Noções de Probabilidade

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Noções de Probabilidade"

Transcrição

1 Noções de Probabilidade Joel M. Corrêa da Rosa 2011 A estatística descritiva é ferramenta indispensável para extrair informação em um conjunto de dados. Entretanto, a tomada de decisões está fortemente vinculada ao uso da estatística inferencial que, por sua vez, ampara-se no Cálculo de Probabilidades. As técnicas de Estatística Inferencial podem ser classificadas em : técnicas de estimação e testes de hipóteses. Antes de investigar estas técnicas é indispensável conhecer conceitos básicos no Cálculo de Probabilidades. Este texto procura apresentar de forma breve e objetiva os conceitos básicos que integram as principais noções de probabilidades. Experimento Aleatório O experimento aleatório é aquele que quando realizado, mesmo de modo controlado, não há como predizer o seu resultado. Se o experimento não é aleatório, este é dito ser determinístico. Existe ainda uma terceira categoria de experimentos chamados de caóticos. A maioria dos experimentos científicos se encaixam na categoria dos experimentos aleatórios e são raros os exemplos de experimentos não-aleatórios(determinísticos). Espaço Amostral O espaço amostral é o conjunto de todos os possíveis resulados de um experimento aleatório. Usualmente este conjunto é denotado por Ω. Como não é possível determinar o resultado do experimento aleatório, estudá-lo por meio de probabilidades implica em primeiramente construir o seu espaço amostral. 1

2 Os espaços amostrais são de três tipos : Finitos Infinitos Enumeráveis Infinitos Não-Enumeráveis Alguns espaços amostrais vinculados a experimentos aleatórios são apresentados a seguir. Exemplo 1 Arremessa-se uma moeda honesta e observa-se a face voltada para cima. O espaço amostral neste caso é finito e obtido por Ω = {cara,coroa}. No próximo exemplo apresentamos um experimento aleatório cujo espaço amostral é infinito, porém enumerável. Exemplo 2 Um experimento aleatório é realizado por consecutivos arremessos de uma moeda honesta e registro do número de lançamentos até a obtenção da primeira cara. Os resultados possíveis deste experimento são: Ω = {1, 2, 3, 4,...} Para completar os exemplos dos espaços amostrais e seus respectivos tipos, vamos verificar uma situação em que o espaço amostral é infinito e não-enumerável. Exemplo 3 Um experimento consiste em registrar o retorno percentual diário do investimento em uma carteira de ações.o espaço amostral é formado por um intervalo contínuo de valores que, por conveniência, assumiremos estar entre duas quantidades desconhecidas M% e M%,ou seja, Ω = ( M, M).Uma forma abstrata de caracterizar este espaço amostral é definí-lo como:ω = (, ). Eventos Os eventos são subconjuntos do espaço amostral sobre os quais desejamos calcular probabilidades. Em geral, vamos nos referir aos eventos por letras maiúsculas do alfabeto: A, B, C, D,.... Dois eventos especiais são: e Ω. O primeiro é conjunto vazio e o segundo é o próprio espaço amostral. Veja os exemplos abaixo: 2

3 Experimento 1: Lançar uma moeda e observar a face superior Espaço amostral: S = {cara,coroa} Evento A = {cara} Evento B = {coroa} Experimento 2: Lançar um dado e observar a face superior Espaço amostral: S = {cara,coroa} Evento A = {números pares} = {2, 4, 6} Evento B = {números impares} = {1, 3, 5} Experimento 3: Observar o índice mensal de inflação Espaço amostral: S = ( 200%, +200%) Evento A = {deflação} = ( 200%, 0) Evento B = {inflação} = (0, 200%) Probabilidade Probabilidade é uma função que associa números reais no intervalo [0, 1] aos eventos de um experimento aleatório. Esta medida quantifica a chance da ocorrência de um evento de interesse. Vamos nos referir a esta medida por P (.), sendo P (A) a medida de probabilidade do evento A. A sua construção baseia-se nos 3 axiomas : 1. P (A) 0 2. P (Ω) = 1 3. P (A 1 A 2 ) = P (A 1 ) + P (A 2 )se A 1 A 2 = Probabilidade é o principal instrumento da Teoria de Inferência Estatística que é utilizada para a tomada de decisões. Regra da Adição de Probabilidades A regra de adição de probabilidades determina o cálculo da probabilidade da união de eventos. Quando houver interseção esta probabilidade é calculada da seguinte forma: P (A B) = P (A) + P (B) P (A B). 3

4 Quando a interseção é vazia, temos por consequência que P (A B) = 0 e os eventos A e B são ditos serem mutuamente exclusivos. Pode-se dizer que os eventos mutuamente exclusivos são aqueles que não podem ocorrer simultâneamente. A ocorrência de um deles determina a nãoocorrência do outro. Probabilidade Condicional Uma informação sobre o experimento aleatório pode alterar a configuração do espaço amostral e, consequentemente, o cálculo da probabilidade de um evento. Esta probabilidade, calculada com uma informação sobre a ocorrência de um evento, é chamada de probabilidade condicional. Exemplo 4 Um experimento consiste em lançar um dado honesto e equilibrado e observar o número de pontos na face superior. Uma pessoa lança o dado e informa que o resultado é um número ímpar de pontos. Qual a probabilidade de ter ocorrido 5 pontos na face superior? Veja que neste caso já existe o conhecimento da ocorrência do evento B = {Número Ímpar}. Isto modifica o espaço amostral, ou seja, o conjunto de possíveis resultados do experimento está restrito a {1, 3, 5}. A probabilidade condicional é definida da seguinte maneira: P (A B) = P (A B) P (B) para P (B) > 0 A probabilidade acima é lida como probabilidade de A dado a ocorrência de B. Regra da Multiplicação de Probabilidades A regra da multiplicação de probabilidades descreve o cálculo de probabilidades para uma interseção de eventos. Esta regra é obtida simplesmente re-escrevendo a fórmula que possibilita o cálculo de probabilidades condicionais. P (A B) = P (A B)P (B) Note que a igualdade abaixo também é verdadeira. 4

5 P (A B) = P (B A)P (A) Quando os eventos são independentes, a probabilidade de interseção é simplesmente determinada pelo produto das probabilidades. P (A B) = P (A)P (B)se A e B são independentes. Uma outra forma de expressar independência entre eventos é colocá-la em termos da probabilidade condiconal. P (A B) = P (A) se A e B são independentes Teorema da Probabilidade Total Seja A 1, A 2,..., A n uma partição do espaço amostral Ω. Então, segundo o Teorema da Probabilidade Total: P (B) = n P (B A i ) i=1 Este resultado é útil para calcular a probabilidade de um evento quando conhecemos a probabilidade dele ocorrer conjuntamente com outro. De outro modo o resultado pode ser escrito como: P (B) = n P (A i )P (B A i ) i=1 Exemplo 5 Em uma agência bancária, 10% dos clientes são classificados como VIP, 30% dos clientes são preferenciais e 60% são correntistas. A inadimplência no grupo dos VIPs é igual a 10%, no grupo dos preferenciais é 20% e dentre os correntistas é de 30%. Qual a chance de, ao sortear um cliente, ele ser inadimplente. Considere os eventos: I : cliente inadimplente V P : cliente VIP P F : ciente Preferencial 5

6 CR : cliente Correntista pelo Teorema da Probabilidade Total P (I) = P (V P ).P (I V P ) + P (P F )P (I P F ) + P (CR)P (I CR) = Teorema de Bayes P (I) = 0, 1 0, 1 + 0, 3 0, 3 + 0, 6 0, 3 = 0, 28 Como consequência da definição de probabilidade condicional e pelo Teorema da probabilidade total, surge uma importante resultado do cálculo de probabilidades que é o Teorema de Bayes. P (A i B) = P (B A i )P (A i ) n j=1 P (A j).p (B A j ) B; Como um caso particular do Teorema de Bayes, sejam dois eventos A e P (A B) = P (B A)P (A) P (B) Na última expressão podemos ver que a razão entre as probabilidades condicionais é igual a razão entre as probabilidades incondicionais. Exemplo 6 Retira-se, consecutivamente, duas cartas de um baralho. Qual a probabilidade da primeira carta ser ás, sabendo que a segunda é ás? Sejam os eventos: A 1 : primeira carta é um ás A 2 : segunda carta é um ás 4 A probabilidade da primeira carta ser ás é :. Pelo Teorema da Probabilidade Total, podemos encontrar P (A 2 ), da seguinte forma: 52 P (A 2 ) = P (A 2 A 1 ) + P (A 2 A 1 ) = P (A 1 )P (A 2 A 1 ) + P (A 1 )P (A 2 A 1 ) = 6

7 = 4 52 Conhecendo as probabilidades calculadas acima, podemos encontrar P (A 1 A 2 ), Utilizando o Teorema de Bayes, P (A 1 A 2 ) = P (A 2 A 1 )P (A 1 ) P (A 2 ) = = 3 51 Exemplo 7 Considere uma doença que é prevalente em 5 % da população exposta. Um teste para o diagnóstico desta doença acerta 95% dos casos quando as pessoas realmente estão doentes. Esta probabilidade de acerto condicional ao conhecimento do estado do indivíduo é chamada de sensibilidade. Por outro lado, o teste acerta 90% dos casos quando os indivíduos não estão doentes e esta probabilidade é chamada de especificidade. Diante destes fatos, a realização de um teste diagnóstico é um experimento aleatório cujos os eventos de interesse são: D + : pessoa doente D : pessoa saudável T + : teste positivo T : negativo o espaço amostral neste caso é formado pelos elementos: Ω = {(D + T + ), (D T ), (D + T ), (D T + )} Embora não conheçamos de antemão as probabilidades dos eventos que forma o espaço amostral, podemos encontrá-las a partir das probabilidades descritas no enunciado. P (D + ) = 0, 05 P (D ) = 0, 95 P (T + D + ) = 0, 95 P (T D ) = 0, 90 7

8 Pela regra da multiplicação, P (D + T + ) = P (D + )P (T + D + ) = 0, 05 0, 95 = 0, 0475 P (D + T ) = P (D + )P (T D + ) = 0, 05 0, 05 = 0, 0025 P (D T + ) = P (D )P (T + D ) = 0, 95 0, 1 = 0, 095 P (D T ) = P (D )P (T D ) = 0, 95 0, 90 = 0, 855 Pelo Teorema da Probabilidade Total: P (T + ) = P (D + T + ) + P (D + T + ) = 0, , 095 = 0, 1425 P (T ) = P (D + T ) + P (D T ) = 0, , 8575 Pelo Teorema de Bayes, podemos achar P (D + T + ), que é chamado de valor preditivo positivo. P (D + T + ) = P (T + D + )P (D + ) P (T + ) pelo mesmo raciocínio podemos encontrar P (D T ) que é o valor preditivo negativo. 8

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva

Probabilidade. Probabilidade e Estatística. Prof. Dr. Narciso Gonçalves da Silva Probabilidade e Estatística Prof. Dr. Narciso Gonçalves da Silva http://paginapessoal.utfpr.edu.br/ngsilva Probabilidade Probabilidade Experimento Aleatório Um experimento é dito aleatório quando satisfaz

Leia mais

Estatística Empresarial. Fundamentos de Probabilidade

Estatística Empresarial. Fundamentos de Probabilidade Fundamentos de Probabilidade A probabilidade de chuva é de 90% A probabilidade de eu sair é de 5% Conceitos Básicos Conceitos Básicos 1. Experiência Aleatória (E) Processo de obtenção de uma observação

Leia mais

Cap. 4 - Probabilidade

Cap. 4 - Probabilidade Estatística para Cursos de Engenharia e Informática Pedro Alberto Barbetta / Marcelo Menezes Reis / Antonio Cezar Bornia São Paulo: Atlas, 2004 Cap. 4 - Probabilidade APOIO: Fundação de Apoio à Pesquisa

Leia mais

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω.

Chamamos de evento qualquer subconjunto do espaço amostral: A é um evento A Ω. PROBABILIDADE 1.0 Conceitos Gerais No caso em que os possíveis resultados de um experimento aleatório podem ser listados (caso discreto), um modelo probabilístico pode ser entendido como a listagem desses

Leia mais

Teoria das Probabilidades

Teoria das Probabilidades Capítulo 2 Teoria das Probabilidades 2.1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento

Leia mais

CE Estatística I

CE Estatística I CE 002 - Estatística I Agronomia - Turma B Professor Walmes Marques Zeviani Laboratório de Estatística e Geoinformação Departamento de Estatística Universidade Federal do Paraná 1º semestre de 2012 Zeviani,

Leia mais

3 NOÇÕES DE PROBABILIDADE

3 NOÇÕES DE PROBABILIDADE 3 NOÇÕES DE PROILIDDE 3.1 Conjuntos Um conjunto pode ser considerado como uma coleção de objetos chamados elementos do conjunto. Em geral denota-se conjunto por letras maiúsculas,, C,... e a sua representação

Leia mais

2 Conceitos Básicos de Probabilidade

2 Conceitos Básicos de Probabilidade CE003 1 1 Introdução No capítulo anterior, foram mostrados alguns conceitos relacionados à estatística descritiva. Neste capítulo apresentamos a base teórica para o desenvolvimento de técnicas estatísticas

Leia mais

Introdução à Probabilidade

Introdução à Probabilidade A Teoria de Probabilidade é responsável pelo estudo de fenômenos que envolvem a incerteza (é impossível prever antecipadamente o resultado) e teve origem na teoria de jogos, servindo como ferramenta para

Leia mais

ELEMENTOS DE PROBABILIDADE. Prof. Paulo Rafael Bösing 25/11/2015

ELEMENTOS DE PROBABILIDADE. Prof. Paulo Rafael Bösing 25/11/2015 ELEMENTOS DE PROBABILIDADE Prof. Paulo Rafael Bösing 25/11/2015 ELEMENTOS DE PROBABILIDADE Def.: Um experimento é dito aleatório quando o seu resultado não for previsível antes de sua realização, ou seja,

Leia mais

T o e r o ia a da P oba ba i b lida d de

T o e r o ia a da P oba ba i b lida d de Teoria da Probabilidade Prof. Joni Fusinato Teoria da Probabilidade Consiste em utilizar a intuição humana para estudar os fenômenos do nosso cotidiano. Usa o princípio básico do aprendizado humano que

Leia mais

INTRODUÇÃO À PROBABILIDADE

INTRODUÇÃO À PROBABILIDADE INTRODUÇÃO À PROBABILIDADE Foto extraída em http://www.alea.pt Profª Maria Eliane Universidade Estadual de Santa Cruz USO DE PROBABILIDADES EM SITUAÇÕES DO COTIDIANO Escolhas pessoais Previsão do tempo

Leia mais

Noções sobre Probabilidade

Noções sobre Probabilidade Noções sobre Probabilidade Introdução Vimos anteriormente como apresentar dados em tabelas e gráficos, e também como calcular medidas que descrevem características específicas destes dados. Mas além de

Leia mais

3. Probabilidade P(A) =

3. Probabilidade P(A) = 7 3. Probabilidade Probabilidade é uma medida numérica da plausibilidade de que um evento ocorrerá. Assim, as probabilidades podem ser usadas como medidas do grau de incerteza e podem ser expressas de

Leia mais

TEORIA DAS PROBABILIDADES

TEORIA DAS PROBABILIDADES TEORIA DAS PROBABILIDADES 1.1 Introdução Ao estudarmos um fenômeno coletivo, verificamos a necessidade de descrever o próprio fenômeno e o modelo matemático associado ao mesmo, que permita explicá-lo da

Leia mais

Probabilidades- Teoria Elementar

Probabilidades- Teoria Elementar Probabilidades- Teoria Elementar Experiência Aleatória Experiência aleatória é uma experiência em que: não se sabe exactamente o resultado que se virá a observar, mas conhece-se o universo dos resultados

Leia mais

Métodos Quantitativos para Ciência da Computação Experimental. Jussara Almeida DCC-UFMG 2013

Métodos Quantitativos para Ciência da Computação Experimental. Jussara Almeida DCC-UFMG 2013 Métodos Quantitativos para Ciência da Computação Experimental Jussara Almeida DCC-UFMG 2013 Revisão de Probabilidade e Estatística Concentrado em estatística aplicada Estatística apropriada para medições

Leia mais

PROBABILIDADE 1. INTRODUÇÃO

PROBABILIDADE 1. INTRODUÇÃO proporção de caras Revisões PROBABILIDADE 1. INTRODUÇÃO As experiências aleatórias apresentam as seguintes características:.o resultado individual é imprevisível.são conhecidos todos os possíveis resultados.a

Leia mais

Curso de Farmácia Estatística Vital Aula 05 Comentários Adicionais. Prof. Hemílio Fernandes Depto. de Estatística - UFPB

Curso de Farmácia Estatística Vital Aula 05 Comentários Adicionais. Prof. Hemílio Fernandes Depto. de Estatística - UFPB Curso de Farmácia Estatística Vital Aula 05 Comentários Adicionais Prof. Hemílio Fernandes Depto. de Estatística - UFPB Um pouco de Probabilidade Experimento Aleatório: procedimento que, ao ser repetido

Leia mais

Definição: É uma coleção bem definida de

Definição: É uma coleção bem definida de EST029 Cálculo de Probabilidade I Cap. 1: Introdução à Probabilidade Prof. Clécio da Silva Ferreira Depto Estatística - UFJF Conjuntos: Definição e notação Definição: É uma coleção bem definida de objetos,

Leia mais

PROBABILIDADE. Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti

PROBABILIDADE. Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti Curso: Logística e Transportes Disciplina: Estatística Profa. Eliane Cabariti PROBABILIDADE Dizemos que a probabilidade é uma medida da quantidade de incerteza que existe em um determinado experimento.

Leia mais

Introdução à Probabilidade

Introdução à Probabilidade Introdução à Probabilidade Silvia Shimakura silvia.shimakura@ufpr.br Probabilidade O que é probabilidade? Medida que quantifica a incerteza de um acontecimento futuro. Como quantificar incerteza? Definição

Leia mais

PROBABILIDADE. ENEM 2016 Prof. Marcela Naves

PROBABILIDADE. ENEM 2016 Prof. Marcela Naves PROBABILIDADE ENEM 2016 Prof. Marcela Naves PROBABILIDADE NO ENEM As questões de probabilidade no Enem podem cobrar conceitos relacionados com probabilidade condicional e probabilidade de eventos simultâneos.

Leia mais

Aula - Introdução a Teoria da Probabilidade

Aula - Introdução a Teoria da Probabilidade Introdução a Teoria da Probabilidade Prof. Magnos Martinello Aula - Introdução a Teoria da Probabilidade Universidade Federal do Espírito Santo - UFES Departamento de Informática - DI 5 de dezembro de

Leia mais

Processos Estocásticos

Processos Estocásticos Processos Estocásticos Primeira Lista de Exercícios de junho de 0 Quantos códigos de quatro letras podem ser construídos usando-se as letras a, b, c, d, e, f se: a nenhuma letra puder ser repetida? b qualquer

Leia mais

Noções sobre probabilidade

Noções sobre probabilidade Capítulo 3 Noções sobre probabilidade Um casal tem dois filhos. Qual é a probabilidade de: o primogênito ser homem? os dois filhos serem homens? pelo menos um dos filhos ser homem? A teoria das probabilidades

Leia mais

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES

PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES PROBABILIDADE E ESTATÍSTICA UNIDADE V - INTRODUÇÃO À TEORIA DAS PROBABILIDADES 0 1 INTRODUÇÃO A teoria das probabilidades é utilizada para determinar as chances de um experimento aleatório acontecer. 1.1

Leia mais

Parte 3 Probabilidade

Parte 3 Probabilidade Parte 3 Probabilidade A probabilidade tem origem no século XVII, motivada, inicialmente, pelos jogos de azar. De maneira bastante informal, refere-se à probabilidade como uma medida de chance de algum

Leia mais

Conceitos básicos de teoria da probabilidade

Conceitos básicos de teoria da probabilidade Conceitos básicos de teoria da probabilidade Experimento Aleatório: procedimento que, ao ser repetido sob as mesmas condições, pode fornecer resultados diferentes Exemplos:. Resultado no lançamento de

Leia mais

Aula 2. ESTATÍSTICA E TEORIA DAS PROBABILIDADES Conceitos Básicos

Aula 2. ESTATÍSTICA E TEORIA DAS PROBABILIDADES Conceitos Básicos Aula 2 ESTATÍSTICA E TEORIA DAS PROBABILIDADES Conceitos Básicos 1. DEFINIÇÕES FENÔMENO Toda modificação que se processa nos corpos pela ação de agentes físicos ou químicos. 2. Tudo o que pode ser percebido

Leia mais

Será que vai chover amanhã? Quantificando a incerteza. Probabilidades Aula 1

Será que vai chover amanhã? Quantificando a incerteza. Probabilidades Aula 1 Será que vai chover amanhã? Quantificando a incerteza Probabilidades Aula 1 Nosso dia-a-dia está cheio de incertezas Vai chover amanhã? Quanto tempo levarei de casa até a universidade? Em quanto tempo

Leia mais

Experiências Aleatórias. Espaço de Resultados. Acontecimentos

Experiências Aleatórias. Espaço de Resultados. Acontecimentos Experiências Aleatórias. Espaço de Resultados. Acontecimentos Experiência Aleatória É uma experiência em que: não se sabe exactamente o resultado que se virá a observar; conhece-se o universo dos resultados

Leia mais

Estatística Aplicada. Prof. Carlos Alberto Stechhahn PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL.

Estatística Aplicada. Prof. Carlos Alberto Stechhahn PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL. Estatística Aplicada Administração p(a) = n(a) / n(u) PARTE I ESPAÇO AMOSTRAL - EVENTOS PROBABILIDADE PROBABILIDADE CONDICIONAL Prof. Carlos Alberto Stechhahn 2014 1. Noções de Probabilidade Chama-se experimento

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aulas passadas Motivação Espaço Amostral, Eventos, Álgebra de eventos Aula de hoje Probabilidade Análise Combinatória Independência Probabilidade Experimentos

Leia mais

AULA 6 MODELOS PROBABILÍSTICOS

AULA 6 MODELOS PROBABILÍSTICOS UNIVERSIDADE FEDERAL DA BAHIA ESCOLA POLITÉCNICA MEAU- MESTRADO EM ENGENHARIA AMBIENTAL URBANA ENG C 18 Métodos de Pesquisa Quantitativos e Qualitativos AULA 6 MODELOS PROBABILÍSTICOS Docente: Cira Souza

Leia mais

Unidade III ESTATÍSTICA. Prof. Fernando Rodrigues

Unidade III ESTATÍSTICA. Prof. Fernando Rodrigues Unidade III ESTATÍSTICA Prof. Fernando Rodrigues Medidas de dispersão Estudamos na unidade anterior as medidas de tendência central, que fornecem importantes informações sobre uma sequência numérica. Entretanto,

Leia mais

ESTATÍSTICA EXPLORATÓRIA

ESTATÍSTICA EXPLORATÓRIA ESTATÍSTICA EXPLORATÓRIA Prof Paulo Renato A. Firmino praf62@gmail.com Aulas 07-08 Probabilidade Apanhado Geral Seguimos nossas discussões sobre a Incerteza Decidir usualmente envolve incerteza Uma presa

Leia mais

UNIVERSIDADE FEDERAL DA PARAÍBA

UNIVERSIDADE FEDERAL DA PARAÍBA UNIVERSIDADE FEDERAL DA PARAÍBA Probabilidade Departamento de Estatística UFPB Luiz Medeiros Introdução Encontramos na natureza dois tipos de fenômenos Determinísticos: Os resultados são sempre os mesmos

Leia mais

Probabilidades 1. Motivação; 2. Conceitos importantes; 3. Definições de probabilidades; 4. Probabilidade Condicional; 5. Independência de eventos; 6.

Probabilidades 1. Motivação; 2. Conceitos importantes; 3. Definições de probabilidades; 4. Probabilidade Condicional; 5. Independência de eventos; 6. Probabilidades 1. Motivação; 2. Conceitos importantes; 3. Definições de probabilidades; 4. Probabilidade Condicional; 5. ndependência de eventos; 6. Regra da probabilidade total. Probabilidades Probabilidades

Leia mais

Lista de Exercícios de Probabilidades

Lista de Exercícios de Probabilidades Lista de Exercícios de Probabilidades Joel M. Corrêa da Rosa 2011 1. Lançam-se três moedas. Enumere o espaço amostral e os eventos : Ω = {(c, c, c); (k, k, k); (c, k, k); (k, c, k); (k, k, c); (k, c, c);

Leia mais

NOÇÕES DE PROBABILIDADE

NOÇÕES DE PROBABILIDADE NOÇÕES DE PROBABILIDADE ALEATORIEDADE Menino ou Menina me? CARA OU COROA? 3 Qual será o rendimento da Caderneta de Poupança no final deste ano? E qual será a taxa de inflação acumulada em 014? Quem será

Leia mais

Conceitos básicos: Variável Aleatória

Conceitos básicos: Variável Aleatória : Variável Aleatória Variável aleatória (v.a.) valor numérico que é resultado de uma eperiência aleatória. Podemos ter variáveis aleatórias contínuas ou discretas. Eemplo 1: Suponha que lança duas moedas

Leia mais

Fernando de Pol Mayer. Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR)

Fernando de Pol Mayer. Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR) Fernando de Pol Mayer Laboratório de Estatística e Geoinformação (LEG) Departamento de Estatística (DEST) Universidade Federal do Paraná (UFPR) Este conteúdo está disponível por meio da Licença Creative

Leia mais

Métodos Estatísticos Básicos

Métodos Estatísticos Básicos Aula 7 - Probabilidade condicional e independência Departamento de Economia Universidade Federal de Pelotas (UFPel) Maio de 2014 Probabilidade condicional Seja (Ω, A, P) um espaço de probabilidade. Se

Leia mais

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios.

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios. PROBABILIDADE Prof. Aurimenes A teoria das Probabilidades é o ramo da Matemática que cria, desenvolve e em geral pesquisa modelos que podem ser utilizados para estudar experimentos ou fenômenos aleatórios.

Leia mais

Modelos de Probabilidade e Inferência Estatística

Modelos de Probabilidade e Inferência Estatística Modelos de Probabilidade e Inferência Estatística Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula 2 03/14 1 / 31 Prof. Tarciana Liberal (UFPB) Aula 2 03/14

Leia mais

VARIÁVEIS ALEATÓRIAS

VARIÁVEIS ALEATÓRIAS UNIVERSIDADE FEDERAL DE JUIZ DE FORA INSTITUTO DE CIÊNCIAS EXATAS DEPARTAMENTO DE ESTATÍSTICA VARIÁVEIS ALEATÓRIAS Joaquim H Vianna Neto Relatório Técnico RTE-03/013 Relatório Técnico Série Ensino Variáveis

Leia mais

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal.

Estatística. Probabilidade. Conteúdo. Objetivos. Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Estatística Probabilidade Profa. Ivonete Melo de Carvalho Conteúdo Definições. Probabilidade: regras e aplicações. Distribuição Discreta e Distribuição Normal. Objetivos Utilizar a probabilidade como estimador

Leia mais

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS

RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS CENTRO UNIVERSITÁRIO FRANCISCANO Curso de Administração Disciplina: Estatística I Professora: Stefane L. Gaffuri RESOLUÇÃO DAS ATIVIDADES E FORMALIZAÇÃO DOS CONCEITOS Sessão 1 Experimentos Aleatórios e

Leia mais

Probabilidade e Estatística

Probabilidade e Estatística Aula 3 Professora: Rosa M. M. Leão Probabilidade e Estatística Conteúdo: 1.1 Por que estudar? 1.2 O que é? 1.3 População e Amostra 1.4 Um exemplo 1.5 Teoria da Probabilidade 1.6 Análise Combinatória 3

Leia mais

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba. Prof. Tarciana Liberal (UFPB) Aula Probabilidade I 07/16 1 / 23

Probabilidade I. Departamento de Estatística. Universidade Federal da Paraíba. Prof. Tarciana Liberal (UFPB) Aula Probabilidade I 07/16 1 / 23 I Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Probabilidade I 07/16 1 / 23 Probabilidade As definições de probabilidade apresentadas anteriormente podem

Leia mais

Universidade Federal de Goiás Instituto de Matemática e Estatística

Universidade Federal de Goiás Instituto de Matemática e Estatística Universidade Federal de Goiás Instituto de Matemática e Estatística Prova 1 de Probabilidade I Prof.: Fabiano F. T. dos Santos Goiânia, 15 de setembro de 2014 Aluno: Nota: Descreva seu raciocínio e desenvolva

Leia mais

Resumo. Parte 2 Introdução à Teoria da Probabilidade. Ramiro Brito Willmersdorf Introdução.

Resumo. Parte 2 Introdução à Teoria da Probabilidade. Ramiro Brito Willmersdorf Introdução. Parte 2 Introdução à Teoria da Probabilidade Ramiro Brito Willmersdorf ramiro@willmersdorf.net Departamento de Engenharia Mecânica Universidade Federal de Pernambuco 2011.2 Resumo 1 Introdução 2 Espaço

Leia mais

Modelos de Probabilidade e Inferência Estatística

Modelos de Probabilidade e Inferência Estatística Modelos de Probabilidade e Inferência Estatística Departamento de Estatística Universidade Federal da Paraíba Prof. Tarciana Liberal (UFPB) Aula Probabilidade Condicional 03/14 1 / 48 É provável que você

Leia mais

Modelos Probabilísticos Teóricos Discretos e Contínuos. Bernoulli, Binomial, Poisson, Uniforme, Exponencial, Normal

Modelos Probabilísticos Teóricos Discretos e Contínuos. Bernoulli, Binomial, Poisson, Uniforme, Exponencial, Normal Modelos Probabilísticos Teóricos Discretos e Contínuos Bernoulli, Binomial, Poisson, Uniforme, Exponencial, Normal Distribuição de Probabilidades A distribuição de probabilidades de uma variável aleatória:

Leia mais

Métodos Estatísticos Básicos

Métodos Estatísticos Básicos Aula 6 - Introdução à probabilidade Departamento de Economia Universidade Federal de Pelotas (UFPel) Maio de 2014 Experimento Experimento aleatório (E ): é um experimento que pode ser repetido indenidamente

Leia mais

TE802 Processos Estocásticos em Engenharia. Informação sobre a disciplina Notes. Processos Estocásticos em Engenharia Conteúdo Notes.

TE802 Processos Estocásticos em Engenharia. Informação sobre a disciplina Notes. Processos Estocásticos em Engenharia Conteúdo Notes. TE802 Processos Estocásticos em Engenharia Conceitos Básicos de Teoria de Probabilidade 7 de março de 2016 Informação sobre a disciplina Terças e Quintas feiras das 09:30 às 11:20 horas Professor: Evelio

Leia mais

Processos Estocásticos. Luiz Affonso Guedes

Processos Estocásticos. Luiz Affonso Guedes Processos Estocásticos Luiz Affonso Guedes Sumário Probabilidade Variáveis Aleatórias Funções de Uma Variável Aleatória Funções de Várias Variáveis Aleatórias Momentos e Estatística Condicional Teorema

Leia mais

Probabilidades. O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados.

Probabilidades. O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados. Probabilidades O cálculo de probabilidades teve a sua origem no estudo dos jogos de azar, principalmente nos jogos de dados. Quando lançamos um dado, os resultados possíveis são sempre um dos elementos

Leia mais

Probabilidade Condicional e Independência

Probabilidade Condicional e Independência Instituto Tecnológico de Aeronáutica Divisão de Engenharia Mecânica-Aeronáutica MOQ-13 Probabilidade e Estatística Profa. Denise Beatriz Ferrari www.mec.ita.br/ denise denise@ita.br 17/08/2011 Probabilidade

Leia mais

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios.

Os experimentos que repetidos sob as mesmas condições produzem resultados geralmente diferentes serão chamados experimentos aleatórios. PROBABILIDADE A teoria das Probabilidades é o ramo da Matemática que cria, desenvolve e em geral pesquisa modelos que podem ser utilizados para estudar experimentos ou fenômenos aleatórios. Os experimentos

Leia mais

Introdução à probabilidade e estatística I

Introdução à probabilidade e estatística I Introdução à probabilidade e estatística I Variáveis Aleatórias Prof. Alexandre G Patriota Sala: 298A Email: patriota@ime.usp.br Site: www.ime.usp.br/ patriota Probabilidade Daqui por diante utilizaremos

Leia mais

Aproximação da binomial pela normal

Aproximação da binomial pela normal Aproximação da binomial pela normal 1 Objetivo Verificar como a distribuição normal pode ser utilizada para calcular, de forma aproximada, probabilidades associadas a uma variável aleatória com distribuição

Leia mais

Aula 9 Teorema da probabilidade total e teorema de Bayes

Aula 9 Teorema da probabilidade total e teorema de Bayes Aula 9 Teorema da probabilidade total e teorema de Bayes Nesta aula você estudará dois importantes teoremas de probabilidade e verá suas aplicações em diversas situações envolvendo a tomada de decisão.

Leia mais

Costa, S.C. 1. Universidade Estadual de Londrina Departamento de Estatística. Probabilidades. Silvano Cesar da Costa.

Costa, S.C. 1. Universidade Estadual de Londrina Departamento de Estatística. Probabilidades. Silvano Cesar da Costa. Costa, S.C. 1 Universidade Estadual de Londrina Departamento de Estatística Probabilidades Silvano Cesar da Costa Londrina - Paraná Costa, S.C. 2 Noções sobre a teoria das probabilidades Conceitos probabilísticos

Leia mais

Experiência Aleatória

Experiência Aleatória Probabilidades Experiência Aleatória Experiência aleatória é uma experiência em que: não se sabe exactamente o resultado que se virá a observar, mas conhece-se o universo dos resultados possíveis. Exemplo

Leia mais

Eisencraft e Loiola 2.1 Probabilidade 37. Para resolver problemas de probabilidades são necessários 3 passos:

Eisencraft e Loiola 2.1 Probabilidade 37. Para resolver problemas de probabilidades são necessários 3 passos: Eisencraft e Loiola 2.1 Probabilidade 37 Modelo matemático de experimentos Para resolver problemas de probabilidades são necessários 3 passos: a Estabelecimento do espaço das amostras b Definição dos eventos

Leia mais

CAPÍTULO 3 PROBABILIDADE

CAPÍTULO 3 PROBABILIDADE CAPÍTULO 3 PROBABILIDADE 1. Conceitos 1.1 Experimento determinístico Um experimento se diz determinístico quando repetido em mesmas condições conduz a resultados idênticos. Exemplo 1: De uma urna que contém

Leia mais

Teoria das Desições Financeiras II p.1/22

Teoria das Desições Financeiras II p.1/22 Teoria das Desições Financeiras II José Fajardo Barbachan IBMEC Business School Rio de Janeiro Teoria das Desições Financeiras II p.1/22 Objetivo Neste curso o aluno aprenderá diversas ferramentas probabílisticas,

Leia mais

Aula 16 - Erivaldo. Probabilidade

Aula 16 - Erivaldo. Probabilidade Aula 16 - Erivaldo Probabilidade Probabilidade Experimento aleatório Experimento em que não pode-se afirmar com certeza o resultado final, mas sabe-se todos os seus possíveis resultados. Exemplos: 1) Lançar

Leia mais

Probabilidade - aula II

Probabilidade - aula II 2012/02 1 Interpretações de Probabilidade 2 3 Amostras Aleatórias e Objetivos Ao final deste capítulo você deve ser capaz de: Calcular probabilidades de eventos conjuntos. Interpretar e calcular probabilidades

Leia mais

Adição de probabilidades. O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e):

Adição de probabilidades. O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e): Adição de probabilidades O número de elementos da união dos conjuntos A e B n(aub) = n(a B) Dividindo os dois membros por n(e): Dois eventos A e B são ditos mutuamente exclusivos se, e somente se, A B

Leia mais

Probabilidade. Prof. Hemílio Fernandes Campos Coêlho. Departamento de Estatística - Universidade Federal da Paraíba - UFPB

Probabilidade. Prof. Hemílio Fernandes Campos Coêlho. Departamento de Estatística - Universidade Federal da Paraíba - UFPB Probabilidade Prof. Hemílio Fernandes Campos Coêlho Departamento de Estatística - Universidade Federal da Paraíba - UFPB Introdução Encontramos na natureza dois tipos de fenômenos: Determinísticos e Não-determinísticos

Leia mais

Tipos de Modelo. Exemplos. Modelo determinístico. Causas. Efeito. Exemplos. Modelo probabilístico. Causas. Efeito. Determinístico.

Tipos de Modelo. Exemplos. Modelo determinístico. Causas. Efeito. Exemplos. Modelo probabilístico. Causas. Efeito. Determinístico. Tipos de Modelo Sistema Real Determinístico Prof. Lorí Viali, Dr. viali@mat.ufrgs.br http://www.mat.ufrgs.br/~viali/ Probabilístico Modelo determinístico Exemplos Gravitação F GM 1 M 2 /r 2 Causas Efeito

Leia mais

Aula de Exercícios - Teorema de Bayes

Aula de Exercícios - Teorema de Bayes Aula de Exercícios - Teorema de Bayes Organização: Rafael Tovar Digitação: Guilherme Ludwig Primeiro Exemplo - Estagiários Três pessoas serão selecionadas aleatóriamente de um grupo de dez estagiários

Leia mais

Probabilidade. Experiências aleatórias

Probabilidade. Experiências aleatórias Probabilidade Experiências aleatórias 1 Experiências aleatórias Acontecimento: Qualquer colecção de resultados de uma experiência. Acontecimento elementar: Um resultado que não pode ser simplificado ou

Leia mais

3. (Apostila 1 - ex.1.4) Defina um espaço amostral para cada um dos seguintes experimentos

3. (Apostila 1 - ex.1.4) Defina um espaço amostral para cada um dos seguintes experimentos Primeira Lista de Exercícios Introdução à probabilidade e à estatística Prof Patrícia Lusié Assunto: Probabilidade. 1. (Apostila 1 - ex.1.1) Lançam-se três moedas. Enumerar o espaço amostral e os eventos

Leia mais

Demonstração. Ver demonstração em [1]. . Para que i j se tem µ i µ j? Determine a derivada no sentido de Radon-Nikodym em cada caso.

Demonstração. Ver demonstração em [1]. . Para que i j se tem µ i µ j? Determine a derivada no sentido de Radon-Nikodym em cada caso. Proposição 2.39 (Propriedades de e.). Sejam µ, λ, λ 1, λ 2 medidas no espaço mensurável (X, F). Então 1. se λ 1 µ e λ 2 µ então (λ 1 + λ 2 ) µ. 2. se λ 1 µ e λ 2 µ então (λ 1 + λ 2 ) µ. 3. se λ 1 µ e λ

Leia mais

Introdução aos Proc. Estocásticos - ENG 430

Introdução aos Proc. Estocásticos - ENG 430 Introdução aos Proc. Estocásticos - ENG 430 Fabrício Simões IFBA 16 de novembro de 2015 Fabrício Simões (IFBA) Introdução aos Proc. Estocásticos - ENG 430 16 de novembro de 2015 1 / 34 1 Motivação 2 Conceitos

Leia mais

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade

Objetivos. Frequência Relativa X Probabilidade. Probabilidade. 1. Definições: Experimento Espaço Amostral Evento Probabilidade Magnos Martinello Universidade Federal do Espírito Santo - UFES Departamento de Informática DI Laboratório de Pesquisas em Redes Multimidia LPRM Objetivos 1. Definições: Experimento Espaço Amostral Evento

Leia mais

PROBABILIDADE. É o conjunto de todos os resultados possíveis de um experimento aleatório. A letra que representa o espaço amostral, é S.

PROBABILIDADE. É o conjunto de todos os resultados possíveis de um experimento aleatório. A letra que representa o espaço amostral, é S. PROBABILIDADE A história da teoria das probabilidades, teve início com os jogos de cartas, dados e de roleta. Esse é o motivo da grande existência de exemplos de jogos de azar no estudo da probabilidade.

Leia mais

Carlos Pedreira.

Carlos Pedreira. Bio-Estatística Carlos Pedreira pedreira@ufrj.br CAPÍTULO 1 Conceitos Básicos de Probabilidade Em qual resultado você apostaria em 1 jogada de uma moeda justa? porque? Agora vamos jogar a moeda 2 vezes,

Leia mais

Capítulo4- Modelos de probabilidade.

Capítulo4- Modelos de probabilidade. Capítulo4- Modelos de probabilidade. 1- Modelos de probabilidade(110) 1.1) Introdução.(110) 1.) Fenómenos aleatórios(11) Experiência determinística-produz sempre o mesmo resultado desde que seja repetido

Leia mais

1.4.2 Probabilidade condicional

1.4.2 Probabilidade condicional M. Eisencraft 1.4 Probabilidades condicionais e conjuntas 9 Portanto, P(A B) = P(A)+P(B) P(A B) (1.2) Para eventos mutuamente exclusivos, P(A B) = e P(A)+P(B) = P(A B). 1.4.2 Probabilidade condicional

Leia mais

Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 2016/17)

Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 2016/17) Tema 4- Modelos de probabilidade. (Versão: para o manual a partir de 016/17) 1- Modelos de probabilidade(136) 1.1) Introdução.(36) (Vídeo: 33) 1.) Fenómenos aleatórios(138) Experiência determinística-produz

Leia mais

MOQ-12: PROBABILIDADES E PROCESSOS ESTOCÁSTICOS. VA s e Distribuições

MOQ-12: PROBABILIDADES E PROCESSOS ESTOCÁSTICOS. VA s e Distribuições Motivação: MOQ-2: PROBABILIDADES E PROCESSOS ESTOCÁSTICOS VA s e Distribuições Definimos anteriormente Espaço de Probabilidades como sendo a tripla (W,, P(.)), em que, dado um eperimento, W representa

Leia mais

Estatística e Modelos Probabilísticos - COE241

Estatística e Modelos Probabilísticos - COE241 Estatística e Modelos Probabilísticos - COE241 Aulas passadas Motivação Exemplos de aplicação de probabilidade e estatística Informações do curso Aula de hoje Espaço amostral Álgebra de Eventos Eventos

Leia mais

Ensino Médio. Fatorial

Ensino Médio. Fatorial As Permutações Comentários: As primeiras atividades matemáticas da humanidade estavam ligadas à contagem de objetos de um conjunto, enumerando seus elementos. As civilizações antigas, como egípcia, babilônia,

Leia mais

PROBABILIDADE. Prof. Patricia Caldana

PROBABILIDADE. Prof. Patricia Caldana PROBABILIDADE Prof. Patricia Caldana Estudamos probabilidade com a intenção de prevermos as possibilidades de ocorrência de uma determinada situação ou fato. Para determinarmos a razão de probabilidade,

Leia mais

MAE116 - Noções de Estatística Grupo A - 1 semestre de 2015

MAE116 - Noções de Estatística Grupo A - 1 semestre de 2015 MAE116 - Noções de Estatística Grupo A - 1 semestre de 2015 Gabarito Lista 4 - Probabilidade - CASA Exercício 1. (2 pontos) Para cada um dos experimentos abaixo, descreva o espaço amostral e apresente

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

Intervalos de Confiança

Intervalos de Confiança Intervalos de Confiança INTERVALOS DE CONFIANÇA.1 Conceitos básicos.1.1 Parâmetro e estatística Parâmetro é a descrição numérica de uma característica da população. Estatística é a descrição numérica de

Leia mais

Aula 10 Estimação e Intervalo de Confiança

Aula 10 Estimação e Intervalo de Confiança Aula 10 Estimação e Intervalo de Confiança Objetivos da Aula Fixação dos conceitos de Estimação; Utilização das tabelas de Distribuição Normal e t de Student Introdução Freqüentemente necessitamos, por

Leia mais

AULA 3. Probabilidade

AULA 3. Probabilidade AULA 3 META: Do mesmo modo que acontece com a teoria da mecânica, que atribui definições precisas a termos de uso diário, como trabalho e força, também a teoria das probabilidades tenta, quantificar, a

Leia mais

Definição de Probabilidade

Definição de Probabilidade INTRODUÇÃO A TEORIA DAS PROBABILIDADES A teoria das probabilidade nada mais é do que o bom senso transformado em cálculo A probabilidade é uma medida da incerteza dos fenômenos. Traduz-se por um número

Leia mais

Fração como Probabilidade - União e Interseção de Eventos. Sexto Ano do Ensino Fundamental

Fração como Probabilidade - União e Interseção de Eventos. Sexto Ano do Ensino Fundamental Material Teórico - Módulo de FRAÇÃO COMO PORCENTAGEM E COMO PROBABILIDADE Fração como Probabilidade - União e Interseção de Eventos Sexto Ano do Ensino Fundamental Prof. Francisco Bruno Holanda Prof. Antonio

Leia mais

Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS

Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS Daniel Queiroz VARIÁVEIS ALEATÓRIAS DISCRETAS INTRODUÇÃO O que é uma variável aleatória? Um tipo de variável que depende do resultado aleatório de um experimento aleatório. Diz-se que um experimento é

Leia mais

VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE

VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE VARIÁVEIS ALEATÓRIAS E DISTRIBUIÇÕES DE PROBABILIDADE.1 INTRODUÇÃO Admita que, de um lote de 10 peças, 3 das quais são defeituosas, peças são etraídas ao acaso, juntas (ou uma a uma, sem reposição). Estamos

Leia mais

Teoria das Desições Financeiras II p.1/15

Teoria das Desições Financeiras II p.1/15 Teoria das Desições Financeiras II José Fajardo Barbachan IBMEC Business School Rio de Janeiro Teoria das Desições Financeiras II p.1/15 Probabilidade para Finanças Teoria das Desições Financeiras II p.2/15

Leia mais

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski

PROBABILIDADE E ESTATÍSTICA. Aula 2 Professor Regina Meyer Branski PROBABILIDADE E ESTATÍSTICA Aula 2 Professor Regina Meyer Branski Probabilidade 1. Conceitos básicos de probabilidade 2. Probabilidade condicional 3. Eventos Dependentes e Independentes 4. Regra da Multiplicação

Leia mais