homologia Estratégia/aplicação Etapas do processo Exemplo

Alinhamento de Sequências de Proteínas. Modelagem por homologia Estratégia/aplicação Etapas do processo Exemplo Objetivos FFI0776 Modelagem e Engenharia de Proteínas Prof. Rafael V. C. Guido rvcguido@ifsc.usp.br Aula 06 Alinhamento de Sequências de Proteínas Determinação da sequência de aa Características do alinhamento

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Bioinformática. Alinhamento de Sequências. Prof. Msc. Rommel Ramos

Bioinformática. Alinhamento de Sequências. Prof. Msc. Rommel Ramos Bioinformática Alinhamento de Sequências Prof. Msc. Rommel Ramos 2013 Sumário 1. Comparação de Sequências 2. O que é alinhamento? 3. Tipos de Alinhamento 4. Algoritmos 5. Métodos de Alinhamento Comparação

Leia mais

Alinhamento de Seqüências Biológicas

Alinhamento de Seqüências Biológicas O que se cmpara? Alinhament de Seqüências Bilógicas A cmparaçã de seqüências de DNA, RNA e prteínas é uma das bases da biinfrmática. Citsina Uracila Timina Prfª Drª Silvana Giuliatti Departament de Genética

Leia mais

RESUMOS ELABORADOS PELOS ALUNOS DO. Tema Paleontologia

RESUMOS ELABORADOS PELOS ALUNOS DO. Tema Paleontologia RESUMOS ELABORADOS PELOS ALUNOS DO Conceitos mais importantes: Tema Paleontologia Paleontologia: é uma das ciências que estuda a evolução da vida na Terra ao longo do tempo geológico; Fóssil: são restos

Leia mais

Nada em Biologia faz sentido senão à luz da evolução.

Nada em Biologia faz sentido senão à luz da evolução. Marcos T. Geraldo ADAPTABILIDADE Nada em Biologia faz sentido senão à luz da evolução. Theodosius Dobzhansky (1973) 1 Processo de evolução em moléculas de DNA, RNA e proteínas Reconstrução das relações

Leia mais

Biologia Molecular Computacional Homologia

Biologia Molecular Computacional Homologia Biologia Molecular Computacional Homologia Luiz Thibério Rangel O que é homologia? Conceito básico para estudos de genômica comparativa; Passo inicial para estudos de filogenia(omica); Importante para

Leia mais

Estrutura covalente de proteínas estrutura tridimensional. Proteina: estrutura covalente com muitas restrições conformacionais

Estrutura covalente de proteínas estrutura tridimensional. Proteina: estrutura covalente com muitas restrições conformacionais Estrutura covalente de proteínas estrutura tridimensional Proteina: estrutura covalente com muitas restrições conformacionais M. Teresa Machini IQ/USP Análise de sequência de aminoácidos Conteúdo de aminoácidos

Leia mais

Cap. 6: Métodos para alinhamento de múltiplas seqüências

Cap. 6: Métodos para alinhamento de múltiplas seqüências Cap. 6: Métodos para alinhamento de múltiplas seqüências Organização O que é um alinhamento múltiplo Escores para alinhamentos múltiplos Relação entre alinhamento múltiplo e análise filogenética Métodos

Leia mais

Universidade Federal do Espírito Santo Programa de Pós Graduação em Biotecnologia Bioinformática. Kellyn Joselyn Andino Lopez Mariana Lugon Lima

Universidade Federal do Espírito Santo Programa de Pós Graduação em Biotecnologia Bioinformática. Kellyn Joselyn Andino Lopez Mariana Lugon Lima Universidade Federal do Espírito Santo Programa de Pós Graduação em Biotecnologia Bioinformática Kellyn Joselyn Andino Lopez Mariana Lugon Lima Alinhamento é...... Comparação de sequências oriundas de

Leia mais

Tipos de Dados Biológicos e Multimídia

Tipos de Dados Biológicos e Multimídia Tipos de Dados Biológicos e Multimídia Arthur Emanuel de O. Carosia Felipe Alves da Louza Luana Peixoto Annibal 1 Dados Biológicos São dados ou medidas coletadas a partir de fontes biológicas São geralmente

Leia mais

Sequenciamento de genoma e transcriptomas

Sequenciamento de genoma e transcriptomas Sequenciamento de genoma e transcriptomas Por que seqüenciar genomas? O seqüenciamento de genomas é o primeiro passo para obter uma descrição completa da composição molecular de cada organismo, pois todas

Leia mais

TÍTULO: ANÁLISE DA SEMELHANÇA ESTRUTURAL ENTRE PROTEÍNAS ATRAVÉS DE MÉTODOS MATEMÁTICOS

TÍTULO: ANÁLISE DA SEMELHANÇA ESTRUTURAL ENTRE PROTEÍNAS ATRAVÉS DE MÉTODOS MATEMÁTICOS Anais do Conic-Semesp. Volume 1, 2013 - Faculdade Anhanguera de Campinas - Unidade 3. ISSN 2357-8904 TÍTULO: ANÁLISE DA SEMELHANÇA ESTRUTURAL ENTRE PROTEÍNAS ATRAVÉS DE MÉTODOS MATEMÁTICOS CATEGORIA: CONCLUÍDO

Leia mais

Exemplo de Aplicação de Algoritmos Genéticos. Prof. Juan Moisés Mauricio Villanueva cear.ufpb.br/juan

Exemplo de Aplicação de Algoritmos Genéticos. Prof. Juan Moisés Mauricio Villanueva cear.ufpb.br/juan Exemplo de Aplicação de Algoritmos Genéticos Prof. Juan Moisés Mauricio Villanueva jmauricio@cear.ufpb.br cear.ufpb.br/juan Estrutura do Algoritmo Genético Algoritmo genético Inicio t = 0 inicializar P(t)

Leia mais

Anabolismo Nuclear e Divisão Celular

Anabolismo Nuclear e Divisão Celular 1. (UFRN) Uma proteína X codificada pelo gene Xp é sintetizada nos ribossomos, a partir de um RNAm. Para que a síntese aconteça, é necessário que ocorram, no núcleo e no citoplasma, respectivamente, as

Leia mais

E se ocorrerem erros durante estes processos? Mutações, que consequências?

E se ocorrerem erros durante estes processos? Mutações, que consequências? E se ocorrerem erros durante estes processos? Mutações, que consequências? Alterações do material genético Mutações alterações bruscas do material genético. Mutantes indivíduos que manifestam mutações.

Leia mais

Universidade Estadual de Maringá - UEM

Universidade Estadual de Maringá - UEM Universidade Estadual de Maringá - UEM Disciplina: Biologia Molecular 6855 T1 e T2 Ciências Biológicas Transcriptoma metodologia ORESTES Profa. Dra. Maria Aparecida Fernandez Estratégia ORESTES ESTs de

Leia mais

Aminoácidos e peptídeos. Prof.: Matheus de Souza Gomes Disciplina: Bioquímica I

Aminoácidos e peptídeos. Prof.: Matheus de Souza Gomes Disciplina: Bioquímica I Aminoácidos e peptídeos Prof.: Matheus de Souza Gomes Disciplina: Bioquímica I Patos de Minas 2017 Conteúdo Aminoácidos e peptídeos Constituição das proteínas Aminoácidos Estrutura Classificação Ácido

Leia mais

Aminoácidos peptídeos e proteínas

Aminoácidos peptídeos e proteínas Pontifícia Universidade Católica de Goiás Departamento de Biologia Aminoácidos peptídeos e proteínas Prof. Macks Wendhell Gonçalves, Msc mackswendhell@gmail.com Algumas funções de proteínas A luz produzida

Leia mais

MATRIZES - PARTE Mais exemplos Multiplicação de duas matrizes AULA 26

MATRIZES - PARTE Mais exemplos Multiplicação de duas matrizes AULA 26 AULA 26 MATRIZES - PARTE 2 26. Mais exemplos Nesta aula, veremos mais dois algoritmos envolvendo matrizes. O primeiro deles calcula a matriz resultante da multiplicação de duas matrizes e utiliza três

Leia mais

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto

Do DNA à Proteína: Síntese protéica. Profa. Dra. Viviane Nogaroto Do DNA à Proteína: Síntese protéica TRADUÇÃO: informação genética em moléculas de mrna é traduzida nas sequências de aminoácidos de proteínas de acordo com especificações do código genético. DO DNA À PROTEÍNA

Leia mais

introdução ao curso

introdução ao curso introdução ao curso http://www.ifsc.usp.br/~rdemarco/ffi0760/ffi0760.htm Cronograma aulas teóricas Aulas teóricas (Segundas-feiras - Sala 146) 30/07-introdução ao curso. 06/08-Busca em bancos de dados

Leia mais

Resumo - capítulo 5 - Predição da estrutura secundária do RNA

Resumo - capítulo 5 - Predição da estrutura secundária do RNA Resumo - capítulo 5 - Predição da estrutura secundária do RNA Pedro Ivo Gomes de Faria Sumário 1 Introdução 2 1.1 Fundamentos da predição da estrutura do RNA........ 2 1.2 Características da estrutura

Leia mais

Aminoácidos não-essenciais: alanina, ácido aspártico, ácido glutâmico, cisteína, glicina, glutamina, hidroxiprolina, prolina, serina e tirosina.

Aminoácidos não-essenciais: alanina, ácido aspártico, ácido glutâmico, cisteína, glicina, glutamina, hidroxiprolina, prolina, serina e tirosina. AMINOÁCIDOS Os aminoácidos são as unidades fundamentais das PROTEÍNAS. Existem cerca de 300 aminoácidos na natureza, mas nas proteínas podemos encontrar 20 aminoácidos principais Estruturalmente são formados

Leia mais

MUTAÇÕES E MECANISMOS DE REPARO. Prof. Odir A. Dellagostin

MUTAÇÕES E MECANISMOS DE REPARO. Prof. Odir A. Dellagostin MUTAÇÕES E MECANISMOS DE REPARO Prof. Odir A. Dellagostin O QUE É MUTAÇÃO? QUALQUER ALTERAÇÃO NA SEQÜÊNCIA DE DNA genômica (adição ou perda de cromossomos); cromossômica (adição, perda ou mudança de local/orientação

Leia mais

Aminoácidos, Péptidos e Proteínas

Aminoácidos, Péptidos e Proteínas Aminoácidos, Péptidos e Proteínas Proteínas: -São as macromoléculas biológicas mais abundantes, presentes em todas as células. - Ocorrem numa variedade enorme numa mesma célula. - Exibem uma enorme diversidade

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Identificação de proteínas através de espectrometria de

Identificação de proteínas através de espectrometria de Identificação de proteínas através de espectrometria de massa Proteomica Durante o curso vimos que é possível realizar medidas de presença e abundancia de moléculas de mrna e deste modo realizar inferências

Leia mais

ESTRUTURA DAS PROTEÍNAS

ESTRUTURA DAS PROTEÍNAS ESTRUTURA DAS PROTEÍNAS Todas essas forças são usadas para a manutenção da estrutura tridimensional das proteínas - conformação A conformação de uma proteína é fundamental para a função que ela exerce

Leia mais

Metahuerísticas: Algoritmos Genéticos. Sistemas de Informação/Ciências da Computação UNISUL Aran Bey Tcholakian Morales, Dr. Eng.

Metahuerísticas: Algoritmos Genéticos. Sistemas de Informação/Ciências da Computação UNISUL Aran Bey Tcholakian Morales, Dr. Eng. Metahuerísticas: Algoritmos Genéticos Sistemas de Informação/Ciências da Computação UNISUL Aran Bey Tcholakian Morales, Dr. Eng. (Apostila 8) Meta-heurísticas Classificação de métodos heurísticos: os métodos

Leia mais

Teoria e Prática de Sistemática Filogenética

Teoria e Prática de Sistemática Filogenética Disciplina BOT-99 PPG-BOT-INPA Teoria e Prática de Sistemática Filogenética Alberto Vicentini alberto.vicentini@inpa.gov.br Mário Henrique Terra Araujo araujo.mht@gmail.com Programa de Pós-Graduação em

Leia mais

Resumo - capítulo 4 - Alinhamento múltiplo de sequências

Resumo - capítulo 4 - Alinhamento múltiplo de sequências Resumo - capítulo 4 - Alinhamento múltiplo de sequências Pedro Ivo Gomes de Faria Sumário 1 Introdução 3 1.1 Sequenciamento de genomas................... 3 1.2 Usos de alinhamentos múltiplos de sequências.........

Leia mais

IACB 1º Semestre de 2014/2015. Exercicios de Preparação para o Teste 1

IACB 1º Semestre de 2014/2015. Exercicios de Preparação para o Teste 1 IACB 1º Semestre de 2014/2015 Exercicios de Preparação para o Teste 1 Introdução (0 ou 1 questão no teste 1) 1. O que é a BioInformática? Resposta: Bioinformática é um campo interdisciplinar que aplica

Leia mais

ALGORITMOS EVOLUCIONARIOS MULTIOBJETIVO PARA ALINHAMENTO MÚLTIPLO DE SEQÛËNCIAS BIOLÓGICAS. Margarita Ramona Ruiz Olazar

ALGORITMOS EVOLUCIONARIOS MULTIOBJETIVO PARA ALINHAMENTO MÚLTIPLO DE SEQÛËNCIAS BIOLÓGICAS. Margarita Ramona Ruiz Olazar ALGORITMOS EVOLUCIONARIOS MULTIOBJETIVO PARA ALINHAMENTO MÚLTIPLO DE SEQÛËNCIAS BIOLÓGICAS Margarita Ramona Ruiz Olazar DISSERTAÇÃO SUBMETIDA AO CORPO DOCENTE DA COORDENAÇÃO DOS PROGRAMAS DE PÓS-GRADUAÇÃO

Leia mais

Capítulo 6. Alinhamentos múltiplos de sequências macromoleculares.

Capítulo 6. Alinhamentos múltiplos de sequências macromoleculares. Capítulo 6. Alinhamentos múltiplos de sequências macromoleculares. versão 0.5 Como vimos no capítulo anterior, o procedimento de alinhamento entre sequências de macromoléculas equivale ao estabelecimento

Leia mais

Lista de Exercícios - Monitorias

Lista de Exercícios - Monitorias Monitoria (Biologia - Biologia Molecular) - data (27/06) 01 (UNEAL 2013) Muito tem sido aprendido sobre como as instruções genéticas escritas em um alfabeto de apenas 4 letras os quatros diferentes nucleotídeos

Leia mais

Transformada de Discreta de Co senos DCT

Transformada de Discreta de Co senos DCT Transformada de Discreta de Co senos DCT O primeiro passo, na maioria dos sistemas de compressão de imagens e vídeo, é identificar a presença de redundância espacial (semelhança entre um pixel e os pixels

Leia mais

Departamento de Biodiversidade Evolução e Meio Ambiente Universidade Federal de Ouro Preto

Departamento de Biodiversidade Evolução e Meio Ambiente Universidade Federal de Ouro Preto Departamento de Biodiversidade Evolução e Meio Ambiente Universidade Federal de Ouro Preto Prof. Dr. Roberth Fagundes roberthfagundes@gmail.com cladograma Como descobrir a filogenia de uma grupo? relações

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007

Estágio Docência. Vanessa Veltrini Abril Doutoranda em. Março de 2007 Ação Gênica Estágio Docência Vanessa Veltrini Abril Doutoranda em Genética e Melhoramento Animal Março de 2007 Qual é a função do DNA? Como a informação genética é transportada? Genes TRANSFERÊNCIA DE

Leia mais

AMINOÁCIDOS.! São biomoléculas que apresentam na sua constituição as funções amina primária e ácido carboxílico NH2 I R - C - C = 0O I I H OH

AMINOÁCIDOS.! São biomoléculas que apresentam na sua constituição as funções amina primária e ácido carboxílico NH2 I R - C - C = 0O I I H OH Aminoácidos AMNOÁCDOS! São biomoléculas que apresentam na sua constituição as funções amina primária e ácido carboxílico radical R C-alfa N2 R - C - C = 0O O amina primária ácido carboxílico Aminoácidos

Leia mais

Sequenciamento de genoma e transcriptomas

Sequenciamento de genoma e transcriptomas Sequenciamento de genoma e transcriptomas Durante décadas o método de Sanger foi praticamente a única opção utilizada para sequenciamento de DNA Nos últimos anos surgiram novas tecnologias de sequenciamento

Leia mais

4 TEORIA MATEMÁTICA DA COMUNICAÇÃO DE SHANNON

4 TEORIA MATEMÁTICA DA COMUNICAÇÃO DE SHANNON 4 TEORIA MATEMÁTICA DA COMUNICAÇÃO DE SHANNON A Teoria Matemática da Comunicação, ou Teoria da Comunicação de Shannon foi proposta por Claude Shannon no final da década de 1940 como forma de sistematizar

Leia mais

Computação Evolutiva Eduardo do Valle Simões Renato Tinós ICMC - USP

Computação Evolutiva Eduardo do Valle Simões Renato Tinós ICMC - USP Computação Evolutiva Eduardo do Valle Simões Renato Tinós ICMC - USP 1 Principais Tópicos Introdução Evolução Natural Algoritmos Genéticos Aplicações Conclusão 2 Introdução http://www.formula-um.com/ Como

Leia mais

Compressão Sem Perdas: Codificações Huffman e Aritmética. Adelar da Silva Queiróz Marcelo Teixeira Thiago da Silva Sodré

Compressão Sem Perdas: Codificações Huffman e Aritmética. Adelar da Silva Queiróz Marcelo Teixeira Thiago da Silva Sodré Compressão Sem Perdas: Codificações Huffman e Aritmética Adelar da Silva Queiróz Marcelo Teixeira Thiago da Silva Sodré Compressão Sem Perdas (Lossless Data Compression) Refere-se a métodos de compressão

Leia mais

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº

Biologia Ensino Médio 2º ano classe: Prof. Cesinha Nome: nº PRIMEIR LETR TEREIR LETR Biologia Ensino Médio 2º ano classe: Prof. esinha Nome: nº Valor: 10 Nota:. Lista de ExercíciosTarefa- Segundos nos prof. esinha 2015 1. (ff 2010) figura a seguir representa um

Leia mais

Profº Lásaro Henrique

Profº Lásaro Henrique Profº Lásaro Henrique Proteínas são macromoléculas complexas, compostas de aminoácidos. São os constituintes básicos da vida e necessárias para os processos químicos que ocorrem nos organismos vivos. Nos

Leia mais

Predição de modificações em proteínas

Predição de modificações em proteínas Predição de modificações em proteínas Modificações de proteína Ao representarmos uma proteína como uma seqüência de caracteres representando os seus aminoácidos (estrutura primaria) estamos representando

Leia mais

Ancoragem de genomas incompletos em genomas completos

Ancoragem de genomas incompletos em genomas completos Ancoragem de genomas incompletos em genomas completos André Chastel Lima Dissertação de Mestrado Orientação: Prof. Dr. Nalvo Franco de Almeida Junior Área de Concentração: Biologia Computacional Dissertação

Leia mais

Aminoácidos (aas) Prof.ª: Suziane Antes Jacobs

Aminoácidos (aas) Prof.ª: Suziane Antes Jacobs Aminoácidos (aas) Prof.ª: Suziane Antes Jacobs Introdução Pequenas moléculas propriedades únicas Unidades estruturais (UB) das proteínas N- essencial para a manutenção da vida; 20 aminoácidos-padrão -

Leia mais

Interações de van der Waals. Interações de van der Waals. Interações de van der Waals.

Interações de van der Waals. Interações de van der Waals. Interações de van der Waals. Interações de van der Waals aandrico@if.sc.usp.br Também conhecidas como forças de dispersão de London, caracterizam-se pelo momento de dipolo induzido e ocorrem entre todos os átomos. Apesar de moléculas

Leia mais

IGC - Dia Aberto 2010 Unidade de Bioinformática e Biologia Computacional

IGC - Dia Aberto 2010 Unidade de Bioinformática e Biologia Computacional 2 I Como é que o DNA codifica para proteínas? Sabia que: O DNA é constituído por fiadas de quatro nucleótidos diferentes, representados pelas letras A G T C, em que A é adenina, G guanina, T timina e C

Leia mais

Proteínas São macromoléculas complexas, compostas de aminoácidos, e necessárias para os processos químicos que ocorrem nos organismos vivos

Proteínas São macromoléculas complexas, compostas de aminoácidos, e necessárias para os processos químicos que ocorrem nos organismos vivos Proteínas São macromoléculas complexas, compostas de aminoácidos, e necessárias para os processos químicos que ocorrem nos organismos vivos São os constituintes básicos da vida: tanto que seu nome deriva

Leia mais

Algoritmos Genéticos. Pontos fracos dos métodos tradicionais. Características de alguns problemas. Tamanho do espaço de busca- Ex. caixeiro viajante:

Algoritmos Genéticos. Pontos fracos dos métodos tradicionais. Características de alguns problemas. Tamanho do espaço de busca- Ex. caixeiro viajante: Algoritmos Genéticos Prof. Luis Otavio Alvares INE/UFSC Características de alguns problemas Tamanho do espaço de busca- Ex. caixeiro viajante: 10 cidades: 181.000 soluções 20 cidades: 10.000.000.000.000

Leia mais

Prof. Marcelo Langer. Curso de Biologia. Aula Genética

Prof. Marcelo Langer. Curso de Biologia. Aula Genética Prof. Marcelo Langer Curso de Biologia Aula Genética CÓDIGO GENÉTICO Uma linguagem de códons e anticódons, sempre constituídos por 3 NUCLEOTÍDEOS. 64 CODONS = 4 tipos diferentes de nucleotídeos, combinação

Leia mais

2 Contexto Biológico Genômica

2 Contexto Biológico Genômica 15 2 Contexto Biológico Neste capítulo abordaremos o contexto biológico para o entendimento deste trabalho. Serão abordados os aspectos gerais da genômica, expostos os processos do sequenciamento genético

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Álgebra Linear e Geometria Analítica Bacharelados e Engenharias Parte II Matrizes (continuação)

Álgebra Linear e Geometria Analítica Bacharelados e Engenharias Parte II Matrizes (continuação) Álgebra Linear e Geometria Analítica Bacharelados e Engenharias Parte II Matrizes (continuação) Prof.a Tânia Preto Departamento Acadêmico de Matemática UTFPR - 2014 Importante Material desenvolvido a partir

Leia mais

Modelagem Comparativa de Proteínas

Modelagem Comparativa de Proteínas Modelagem Comparativa de Proteínas Bioinformática Estrutural Aula 3 3 de Junho de 2013 Paula Kuser Falcão Laboratório de Bioinformática Aplicada Embrapa Informática Agropecuária Por que predizer a estrutura?

Leia mais

Aminoácidos e Peptideos

Aminoácidos e Peptideos Aminoácidos e Peptideos O que são aminoácidos? Precursores de vários tipos de biomoléculas Compostos formados por : um grupo amina primário [ ] um grupo ácido carboxílico [ ] ambos ligados a um carbono

Leia mais

MARCADORES MOLECULARES

MARCADORES MOLECULARES ESALQ/USP MARCADORES MOLECULARES Base genética dos marcadores e usos no melhoramento de plantas e em estudos de diversidade genética e conservação Departamento de Genética ESTUDO DIRIGIDO 1. O que são

Leia mais

INSTRUÇÕES PARA A REALIZAÇÃO DA PROVA LEIA COM MUITA ATENÇÃO

INSTRUÇÕES PARA A REALIZAÇÃO DA PROVA LEIA COM MUITA ATENÇÃO 3º EM Biologia A Marli / Pedro Av. Mensal 04/06/14 INSTRUÇÕES PARA A REALIZAÇÃO DA PROVA LEIA COM MUITA ATENÇÃO 1. Verifique, no cabeçalho desta prova, se seu nome, número e turma estão corretos. 2. Esta

Leia mais

14/02/2017. Genética. Professora Catarina

14/02/2017. Genética. Professora Catarina 14/02/2017 Genética Professora Catarina 1 A espécie humana Ácidos nucleicos Tipos DNA ácido desoxirribonucleico RNA ácido ribonucleico São formados pela união de nucleotídeos. 2 Composição dos nucleotídeos

Leia mais

Teste de Software. Teste Funcional Teste Estrutural. Teste Baseado em Erros (Análise de Mutantes)

Teste de Software. Teste Funcional Teste Estrutural. Teste Baseado em Erros (Análise de Mutantes) Teste de Software Teste Funcional Teste Estrutural Teste Baseado em Erros (Análise de Mutantes) Profa Rosana T. V. Braga Material adaptado do material dos profs. Ellen Francine Barbosa e José Carlos Maldonado

Leia mais

Algoritmos Genéticos. Princípio de Seleção Natural. Sub-áreas da Computação Evolutiva. Idéias básicas da CE. Computação Evolutiva

Algoritmos Genéticos. Princípio de Seleção Natural. Sub-áreas da Computação Evolutiva. Idéias básicas da CE. Computação Evolutiva Computação Evolutiva Algoritmos Genéticos A computação evolutiva (CE) é uma área da ciência da computação que abrange modelos computacionais inspirados na Teoria da Evolução das Espécies, essencialmente

Leia mais

Estatística I Aula 2. Prof.: Patricia Maria Bortolon, D. Sc.

Estatística I Aula 2. Prof.: Patricia Maria Bortolon, D. Sc. Estatística I Aula 2 Prof.: Patricia Maria Bortolon, D. Sc. Análise Exploratória de Dados Consiste em resumir e organizar os dados coletados Utiliza-se tabelas, gráficos ou medidas numéricas para resumir

Leia mais

BIOLOGIA. Questões de 01 a 06

BIOLOGIA. Questões de 01 a 06 GRUPO 2 TIPO A BIO. 1 BIOLOGIA Questões de 01 a 06 01. O colágeno é uma proteína fibrosa e um dos constituintes mais abundantes do tecido conjuntivo dos vertebrados, encontrada principalmente em tendões,

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO Disciplina de BIOLOGIA E GEOLOGIA 11º ano 1º Teste Formativo 11º A TEMA: DNA e Síntese de Proteínas 45 minutos 21 de Outubro de 2011 Nome: Nº Classificação: _,

Leia mais

Professor Antônio Ruas

Professor Antônio Ruas Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Componente curricular: BIOLOGIA GERAL Aula 4 Professor Antônio Ruas 1. Temas: Macromoléculas celulares Produção

Leia mais

Modelos Evolucionários e Tratamento de Incertezas

Modelos Evolucionários e Tratamento de Incertezas Ciência da Computação Modelos Evolucionários e Tratamento de Incertezas Aula 03 Teoria dos Esquemas Max Pereira Um esquema consiste em um template descrevendo um subconjunto dentre o conjunto de todos

Leia mais

Aminoácidos. Prof. Dr. Walter F. de Azevedo Jr. Laboratório de Sistemas BioMoleculares. Departamento de Física. UNESP São José do Rio Preto. SP.

Aminoácidos. Prof. Dr. Walter F. de Azevedo Jr. Laboratório de Sistemas BioMoleculares. Departamento de Física. UNESP São José do Rio Preto. SP. Aminoácidos Prof. Dr. Walter F. de Azevedo Jr. Laboratório de Sistemas BioMoleculares. Departamento de Física. UNESP São José do Rio Preto. SP. Resumo Introdução Quiralidade Ligação peptídica Cadeia peptídica

Leia mais

SOLUÇÕES HEURÍSTICAS PARA O JOGO DE DAMAS

SOLUÇÕES HEURÍSTICAS PARA O JOGO DE DAMAS Universidade Federal do Tocantins SOLUÇÕES HEURÍSTICAS PARA O JOGO DE DAMAS Diogo Rigo de Brito Guimarães Alexandre Tadeu Rossini da Silva Objetivo Implementar soluções heurísticas para o Jogo de Damas

Leia mais

Módulo: Biodiversidade

Módulo: Biodiversidade Módulo: Biodiversidade Paulo Cesar de Paiva 2016!1 Aula 1 O que é Biodiversidade? Diversidade, Riqueza e Biodiversidade Biodiversidade é uma palavra que tem sido incorporada ao vocabulário regular, não

Leia mais

Cálculo Numérico Noções básicas sobre erros

Cálculo Numérico Noções básicas sobre erros Cálculo Numérico Noções básicas sobre erros Profa. Vanessa Rolnik 1º semestre 2015 Fases da resolução de problemas através de métodos numéricos Problema real Levantamento de Dados Construção do modelo

Leia mais

Universidade de Brasília

Universidade de Brasília Universidade de Brasília Instituto de Ciências Exatas Departamento de Ciência da Computação MASA-SSE: Comparação de Sequências Biológicas Utilizando Instruções Vetoriais Phillipe G. Ferreira Monografia

Leia mais

IBM1029 Introdução à Bioinformática. O Início da Bioinformática 27/03/2017. Aula 2. O Início. Bioionformática: definição

IBM1029 Introdução à Bioinformática. O Início da Bioinformática 27/03/2017. Aula 2. O Início. Bioionformática: definição IBM1029 Introdução à Bioinformática Profa Dra Silvana Giuliatti Departamento de Genética FMRP silvana@fmrp.usp.br O Início da Bioinformática Aula 2 O Início Trabalho de Margaret Dayhoff e colaboradores:

Leia mais

Estrutura comum dos AEs

Estrutura comum dos AEs Estrutura comum dos AEs Os algoritmos estudados seguem o seguinte padrão para modelagem dos sistemas evolutivos: Uma população de tamanho constante m evolui sobre o tempo A população atual é utilizada

Leia mais

A origem do Cromossomo Y

A origem do Cromossomo Y A origem do Cromossomo Y Felipe Costa¹; Matheus Lobo² ¹Aluno do Curso de Licenciatura em Física; Campus de Araguaína TO off.r.dac@gmail.com PIBIC/CNPq ²Orientador do Curso de Licenciatura em Física; Campus

Leia mais

4 Modelagem em Árvore

4 Modelagem em Árvore MODELAGEM EM ÁRVORE 39 4 Modelagem em Árvore 4.1 Introdução A modelagem por árvore de cenários é uma forma usual de representação de incertezas em problemas estocásticos multi-período [9, 14, 28, 42, 43].

Leia mais

Codificação de Seqüências de Aminoácidos e sua Aplicação na Classificação de Proteínas com Redes Neurais Artificiais. Thiago de Souza Rodrigues

Codificação de Seqüências de Aminoácidos e sua Aplicação na Classificação de Proteínas com Redes Neurais Artificiais. Thiago de Souza Rodrigues Codificação de Seqüências de Aminoácidos e sua Aplicação na Classificação de Proteínas com Redes Neurais Artificiais Thiago de Souza Rodrigues Universidade Federal de Minas Gerais Instituto de Ciências

Leia mais

Árvores Filogenéticas

Árvores Filogenéticas Árvores Filogenéticas 1 Introdução todos os fundamentos da biologia moderna estão associados à teoria da evolução de Darwin. de aspectos de anatomia, passando por comportamento e chegando à genética, toda

Leia mais

3 Similaridade e tamanho da seqüência de consulta no BLAST

3 Similaridade e tamanho da seqüência de consulta no BLAST 3 Similaridade e tamanho da seqüência de consulta no BLAST Quando se planeja construir aplicativos que utilizam um agrupamento de computadores no intuito de paralelizar ou distribuir processamento, se

Leia mais

seleção natural. A seleção natural atua sobre a variabilidade selecionando os mais aptos.

seleção natural. A seleção natural atua sobre a variabilidade selecionando os mais aptos. Mutação gênica, recombinação gênica e seleção natural. Variabilidade genética A seleção natural atua sobre a variabilidade selecionando os mais aptos. Nas diversas populações de uma mesma espécie, os indivíduos

Leia mais