Teoria neutralista da evolução molecular

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Teoria neutralista da evolução molecular"

Transcrição

1 Teoria neutralista da evolução molecular

2 Polimorfsmos genétcos Um locus gênico é considerado polimórfco se a frequência de um dos alelos na população é menor que 99% O polimorfsmo, obviamente, é resultado de mutação ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT

3 Uma população polimórfca ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT A a f(a)= 3/20 f(a)= 7/20

4 Modelo de mutação O modelo mais usado em genétca de populações é o dos alelos infnitos Toda mutação gera um novo alelo

5 Alelos infnitos ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGTT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGTT ATTAGAATCTAGATCGATCGATGTT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT AGTAGATTCTAGGTCGATCGATGCT

6 Idéias sobre o polimorfsmo genétco em populações naturais Antes dos anos 60: Escola clássica: a maioria dos lócus possui apenas alelo, pois a seleção é muito efcaz Escola balanceada: Ausência de variação não é vantajosa. Maioria dos lócus possui mais de alelo. A variação é mantda por seleção Após anos 60: eutralistas: maioria do polimorfsmo genétco é neutro e é uma fase antes da fxação por deriva Selecionistas: polimorfsmo genétco é mantdo por seleção natural

7 A deriva genétca Como a deriva genétca atua sobre o polimorfsmo genétco? Qual é a frequência de heterozigotos esperada por deriva genétca? Qual é o tempo médio de fxação de um alelo por deriva? Qual é a taxa de substtuição esperada por deriva?

8 A dinâmica populacional Wright-Fisher Populações Wright-Fisher são diplóides, apresentam tamanho e se reproduzem por encontro randômico de gametas de um pool gamétco

9 Populações Wright-Fisher Tamanho populacional = alelo A alelo a f( ) = p f( ) = q Freqüência de heterozigotos (heterozigosidade) = H produção de gametas pool gamétco f( ) = p f( ) = q número infnito de gametas nas proporções p e q

10 G 0 : f( ) = p 0 f( ) = q 0 Reprodução f( ) = p 0 f( ) = q 0 G : f( ) = p f( ) = q amostragem de pares de gametas f( ) = p f( ) = q

11 Modifcação da freqüência alélica G 0 f( ) = p 0 f( ) = q 0 G f( ) = p f( ) = q p G 2 f( ) = p 2 f( ) = q 2 0 G 0 G G 2 G 3 G 4 G 5 G 3 f( ) = p 3 f( ) = q 3 q G 4 f( ) = p 4 f( ) = q 4 0 G 0 G G 2 G 3 G 4 G 5 G 5 f( ) = p 5 f( ) = q 5

12 Tamanho populacional infnito = = G 0 f( ) = p 0 f( ) = q 0 G = f( ) = p f( ) = q p = G 2 f( ) = p 2 f( ) = q 2 0 G 0 G G 2 G 3 G 4 G 5 G 3 = f( ) = p 3 f( ) = q 3 q = G 4 f( ) = p 4 f( ) = q 4 0 G 5 = f( ) = p 5 f( ) = q 5 G 0 G G 2 G 3 G 4 G 5

13 Tamanho populacional e erro amostral Quanto menor o tamanho populacional, maior será a diferença de freqüências alélicas entre a geração dos pais e a dos flhos Essa diferença de freqüências alélicas ocorre de forma randômica (erro amostral) e é denominada de deriva genétca

14

15 Medindo a mudança estocástca das freqüências alélicas A deriva genétca é estudada usando cadeias de Markov O princípio da cadeia de Markov é quando a probabilidade futura do estado de um sistema depende apenas do estado presente.

16 Quantfcando a deriva genétca f( ) = p 0 f( ) = q 0 f( ) = p 0 f( ) = q 0 f( ) = p 0 f( ) = q 0 Considere que em t = 0 existem infnitas populações com indivíduos em cada. Essas infnitas populações não trocam genes. Elas evoluem independentemente ao longo das gerações exatamente como nos slides anteriores Como exemplo, suponha que f( ) = 0.5 e f( ) = 0.5 em cada uma das populações em t = 0 Como mudará a p e q ao longo do tempo?

17 f( ) = p 0 f( ) = q 0 f( ) = p 0 f( ) = q 0 f( ) = p 0 f( ) = q 0 G 0 G G 2 G 3 G 4 G 5 G 6

18 zoom zoom G 0 G G 2 G 3 G 4 G 5 G 6

19 Acompanhando a freqüência média do alelo G 0 f(populações) G G 2 G 3 G 4 G 5 G 6 f(populações) f(populações) f(populações)

20 Acompanhando a freqüência média do alelo G 7 f(populações) G 8 G 9 G 0 G G 2 G 3 f(populações) f(populações) f(populações)

21 f(populações) A freqüência média não muda f(populações) f(populações) f(populações) f(populações) f(populações) f(populações) f(populações)

22 f(populações) A variância da freqüência alélica entre as populações aumenta f(populações) f(populações) f(populações) f(populações) f(populações) f(populações) f(populações)

23 Juntando os gráfcos f(populações) tempo frequência alélica (p)

24

25 Quantfcação da perda de variabilidade genétca por deriva Frequentemente medimos a variabilidade genétca pela frequência de heterozigotos o modelo Wright-Fisher, a heterozigosidade dad populações tende a zero, pois a deriva fxará um dos alelos Como medir o decaimento da heterozigosidade?

26 Autozigosidade e alozigosidade Para medir o decaimento, precisamos destes dois conceitos: autozigoto homozigoto em que os 2 alelos são idêntcos por descendência alozigoto homozigoto em que os 2 alelos são idêntcos por estado e não por descendência

27 Identdade por descendência ATTAGATTCTAGATCGATCGATGTT AGTAGATTCTAGGTCGATCGATGCT ATTAGAATCTAGATCGATCGATGTT ATTAGAATCTAGATCGATCGATGTT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT pool gamétco ATTAGAATCTAGATCGATCGATGTT ATTAGATTCTAGATCGATCGATGCT AGTAGATTCTAGGTCGATCGATGCT idêntcos por descendência idêntcos por estado homozigotos

28 o modelo dos alelos infnitos homozigosidade = autozigosidade o modelo dos alelos infnitos cada mutação gera um novo alelo Portanto, se 2 alelos são idêntcos por estado eles necessariamente são idêntcos por descendência

29 Portanto ATTAGATTCTAGATCGATCGATGTT AGTAGATTCTAGGTCGATCGATGCT ATTAGAATCTAGATCGATCGATGTT ATTAGAATCTAGATCGATCGATGTT ATTAGATTCTAGATCGATCGATGCT ATTAGATTCTAGATCGATCGATGCT pool gamétco ATTAGAATCTAGATCGATCGATGTT ATTAGATTCTAGATCGATCGATGCT AGTAGATTCTAGGTCGATCGATGCT idêntcos por descendência? idêntcos por descendência! homozigotos

30 A homozigosidade medida pela autozigosidade (F) t - t P = 2 P =- 2

31 t -? Ft- t P = 2 P =- 2 F t = F t-

32 Se a autozigosidade (F) = homozigosidade Podemos medir o decaimento da heterozigosidade por H t =- F t H t = - 2 H t-

33 Decaimento da heterozigosidade (=variabilidade genétca)

34 Inserindo mutação no modelo Com mutação, a variabilidade genétca não será perdida, pois existem alelos novos sendo produzidos Portanto, devemos modifcar a descrição matemátca do processo

35 t - F t- t µ µ µ µ P = 2 (- m)2 P =- 2 F t = 2 m 2 2 m 2 F t

36 Homozigosidade de equilíbrio Quando F t = F t- F = 4m

37 Heterozigosidade de equilíbrio H = F H = 4m 4m =4m H =

38 O que isso signifca? Com mutação, se todos os alelos forem seletvamente neutros, a heterozigosidade fcará estabilizada em H Pois a diversidade eliminada por deriva é reposta por mutação mutação H deriva

39 Podemos representar o modelo Wright-Fisher por genealogias de alelos

40 Quando isso é feito, aplicamos a teoria da coalescência eventos de coalescência

41 Modelando coalescência Probabilidade de 2 alelos não coalescerem em uma geração = /2 = Probabilidade de 2 alelos terem 2 ancestrais = /2 = /2 Probabilidade de 3 alelos não coalescerem em uma geração = ( /2).[ 2.(/2)] = Probabilidade de 3 alelos terem 3 ancestrais

42 Probabilidade de não ocorrer coalescência em k alelos k- Pr(k) = - i= i 2 3- Pr(k = 3) = - i= i 2 =

43 Probabilidade de coalescência de um par de alelos em t gerações Probabilidade de não ocorrer coalescência em t gerações X probabilidade de ocorrer coalescência na geração t Pr(coal. 2 alelos t ger.) = - 2 t 2

44 Probabilidade de ocorrer coalescência em k alelos após t gerações = Pr(k) t [(- Pr(k)] Probabilidade de k ancestrais por t gerações, k ancestrais em t +

45 Representação gráfca

46 Tempo médio de coalescência de todos os k alelos t = 4 - k t 4

47 Tempo médio de fxação de um alelo por deriva

48 Probabilidade de fxação de um alelo neutro Se um alelo possui frequência p, a probabilidade dele ser fxado é p Um alelo neutro recentemente introduzido na população por mutação tem chance de ser fxado = /2. Pois p 0 =/2

49 Taxa de substtuição por deriva (neutra) Suponha que, numa população de indivíduos, a taxa de mutação neutra é μ Dessa forma, a cada geração, (2 x μ) alelos mutantes aparecerão Cada um desses alelos tem chance se fxar = /2 Portanto, a taxa de mudanças efetvamente fxadas (substtuições) é k = (2m) 2 = m

50 A taxa de evolução neutra é igual a taxa de mutação neutra Esse resultado mostra que a taxa de substtuição neutra é independente do tamanho populacional Kimura usou essa relação para explicar o relógio molecular vantajosas deletérias neutras

51 The uniformity of the rate of mutant substtuton per year for a given protein may be explained by assuming constancy of neutral mutaton rate per year over diverse lines. Kimura & Ohta ature (97)

52 O que é o polimorfsmo para os neutralistas? polimorfsmo

53 Evidências da teoria neutralista Os primeiros 220 nucleotdeos da proteína que liga à renina de humanos e ratos terceiras posições de codons estão marcadas Das 3 mudanças: 4 - a pos 4-2a pos 23 3a pos

54 Evidências da teoria neutralista

55 Relatve substtuton frequency Minor changes are more frequent Drastc changes are infrequent Physico-chemical diference

Forças evolutivas. Definição de Evolução. Deriva Genética. Desvios de Hardy-Weinberg

Forças evolutivas. Definição de Evolução. Deriva Genética. Desvios de Hardy-Weinberg Definição de Evolução A definição operacional de evolução em nível de deme é mudanças na freqüência alélica ou genotípica. Forças evolutivas Fatores ou processos que podem alterar a freqüência alélica

Leia mais

SUBESTRUTURA POPULACIONAL E FLUXO GÊNICO

SUBESTRUTURA POPULACIONAL E FLUXO GÊNICO SUBESTRUTURA POPULACIONAL E FLUXO GÊNICO AULA 5 Mariana Fonseca Rossi mfonsecarossi@gmail.com RELEMBRANDO... Equilíbrio de Hardy-Weiberng: RELEMBRANDO... Equilíbrio de Hardy-Weiberng: Frequência dos genótipos

Leia mais

Modelando microevolução GENÉTICA DE POPULAÇÕES E EVOLUÇÃO

Modelando microevolução GENÉTICA DE POPULAÇÕES E EVOLUÇÃO Modelando microevolução GENÉTICA DE POPULAÇÕES E EVOLUÇÃO Modelando microevolução Evolução: mudança na frequência de alelos ou combinações de alelos no pool gênico. Modelos de evolução deve incluir a passagem

Leia mais

Tamanho populacional 31/08/2010. Evolução Estocasticidade (Acaso) e Determinismo (Seleção natural) Relação entre o Censo (N) e tamanho efetivo (Ne)

Tamanho populacional 31/08/2010. Evolução Estocasticidade (Acaso) e Determinismo (Seleção natural) Relação entre o Censo (N) e tamanho efetivo (Ne) Evolução Estocasticidade (Acaso) e Determinismo (Seleção natural) Equilíbrio de Hardy-Weinberg (EHW) Os fatores evolutivos e a dinâmica populacional (p + q) 2 = p 2 + 2pq + q 2 Professor Fabrício R. Santos

Leia mais

Definições. Interpretação ingênua de seleção natural: sobrevivência do mais apto ou a natureza com unhas dentes

Definições. Interpretação ingênua de seleção natural: sobrevivência do mais apto ou a natureza com unhas dentes Seleção Natural Definições Interpretação ingênua de seleção natural: sobrevivência do mais apto ou a natureza com unhas dentes Essas definições são inexatas e insuficientes Seleção Natural Para Huxley,

Leia mais

GENÉTICA DE POPULAÇÃO

GENÉTICA DE POPULAÇÃO GENÉTICA DE POPULAÇÃO Eng. Agr. Msc. Franco Romero Silva Muniz Doutorando em Genética e Melhoramento de Soja Departamento de Produção Vegetal UNESP Jaboticabal/SP Molecular e Biotecnologia Quantitativa

Leia mais

AULA Nº 4. Neste tópico começamos a falar dos aspectos quantitativos da coleta, uma vez

AULA Nº 4. Neste tópico começamos a falar dos aspectos quantitativos da coleta, uma vez AULA Nº 4 Neste tópico começamos a falar dos aspectos quantitativos da coleta, uma vez que até aqui tratamos dos aspectos qualitativos. Para tanto teremos que apreender alguns conceitos de genética de

Leia mais

Genética de Populações. Genética de Populações. Deriva 1/2N e. Mutações recentes. Alelos Neutros. Mutações recentes

Genética de Populações. Genética de Populações. Deriva 1/2N e. Mutações recentes. Alelos Neutros. Mutações recentes Deriva 1/2N e Por que então é também importante em grandes populações? Mutações recentes Mutações recentes Qual a prob de uma mutação que ocorreu pela 1 a vez passar para a próxima geração? Modelo aleatório,

Leia mais

Sistemas de Acasalamento. Acasalamento ao acaso. Acasalamento ao acaso. O ciclo de vida de uma população. Pressupostos de Hardy Weinberg.

Sistemas de Acasalamento. Acasalamento ao acaso. Acasalamento ao acaso. O ciclo de vida de uma população. Pressupostos de Hardy Weinberg. Pressupostos de Hardy Weinberg Produção de alelos: 1 locus autossômico 2 alelos sem mutação 1ª Lei de Mendel União de alelos: Sistema de acasalamento aleatório Tamanho populacional infinito Troca genética

Leia mais

ESTRUTURA POPULACIONAL

ESTRUTURA POPULACIONAL ESTRUTURA POPULACIONAL ESTRUTURA POPULACIONAL fluxo génico Selecção natural Processos ao acaso na transmisão dos alelos de uma geração para outra deriva genética Diferenças de frequências alélicas entre

Leia mais

Curso de Licenciatura em Biologia Evolução Biológica

Curso de Licenciatura em Biologia Evolução Biológica INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DO RIO GRANDE DO NORTE Campus Macau Curso de Licenciatura em Biologia Evolução Biológica IFRN/Macau - Curso de Licenciatura em Biologia - Parasitologia

Leia mais

O MODELO DE HARDY-WEINBERG

O MODELO DE HARDY-WEINBERG Modelo simples de genética de populações: modelo de Hardy-Weinberg (Hardy 1908; Weinberg 1908). Embora faça vários pressupostos simplificadores que não são realistas, ele se mostra bastante útil para descrever

Leia mais

Genética de Populações. Prof. Anderson Moreira

Genética de Populações. Prof. Anderson Moreira Genética de Populações Prof. Anderson Moreira Genética de Populações É o estudo do conjunto de genes de uma população em dado momento (pool gênico), detectando suas variações ou sua estabilidade (equilíbrio

Leia mais

Estudo da diversidade com sequências de DNA

Estudo da diversidade com sequências de DNA Estudo da diversidade com sequências de DNA estudo do DNA por sequenciação extracção de DNA PCR do fragmento desejado sequenciação estudo do DNA por sequenciação sequenciação 1 2 3 indivíduo A indivíduo

Leia mais

Biologia Professor Leandro Gurgel de Medeiros

Biologia Professor Leandro Gurgel de Medeiros Biologia Professor Leandro Gurgel de Medeiros Genética Clássica 1. Conceito: É a ciência voltada para o estudo da hereditariedade, bem como da estrutura e função dos genes. Características Fundamentais

Leia mais

5.1 Estratégias de regeneração. Para populações autógamas constituídas de misturas de linhas puras, sem

5.1 Estratégias de regeneração. Para populações autógamas constituídas de misturas de linhas puras, sem a) Para populações autógamas 5.1 Estratégias de regeneração Para populações autógamas constituídas de misturas de linhas puras, sem controle genético e considerando u como a proporção de sementes da amostra

Leia mais

Neodarwinismo ou Teoria sintética de evolução

Neodarwinismo ou Teoria sintética de evolução Neodarwinismo ou Teoria sintética de evolução O desenvolvimento dos conhecimentos de genética e as novas descobertas sobre hereditariedade, permitiram fazer uma nova interpretação da teoria da evolução

Leia mais

Seleção Natural. Fundamentos de Ecologia e Modelagem Ambiental Aplicados à Conservação da Biodiversidade

Seleção Natural. Fundamentos de Ecologia e Modelagem Ambiental Aplicados à Conservação da Biodiversidade Seleção Natural Fundamentos de Ecologia e Modelagem Ambiental Aplicados à Conservação da Biodiversidade Aluna: Michelle Andrade Furtado Profº Dalton e Profª Silvana Definição Seleção Natural pode ser definida

Leia mais

Pode-se pensar que a deriva genética seja importante apenas em poucas espécies. Entretanto, a maioria das espécies é formada por demes pequenos e com

Pode-se pensar que a deriva genética seja importante apenas em poucas espécies. Entretanto, a maioria das espécies é formada por demes pequenos e com Pode-se pensar que a deriva genética seja importante apenas em poucas espécies. Entretanto, a maioria das espécies é formada por demes pequenos e com localização estável Essas populações podem divergir

Leia mais

Introdução a Algoritmos Genéticos

Introdução a Algoritmos Genéticos Introdução a Algoritmos Genéticos Tiago da Conceição Mota Laboratório de Inteligência Computacional Núcleo de Computação Eletrônica Universidade Federal do Rio de Janeiro Outubro de 2007 O Que São? Busca

Leia mais

PROGRAMA DE PÓS-GRADUAÇÃO EM ECOLOGIA E CONSERVAÇÃO DA BIODIVERSIDADE

PROGRAMA DE PÓS-GRADUAÇÃO EM ECOLOGIA E CONSERVAÇÃO DA BIODIVERSIDADE Processo seletivo PPGECB - 2013 Prova de conhecimentos em Ecologia e Evolução CPF do candidato: MS ( ) DR ( ) Instruções para a prova: 1) Não coloque NOME nas folhas de prova em hipótese alguma. Sua única

Leia mais

Origem da variação. Conceitos importantes. Variabilidade genética. Variabilidade Genética. Variação genética e Evolução

Origem da variação. Conceitos importantes. Variabilidade genética. Variabilidade Genética. Variação genética e Evolução Variabilidade genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2011 Conceitos importantes Variação genética: variantes alélicos originados

Leia mais

Mutação e equilíbrio mutação- deriva

Mutação e equilíbrio mutação- deriva Mutação e equilíbrio mutação- deriva Evolução 2015.1 Le;cia Loss bioloss@gmail.com Aulas prévias Equilíbrio Hardy- Weinberg sem seleção natural sem deriva genéhca sem migração sem mutação população panmíhca

Leia mais

Ligação, permuta e mapas genéticos: ligação e permuta genética, estimativa da freqüência de permuta

Ligação, permuta e mapas genéticos: ligação e permuta genética, estimativa da freqüência de permuta Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal Ligação, permuta e mapas genéticos: ligação e permuta genética, estimativa da freqüência de permuta Após

Leia mais

Introdução à Genética da Conservação: Diversidade Genética e Evolução das Populações Naturais

Introdução à Genética da Conservação: Diversidade Genética e Evolução das Populações Naturais Biologia da Conservação: Genética Professor: Fabrício R. Santos Bibliografia: Fundamentos de Genética da Conservação [Frankham et al. 2008] e artigos científicos http://www.icb.ufmg.br/labs/lbem/aulas/grad/biolcons

Leia mais

AU08. Genética de Populações. Lorena Carolina Peña. Doutoranda PPG-GEN

AU08. Genética de Populações. Lorena Carolina Peña. Doutoranda PPG-GEN AU08 Genética de Populações Lorena Carolina Peña Doutoranda PPG-GEN lorecarol@gmail.com Resumo Aula expositiva/participativa abordando os tópicos: Definição de populações, Frequências genotípica e alélica,

Leia mais

UNIVERSIDADE FEDERAL DO PARANÁ Setor de Ciências Biológicas Departamento de Genética BG403 - GENÉTICA ANIMAL. Lista de Exercícios

UNIVERSIDADE FEDERAL DO PARANÁ Setor de Ciências Biológicas Departamento de Genética BG403 - GENÉTICA ANIMAL. Lista de Exercícios UNIVERSIDADE FEDERAL DO PARANÁ Setor de Ciências Biológicas Departamento de Genética Profa Angelica Boldt BG403 - GENÉTICA ANIMAL Lista de Exercícios T7 GENÉTICA DE POPULAÇÕES 1) As propriedades genéticas

Leia mais

Deriva Genética. (Genetic drift)

Deriva Genética. (Genetic drift) Deriva Genética (Genetic drift) => Primeiros trabalhos demonstrando a existência de deriva genética, em 1954, pelos Profs. Warwick Kerr e S. Wright: Um dos fundadores da Teoria Sintética da Evolução i)

Leia mais

Tamanho populacional 18/02/2014. A estimativa do Ne é baseada em uma população idealizada: Categorias ameaçadas da IUCN

Tamanho populacional 18/02/2014. A estimativa do Ne é baseada em uma população idealizada: Categorias ameaçadas da IUCN Evolução em pequenas populações e manutenção da diversidade genética Tamanho efetivo, Deriva, Endogamia, Depressão Endogâmica, Populações geneticamente viáveis e Extinção Importância das pequenas populações

Leia mais

Segregação Monogênica: 1 a Lei de Mendel. Profa. Vanessa Kava

Segregação Monogênica: 1 a Lei de Mendel. Profa. Vanessa Kava Segregação Monogênica: 1 a Lei de Mendel Profa. Vanessa Kava 1a Lei de Mendel VOCÊ JÁ SABE QUE Os cromossomos situam-se no núcleo das células 1 cromossomo 1 molécula de DNA 1molécula de DNA vários genes

Leia mais

Herança das Características de Interesse

Herança das Características de Interesse Herança das Características de Interesse Algumas características dos bovinos podem ser classificadas em classes fenotipicamente distintas Presença de chifres Susceptibilidade a doenças Musculatura dupla

Leia mais

Seleção Natural. Seleção Natural. Seleção Natural. Valor Adaptativo ( Fitness )

Seleção Natural. Seleção Natural. Seleção Natural. Valor Adaptativo ( Fitness ) eleção Natural eleção Natural: obrevivência e reprodução diferencial de indivíduos na população Valor daptativo: progênie gerada que sobrevive e reproduz na próxima geração eleção natural requer variação

Leia mais

Seleção Natural. BIO0230 Genética e Evolução. Felipe Bastos Rocha

Seleção Natural. BIO0230 Genética e Evolução. Felipe Bastos Rocha Seleção Natural BIO0230 Genética e Evolução Felipe Bastos Rocha Charles Darwin Origem das adaptações: Seleção Natural Há fenótipos que conferem maior probabilidade de sobrevivência e/ou reprodução Gregor

Leia mais

Genética de Populações e Evolução

Genética de Populações e Evolução Genética de Populações e Evolução Populações Genética de populações a palavra população geralmente não se refere a todos os indivíduos de uma espécie, mas sim a um grupo de indivíduos da mesma espécie

Leia mais

Genética. Gregor Mendel (1866)

Genética. Gregor Mendel (1866) Genética Gregor Mendel (1866) Fundamentos da genética moderna Experimentos com Pisum sativum Sucesso dos resultados deveu-se ao controle dos cruzamentos, reprodução rápida, características contrastantes

Leia mais

BC.09: Herança de um par de alelos BIOLOGIA

BC.09: Herança de um par de alelos BIOLOGIA ATIVIDADES A provável fórmula genética dos cruzantes é: 1. Pessoas de mesmo genótipo para o caráter cor da pele podem adquirir fenótipos diferentes expondo-se mais ou menos às radiações solares. Tal fato

Leia mais

Neodarwinismo Teoria Sintética da Evolução

Neodarwinismo Teoria Sintética da Evolução Neodarwinismo Teoria Sintética da Evolução Aula nº45, 46 e 48 26 e 28 Jan e 2 Fev09 Prof. Ana Reis Principais críticas apontadas à Teoria de Darwin: não explicar o surgimento de variações naturais nos

Leia mais

A teoria sintética da evolução

A teoria sintética da evolução A teoria sintética da evolução De 1900 até cerca de 1920, os adeptos da genética mendeliana acreditavam que apenas as mutações eram responsáveis pela evolução e que a seleção natural não tinha importância

Leia mais

Por quê? Mendelismo após Ronald A. Fisher. Dois aspectos essenciais à maioria de características genéticas

Por quê? Mendelismo após Ronald A. Fisher. Dois aspectos essenciais à maioria de características genéticas Dois aspectos essenciais à maioria de características genéticas Complexidade da relação entre genótipo e fenótipo que representa uma interação entre múltiplos fatores genéticos e ambientais A confusão

Leia mais

Fundamentos da Genética. Professor: Anderson Marques de Souza 2016

Fundamentos da Genética. Professor: Anderson Marques de Souza 2016 Fundamentos da Genética Professor: Anderson Marques de Souza 2016 Genética: Conceitos Básicos 1º estuda a transmissão de características da célula-mãe para a célula-filha; 2º estuda as características

Leia mais

Universidade Federal de Santa Maria PET - Biologia. Marcela Dambrowski dos Santos

Universidade Federal de Santa Maria PET - Biologia. Marcela Dambrowski dos Santos Universidade Federal de Santa Maria PET - Biologia Marcela Dambrowski dos Santos Introdução Hemoglobina A Hemoglobina S Anemia falciforme Traço falciforme Malária Hipótese da malária Origem e dispersão

Leia mais

Ligação Gênica e Mapeamento

Ligação Gênica e Mapeamento Ligação Gênica e Mapeamento 09/02/2017 Profa. Dra. Angela Ikeda Adaptada da aula da Profa. Dra. Vanessa Kava 1 Princípio Mendeliano 2 Segregação Independente 3 Número de CROMOSSOMOS x Número de GENES 4

Leia mais

Genética II: Ligação e a Teoria Cromossômica

Genética II: Ligação e a Teoria Cromossômica Genética II: Ligação e a Teoria Cromossômica Um indivíduo possui duas cópias de cada partícula de herança (gene). Essas duas cópias são separadas durante a formação dos gametas e juntam-se novamente quando

Leia mais

GENÉTICA. Profª Fernanda Toledo

GENÉTICA. Profª Fernanda Toledo GENÉTICA Profª Fernanda Toledo O que é Genética? É a ciência que estuda os genes e sua transmissão para as gerações futuras. As características são transmitidas de pais para filhos. Essa atividade é coordenada

Leia mais

2 vertical: 5 letras, plural. 1 vertical: 11 letras

2 vertical: 5 letras, plural. 1 vertical: 11 letras 1 vertical: 11 letras São organismos originados da alteração molecular do DNA. 2 vertical: 5 letras, plural Fatores que condicionam as características genéticas de um organismo, sendo um proveniente do

Leia mais

a) Qual é o mecanismo de herança dessa doença? Justifique.

a) Qual é o mecanismo de herança dessa doença? Justifique. É sabido que indivíduos homozigotos recessivos para alelos mutados do gene codificador da enzima hexosaminidase desenvolvem uma doença conhecida como Tay-Sachs, e morrem antes do quarto ano de vida. Nos

Leia mais

Aula 2: Genética da Transmissão I

Aula 2: Genética da Transmissão I LGN215 - Genética Geral Aula 2: Genética da Transmissão I Antonio Augusto Franco Garcia Maria Marta Pastina Primeiro semestre de 2011 Piracicaba SP Conceitos Essenciais A existência de genes pode ser deduzida

Leia mais

Teoria e Prática de Sistemática Filogenética

Teoria e Prática de Sistemática Filogenética Disciplina BOT-99 PPG-BOT-INPA 2015 Teoria e Prática de Sistemática Filogenética Alberto Vicentini alberto.vicentini@inpa.gov.br Mário Henrique Terra Araujo araujo.mht@gmail.com Programa de Pós-Graduação

Leia mais

As bases evolutivas da Saúde Pública Teoria da evolução

As bases evolutivas da Saúde Pública Teoria da evolução As bases evolutivas da Saúde Pública Teoria da evolução Claudia Torres Codeço codeco@procc.fiocruz.br 22 de Julho de 2003 Página 1 de 24 1. Epidemiologia: dinâmica de doenças na população Genética de populações:

Leia mais

Biologia Evolutiva. A Biologia Evolutiva é o estudo da história da vida e dos processos que levam à sua diversidade.

Biologia Evolutiva. A Biologia Evolutiva é o estudo da história da vida e dos processos que levam à sua diversidade. 2017 Biologia Evolutiva A Biologia Evolutiva é o estudo da história da vida e dos processos que levam à sua diversidade. Biologia Evolutiva Análises e metodologias reducionistas e composicionistas (propriedades

Leia mais

Introdução a genética de populações e a origem da variação genética. Aula 1

Introdução a genética de populações e a origem da variação genética. Aula 1 Introdução a genética de populações e a origem da variação genética Aula 1 O Escopo da Genética de populações! Genética mendeliana! A transmissão da informação da informação genética está sujeita as leis

Leia mais

Desequilíbrio de ligação

Desequilíbrio de ligação Desequilíbrio de ligação Associação não aleatória de alelos em loci diferentes. É um indicador sensível das forças da genética de populações que estruturam o genoma. Crescimento de métodos para avaliar

Leia mais

Melhoramento de espécies autógamas

Melhoramento de espécies autógamas Universidade Federal de Rondônia Curso de Eng. Florestal Melhoramento genético Florestal Melhoramento de espécies autógamas Emanuel Maia www.lahorta.acagea.net emanuel@unir.br Apresentação Introdução Efeitos

Leia mais

Universidade Federal de Viçosa - UFV Departamento de Biologia Geral

Universidade Federal de Viçosa - UFV Departamento de Biologia Geral Universidade Federal de Viçosa - UFV Departamento de Biologia Geral 1 Genética de Populações Evolução Orgânica - Bio 340 Profa. Karla Yotoko 2 Capítulo 1 Introdução à Genética de Populações Equilíbrio

Leia mais

Aula3 FATORES GERADORES DE VARIABILIDDE GENÉTICA. Silmara de Moraes Pantaleão

Aula3 FATORES GERADORES DE VARIABILIDDE GENÉTICA. Silmara de Moraes Pantaleão Aula3 FATORES GERADORES DE VARIABILIDDE GENÉTICA META Discutir a importância dos fatores biológicos e ecológicos que atuam na evolução dos Seres Vivos. OBJETIVOS Ao fi nal desta aula, o aluno deverá: Compreender

Leia mais

BIODIVERSIDADE E V O L U Ç Ã O. Qual a origem de tamanha variedade de seres vivos?

BIODIVERSIDADE E V O L U Ç Ã O. Qual a origem de tamanha variedade de seres vivos? EVOLUÇÃO BIODIVERSIDADE Qual a origem de tamanha variedade de seres vivos? FIXISMO Teorias A Fixismo 9 As espécies surgiram independentemente umas das outras (tal como se conhecem hoje) e mantiveram-se

Leia mais

ESTATÍSTICAS PARA INFERIR PADRÕES SELECÇÃO

ESTATÍSTICAS PARA INFERIR PADRÕES SELECÇÃO ESTATÍSTICAS PARA INFERIR PADRÕES DEMOGRÁFICOS E SELECÇÃO Inferências demográficas e selectivas Os fenómenos demográficos (expansão ou redução do efectivo populacional, subdivisão, migração) e selectivos

Leia mais

GOIÂNIA, / / PROFESSOR: Mário Neto. DISCIPLINA: Ciências da Natureza SÉRIE: 3º. ALUNO(a):

GOIÂNIA, / / PROFESSOR: Mário Neto. DISCIPLINA: Ciências da Natureza SÉRIE: 3º. ALUNO(a): GOIÂNIA, / / 2016 PROFESSOR: Mário Neto DISCIPLINA: Ciências da Natureza SÉRIE: 3º ALUNO(a): NOTA: No Anhanguera você é + Enem 1) Em urtigas o caráter denteado das folhas domina o caráter liso. Numa experiência

Leia mais

LGN GENÉTICA. Aula 2 - Genética da Transmissão I. Antonio Augusto Franco Garcia Filipe Inácio Matias Marianella F. Quezada Macchiavello

LGN GENÉTICA. Aula 2 - Genética da Transmissão I. Antonio Augusto Franco Garcia Filipe Inácio Matias Marianella F. Quezada Macchiavello LGN 215 - GENÉTICA Aula 2 - Genética da Transmissão I Antonio Augusto Franco Garcia Filipe Inácio Matias Marianella F. Quezada Macchiavello Departamento de Genética Escola Superior de Agricultura Luiz

Leia mais

QUESTÕES DE GENÉTICA - PROFESSORA: THAÍS ALVES 30/05/2015

QUESTÕES DE GENÉTICA - PROFESSORA: THAÍS ALVES 30/05/2015 QUESTÕES DE GENÉTICA - PROFESSORA: THAÍS ALVES 30/05/2015 01. Em situações problemas relacionadas à genética mendeliana, um dos cálculos probabilísticos utilizados é a aplicação da denominada regra da

Leia mais

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta.

a) Baseando-se nos resultados acima, qual é a sequência mais provável desses 4 genes no cromossomo, a partir do gene A? b) Justifique sua resposta. CAP. 08: HERANÇA QUANTITATIVA OU POLIGENICA CAP. 09: MAPAS DE LIGAÇÃO GÊNICA - LINKAGE CAP. 10: O MATERIAL GENÉTICO E A GENÉTICA DO FUNCIONAMENTO DOS GENES 1. Considere dois genes e seus respectivos alelos:

Leia mais

Genética Quantitativa. Genética de características com herança complexa

Genética Quantitativa. Genética de características com herança complexa Genética Quantitativa Genética de características com herança complexa DIFERENÇAS ENTRE CARÁTER QUANTITATIVO 1 E QUALITATIVO 2 1 herança poligênica 1 estudadas em nível de população; descritas através

Leia mais

10) (UFPA) Usando seus conhecimentos de probabilidade, Mendel chegou às seguintes conclusões, com exceção de uma delas. Indique-a:

10) (UFPA) Usando seus conhecimentos de probabilidade, Mendel chegou às seguintes conclusões, com exceção de uma delas. Indique-a: 1) Em urtigas o caráter denteado das folhas domina o caráter liso. Numa experiência de polinização cruzada, foi obtido o seguinte resultado: 89 denteadas e 29 lisas. A provável fórmula genética dos cruzantes

Leia mais

Extensão da herança Mendeliana

Extensão da herança Mendeliana Extensão da herança Mendeliana Genética Básica Licenciatura em Biologia Victor Martin Quintana Flores Diferentes Tipos de padrões de herança mendeliana Mendeliana simples Herança: Este padrão é comumente

Leia mais

1. Produção de DNA recombinante (plasmídio de uma bactéria/gene do vaga-lume). 3. Multiplicação da célula de tabaco com o gene do vaga-lume.

1. Produção de DNA recombinante (plasmídio de uma bactéria/gene do vaga-lume). 3. Multiplicação da célula de tabaco com o gene do vaga-lume. 01. Analise a figura a seguir, que representa um determinado experimento: 1. Produção de DNA recombinante (plasmídio de uma bactéria/gene do vaga-lume). 2. Introdução do DNA em célula de tabaco. 3. Multiplicação

Leia mais

UNIVERSIDADE TÉCNICA DE MOÇAMBIQUE ÁREA DE FORMAÇÃO EM CIÊNCIAS TECNOLÓLGICAS Disciplina: Ecologia e Diversidade Biológica

UNIVERSIDADE TÉCNICA DE MOÇAMBIQUE ÁREA DE FORMAÇÃO EM CIÊNCIAS TECNOLÓLGICAS Disciplina: Ecologia e Diversidade Biológica UNIVERSIDADE TÉCNICA DE MOÇAMBIQUE ÁREA DE FORMAÇÃO EM CIÊNCIAS TECNOLÓLGICAS Disciplina: Ecologia e Diversidade Biológica 01. Considerando os níveis de complexibilidade e interrelações, distinguem-se

Leia mais

Gene tica. O que é genética? É o estudo dos genes e de sua transmissão para as futuras gerações. Genética Clássica -> Mendel(1856)

Gene tica. O que é genética? É o estudo dos genes e de sua transmissão para as futuras gerações. Genética Clássica -> Mendel(1856) Gene tica Conceitos básicos Na semente estão contidas todas as partes do corpo do homem que serão formadas. A criança que se desenvolve no útero da mãe tem as raízes da barba e do cabelo que nascerão um

Leia mais

MELHORAMENTO DE PLANTAS. 1. Teoria das Linhas Puras 2. Seleção em Plantas Autógamas

MELHORAMENTO DE PLANTAS. 1. Teoria das Linhas Puras 2. Seleção em Plantas Autógamas MELHORAMENTO DE PLANTAS 1. Teoria das Linhas Puras 2. Seleção em Plantas Autógamas Espécies autógamas A autofecundação sucessiva leva a homozigose genótipo homozigótico - linhagem - ou mistura de linhas

Leia mais

NÚCLEO E DIVISÃO CELULAR 18/07/2014 1

NÚCLEO E DIVISÃO CELULAR 18/07/2014 1 NÚCLEO E DIVISÃO CELULAR 18/07/2014 1 DEFINIÇÕES CROMATINA: É o DNA desespiralizado, desenrolado. CROMOSSOMOS: estrutura formada pelo DNA completamente compactado pelas proteínas histonas e por um grande

Leia mais

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: Genética: É o estudo da hereditariedade. Hereditariedade: fenômeno que explica as semelhanças

Leia mais

Genética de Populações. Prof. Ricardo Lehtonen R. de Souza

Genética de Populações. Prof. Ricardo Lehtonen R. de Souza Genética de Populações Prof. Ricardo Lehtonen R. de Souza E-mail: ricardo.lehtonen@gmail.com http://www.ufpr.br/~lehtonen VARIAÇÃO EM POPULAÇÕES NATURAIS A maioria das características varia pelo menos

Leia mais

Exercícios Genética e Evolução Curso: Tecnológicos Campus Palotina

Exercícios Genética e Evolução Curso: Tecnológicos Campus Palotina Exercícios Genética e Evolução Curso: Tecnológicos Campus Palotina Professor: Robson Fernando Missio 1ª Avaliação 1) Um pesquisador trabalhando com o melhoramento de milho realizou o cruzamento controlado

Leia mais

Prof. Manoel Victor. Genética Quantitativa

Prof. Manoel Victor. Genética Quantitativa Genética Quantitativa Modos de ação dos genes ação qualitativa expressão de genes seguindo padrões e modelos como os descritos por Mendel AA Aa aa (genes qualitativos) Fenótipos Genótipos Modos de ação

Leia mais

LGN215 - Genética Geral

LGN215 - Genética Geral LGN215 - Genética Geral Aula 5: Ligação I Prof. Dr. Antonio Augusto Franco Garcia Maria Marta Pastina Piracicaba SP Ligação Dois genes próximos no mesmo par cromossômico não segregam independentemente

Leia mais

UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA DEPARTAMENTO DE GENÉTICA E EVOLUÇÃO. BG280 Lista de exercícios 1

UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA DEPARTAMENTO DE GENÉTICA E EVOLUÇÃO. BG280 Lista de exercícios 1 UNERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA DEPARTAMENTO DE GENÉTICA E EVOLUÇÃO BG280 Lista de exercícios 1 1 - Seguem quatro heredogramas humanos. Os símbolos pretos representam o fenótipo anormal

Leia mais

Probabilidade e estatística

Probabilidade e estatística Probabilidade e estatística stica Genética BásicaB Licenciatura Victor Martin Quintana Flores Qual a utilidade de usar probabilidade e estatística em Genética? 1 Calcular a probabilidade de determinados

Leia mais

3) Usando seus conhecimentos de probabilidade, Mendel chegou às seguintes conclusões, com exceção de uma delas. Indique-a:

3) Usando seus conhecimentos de probabilidade, Mendel chegou às seguintes conclusões, com exceção de uma delas. Indique-a: LISTA REVISÃO BIOLOGIA DIVISÃO CELULAR E GENÉTICA 1) Em urtigas o caráter denteado das folhas domina o caráter liso. Numa experiência de polinização cruzada, foi obtido o seguinte resultado: 89 denteadas

Leia mais

UM JOGO DE BOLINHAS: ENTENDENDO O TEOREMA DE HARDY-WEINBERG

UM JOGO DE BOLINHAS: ENTENDENDO O TEOREMA DE HARDY-WEINBERG UM JOGO DE BOLINHAS: ENTENDENDO O TEOREMA DE HARDY-WEINBERG Alan Bonner da Silva Costa (Laboratório de Genética Marinha e Evolução - Departamento de Biologia Marinha - Instituto de Biologia - UFF - Bolsista

Leia mais

PRINCÍPIOS DE GENÉTICA DE POPULAÇÕES

PRINCÍPIOS DE GENÉTICA DE POPULAÇÕES PRINCÍPIOS DE GENÉTICA DE POPULAÇÕES Aula 10 META Mostrar ao aluno que a dinâmica dos genes nas populações pode ser compreendida por meio do estudo das suas frequências gênicas e genotípicas. Pretende-se

Leia mais

Capítulo 2 Endogamia. Acasalamentos Preferenciais. Introdução

Capítulo 2 Endogamia. Acasalamentos Preferenciais. Introdução Capítulo 2 Endogamia Acasalamentos Preferenciais Introdução No capítulo anterior foi demonstrado que se os acasalamentos forem aleatórios, as populações têm proporções genotípicas equivalentes às calculadas

Leia mais

Ecologia de Populações e Comunidades

Ecologia de Populações e Comunidades Ecologia de Populações e Comunidades Profa. Isabel Belloni Schmidt Dept. Ecologia UnB isabels@unb.br Evolução Nada em biologia faz sentido a não ser à luz da evolução Theodosius Dobzhansky Jean Baptiste

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Unidade I ESTATÍSTICA APLICADA. Prof. Mauricio Fanno

Unidade I ESTATÍSTICA APLICADA. Prof. Mauricio Fanno Unidade I ESTATÍSTICA APLICADA Prof. Mauricio Fanno Estatística indutiva Estatística descritiva Dados no passado ou no presente e em pequena quantidade, portanto, reais e coletáveis. Campo de trabalho:

Leia mais

Bases da Hereditariedade. Profa. Vanessa Silveira

Bases da Hereditariedade. Profa. Vanessa Silveira Bases da Hereditariedade Profa. Vanessa Silveira Roteiro de Aula 1. A informação genética: conceitos básicos 2. Base da Hereditariedade Leis de Mendel 3. Padrões clássicos de herança 4. Padrões não clássicos

Leia mais

LGN 313 Melhoramento Genético

LGN 313 Melhoramento Genético LGN 313 Melhoramento Genético Professores: Antonio Augusto Franco Garcia José Baldin Pinheiro Escola Superior de Agricultura Luiz de Queiroz Departamento de Genética - ESALQ/USP Segundo semestre - 2010

Leia mais

Estatística II Aula 2. Prof.: Patricia Maria Bortolon, D. Sc.

Estatística II Aula 2. Prof.: Patricia Maria Bortolon, D. Sc. Estatística II Aula Prof.: Patricia Maria Bortolon, D. Sc. Distribuições Amostrais ... vocês lembram que: Antes de tudo... Estatística Parâmetro Amostra População E usamos estatíticas das amostras para

Leia mais

Capítulo 4 Fontes de Variação

Capítulo 4 Fontes de Variação Capítulo 4 Fontes de Variação Mutação: Para que uma população esteja e se mantenha em equilíbrio de Hardy-Weinberg, é necessário que atenda a uma série de pressupostos (ver capítulo ). Em caso positivo,

Leia mais

Otimização. Unidade 6: Algoritmo Genético. Jaime Arturo Ramírez. 7. Teoria do processo evolutivo num GA. 8. Aspectos avançados

Otimização. Unidade 6: Algoritmo Genético. Jaime Arturo Ramírez. 7. Teoria do processo evolutivo num GA. 8. Aspectos avançados Otimização Jaime Arturo Ramírez Conteúdo 1. Introdução 2. Analogia de mecanismos de seleção natural com sistemas artificiais 3. Algoritmo genético modelo 4. Um GA simples 5. Representação, genes e cromossomos

Leia mais

BIOLOGIA QUESTÕES DE GENÉTICA

BIOLOGIA QUESTÕES DE GENÉTICA QUESTÕES DE GENÉTICA 01. (Fac. Objetivo-SP) Em camundongos o genótipo aa é cinza; Aa é amarelo e AA morre no início do desenvolvimento embrionário. Que descendência se espera do cruzamento entre um macho

Leia mais

Aula 4: Genética da Transmissão III

Aula 4: Genética da Transmissão III LGN215 - Genética Geral Aula 4: Genética da Transmissão III Prof. Dr. Antonio Augusto Franco Garcia Monitora: Maria Marta Pastina Experimentos de Mendel Inicialmente, Mendel estudou cruzamentos considerando

Leia mais

MELHORAMENTO DE PLANTAS AUTÓGAMAS POR SELEÇÃO

MELHORAMENTO DE PLANTAS AUTÓGAMAS POR SELEÇÃO MELHORAMENTO DE PLANTAS AUTÓGAMAS POR SELEÇÃO 6 INTRODUÇÃO A seleção é uma das principais ferramentas do melhorista independente do tipo de método de melhoramento utilizado. A seleção é utilizada tanto

Leia mais

Endogamia & Heterose. Leandro S. A. Gonçalves Dr. Genética e Melhoramento de Plantas

Endogamia & Heterose. Leandro S. A. Gonçalves Dr. Genética e Melhoramento de Plantas Endogamia & Heterose Leandro S. A. Gonçalves Dr. Genética e Melhoramento de Plantas - Endogamia - Conceito: Acasalamento entre indivíduos aparentados (FEHR, 1987) - Histórico: Desde os primeiros tempos

Leia mais

Algoritmo Genético. Inteligência Artificial. Professor: Rosalvo Ferreira de Oliveira Neto

Algoritmo Genético. Inteligência Artificial. Professor: Rosalvo Ferreira de Oliveira Neto Algoritmo Genético Inteligência Artificial Professor: Rosalvo Ferreira de Oliveira Neto Estrutura 1. Introdução 2. Conceitos Básicos 3. Aplicações 4. Algoritmo 5. Exemplo Introdução São técnicas de busca

Leia mais

FICHA 2 Herança Ligada ao sexo

FICHA 2 Herança Ligada ao sexo UNIVERSIDADE EDUARDO MONDLANE FACULADADE DE CIÊNCIAS DEPARTAMENTO DE CIÊNCIAS BIOLÓGICAS Parte Teórica a) Na espécie humana o sexo masculino é denominado heterogamético e feminino Homogamético. Por quê?

Leia mais

ZAB1304 Genética Básica e Biologia Molecular. Prof. Dr. José Bento Sterman Ferraz Aula preparada do Dra. Fernanda Marcondes de Rezende

ZAB1304 Genética Básica e Biologia Molecular. Prof. Dr. José Bento Sterman Ferraz Aula preparada do Dra. Fernanda Marcondes de Rezende ZAB1304 Genética Básica e Biologia Molecular Prof. Dr. José Bento Sterman Ferraz Aula preparada do Dra. Fernanda Marcondes de Rezende Roteiro Estrutura genética de uma população Freqüências gênicas e genotípicas

Leia mais

REVISÃO RECUPERAÇÃO FINAL DE ANO. 1ª LEI DE MENDEL (Cálculo de apenas 1 característica)

REVISÃO RECUPERAÇÃO FINAL DE ANO. 1ª LEI DE MENDEL (Cálculo de apenas 1 característica) Foz do Iguaçu, 10 de Novembro de 2016. Nome: Série Prof o : Ailton Pastro. 1 as séries A, B e C REVISÃO RECUPERAÇÃO FINAL DE ANO 1ª LEI DE MENDEL (Cálculo de apenas 1 característica) Cada característica

Leia mais

Alelos: Um alelo é cada uma das várias formas alternativas do mesmo

Alelos: Um alelo é cada uma das várias formas alternativas do mesmo Genética Animal Alelos múltiplos 1 Alelos Múltiplos: خ Alelos: Um alelo é cada uma das várias formas alternativas do mesmo gene, ocupando um dado locus num cromossomo. Consiste em uma seqüência de núcleotídeos

Leia mais

Ligação, Recombinação e Mapeamento gênico em eucariotas

Ligação, Recombinação e Mapeamento gênico em eucariotas Ligação, Recombinação e Mapeamento gênico em eucariotas A lei da segregação independente estelece que: Em um cruzamento envolvendo mais de um gene, os genes diferentes se separam ou segregam independentemente

Leia mais

Gregor Mendel. Nasceu em 1822, em Heinzendorf, República Tcheca.

Gregor Mendel. Nasceu em 1822, em Heinzendorf, República Tcheca. Herança Mendeliana Gregor Mendel Nasceu em 1822, em Heinzendorf, República Tcheca. Monastério de Mendel Estátua de Mendel ao fundo Canteiro de begônias vermelhas e brancas representando os padrões de herança.

Leia mais

Extensão da herança a Mendeliana

Extensão da herança a Mendeliana Extensão da herança a Mendeliana Genética Básica Licenciatura em Biologia Victor Martin Quintana Flores Diferentes padrões de herança a Mendeliana Tipo Descrição Mendeliana simples Ligado ao X Alelos letais

Leia mais