DIVERSIDADE METAGENÔMICA MICROBIANA DE DE BIOMAS TERRESTRES E MARINHOS

Tamanho: px
Começar a partir da página:

Download "DIVERSIDADE METAGENÔMICA MICROBIANA DE DE BIOMAS TERRESTRES E MARINHOS"

Transcrição

1 UNIVERSIDADE FEDERAL DO RIO DE JANEIRO Instituto de Biologia Departamento de Genética DIVERSIDADE METAGENÔMICA MICROBIANA DE DE BIOMAS TERRESTRES E MARINHOS THIAGO BRUCE RODRIGUES Rio de Janeiro, agosto de 2011

2 Universidade Federal do Rio de Janeiro Instituto de Biologia Departamento de Genética Pós-Graduação em Ciências Biológicas (Genética) DIVERSIDADE METAGENÔMICA MICROBIANA DE DE BIOMAS TERRESTRES E MARINHOS Thiago Bruce Rodrigues Tese submetida ao curso de Pós-Graduação em Ciências Biológicas (Genética), como parte dos requisitos para a obtenção de grau de Doutor em Ciências Biológicas (Genética) Orientador: Dr. Fabiano L. Thompson Rio de Janeiro, agosto de 2011

3 Dedico este trabalho à minha Vó, D. Wilma

4 Para ser grande, sê inteiro: nada Teu exagera ou exclui. Sê todo em cada coisa. Põe quanto és No mínimo que fazes. Assim em cada lago a lua toda Brilha, porque alta vive. -Fernando Pessoa iv

5 AGRADECIMENTOS À minha Família, por tudo. Ao Dr. Fabiano L. Thompson pela oportunidade, parceria e ensinamentos. Ao Programa de Pós Graduação em Genética. À Giselle Bussi pelo amor e compreensão. Aos Colegas do Laboratório de Microbiologia da UFRJ pelos anos de convivência. Ao Dr. Ricardo Kruger, Alinne Castro e Alessandra Reis pela colaboração na construção das bibliotecas da Mata Atlântica. Ao Dr. Nei Pereira e Roberto Maeda pela ajuda com as atividades celulolíticas. Ao Dr. Robert Edwards e Dra. Elizabeth Dinsdale pela oportunidade e por disponibilizar uma das plataformas de sequenciamento da San Diego State University. A Dra. Marina Paez e os alunos Paulo Dick e Felipe Vega pela ajuda nas análises estatísticas. Á Dra Ana Carolina Vicente, Dr. Allen Hagler e Dra Ana Coelho que compuseram a banca do meu exame de qualificação. À Direção do Parque Nacional da Serra dos Órgãos por possibilitar o acesso ao parque. À Direção do Parque Marinho de Abrolhos por possibilitar o acesso ao parque. Aos senhores membros da banca. Ao CNPQ pelo apoio financeiro. A todos aqueles que contribuíram de forma direta ou indireta durante toda minha formação acadêmica. v

6 RESUMO A aplicação de métodos independentes de cultivo para o estudo da diversidade microbiana nos últimos 20 anos mostrou que parcela significativa da diversidade não é recuperada em meios de cultura. Cerca de 325 Mb de dados (aproximadamnete 800 mil sequências) foram analisados neste trabalho. Mais de 700 mil sequências são oriundas de biomas brasileiros. Este trabalho representa o estudo com maior número de sequências da microbiota Brasileira já realizado. Quatro estudos sucessivos e complementares foram realizados: (1) Diversidade de comunidades do bacterioplâncton das águas costeiras da América Latina foi caracterizada através de pirosequenciamento da região hipervariável V6 do gene RNA 16S a partir de bibliotecas de amplicons; (2) Diversidade taxonômica e funcional da microbiota planctônica dos sistemas de recifes de corais do Banco de Abrolhos foi caracterizada através de pirosequenciamento a partir de bibliotecas de fragmentos aleatórios (método shotgun); (3) Diversidade de comunidades bacterianas do solo da Mata Atlântica foi caracterizada através do sequenciamento de fragmentos do gene rrna 16S e (4) Potencial biotecnológico da microbiota do solo da Mata Atlântica foi demonstrado através da construção de biblioteca metagenômica de pequenos insertos (10 Kb) para triagem funcional de clones com atividade celulolítica. Além disso, foi apresentado um panorama acerca da utilização de métodos independentes de cultivo para caracterização da diversidade microbiana de ecossistemas tipicamente brasileiros. Desta forma, foi possível determinar a assinatura microbiana de diferentes ecossistemas. Os resultados mostram a existência de gradiente latitudinal de diversidade do bacterioplâncton ao longo da costa da América latina, com predomínio de organismos cosmopolitas pertencentes a grupos taxonômicos conhecidos (Ex. SAR 11, Acinetobacter e Flavobacteraceae) e uma pequena fração endêmica, sendo que o maior endemismo ocorreu em localidades brasileiras. A partir dos resultados obtidos foi possível concluir que as sequências da região V6 do gene rrna 16S permitiram a caracterização de vi

7 um gradiente latitudinal de diversidade ao longo da costa da América Latina. Já o segundo estudo, focado na compreensão da diversidade microbiana do Banco de Abrolhos, mostrou que os recifes protegidos apresentam menor abundância de Arquéias, vírus, patógenos humanos e patógenos marinhos como os vibrios. As áreas protegidas apresentam maior contribuição de organismos autotróficos. Foi possível identificar diferentes níveis de degradação dos recifes do Banco de Abrolhos. Portanto, os metagenomas refletem a tendência de degradação da região do Banco de Abrolhos, sugerindo que os metagenomas podem ser usados no monitoramento da saúde recifal. A análise DNA metagenômico da microbiota da Mata Atlântica permitiu a caracterização de grupos taxonômicos dominantes como Acidobacteria e Proteobacteria no solo. A estimativa do número de espécies por grama de solo é de aproximadamente 1500 espécies. Grande número de sequências não classificadas (Aprox. 15%) reforça a idéia da existência de espécies e filos novos para serem caracterizados e o potencial da Mata Atlântica para bioprospecção. Estes dados demonstram que existe um vasto repertório genético que apresenta potencial biotecnológico, mas ainda não foi completamente explorado. A construção de uma biblioteca metagenômica (aproximadamente clones) permitiu a triagem funcional de clones com atividade celulolítica (FPásica e CMCásica. 20 U/L e 100 U/L, respectivamente), semelhante a observada em isolados ambientais. Este trabalho de doutoramento. O solo da Mata Atlântica brasileira representa uma vasta fonte de novas espécies de bactérias com potencial para exploração biotecnológica. A comparação da diversidade de diferentes ecossistemas evidencia que a microbiota de biomas terrestres e marinhos é diferente e particular de cada ecossistema. vii

8 ABSTRACT The application of culture independent methods for the study of microbial diversity in the last 20 years has disclosed a unknown majority that not yet was recovered by using of culture media. About 325 Mb of data (about 800 thousands of sequences) were analyzed in this thesis (200 Mb correspond to sequences generated in this work). More than sequences belonging to Brazilian biomes were analyzed. This work represents the study with the larger number of sequences of Brazilian microbiota already carried out. Four complementary and successive studies were performed: (1) Bacterioplankton communities diversity along coastal waters of Latin America was characterized by means of V6 tag pyrosequencing from amplicon libraries; (2) Taxonomic and functional diversity of aquatic microbiota of Abrolhos Bank was characterized through pyrosequencing of shotgun libraries; (3) Microbial community diversity of Atlantic Forest soils was characterized through rrna 16S clone libraries sequencing and (4) Biotechnological potential of microbiota of Atlantic Forest soils was demonstrated through of a small fragments metagenomic library (10 Kb) for functional screening of clones with cellulolytic activity. Moreover, an overview on the culture independent methods for characterization of microbial diversity from typically Brazilian ecosystems was presented. In such a way, it was possible to determine the microbial signature of different Brazilian ecosystems. Results showed a latitudinal gradient of diversity for bacterioplakton communities along Latin America coast with predominance of cosmopolite organisms belonging to known taxonomic groups (ex. SAR 11, Acinetobacter, Flavobacteraceae and others) and a small endemic fraction, with higher endemism in Brazilian samples. The Abrolhos Bank metagenomes showed that protecting reefs present minor abundance of Archaea, viruses, human patogens and marine patogens as Vibrios and viii

9 the protecting areas present greater contribution of autotrophic organisms. It was possible to identify different degradation levels of Abrolhos reefs. Metagenomes reflected the trend of degradation of Abrolhos Bank region, suggesting that the metagenomes can be used in the monitoring of reef health as early warning tool. The strategies based on cloning of the metagenomic DNA of Atlantic Forest soils allowed the characterization of dominant taxonomic groups as Acidobacteria and Proteobacteria. The estimate species number per gram of soil was approximately 1500 species. A great number of unclassified sequences (approx 15%) reinforce the existence of many species and phyla not yet characterized. These data demonstrate a vast genetic repertoire that presents biotechnological potential, but not duly was explored. The construction metagenomic library contend approximately clones allowed the functional screening of clones with celullolyitic activity (FPásica and CMCásica; 20 U/L and 100 U/L, respectively), with similar measures observed for environmental isolates. Brazilian Atlantic Forest soils represent a vast source of new bacteria with potential for biotechnological exploration. The comparison of microbiotas of different ecosystems shows that each ecosystem has a typical microbial composition. ix

10 SUMÁRIO 1. Introdução Origem da diversidade genética O DNA detem a informação Principais mecanismos de evolução molecular em procariotos Mutação Duplicação gênica Transferência horizontal de Genes Abordagens de estudo em diversidade microbiana Métodos dependentes de cultivo Métodos independentes de cultivo Metagenômica Análise baseada em função Análise baseada em sequências Desafio computacional Pirosequenciamento Medidas de diversidade Riqueza de espécies Índices de diversidade Estimadores de diversidade Os microrganismos no meio ambiente Microbiota aquática e a saúde ambiental Microbiota terrestre e seu potencial biotecnológico Biodiversidade Biomas aquáticos: zona costeira Manguezais e lagoas Sistemas recifais Bioma terrestre: o solo da Mata Atlântica Características do solo A Mata Atlântica Objetivos Objetivo geral x

11 2.2 Objetivos específicos Materiais e métodos Gradiente latitudinal de diversidade do bacterioplâncton da costa da América latina Avaliação da saúde do Banco de Abrolhos através da metagenômica Área de estudo e coleta Extração do DNA metagenômico da água do mar Pirosequenciamento dos metagenomas do Banco de Abrolhos Purificação e quantificação do DNA metagenômico Preparação de bibliotecas pelo método shotgun Quantificação e checagem da qualidade da fragmentação das bibliotecas Reação em cadeia da polimerase em emulsão (em-pcr) Quebra da emulsão (break emulsion) Enriquecimento (Enrichment) Preparação e sequenciamento Análises Computacionais dos metagenomas da água dos recifes do Banco de Abrolhos Filtragem das sequências de baixa qualidade Anotação dos metagenomas pela tecnologia de subsistemas Análises comparativas Diversidade Microbiana do solo da Mata Atlântica Área de estudo e coleta Construção de bibliotecas de rdna 16S das comunidades microbianas dos solos do PARNASO Extração do DNA metagenômico Amplificação do gene rrna 16S Clonagem dos genes rrna 16S Sistema de ligação Preparação de células eletrocompetentes Transformação Montagem das bibliotecas e estocagem dos clones Confirmação dos clones Extração plasmidial em placa Sequenciamento dos clones Análises Computacionais de Sequências do gene rrna 16S do solo da Mata Atlântica Filtragem de sequências Estrutura das comunidades microbianas (classificação taxonômica) Estimativa de riqueza e diversidade Análises filogenéticas xi

12 3.3.3 Construção da biblioteca metagenômica de médios insertos Extração e purificação do DNA metagenômico Preparação do vetor de clonagem pcf Preparação dos médios insertos Análise funcional da Biblioteca Metagenômica do solo da Mata Atlântica Triagem de clones com atividade celulolítica Determinação da atividade celulolítica Curva de crescimento Atividade FPásica (celulose total) Atividade CMCásica (endoglucanásica) Atividade β-glicosidásica Diversidade microbiana dos biomas brasileiros Resultados e discussão Diversidade da comunidade de bacterioplâncton ao longo de uma gradiente latitudinal na costa da América Latina por meio de pirosequenciamento da região V Resultados Discussão Avaliação da saúde do Banco de Abrolhos através da metagenômica Resultados Discussão Diversidade das comunidades microbianas dos solos da Mata Atlântica e o seu potencial biotecnológico Resultados Diversidade da das comunidades microbianas dos solos da Mata Atlântica Potencial biotecnológico do DNA metagenômico do solo da Mata Atlântica Discussão Diversidade microbiana dos biomas brasileiros Resultados Discussão Diversidade microbiana nos biomas terrestres Diversidade microbiana em ambientes marinhos Diversidade microbiana em áreas urbanas costeiras Perspectivas Conclusões Conclusões gerais Conclusões específicas xii

13 5.2.1 Diversidade da comunidade de bacterioplâncton ao longo de uma gradiente latitudinal na costa da América Latina por meio de pirosequenciamento da região V Avaliação da saúde do Banco de Abrolhos através da metageômica Diversidade das comunidades microbianas dos solos da Mata Atlântica e o seu potencial biotecnológico Diversidade microbiana dos biomas brasileiros Referências Bibliográficas ANEXOS Anexo 1. Métodos Pirosequenciamento dos metagenomas do Banco de Abrolhos Extração do DNA realizada no interior do Sterivex Purificação do DNA metagenômico Preparação das bibliotecas pelo método shotgun Preparação de esferas magnéticas Ligação do DNA as esferas Quantificação e checagem da qualidade da fragmentação das bibliotecas Reação em cadeia da polimerase em emulsão (em-pcr) Preparação do óleo para emulsões Mock Amplification Mix e pré-emulsões Preparação do Live Amplification Mix Preparação das esferas de captura de DNA (beads) Captura das bibliotecas Emulsificação Quebra da emulsão (break emulsion) Recuperação das esferas Lavagem das esferas Enriquecimento (Enrichment) Enriquecimento indireto Preparação das esferas de enriquecimento (enrichment beads) Enriquecimento das esferas com DNA Recuperação das esferas de DNA enriquecidas Preparação e sequenciamento Carregamento da Placa PicoTilter Plate (PTP) Preparação da PTP e DNA beads Preparação do GS FLX Diversidade de comunidades microbianas do solo da Mata Atlântica Concentração e purificação dos fragmentos do rrna 16S xiii

14 Sistema de ligação Preparação de células eletrocompetentes Extração plasmidial em placa Análise funcional da Biblioteca Metagenômica Extração e purificação do DNA metagenômico com esferas de vidro Preparação do vetor de clonagem pcf Digestão parcial do DNA metagenômico Clonagem dos médios insertos Reativação e pré - seleção de clones em meio CMC Atividade FPásica (celulose total) Atividade CMCásica (endoglucanásica) Atividade β-glicosidásica Anexo 2. Lista de publicações Periódicos Artigo Artigo Artigo Artigo Capítulo de livro LISTA DE TABELAS Tabela 1. Principais consórcios que desenvolvem análises a partir de metagenomas baseada em sequenciamento Tabela 2. Parâmetros biológicos e físico-químicos dos locais de amostragem Tabela 3. Número de sequências, diversidade e cobertura das bibliotecas da região V6 do gene rrna 16S das comunidades microbianas ao longo do gradiente latitudinal Tabela 4. Distribuição e identificação da fração cosmopolita do gradiente latitudinal. Os números representam a fração de sequências agrupadas por táxons em relação ao total de seqüências classificadas pelo GAST. A identificação foi possível em diferentes níveis taxonômicos Tabela 5. Distribuição e identificação da fração endêmica ao longo do gradientelatitudinal. *PR Puerto Rico; AM Amazon estuary; GB Guanabara Bay; LG1 Laguna do Rocha 1; LG2 Laguna do Rocha 2; RP Rio de la Plata and AS Argentinian shelf Tabela 6. Características gerais dos locais de coleta e dos metagenomas. Média ± erro padrão. Número de replicatas entre parênteses. DOC (Carbono orgânico diddolvido); POC (Carbono orgânico particulado). 109 xiv

15 Tabela 7. Diversidade nas areas protegidas e não protegidas. Os valores foram obtidos usando o número total de sequências classificadas como Bacteria, Virus ou Archeae pelo MG-RAST. Abaixo, o resumo das análises estatísticas aplicadas aos valores encontrados mostra que houve diferença significativa apenas para os valores relacionados a riqueza de espécies. NS - diferença não significativa; DS - Diferença significativa Tabela 8. Diversidade e abundância dos subsistemas (metabolismo do carboidrato, nitrogênio, virulência, resposta a estresse e fotossíntese). Os dez primeiros subsistemas (hierarquia 1) de cada subsistemas Tabela 9. Os grupos mais frequentes encontrados nas bibliotecas e seus vizinhos filogenéticos mais próximos (cultivados e não cultivados). Os agrupamentos representam pelo menos seis sequências com similaridade > 97 % entre elas Tabela 10. Distribuição das sequências dos grupos mais frequentes nos diferentes tipos de solo da Mata Atlântica Tabela 11. Ensaios de atividade enzimática. A1, A2 e A3 são clones selecionados da biblioteca de pequenos insertos. Cel 1A e Cel CAAB são isolados do solo da Mata Atlântica que apresentaram capacidade de formar halos de degradação no meio de cultura Tabela 12. Lista de estudos de diversidade microbiana nos principais biomas brasileiros por abordagens independentes de cultivo em ambientes terrestres Tabela 13. Lista de estudos de diversidade microbiana dos principais biomas brasileiros por abordagens independentes de cultivo em ambientes aquáticos nos últimos anos Tabela 14. Lista de novos táxons de ambientes terrestres descritos nos últimos 5 anos Tabela 15. Lista de novos táxons de ambientes aquáticos descritos nos últimos 5 anos LISTA DE FIGURAS Figura 1. A árvore da vida baseada em filogenia molecular do gene rrna 16S (adaptado de Pace, 2011). 3 Figura 2. Principais mecanismos de geração de variabilidade genética (adaptado de Alberts, 2008)... 4 Figura 3. Origem de genes parálogos (adaptado de Alberts, 2008) Figura 4. Processos de intercelulares de troca de material genético Figura 5. Regiões de recombinação homóloga das ilhas de patogenicidade, de maneira geral, apresentam maior conteúdo AT em relação ao restante do genoma. Ilhas genômicas são muitas vezes inseridos em genes trna e genes que codificam fatores envolvidos na mobilidade genética, como integrases, transposases e sequências de inserção (IS). De acordo com seu conteúdo genético, podem ser descritas como ilhas de patogenia, simbiose, metabólicas, ilhas de fitness ou de resistência (Juhas, 2009) Figura 6. Halo de degradação produzido por bactérias celulolíticas, revelado por vermelho congo Figura 7. Modelo esquemático de um estudo com abordagem metagenômica.(adaptado de Handelsman, 2004) 15 Figura 8. Representação esqumática do sistema enzimático do pirosequenciamento. O nucleotídeo incorporado pela polimerase, liberando uma molécula de pirofosfato (PPi). A enzima ATP sulfurilase converte o PPi em ATP, que atua como substrato para a produção de luz pela luciferase. A luz produzida é detectada, formando um pirograma que indica a sequência de nucleotídeos incorporados durante o sequenciamento (retirado de Ahmadian, 2006) xv

16 Figura 9. Preparação da amostra para pirosequenciamento. a) Fragmentos de DNA com adaptadores e acoplados as esferas submetidas a em-pcr em emulsões de óleo. Após a quebra das emulsões são depositadas em um slide onde cada esfera contendo os produtos da amplificação são separadas individualmente. b) Microscopia da emulsão mostrando gotas contendo as esferas. A seta larga representa uma gota de 100 μm e a fina mostra uma esfera de 28 μm. c) Microscopia eletrônica de um slide (retirada de Margulies, 2005) Figura 10. Curvas de rarefação mostrando comunidades com diferente diversidade de espécies. É possível observar que as comunidades presentes em carcaças de baleia são menos diversas que as do solo e por isso apresentam uma menor inclinação da reta, representando que houve mairo cobertura da diversidade, indicando um menos número de filotipos em comparação com o solo (Retirado de Tringe, 2005) Figura 11. O modelo DDAM é positivamente retroalimentado quando há aumento de COD, produzido por algas, para suportar o crescimento de microrganismos associados aos corais. A proliferação de algas ocorre em função da retirada de peixes, principalmente herbívoros, dos sistemas recifais. A proliferação de microrganismos promove a morte de corais, aumentando a cobertura de algas Figura 12. Doenças que afetam corais brasileiros. A) Doença da banda-preta em Mussismilia braziliensis, B) doença da faixa-vermelha em Siderastrea spp, C) doença dark spot like em Siderastrea spp e D) praga branca em M. braziliensis (retirado de Francini-Filho, 2008) Figura 13. Estrutura da lignocelulose. O principal componente de lignocelulose é a celulose, ab (1-4) ligada cadeia de moléculas de glicose. A lignina é sintetizado através da polimerização dos componentes e sua relação dentro do polímero varia entre diferentes plantas, tecidos e camadas de madeira da parede celular. Celulose, hemicelulose e lignina formam estruturas chamadas microfibrilas, que são organizados em macrofibrilas que medeiam a estabilidade estrutural da parede celular vegetal (retirado de Rubin, 2008).. 36 Figura 14. Localização dos hotspots de riqueza de espécies ao redor do mundo considerados áreas prioritárias para conservação (Meyers, 2000) Figura 15. Áreas no território brasileiro com potencial impacto poluidor, localizadas próximas a corpos d água. Os pontos vermelhos indicam as áreas com potencial impacto poluidor. A maior concentração dessas áreas encontra-se ao longo da costa, onde observamos maior concentração de atividades humanas e industriais. Fonte: (IBGE, 2000) Figura 16. Ecossistemas costeiros sob impacto antropogênico. A) Manguezal da Baía de Guanabara (foto: Erick Aniszewski) e B) Ocupação industrial na Baía de Sepetiba (fonte: 46 Figura 17. A produção primária requerida para sustentar a produção pesqueira mundial de pesca, expresso em percentagem da produção primária local. Os mapas representam o total de desembarques anuais de 1950 (acima) e 2005 (abaixo) (Swartz, 2010) Figura 18. Mapa com a distribuição dos recifes na costa brasileira. (Fonte: RECOR) Figura 19. Os latossolos representam um dos tipos mais comumente encontrados no Mata Atlântica Figura 20. Cobertura do bioma Mata Atlântica. Aproximadamente 90 % do bioma já foi devastado (Fonte: Atlas dos Remanescentes Florestais da Mata Atlântica. SOS Mata Atlântica e Instituto Nacional de Pesquisas Espaciais INPE Figura 21. Localização geográfica dos pontos de coleta ao longo da costa da America Latina Figura 22. Sistema GAST de classificação taxonômica utilizado para implementação de um banco de dados curados da região V6 do gene rrna 16S (Retirada de https://vamps.mbl.edu/) xvi

17 Figura 23. Região do Banco de Abrolhos e os pontos de coleta. Em azul, as áreas não protegidas e em vermelho as áreas protegidas. As linhas vermelhas representam os limites do Parque Marinho de Abrolhos (Foto: Pedro Meirelles) Figura 24. Mergulhador coletando a água dos recifes de Abrolhos a aproximadamente 20 m de profundidade (Foto: Ronaldo Francini-Filho) Figura 25. Sistem de filtração Niskin. A) Sistema de filtração com os filtros Sterivex já acoplados. B) Filtros Sterivex durante o processo de filtração (Foto: Rodrigo Moura) Figura 26. Mapa do Parque Nacional da Serra dos Órgãos com a localização geográfica dos pontos analisados. 74 Figura 27. Vetor de clonagem pgemt Easy Figura 28. Plasmídeo pcf Figura 29. Influência do gradiente latitudinal na equitabilidade e produção primária bacteriana ao longo da costa da América Latina. A) Os dados indicam uma tendência de diminuição da uniformidade de distribuição das OTUs no nível de espécie, de acordo com a diminuição da latitude (R 2 = 0,9451). B) A produtividade primária é maior nas regiões tropicais e tende a diminuir em direção as regiões subtropicais (o eixo Contribuição (%) está em escala logarítimica) Figura 30. Estrutura das comunidades bacterianas nos sete locais. Os filos mais comumente encontrados são indicados. Sequências Unknown representam aquelas as quais não foi possível atribuir uma classificação taxonômica pelo VAMPS Figura 31. Número de sequências identifiicadas na fração conservada do gradiente latitudinal. Nível taxonômico mais profundo identificados pelo VAMPS Figura 32. Fração de sequências comuns de um local para outro usando 97% de similaridade para definir OTUs Figura 33. Análise de agrupamento das sequências. A ) Curvas de rarefação; B) Número de OTUs a diferentes níveis de similaridade correspondente a diferentes níveis taxonômicos (linhagens, espécies, gêneros e famílias) Figura 34. Análise baseada na distribuição de filos, demonstrando a existência de táxons dominantes distribuídos por poucos grupos taxonômicos. Por outro lado, mostra a contribuição de um grande número de táxons em baixa frequênciaque representa a biosfera rara da microbiota aquática Figura 35. Análise filogenética demonstrando a resolução taxonômica da região v6 do gene rrna 16S para os gênero relacionados Prochlorococcus e Synechococcus. Foi utilizado método neighbor join, corrigido pelo modelo Juckes-Cantor e bootstrap com 1000 replicatas Figura 36. Comparação dos valores dos parâmetro Carbono Orgânico Dissolvido (COD) (acima) e Clorofila (abaixo) entre os recifes protegidos e desprotegidos. Foi observada maior concentração de COD nos recifes protegidos. A) ANOVA e B) Visualização gráfica dos resultados do teste de Tukey. PAB - Parcel dos Abrolhos; SG - Sebastião Gomes; TIM Timbebas e CAL California.. Comparação dos valores do parâmetro Clrofila entre os recifes mostra maiores concentrações no recife protegido. A) ANOVA e B) Visualização gráfica dos resultados do teste de Tukey. PAB - Parcel dos Abrolhos; SG - Sebastião Gomes; TIM Timbebas Figura 37. Estrutura da comunidade microbiana dos recifes de Abrolhos. A). Contribuição dos diferentes domínios. Enriquecimento de vírus é observada em amostras de recifes desprotegidos. B) Nível trófico dos microrganismos dos cinco pontos. A classificação foi realizada com base na identificação dos filos. xvii

18 Enriquecimento do metabolismo autotrófico é observado nos recifes protegidos. C) Distribuição dos patógenos comumente encontrados. A classificação foi realizada baseada na identificaçãodas taxonômica espécies/ linhagens. A contribuição da Vibrios está relacionada a sequências atribuídas como Gammaproteobacteria. N corresponde ao número total de sequências para cada local Figura 38. Estrutura das comunidades microbianas nos níveis de A) Filos e B) espécies / linhagens mais frequentes (contribuição >1% do conjunto de sequências da amostra). A classificação taxonômica foi realizada usando o servidor Mg-Rast. A identificação taxonômica é realizada baseada no resultado do BLAST X realizado contra as sequências do banco de dados SEED (banco de genomas completos). A origem taxonômica do melhor hit para a proteína identificada foi relacionada a abundância do táxon identificado. N é o número de sequências utilizadas nas análises Figura 39. Contribuição dos subsistemas (hierarquia 1) nos diferentes recifes. As barras indicam a contribuição das sequências para cada subsistema nos recifes protegidos e não protegidos. A coluna contribuição é relativa ao número total de sequências identificadas para cada subsistema. Somente sequências informativas foram utilizadas para identificação subsistemas. Sequências atribuído como subsistemas miscelaneus, unknown e clustered based subsystems não foram incluídos nas análises Figura 40. Subsistemas do metabolismo de fotossíntese (média dos anos ). A) Contribuição dos subsistemas (hierarquia 3) relativa a todas as sequências anotadas pelo Mg-Rast. Os subsitemas mostraram diferença (p<0,5; CI 95%) entre os recifes protegidos e não protegidos. B) Contribuição de diferente táxons para o subsistema das proteorodopsinas Figura 41. Contribuição dos diferentes grupos taxonômicos para seis subsistemas relevantes (carboidrato, fósforo, nitrogênio, virulência, resposta ao estresse, e fotossíntese), utilizando MG- RAST. As estrelas coloridas representam maior abundância (p <0,5, IC 95%) de taxa para o respectivo subsistema em áreas desprotegidas e protegidas. N representa o número de sequências analisadas Figura 42. Versatilidade metabólica dos Vibrios. O gráfico mostra que os grupos de Vibrios nas áreas não protegidas apresentam maior comprometimento com metabolismo fototrófico Figura 43. Diversidade de filos encontrados nas bibliotecas do gene rrna 16S Figura 44. Estrutura das comunidades microbianas do solo da Floresta da Mata Atlântica do PARNASO baseada no sequenciamento de bibliotecas de clones do gene rrna 16S de acordo com o RDP (limite de confiança em 80 %). A) Abundância de filos; B) Contribuição (%) de subgrupos do filo Acidobacteria (Acidobacteria Gp 1 ao Gp 17) e C) Contribuição (%) das classes de Proteobacteria. N representa o número te sequências analisadas Figura 45. Análise da cobertura e estimativa da diversidade baseada na análise da bibliotecas de clones do gene rrna 16S. Foram utilizados os níveis de corte de 97% (acima), 90% (meio) e 80% (abaixo) de similaridade entre as sequências.curvas de rarefação (A, B e C) e curvas coletoras (estimador Chao 1) (D, E, e F) Figura 46. Análise filogenética baseada nas sequências do gene rrna 16S dos grupos de clones mais frequentes nas bibliotecas Os grupos apresentam pelo menos seis sequências com similaridade > 97 % entre elas. Os círculos pretos representam uma sequência representativa de cada grupo e entre parêntesis o número de sequências representadas. As linhagens tipo e sequências relacionadas como vizinhos filogenéticos mais próximos foram determinadas pelos bancos de dados RDP e GenBank. A fonte de identificação das sequências dos bancos de dados do NCBI estão indicados Figura 47. Relação entre diversidade H (índice de Shannon) e parâmetros físico químicos do solo. Unidades: Matéria Orgânica (%); Alumínio (me/100cm³); Fósforo (mg/l); Potássio (mg/l) xviii

19 Figura 48. Fração de sequências dos filos Proteobacteria, Firmicutes e Actinobacteria compartilhada pelos métodos dependentes e independentes de cultivo Figura 49. Extração do DNA metagenômico pelos métodos A) Kit comercial Mo Bio e B) Esferas de vidro. A1) Mistura de DNA metagenômico dos diferentes tipos de solo da Mata Atlântico do PARNASO; A2) Resultado da digestão parcial do DNA metagenômico pela enzima PstI, gerando quantidades insuficientes para a construção da biblioteca metagenômica. B1) Resultado da extração do DNA metagenômico dos solos ainda com contaminantes em diferentes concentrações (1, 3, 5 e 10 μl); B2)Resultado da purificação e B3) Resultado da digestão parcial. A linha vermelha mostra a região excisadacontendo os fragmentos para clonagem no plasmídeo pcf Figura 50. Extração plasmidial de colônias aleatórias demonstrando a variedade de insertos com diferentes tamanhos. 1. pcf430 circular diferentes colônias (5μL) Figura 51. Curva de crescimento dos clones em meio CMC Figura 52. Parte superior: análise das componentes principais (PCoA) do pareamenteo unweight através da matriz de distância do FastUniFrac. Cada ponto corresponde a comparação da presença ou ausência dos grupos taxonômicos de bactérias em diferentes biomas. Triângulos verdes, círculos roxos e hexágonos vermelhos representam microrganismos associados a solo, água e organismos marinhos. Comunidades de (A) Bactérias e (B) Archaea, respectivamente. A porcentagem de variação explicada pelo traçado das componentes principais está indicada nos eixos. Um total de e sequências do gene 16S rrna foram alinhadas para Bacterias e Archaea, respectivamente. Foram selecionadas sequências referentes as regiões V1 e V2 do gene rrna 16S. Sequências curtas menores que 300 pb foram retiradas da análise. Archeas do solo não foram incluídas. Parte inferior: classifcação taxonômica baseada nas sequências do gene rrna 16S através da ferramenta Classifier do RDP. (C) Contribuição dos principais filos bacterianos e (D) Contribuição de filos do domínio Archeae Figura 53. Análise filogenética de sequências não classificadas, recuperadas da água. As sequências foram comparadas com sequências tipo a aprtir de comparação com o RDP. Todas as sequências foram alinhadas usando o programa Muscle. As análises filogenéticas foram realizadas com o programa Mega, usando o método de neighbor joining. Valores de bootstrap (1000 repetições) > 50 % são mostrados. A linha azul corresponde a OTUs com alta similaridade (> 97 %) entre os genes rrna 16S encontrados por diferentes autores em ambientes aquáticos. É importante salientar os longos ramos, que representam novos grupos taxonômicos em potencial Figura 54. Análise filogenética de sequências não classificadas, recuperadas do solo. As sequências foram comparadas com sequências tipo a aprtir de comparação com o RDP. Todas as sequências foram alinhadas usando o software Muscle. As análises filogenéticas foram realizadas com o software Mega, usando o método de neighbor-joining. Valores de bootstrap (1000 repetições) > 50 % são mostrados. A linha verde corresponde ao exemplo de sequências singletons, com grande distância evolutiva em comparação com as sequências do gene 16S rrna linhagens de tipo, demonstrando a heterogeneidade da diversidade de Bactérias dos solos Figura 55. Estrutura das comunidades bacterianas associadas ao solo, água e organismos marinhos.a classificação foi realizada através de comparação com o RDP. A análise foi realizada com sequências de ecossistemas terrestres e 1864 sequências marinhas xix

20 1. INTRODUÇÃO A diversidade microbiana representa o mais vasto repertório genético do planeta. Entretanto, apenas uma pequena fração dessa diversidade é conhecida. Os microrganismos direcionam os principais ciclos biogeoquímicos (como o ciclo do carbono) e por isso desempenham funções ecológicas indispensáveis no ambiente, como o ciclo do carbono. A microbiologia ambiental foi revolucionada na década de 90 pelo avanço das técnicas moleculares que proporcionaram a identificação de uma maioria microbiana até então não identificada pelos métodos de cultivo tradicionais. O sequenciamento massivo tem proporcionado a caracterização de organismos não cultivados que compõe as comunidades microbianas. Neste trabalho foram utilizadas técnicas independentes de cultivo para acessar a diversidade microbiana de biomas aquáticos e terrestres. Os resultados foram sumarizados em 4 capítulos onde apresento os resultados e discussões. No primeiro capítulo, a diversidade da comunidade de bacterioplâncton ao longo de uma gradiente latitudinal na costa da América Latina foi caracterizada por meio de pirosequenciamento da região V6 através de pirosequenciamento de bibliotecas de amplicons. O segundo capítulo trata da caracterização do metagenoma da água para avaliação da saúde do Banco de Abrolhos através de pirosequenciamento de bibliotecas de fragmentos aleatórios (shotgun). O terceiro capítulo teve como objetivo avaliar a diversidade das comunidades microbianas dos solos da Mata Atlântica e o seu potencial biotecnológico através da construção e sequenciamento de bibliotecas de clones do gene rrna 16S pelo método de Sanger através da construção de bibliotecas de pequenos insertos para e avaliação de atividade celulolítica. O quarto capítulo apresenta um panorama da diversidade microbiana dos biomas brasileiros a 1

21 demonstração da assinatura microbiana associada aos diferentes ecossistemas terrestres e aquáticos. Esta introdução tem como objetivo apresentar os principais aspectos relevantes para o estudo da diversidade microbiana para compreensão dos resultados que serão apresentados nos capítulos posteriores. Temas como a origem da diversidade genética e as mudanças na estruturas das comunidades microbianas em função das alterações das condições ambientais foram abordados para compreender sua importância no funcionamento dos ecossistemas. 1.1 Origem da diversidade genética A maioria dos organismos vivos são células simples, outros, como o ser humano, são formadas por complexos multicelulares que desempenham funções especializadas e conectadas por sistemas de comunicação. Em ambos os casos, as células, são o veículo para a informação hereditária. Um dos mistérios em torno da origem da vida é como o material genético poderia ter sido formado a partir de moléculas mais simples presentes no início Terra. O DNA surgiu como uma forma permanente de armazenamento, devido à sua maior estabilidade química. O surgimento da molécula de DNA representa o surgimento de uma nova era no Planeta O DNA detem a informação O sucesso dos organismos vivos com base em DNA, RNA e proteínas tem sido espetacular. A capacidade de sobreviver e se perpetuar determinou sua persistência no ambiente (Futuyma, 2002). Células procarióticas vivem em uma ampla variedade de nichos ecológicos, e eles são incrivelmente versáteis em suas capacidades bioquímicas, sendo capazes de metabolizar uma ampla variedade de moléculas no ambiente. 2

22 A elucidação da estrutura da molécula do DNA, a partir de 1953, por Watson e Crick, forneceu uma melhor compreensão da natureza das mutações e da variação genética. O conceito de seleção natural foi expandido de modo a incluir não somente a sobrevivência e reprodução de organismos individuais, mas também aos genes, populações e espécies. Como a informação genética de cada organismo é escrita na linguagem universal de sequências de DNA, a sequência de qualquer organismo pode ser obtida através de técnicas moleculares. Com isso, é possível caracterizar, catalogar e comparar conjunto de organismos vivos a partir dessas sequências. A partir de tais comparações, podemos estimar o lugar de cada organismo na árvore genealógica das espécies vivas através de uma árvore da vida (Pace, 2009) (Figura. 1). As análises do conjunto de genes de uma célula (genoma) é uma poderosa ferramenta para determinar as relações evolutivas. A sequência completa do DNA de um organismo define a sua natureza com precisão. Como o DNA está sujeito a mudanças aleatórias que se acumulam durante longos períodos de tempo, o número de diferenças entre as sequências de DNA de dois organismos pode proporcionar uma direta, objetiva e quantitativa indicação da distância evolutiva entre eles. Figura 1. A árvore da vida baseada em filogenia molecular do gene rrna 16S (adaptado de Pace, 2011). 3

23 1.1.2 Principais mecanismos de evolução molecular em procariotos O DNA é a matéria-prima da evolução. Não existe um mecanismo natural para fazer longos trechos de sequências aleatórias novos. Sendo assim, nenhum gene é sempre inteiramente novo. A inovação pode ocorrer através de processos intracelulares como mutação, duplicação gênica e transferência horizontal de genes (THG) (Figura 2). Figura 2. Principais mecanismos de geração de variabilidade genética (adaptado de Alberts, 2008) Mutação As mutações são a principal origem da variação genética (Nei and Kumar, 2000). Elas geram variações no conjunto de genes de uma população. Mutações desfavoráveis (ou deletérias) podem ter sua frequência reduzida ou anulada na população por meio da seleção natural, 4

24 enquanto mutações favoráveis (benéficas ou vantajosas) podem se acumular, resultando em mudanças evolutivas adaptativas (Futuyma, 2002) (Figura 2). A maioria das mutações ocorre por mecanismos endógenos, por hidrólise espontânea e erros durante a replicação. Por exemplo, a DNA polimerase apresenta taxa de erro de 1 para cada 10 9 nucleotídeos incorporados (Alberts et al., 2008). As substituições podem ocorrer através das transições, quando a mudança ocorre entre purinas (A G) ou pirimidinas (T C) e também pode ocorrer através das transversões, quando ocorre a mudança de purina por pirimidina e vice-versa (A, G T, C). Substituições também podem ocorrer espontaneamente através de mudança tautomérica, permitindo o pareamento entre adenina e citosina ou guanina e timina. Além disso, a duplicação, inserção e deleção de nucleotídeos podem ocorrer espontaneamente ou através da ação de agentes físico ou químicos e pela exposição a metabólitos tóxicos como as espécies reativas de oxigênio Duplicação gênica Dentro de uma mesma família gênica, ou seja, conjuntos de dois ou mais loci com sequências similares de DNA, podem surgir genes com novas funções através do processo de duplicação gênica. Genes não correspondentes, na mesma ou em diferentes espécies, são chamados de parálogos (Figura 3). Em procariontes, de modo geral, pelo menos 5-10% dos genes são parálogos. Eventos de duplicação gênica constituem um marco na evolução da complexidade biológica (Innan and Kondrashov, 2010). A idéia da duplicação gênica como força motriz do processo evolutivo foi popularizada por Ohno (1970) (Ohno, 1970). Uma vez duplicado, um gene pode estar sujeito a três destinos: (i) não-funcionalização, em que uma das duas cópias do gene degenera em um pseudogene que pode ser subsequentemente perdido do genoma; (ii) sub-funcionalização, que consiste na divisão das funções originais do gene ancestral entre as duas cópias gênicas duplicadas; (iii) neo- 5

25 funcionalização, onde a cópia duplicada assume uma nova função (Zhang, 2003). A duplicação gênica permite que as novas cópias do gene assumam funções mais especializadas ou mesmo possibilita a origem de novos genes com funções totalmente distintas daquelas dos genes de origem. Figura 3. Origem de genes parálogos (adaptado de Alberts, 2008) Transferência horizontal de Genes Um pedaço de DNA pode ser transferido do genoma de uma célula para outra. Esse processo é distinto da transferência vertical da informação genética dos pais para a progênie. Essas alterações são capazes de deixar um traço característico do DNA exógeno. Genomas procarióticos são compostos por dois tipos distintos de genes: (i) os "informacionais", menos transmissíveis e envolvidos no processamento de informação na célula, tais como a transcrição, tradução e replicação, e (ii) os "operacionais, frequentemente transferíveis e envolvidos no metabolismo, mas com menor restrição funcional (Rivera et al., 1998). Sendo assim, genomas microbianos podem evoluir através de transferência horizontal dos genes. Em geral, genomas procariontes têm entre 5-30% de genes transferidos 6

26 lateralmente (Lawrence, 1999). Além dos genes essenciais que codificam as funções metabólicas, genomas bacterianos também abrigam genes acessórios, adquiridos por transferência horizontal de genes que podem ser benéficos em determinadas condições ambientais. No ambiente ocorre transferência horizontal de genes entre vários gêneros e espécies de bactérias por transformação, conjugação e transdução (Figura 4). A. Transformação: As células capturam DNA exógeno diretamente do ambiente ao seu redor. B. Conjugação: Duas células interagem e uma doadora transfere DNA para a receptora. C. Transdução: Fagos transportam DNA de uma célula para outra. Figura 4. Processos de intercelulares de troca de material genético. A comparação dos genomas das linhagens de E. coli revelou que o número de genes centrais, ou que executam funções essenciais naquela espécie, é surpreendentemente baixo (Welch et al., 2002). Muitos dos genes transferidos recentemente não estão presentes em grupos filogeneticamente próximos. Os genes acessórios contêm um maior percentual de nucleotídeos A e T (Figura 5), e tem uma utilização de códons que é semelhante à encontrada 7

27 em fagos e plasmídeos (Gogarten and Townsend, 2005). Muitos dos genes acessórios adquiridos por transferência horizontal formam blocos chamados de ilhas genômicas. Ilhas genômicas geralmente são reconhecidas como discretos segmentos de DNA presentes em estirpes estreitamente relacionadas. Elas promovem a diversificação e adaptação dos microrganismos, com significativo impacto na plasticidade dos genomas, disseminação de resistência a antibióticos, genes de virulência e vias catabólicas (Gal-Mor and Finlay, 2006; Juhas et al., 2009). Figura 5. Regiões de recombinação homóloga das ilhas de patogenicidade, de maneira geral, apresentam maior conteúdo AT em relação ao restante do genoma. Ilhas genômicas são muitas vezes inseridos em genes trna e genes que codificam fatores envolvidos na mobilidade genética, como integrases, transposases e sequências de inserção (IS). De acordo com seu conteúdo genético, podem ser descritas como ilhas de patogenia, simbiose, metabólicas, ilhas de fitness ou de resistência (Juhas, 2009). 8

28 Esses processos ocorrem devido à recombinação genética de regiões homólogas do DNA, que permite o aumento da variabilidade genética. Existem três principais maneiras de ocorrer o evento de recombinação gênica na natureza. De forma geral, são elas (Ringo, 2004): Recombinação: Ocorre troca entre moléculas de DNA homólogas, na qual a localização do sítio de troca não é restrita. Geralmente, porções do DNA duplahélice podem apresentar extensa homologia em regiões que ajudam na ligação de proteínas (proteínas ligantes do DNA). As duas moléculas trocam segmentos do DNA em um processo de várias etapas, catalisado por diferentes enzimas. Recombinação sítio-específica: Ocorre troca entre moléculas de DNA nãohomólogos, ocorrendo apenas em sequências curtas e específicas, restritas a poucos loci. A integração de plasmídeos ou cromossomos de fagos no DNA genômico e a inversão de segmentos para expressão de genes alternativos são exemplos deste tipo de evento. Transposição: Consiste no movimento de elementos genéticos móveis chamados transposons. Existem centenas de transposons diferentes. As transposases (enzimas que promovem a recombinação do transposon) apresentam três diferentes mecanismos de atuação: não-replicativo (processo de cortar-colar ), replicativo (processo que integra e resolve) e retrotransposição (via RNA intermediário). Além disso, diferentes forças evolutivas, como seleção natural, deriva gênica e migração, também podem interferir no desenvolvimento das comunidades de um ecossistema. Espécies diferentes, resultantes de processos seletivos em condições ambientais distintas, apresentam indivíduos com diferenças ainda mais evidentes. Essas diferenças se manifestam não só através de variáveis estruturais, mas também bioquímicas, fisiológicas e etológicas, implicando em capacidades de adaptação e habilidades diferentes entre indivíduos. Indivíduos 9

29 de espécies diferentes podem reunir-se em comunidades que variam conforme as interações das espécies entre si, fatores históricos e diferentes condições abióticas (clima, solo, relevo). Assim, a complexidade de uma comunidade está associada a sua diversidade microbiana. 1.2 Abordagens de estudo em diversidade microbiana As duas abordagens principais no estudo de diversidade microbiana incluem as análises dependentes e independentes de cultivo. Ambas permitem caracterizar a diversidade, e por isso ainda são consideradas complementares. Estima-se que apenas 1% dos microrganismos é detectado em placas com meio de cultura devido às condições seletivas, em função da composição dos meios de cultura (Torsvik et al., 1990; Torsvik et al., 2002; Whitman et al., 1998). Por outro lado, a abordagem independente de cultivo indica a predominância de muitas espécies não cultivadas (Schloss and Handelsman, 2004) Métodos dependentes de cultivo As técnicas de cultivo tradicionais desenvolvidas por Pasteur, Koch, Beijerinck e Winogradsky foram extensivamente utilizadas ao longo do século passado e se mostraram até certo ponto bem sucedidas diante a falta de outras metodologias para o estudo da diversidade microbiana. Os métodos tradicionais de análise da diversidade de bactérias envolvem a caracterização de culturas puras isoladas em laboratório. O isolamento em meio de cultivo exige que a composição do meio supra as necessidades metabólicas dos microrganismos. Essa é uma das principais dificuldades para o estudo de diversidade microbiana, pois o repertório metabólico dos procariontes é vasto. Em solos, por exemplo, já foi estimado que existam pelo menos cerca de 4000 genomas procariontes por grama de solo (Torsvik et al., 1990). Porém, o número de espécies que são isoladas de um grama de solo é estimado em 100. Por isso é necessário adequar as condições de cultivo para conseguir recuperar organismos inicialmente não cultivados e que são abundantes no ambiente. 10

30 Durante várias décadas foram concentrados esforços no isolamento de microrganismos patogênicos, ou relacionados à determinada patogenia, bem como aqueles com capacidade de sintetizar antimicrobianos, em laboratório. Isso permitiu um enorme avanço para a microbiologia médica. Por isso, alguns grupos como actinomicetos, enterobactérias e bacilosgrampositivos apresentam um grande número de espécies identificadas com representantes cultivados (Schloss and Handelsman, 2004). Por outro lado, a microbiologia ambiental precisa desenvolver estratégias de aprimoramento dos meios de cultura já estabelecidos, para uma melhor compreensão da biologia dos microrganismos isolados de amostras ambientais (Hugenholtz et al., 1998). O uso de meios com baixa concentração de nutrientes e aumento dos tempos de incubação permite a obtenção de representantes da cultura pura de várias subdivisões do dos filos Acidobacteria e Verrucomicrobia (Janssen, 2006; Sait et al., 2002). É importantte ressaltar que membros destes dois grupos são de difícil obtenção em cultivo mesmo com meios feitos especificamente para eles. Alteração de condições de cultivo como concentração de oxigênio, nível de nutrientes, adição de moléculas húmicas e moléculas de sinalização aumentam a capacidade de cultivo de microrganismos no solo, incluindo esses dois grupos (Stevenson et al., 2004). A adição de compostos de sinalização também foi relatada para ajudar no cultivo de organismos aquáticos (Bruns et al., 2002; Bruns et al., 2003). A utilização de extratos de solo solidificados com ágar é uma alternativa para melhorar a recuperação de isolados ambientais (Sait et al., 2002; Wirth and Ulrich, 2002). Esta abordagem tem como objetivo criar condições nutricionais que sejam as mais semelhantes possíveis àquelas sob as quais os microrganismos se encontram no meio ambiente. O isolamento e a manutenção em laboratório de microrganismos que ocorrem no meio ambiente, permite a construção de uma coleção microbiana. É uma metodologia altamente atrativa, pois permite a determinação de características morfológicas, fisiológicas e bioquímicas da coleção 11

31 microbiana, além de possibilitar a utilização de microrganismos para fins biotecnológicos. Estes aspectos permitem a pesquisa e a bioprospecção rápida e pontual de diversos processos com potencial de aplicação biotecnológica a partir de culturas puras. Para isso os isolados devem ser crescidos sobre substrato específico em um meio capaz de indicar a ocorrência do processo metabólico de interesse. Por exemplo, o corante vermelho congo é utilizado para demonstrar a ocorrência de degradação de celulose através de halos formados pela afinidade do corante pelas ligações β-1,4 da molécula (Teather and Wood, 1982) (Figura 6). As propriedades metabólicas de um isolado podem ser utilizadas para inferir o potencial papel ecológico que esse organismo desempenha em um ecossistema. Figura 6. Halo de degradação produzido por bactérias celulolíticas, revelado por vermelho congo. Embora os métodos de cultivo representem uma poderosa ferramenta para o estudo da diversidade (taxonômica e funcional), ele subestima a diversidade taxonômica e metabólica em função das limitações apresentadas anteriormente. Técnicas moleculares para a análise da diversidade de comunidades microbianas superam este problema. 12

32 1.2.2 Métodos independentes de cultivo Há pelo menos vinte anos foi verificada a existência de uma vasta diversidade até então não acessada pelos métodos dependentes de cultivo (Torsvik et al., 1990; Torsvik et al., 2002). A diversidade microbiana identificada pelos meios de cultivo representa apenas a ponta de um iceberg de um vasto repertório genético. As análises independentes de cultivo permitem acesso ao genoma de toda a comunidade microbiana de uma amostra (Handelsman, 2004). As técnicas como T-RFLP, ARDRA e DGGE diferenciam as comunidades através do padrão de bandeamento do gene ribossomal sob diferentes tratamentos. Entre as técnicas moleculares, o sequenciamentos têm se mostrado bastante eficientes na para a identificação e caracterização de táxons presentes nas comunidades. Atualmente, as técnicas de sequenciamento são amplamente aplicadas ao estudo da diversidade microbiana. O desenvolvimento e aprimoramento dos sequenciadores de primeira geração (baseado no método de Sanger), e mais recentemente, os de segunda (pirosequenciamento) e terceira (íonsequenciamento) geração permitem o sequenciamento massivo de amostras ambientais. Os de primeira geração, através do sequenciamento de bibliotecas de clones. Já os de segunda e terceira geração evitam a distorção inerente à construção das bibliotecas. Essas metodologias permitem o estudo das populações microbianas a partir de amostras ambientais Metagenômica O termo metagenômica se refere a uma abordagem independente de cultivo baseada na investigação das moléculas de DNA de uma mistura de populações microbianas, ou seja, é baseado na análise genômica de DNA microbiano extraído diretamente de amostras ambientais (Handelsman et al., 1998) (Figura 10). Em grego, a palavra meta significa "transcendente". Isso significa que essa abordagem vai além das análises genômicas que, de maneira geral, são aplicadas em microrganismos cultivados. O estudo da diversidade de 13

33 comunidades microbianas sofreu uma revolução com o estabelecimento da metagenômica. Com a aplicação dessa abordagem os pesquisadores passaram a ter acesso ao genoma de uma maior variedade de microrganismos que não haviam sido isolados em meio de cultura em laboratório. A metagenômica representa um conjunto de técnicas, que inclui muitas abordagens e métodos relacionados à genômica como o sequenciamento. Sendo assim, a abordagem metagenômica se caracteriza por contornar a necessidade de cultivo e, em função da vasta diversidade microbiana, ser conduzida em grande escala (Handelsman, 2005). Comunidade genômica, genômica ambiental, e genômica populacional são sinônimos para a mesma abordagem (Handelsman, 2004). As informações obtidas a partir da análise de metagenomas podem ser usadas para determinar a diversidade de uma comunidade, a presença de microrganismos específicos ou dominantes, rotas metabólicas, bem como determinar a simples presença de um gene. A abordagem metagenômica permite a visualização dos ecossistemas como unidades biológicas com os seus próprios repertórios genéticos. Desta maneira esta abordagem possibilita a avaliar o que está sendo feito pela comunidade microbiana. A metagenômica vem sendo aplicada para responder questões fundamentais da microbiologia ambiental como: quantos são? Quem são? E fazendo o quê? Por isso, a metagenômica representa uma importante ferramenta para estudo da ecologia microbiana e prospecção do potencial metabólico através da análise da diversidade taxonômica e localização de genes e operons responsáveis pela síntese de moléculas com propriedades de interesse biotecnológico (Handelsman, 2004; Steele and Streit, 2005). A abordagem metagenômica é conduzida de forma que o DNA metagenômico seja analisado através da investigação funcional e/ou baseada em sequenciamento (Figura 7). Para isso, o desenvolvimento da bioinformática tem sido determinante, já que permite o processamento e 14

34 análise da grande quantidade de dados gerada pelas técnicas de sequenciamento de segunda geração (pirosequenciamento). Figura 7. Modelo esquemático de um estudo com abordagem metagenômica.(adaptado de Handelsman, 2004) Análise baseada em função A metagenômica oferece a possibilidade de localizar e caracterizar uma ampla variedade de enzimas a partir de amostras ambientais. A detecção dessas moléculas requer uma triagem funcional que necessita da expressão heteróloga dos genes seguida do sequenciamento dos fragmentos isolados. Linhagens de E. coli são amplamente utilizadas neste tipo de abordagem. 15

35 Isso ocorre em função do profundo conhecimento já existente sobre a fisiologia e o genoma desta espécie. A revisão de Daniel (2004) (Daniel, 2004) apresenta um conjunto de trabalhos que obtiveram sucesso na busca de moléculas bioativas (ex. agarase, lípase, amilase, protease e outras) através triagem funcional em bibliotecas metagenômicas de amostras de solo. A frequência de clones que são capazes de expressar uma atividade, de maneira geral é baixa. Ainda existe dificuldade para melhorar a eficiência na identificação de clones raros em bibliotecas muito grandes. Em alguns casos foi necessário analisar uma biblioteca de 4 Gb de DNA ou aproximadamente 1 milhão de genes e assim, sua baixa representatividade torna a descoberta de novas atividades extremamente laboriosa sem uma triagem prévia. A utilização de meios indicadores da atividade, onde os clones ativos possam ser facilmente identificados é uma estratégia bastante utilizada. A descoberta, expressão e caracterização de um novo antimicrobiano, a partir de DNA metagenômico de solo, representam o primeiro exemplo do uso bem sucedido da metagenômica para a descoberta de novas moléculas e atividades (Gillespie et al., 2002). O antibiótico turbomicina foi isolado através da expressão heteróloga do DNA extraído diretamente do solo por clones de uma biblioteca metagenômica de microrganismos do solo. Foi necessária a triagem de uma biblioteca metagenômica de clones, representando cerca de 1 Gb de DNA, para obter 3clones apresentando níveis detectáveis da atividade antimicrobiana. Este trabalho representou uma mudança no paradigma na busca de novas moléculas bioativas. A utilização de sistemas de clonagem permite a separação e amplificação individual de fragmentos de DNA clonados, a partir de uma mistura de genes frequentemente desconhecidos e heterogêneos, oriunda de microrganismos do solo. Existe uma grande variedade de sistemas de clonagem disponíveis para acomodar diferentes tipos e tamanhos de fragmentos de DNA em linhagens hospedeiras. 16

36 Plasmídeos são utilizados para inserção de fragmentos pequenos (< 10kb), assim como os bacteriófagos (7-10kb), tendo grande aplicação na construção de bibliotecas de fragmentos de genes ou genes específicos (Henne et al., 1999; Knietsch et al., 2003). Entretanto, estes vetores não permitem a detecção de clusters genéticos nem operons. Com esse objetivo, a utilização de cosmídeos (25-35kb) e fosmídeos (até 40 kb) tem sido relatada (Handelsman, 2004). Para bibliotecas de grandes insertos, cromossomas artificiais bacterianos (BAC Bacterial Artificial Choromosome) e de leveduras (YAC Yeast Artificial Chromosome), são capazes de permitir a inserção de fragmentos de kb e 200kb-1.5Mb, respectivamente (Xu, 2006). Esses vetores podem ser utilizados na construção de sistemas de expressão de enzimas. A utilização de promotores gênicos permite o controle da expressão de um gene em condições controladas. O desenvolvimento de novas tecnologias que promovam a expressão e identificação eficiente de clones irá representar um avanço na fronteira da genômica funcional Análise baseada em sequências A aplicação de iniciadores universais para amplificação direta de sequências do rrna 16S, através de PCR (Polymerase Chain Reaction) do DNA total de uma comunidade microbiana e combinada com tecnologias de clonagem e sequenciamento têm gerado uma vasta quantidade de dados sobre a diversidade de procariotos. Woese e Fox (1977) (Woese and Fox, 1977) foram os primeiros a propor a utilização do gene rrna 16S para descrever relações filogenéticas entre bactérias. Já o conceito de clonagem do DNA diretamente de uma amostra ambiental foi inicialmente sugerido por Pace et al. (1985) (Pace et al., 1985) e primeiramente implementado por Schmidt et al. (1991) (Schmidt et al., 1991). Ele utilizou fago λ para construir uma biblioteca de rrna 16S a partir de amostras de água e comparou a diversidade picoplanctônica (organismos que medem entre 0.2 e 2 µm) do Oceano Pacífico e com sequências de organismos cultivados do Oceano Atlântico. Foram identificadas sequências 17

37 com distante relação filogenética com os táxons de Gammaproteobacteria conhecidos. Essas sequências foram consideradas representantes de novos organismos profundamente divergentes filogeneticamente. Isso demonstrou o enorme potencial das abordagens independentes de cultivo, revolucionando a ecologia microbiana. O sequenciamento do gene rrna 16S permite a identificação de células, mesmo em pequenas quantidades. Com isso, obtemos importantes informações sobre a composição taxonômica da comunidade microbiana de determinado solo. Desta maneira, a construção de bibliotecas genômicas de rrna 16S representa uma poderosa ferramenta para a análise da diversidade molecular de comunidades de microrganismos representativos do solo. O conjunto de clones bem como a análise de suas frequências dentro de uma biblioteca pode representar de maneira geral, uma correlação com as unidades taxonômicas predominantes (Janssen, 2006; Nogales et al., 2001). Schloss (2004) (Schloss and Handelsman, 2004) avaliou a diversidade taxonômica de procariotos através de sequências curadas do gene rrna 16S depositadas no banco de dados de genes ribossômicos RDP (Ribosomal Database Project). Foram identificados mais de 50 filos, sendo metade deles compostos inteiramente por membros não cultivados. Levantamentos da diversidade de ecossistemas terrestres e marinhos revelam sequências dominantes pertencentes a grupos taxonômicos como filo Acidobacteria e o clado SAR11 (Janssen, 2006; Venter et al., 2004a), que apresentam poucas espécies cultivadas já isoladas em comparação com o número de espécies identificadas pelos métodos independentes de cultivo. Além disso, a abordagem metagenômica tem permitido a identificação de táxons em baixa frequência, em ambientes terrestres e aquáticos, que não apresentam relação filogenética com nenhum filo descrito (Elshahed et al., 2008; Schloss and Handelsman, 2006; Sogin et al., 2006). O sequenciamento parcial do gene marcador filogenético rrna 16S permite a identificação de membros de subgrupos do filo Acidobacteria sem representantes cultivados. 18

38 A abordagem metagenômica permite correlacionar os membros das comunidades microbianas às sequências de genes funcionais obtidos por diferentes técnicas de sequenciamento. O sequenciamento do genoma revelou que este grupo apresenta genes envolvidos com o ciclo do carbono, como por exemplo, celulases (Ward et al., 2009) O padrão de distribuição dos genes funcionais e marcadores filogenéticos podem ser comparados entre metagenomas de diferentes ambientes. A metagenômica comparativa possibilita a determinação de habitats preferidos pelos táxons microbianos de diferentes ecossistemas. A comparação em diferentes escalas (globais, regionais e locais) ajuda a definir as especificidades dos ecossistemas. A análise quantitativa do conteúdo gênico revela as assinaturas de habitats que refletem características específicas de uma amostra ambiental. A composição taxonômica das comunidades ambientais é um indicador importante da sua ecologia e função. Isto nos permite comparar a complexidade das comunidades e distingui-las em função do repertório metabólico representado pelas sequências dos metagenomas (Tringe et al., 2005; von Mering et al., 2007). Desta forma, podemos correlacionar as características ambientais ao longo de biomas terrestres e aquáticos com os padrões de distribuição dos táxons microbianos (DeLong et al., 2006; Dinsdale et al., 2008a; Raes et al., 2011). O Projeto Coleta Global dos Oceanos (Global Ocean Sampling Project- GOS) coletou um impressionante volume de dados através do sequenciamento do da comunidade microbiana do Mar Sargasso (Venter et al., 2004a). Foi obtido um total de bilhões de pares de bases não redundantes. Atualmente, os dados da GOS representam um dos maiores depositórios de dados biológicos, relacionados com metadados para uma única região (Raes et al., 2011) Desafio computacional Estudos em metagenômica são ricos em dados, tanto na quantidade quanto em complexidade. Atualmente, após duas décadas de experiência no manuseio e análise de dados da sequências de DNA baseados no estudo de genomas completos de organismos cultivados, os biólogos 19

39 estão tendo que lidar com a grande quantidade de dados gerados pela abordagem metagenômica. Análises computacionais que permitam eficiente processamento e interpretação desses dados representam uma questão ainda a ser superada pela abordagem metagenômica. Novas tecnologias de sequenciamento, com o pirosequenciamento, estão aumentando substancialmente a transferência de dados e representam novos desafios específicos de plataformas de armazenamento de dados. Armazenar as sequências que serão geradas pelos projetos que utilizam abordagem metagenômica será um desafio para os bancos de dados (Ex. GenBank, EMBL-Bank, DDBJ e outros). Mas além do desafio de arquivamento, fica claro que a comunidade vai exigir novos bancos de dados secundários para que estes dados possam se utilizados de forma eficaz. A análise de sequências metagenômicas exige programas computacionais robustos, eficientes e especializados, como, por exemplo, programas para o agrupamento de sequências ou para análise de séries temporais. Dados metagenômicos devem ser integrados com dados de diferentes projetos, tais como dados de satélite sobre as temperaturas oceânicas e dados de séries temporais sobre as mudanças na salinidade dos oceanos (Sun et al., 2011). Bancos de dados como o Mg-Rast (Meyer et al., 2008) representam uma forma de armazenar, disponibilizar e interagir com o grande volume de dados gerados pelos projetos. Os principais consórcios, envolvidos na caracterização de metagenomas em andamento estão listados na Tabela 1. O avanço das tecnologias de sequenciamento permite o sequenciamento massivo do DNA metagenômico, possibilitando a identificação de genes ou famílias de genes relacionadas a proteínas já conhecidas como as depositadas em bancos de dados. Os principais projetos de metagenomas têm gerado um significativo aumento no volume de dados submetidos nos bancos de dados, tornando um desafio para o futuro a capacidade de armazenamento, processamento e análises dos dados gerados. Esta demanda se trona ainda mais necessária em função dos avanços das técnicas de sequenciamento, representados pelos 20

40 sequenciadores de segunda geração. O método de pirosequenciamento tem proporcionado um aumento significativo na capacidade de geração de sequências nos últimos anos. Tabela 1. Principais consórcios que desenvolvem análises a partir de metagenomas baseada em sequenciamento Consórcios Genomic Encyclopaedia of Bacteria and Archaea project Microbial Earth Project Human Microbiome Project Metagenomics of the Human IntestinalTract consortium Terragenome Initiative Tara Oceans Expedition National Ecological Observatory Network -NEON International Census of Marine Microbes (ICOMM) Endereço virtual Microbial Inventory Research Across Diverse Aquatic Long-Term Ecological Research Sites Earth Microbiome Project Pirosequenciamento O uso do sequenciamento, através do método de Sanger, e suas variações entre os anos 90 e 2000 representou um avanço significativo no estudo dos sistemas biológicos. A consolidação do sucesso da aplicação do método veio com o anúncio do sequenciamento do genoma humano (Lander et al., 2001; Venter et al., 2001). Entretanto, limitações como a clonagem física de fragmentos e longos tempos de execução incentivaram o desenvolvimento de técnicas de sequenciamento mais velozes, sensíveis e acuradas. Atualmente, a técnica de pirosequenciamento vem sendo amplamente aplicada aos estudos da diversidade microbiana (Dinsdale et al., 2008a; Edwards et al., 2006; Huber et al., 2007; Raes et al., 2011; Rodriguez- Brito et al., 2010; Sogin et al., 2006; Tringe et al., 2005). O pirosequenciamento é um método de sequenciamento de DNA, baseado no princípio do sequenciamento por síntese. A detecção da incorporação das bases difere do sequenciamento 21

41 de Sanger, pois é baseada na detecção da liberação do pirofosfato, em vez de terminação da cadeia com dideoxinucleotídeos (Nyrén, 1987). A abordagem desenvolvida para monitoramento do sequenciamento em tempo real sem a necessidade de eletroforese foi inicialmente proposto por Ronaghi (1996 e 1998) (Ronaghi et al., 1996; Ronaghi et al., 1998). O sistema de pirosequenciamento é constituído por um sistema enzimático que consiste de DNA polimerase, ATP sulfurilase, luciferase e apirase. Estas enzimas, de forma geral, executam as seguintes funções: a DNA polimerase (EC ) catalisa a polimerização de DNA na replicação, reparação e é, portanto, crucial para sobrevivência de todas as células vivas. A produção de PPi liberado mediante ATP durante a polimerização é catalisada pela ATP sulfurilase (EC ). A luciferase (EC ) catalisa a produção de luz a partir de ATP que é detectada durante o pirosequenciamento. Já a apirase (EC ) é incluída no pirosequenciamento para a degradação dos nucleotídeos não incorporados e ATP em excesso, entre as adições das bases. O método é baseado na detecção do pirofosfato (PPi) liberado durante a síntese do DNA. Em uma cascata de reações enzimáticas, a luz visível gerada é proporcional ao número de nucleotídeos incorporados. O pirofosfato é convertido em ATP. O ATP fornece a energia necessária para a enzima luficerase catalisar a reação de oxidação da luciferina, gerando luz. O perfil de emissão da luz resultante da incorporação das bases pode ser observado através de um pirograma (Figura 8). O pirosequenciamento massivo em paralelo aliado ao aumento da capacidade computacional e bioinformática permitiu o desenvolvimento substancial das ciências genômicas. Na metade dos anos 2000, o custo do sequenciamento foi reduzido por aproximadamente duas ordens de grandeza e reduziu os esforços dos projetos genomas (Rogers and Venter, 2005). 22

42 Figura 8. Representação esqumática do sistema enzimático do pirosequenciamento. O nucleotídeo incorporado pela polimerase, liberando uma molécula de pirofosfato (PPi). A enzima ATP sulfurilase converte o PPi em ATP, que atua como substrato para a produção de luz pela luciferase. A luz produzida é detectada, formando um pirograma que indica a sequência de nucleotídeos incorporados durante o sequenciamento (retirado de Ahmadian, 2006). Genomas e metagenomas podem ser sequenciados a partir de bibliotecas geradas pela fragmentação aleatória do DNA (método de sequenciamento shotgun). A ligação de adaptadores específicos aos fragmentos aliada a uma quantificação precisa do DNA, permitem a ligação de peças únicas da molécula a esferas de 28 nm (Figura 9 a). Estas bibliotecas eliminam a necessidade de sistemas de clonagem utilizados no método de Sanger. Os fragmentos ligados às esferas são amplificados através de PCR em emulsão (em-pcr), permitindo a amplificação de centenas de milhares de diferentes fragmentos de DNA em uma única reação. As esferas são compartimentalizadas em uma emulsão de óleo (Figura 9 b), criando um ambiente individualizado contendo todos os reagentes necessários para a amplificação da peça de DNA, gerando milhões de cópias do fragmento ligado a esfera. 23

43 Posteriormente, as emulsões são quebradas e os fragmentos de DNA fita dupla são desnaturados e as esferas contendo apenas fitas simples são depositados em um slide de fibra ótica contendo aproximadamente 1,6 milhões de poços, onde ocorrem as reações de sequenciamento em paralelo (Figura 9 c) (Margulies et al., 2005). Figura 9. Preparação da amostra para pirosequenciamento. a) Fragmentos de DNA com adaptadores e acoplados as esferas submetidas a em-pcr em emulsões de óleo. Após a quebra das emulsões são depositadas em um slide onde cada esfera contendo os produtos da amplificação são separadas individualmente. b) Microscopia da emulsão mostrando gotas contendo as esferas. A seta larga representa uma gota de 100 μm e a fina mostra uma esfera de 28 μm. c) Microscopia eletrônica de um slide (retirada de Margulies, 2005). Em janeiro de 2009 o sequenciador 454 Genome sequencer 20 (454 GS20), que apresentava uma acurácia de 99,5% para sequências não montadas (Huse et al., 2007), foi substituído por uma nova versão, o equipamento 454 Genome sequencer FLX System (454 GS FLX - Roche, Life Sciences). O novo sequenciador é capaz de produzir sequências mais longas que o anterior, alcançando 300 pb, excedendo 1 milhão de pb por dia (> 5GB em 5 dias de trabalho) 24

44 (Droege and Hill, 2008). Este melhoramento permitiu maior acurácia da tecnologia 454 de sequenciamento. Além do desenvolvimento de sequenciadores mais robustos, a tecnologia 454 de sequenciamento também foi otimizada através da alteração da química utilizada nas reações de sequenciamento. Atualmente, a química 454 GS FLX Titanium fornece cerca de mais que 1 milhão de sequências em uma única corrida de 10 horas. Estas sequências, com uma média de leitura de comprimento próxima dos 500 pb para bibliotecas shotgun, geram muito mais dados do que outras abordagens de sequenciamento disponíveis (Gilles et al., 2011). Os dados de sequências biológicas são então analisados por meio de fórmulas que medem a diversidade das comunidades microbianas Medidas de diversidade A diversidade microbiana pode ser avaliada a partir do número de espécies encontradas em uma amostra. Com isso, podem-se construir curvas de rarefação, que permitem avaliar a o tamanho da riqueza de espécies amostradas. Amostras de tamanhos diferentes podem ser comparadas através do uso de índices de diversidade e o tamanho total pode ser estimado a partir das relações de contribuição das espécies, sem a necessidade de acessar todos os indivíduos de uma amostra Riqueza de espécies Obtendo-se várias curvas a partir da adição aleatória das amostras pode-se calcular uma curva coletora média. As curvas de acumulação de espécies (curvas coletora) permitem avaliar o quanto um estudo se aproxima de capturar todas as espécies do local. Quando a curva estabiliza, ou seja, nenhuma espécie nova é adicionada, significa que a riqueza total foi obtida (Figura 10). A partir disso, novas amostragens não são necessárias. 25

45 Figura 10. Curvas de rarefação mostrando comunidades com diferente diversidade de espécies. É possível observar que as comunidades presentes em carcaças de baleia são menos diversas que as do solo e por isso apresentam uma menor inclinação da reta, representando que houve mairo cobertura da diversidade, indicando um menos número de filotipos em comparação com o solo (Retirado de Tringe, 2005). Em todo caso, a estabilização da curva é bastante difícil, pois muitas espécies raras costumam ser adicionadas após muitas amostragens, sobretudo em regiões tropicais. Assim, medidas de riqueza de espécies que permitam estimar a riqueza a partir dos dados obtidos, ou comparar inventários entre diferentes áreas com diferentes unidades amostrais, são bastante úteis para comparar comunidades microbianas. Entretanto, frequentemente a comparação de comunidades é baseada em diferentes tamanhos amostrais, que, por sua vez, dificultam conclusões. A técnica de rarefação consiste em calcular o número esperado de espécies em cada amostra para um tamanho de amostra padrão. A obtenção de uma curva desse tipo permite a comparação de amostras, mesmo com intensidades amostrais diferentes. Nesses casos, índices também são úteis para comparar comunidades de diferentes tamanhos amostrais. Índices de 26

46 diversidade são expressos por um único número, que pode representar a redução ou a abundância de um conjunto complexo de táxons. Os índices permitem dimensionar a riqueza, a igualdade e a diversidade nos diferentes ambientes estudados (Kennedy and Smith, 1995) Índices de diversidade O índice de Shannon-Wiener (H), já tradicionalmente designado como índice de Shannon, expressa a importância relativa de cada espécie e não apenas a proporção entre espécies e indivíduos (Shannon, 1948). Este é um índice que atribui um maior peso a espécies raras, prevalecendo, desta forma, o componente de riqueza de espécies. O índice de Shannon assume, também, que os indivíduos são amostrados ao acaso de uma população indefinidamente grande e que todas as espécies estão representadas na amostra coletada, sendo relativamente independente do tamanho da amostra. Segundo Hutcheson (1970) (Hutcheson, 1970) os dados obtidos se enquadram em uma distribuição normal, desde que N seja um número inteiro, de modo que os métodos estatísticos podem ser empregados para testar a significância da variância. Já o índice de Simpson (1949) (Simpson, 1949) foi o primeiro a ser usado em estudos ecológicos e mostra a concentração de dominância, uma vez que, quanto maior o valor, maior a dominância por uma ou poucas espécies. Este índice exprime, basicamente, a abundância das espécies mais comuns, sendo, consequentemente, mais sensível a mudanças que ocorrem nestas espécies (Magurran, 1988). Considerando-se as duas medidas heterogêneas, Shannon e Simpson, o último é que atribui um peso maior às espécies comuns Estimadores de diversidade Os estimadores de riqueza fornecem a quantidade de espécies que se pode encontrar em uma área, sem levar em conta a quantidade de indivíduos por espécie (abundância). Alguns já são aplicados há três décadas, mas atualmente têm sido mais amplamente aplicados devido ao 27

47 desenvolvimento de ferramentas computacionais que facilitam seu cálculo. Esses estimadores são aplicáveis aos dados com diferentes distribuições de abundância, levando-se em conta os dados relativos às espécies raras (ou aquelas que só aparecem em uma ou em poucas amostras). O cálculo da riqueza de espécies é mais acurado em comunidades com alta equitabilidade (as espécies são compostas pelo número semelhante de indivíduos). A aplicação dos estimadores, em teoria, independe do tamanho da amostra, embora quanto maior for a quantidade de organismos coletados, maior sua acurácia. O sequenciamento massivo de DNA tem revelado que a maioria das comunidades microbianas apresenta alto número de espécies composta por poucos indivíduos, também denominada biosfera rara (Elshahed et al., 2008; Sogin et al., 2006). Os estimadores que se baseiam na riqueza das espécies raras compartilhadas entre grupos de amostras utilizam-se de quatro variáveis: singletons (espécies com somente um indivíduo), doubletons (espécies com somente dois indivíduos), uniques (espécies que ocorrem em somente uma amostra) e duplicates (espécies que ocorrem em somente duas amostras). As estimativas realizadas com espécies representadas por poucos indivíduos são, segundo (Hellmann and Fowler, 1999), uma função do número de espécies raras encontradas em uma comunidade. Os estimadores de riqueza podem calcular: o número de espécies através de curvas coletoras, de modo que seja possível estimar o esforço empregado para inventariar uma área; número real de riqueza de espécies baseada em espécies raras compartilhadas entre grupos de amostras baseadas em incidência e a riqueza de espécies raras compartilhadas entre grupos de amostras. Amostras amientais costumam apresentar um grande número de espécies. Por exemplo, as estimativas baseadas em análises não paramétricas apontam um número de espécie entre a espécies por grama de solo (Curtis et al., 2002; Schloss and Handelsman, 2006). 28

48 1.3 Os microrganismos no meio ambiente O estudo dos padrões espaciais e processos que estão envolvidos na distribuição da biodiversidade são conhecidos como a biogeografia (O'Malley, 2007). A maioria dos estudos sobre padrões de distribuição microbiana tenta avaliar o princípio conhecido como Everything is everywhere, proposto no fim do século XIX, pelo professor alemão Lourens Gerhard Marinus Baas Becking (Baas Becking, 1834). Ele se baseou em observações feitas pelo microbiologista Beijerinck (1813) (Beijerinck, 1913). O princípio diz que tudo está em todos os lugares, mas o ambiente seleciona. Vários estudos enfatizam o impacto da composição do solo e da água na distribuição espacial na diversidade microbiana e na estrutura das comunidades (Clementino et al., 2008; DeLong et al., 2006; Fuhrman and Azam, 1980; Galand et al., 2009; Pommier et al., 2007; Schauer et al., 2009). Padrões na distribuição espacial de organismos fornecem evidências importantes sobre os mecanismos que influenciam a estrutura das comunidades ecológicas. Este princípio vem sendo observado e aplicado em alguns trabalhos durante os últimos anos em comunidades microbianas (Green and Bohannan, 2006; Green et al., 2004; Horner-Devine et al., 2004; Martiny et al., 2006; Zhou et al., 2008). A relação taxa-área observada em comunidades microbianas é regida pela Lei de Potência (Power-law). Esta relação é uma das regras mais difundidas da ecologia: áreas maiores contêm mais espécies do que as pequenas. A diversidade microbiana pode variar entre locais separados por milímetros ou milhares de quilômetros, embora o limite de dispersão seja mais aparente em escalas continentais do que em menores escalas. O pequeno tamanho dos microrganismos pode facilitar sua dispersão.a capacidade de dispersão por longas distâncias é uma característica fundamental para distribuição de organismos cosmopolitas. Estudos revelam que a maioria dos táxons cosmopolitas são também os mais abundantes nas comunidades (Nemergut et al., 2011). 29

49 Um gradiente latitudinal de diversidade tem sido documentado para organismos (animais e plantas) marinhos com aumento do número de espécies dos pólos em direção ao Equador. Os mecanismos que estabelecem esse tipo de padrão estão relacionados com o aumento da temperatura ao longo do gradiente. Maiores temperaturas e a produtividade primária influenciam os padrões de distribuição das espécies (Rohde, 1992). Este padrão foi confirmado recentemente no bacterioplâncton de águas superficiais dos oceanos (Pommier et al., 2007). A análise dos padrões globais de diversidade de bactérias revela que a salinidade é um dos principais fatores que influenciam a diversidade global das comunidades microbiana (Lozupone and Knight, 2007). Fatores climáticos como incidência de raios solares e temperatura, estão entre os principais fatores que influenciam na diversidade microbiana nos oceanos (Raes et al., 2011). Entretanto, ainda é pequeno o entendimento sobre a influência de fatores ambientais na seleção dos grupos funcionais e taxonômicos especialistas que compõem as comunidades microbianas. Os métodos independentes de cultivo têm colaborado significativamente para o melhor entendimento da biogeografia de microrganismos. Sequências de genes podem ser usadas para atribuir diferenças ou semelhanças entre as comunidades através da similaridade entre sequências de genes. O gene ribossomal é amplamente utilizado para associar um conjunto de características que determinam um estilo de vida e estratégias ecológicas gerais com a identificação de táxons (Green et al., 2008). Os microrganismos participam de importantes ciclos como do carbono, nitrogênio e enxofre. Por isso, exercem papéis fundamentais na homeostase de ambientes terrestres e aquáticos, permitindo o fluxo de energia e a reciclagem de nutrientes (Hackl et al., 2004; Wertz et al., 2006). O fluxo de matéria e energia paralelo ao fluxo da cadeia trófica clássica é chamado de alça microbiana. Através dele grande quantidade de matéria orgânica indisponível aos níveis 30

50 tróficos superiores, pode ser integrada nos ecossistemas aquático e terrestre pela produção secundária da biomassa microbiana (Fuhrman and Azam, 1980). A importância da microbiota na manutenção da saúde de ecossistemas aquático e o potencial biotecnológico da microbiota terrestre são discutidos a seguir Microbiota aquática e a saúde ambiental Microrganismos marinhos estão presentes em milhares de milhões de células por litro de água do mar. Eles se multiplicam em poucos dias e são consumidos na mesma taxa por parasitas e predadores protistas e virais. Essas atividades envolvem a captura e processamento da energia que direcionam os principais ciclos elementares. A diversidade genômica e a dinâmica evolutiva dos processos ecológicos das populações têm efeitos globais sobre as taxas e fluxo de energia no mar. De maneira global, o bacterioplâncton dos oceanos é formado em sua maioria por membros dos filos Proteobacteria, Cyanobacteria, Bacteroidetes e Actinobacteria (Pommier et al., 2007). Foram identificados grupos bacterianos como Prochlorococcus; Verrucomicrobiales; Flexibacteraceae; Gammaproteobacteria (SAR92, OM60, SAR86); Alphaproteobacteria e Deltaproteobacteria em amostras do Oceano Pacífico. Por outro lado, grupos de bactérias como Deferribacteres; Planctomycetaceae; Acidobacteriales; Gemmatamonadaceae; Nitrospina; Alteromonadaeceae SAR202 e SAR11 são encontrados em águas profundas (DeLong et al., 2006). Entretanto, os fatores que determinam o estabelecimento e manutenção desses grupos dominantes ainda precisam ser mais bem compreendidos. A maior parte das Cyanobacteria marinhas está agrupada em dois gêneros estreitamente relacionados de acordo com suas sequências do gene rrna 16S: Prochlorococcus e Synechococcus. Estima-se que essas Cyanobacteria são responsáveis por dois terços da fotossíntese nos oceanos e elas são amplamente distribuídas nas latitudes equatoriais e 31

51 temperadas de todos os oceanos (Bouman et al., 2006). Prochlorococcus são os organismos fotossintéticos mais abundantes nos oceanos do planeta e contribuem significativamente com a produtividade primária de oceanos tropicais e subtropicais (Partensky et al., 1999). Para alguns procariotos, as distribuições verticais de profundidade e variação nas propriedades fisiológicas estão se tornando conhecidas. Diferenças genotípicas e fenotípicas em espécies de Prochlorococcus foram observadas em populações expostas a diferentes níveis de exposição á luz (Paul et al., 2010). A recente descoberta de genes de bacteriorodopsinas em Proteobacteria do clado SAR11, não cultivadas, revelou a base de sistemas fototróficos em ambientes marinhos (Béjà et al., 2000; Béja et al., 2001). Bacteriorodopsinas permitem o acoplamento da energia da luz e a ciclagem de carbono no oceano. As proteorodopsinas são fotoproteínas que são capazes de gerar energia a partir da luz, realizando a translocação de prótons através da membrana celular. Esse mecanismo não é baseado no pigmento clorofila como ocorre organismos fotossintetizantes. A fototrofia baseada em proteorodopsinas é globalmente significante nos processos microbianos nos oceanos (Béja et al., 2001; Venter et al., 2004b). A presença de proteorodopsinas em bactérias heterotróficas de crescimento rápido, como as do gênero Vibrio, está envolvida com o aumento da sobrevida de microrganismos em situação de baixa disponibilidade de nutrientes (Gómez-Consarnau et al., 2010). Isto significa que as proteorodopsinas representam uma vantagem ecológica para determinados grupos m microbianos. Durante os últimos 30 anos foi demonstrado que as bactérias são dominantes na superfície terrestre e apresentam alta versatilidade metabólica. Uma grande fração da produção primária torna-se matéria orgânica dissolvida por vários mecanismos na cadeia alimentar, e esta parte da produção primária é quase exclusivamente acessível para bactérias heterotróficas e arqueias (Azam et al., 1983; Ducklow and Carlson, 1992). Como resultado, a absorção de 32

52 matéria orgânica por bactérias é uma das principais vias de fluxo de carbono e sua variabilidade pode mudar os padrões globais do fluxo do elemento carbono (Azam, 1998). A concentração dos gases do efeito estufa tem afetado o equilíbrio em diferentes regiões do mundo promovendo a acidificação dos oceanos (Caldeira and Wickett, 2003). O equilíbrio desta molécula determina não só o ph, mas também a disponibilidade de CO 2 para a fotossíntese e carbonato de cálcio usado por organismos marinhos, incluindo corais. O CO 2 da atmosfera é dissolvido em contato com o oceano. O carbono inorgânico dissolvido (CID) é incorporado à biomassa de algas através de fotossíntese. Na alga ele é convertido em carbono orgânico particulado (COP) e carbono orgânico dissolvido (COD) (partículas menores que 0,45 µm). O COD liberado pelas algas promove o crescimento de bactérias que promovem a morte do coral (Smith et al., 2006). O aumento da concentração de bactérias na superfície do coral provoca a diminuição da concentração de oxigênio, interferindo no processo de respiração levando a morte. É observada uma mudança de fase da comunidade bacteriana associada aos corais, com aumento da concentração de bactérias patogênicas (Mao-Jones et al., 2010). A correlação entre a retirada de peixes com a morte de corais através do aumento da cobertura de algas e proliferação de patógenos microbianos é chamada DDAM (do inglês, COD, Disease, Algae and Microbes) (Rohwer, 2010) (Figura 11). 33

53 Figura 11. O modelo DDAM é positivamente retroalimentado quando há aumento de COD, produzido por algas, para suportar o crescimento de microrganismos associados aos corais. A proliferação de algas ocorre em função da retirada de peixes, principalmente herbívoros, dos sistemas recifais. A proliferação de microrganismos promove a morte de corais, aumentando a cobertura de algas. As doenças infecciosas têm sido identificadas como as principais causas da degradação e extinção de corais em diversas partes do mundo (Bourne et al., 2009). Surtos consecutivos de doenças no Caribe foram responsáveis por intensa destruição de espécies de corais, levando a mudança drástica para um ecossistema dominado por algas (Patterson et al., 2002; Weil et al., 2006). Até este momento, 18 doenças em corais foram descritas, porém somente algumas têm a doença bem caracterizada (Figura 12). Em uma escala global, o branqueamento tem sido a doença mais devastadora nas últimas duas décadas (Stone, 2007). Muitas destas doenças em corais, incluindo o branqueamento, banda preta e banda amarela podem levar a morte. 34

54 Figura 12. Doenças que afetam corais brasileiros. A) Doença da banda-preta em Mussismilia braziliensis, B) doença da faixa-vermelha em Siderastrea spp, C) doença dark spot like em Siderastrea spp e D) praga branca em M. braziliensis (retirado de Francini-Filho, 2008) Microbiota terrestre e seu potencial biotecnológico A matéria orgânica no solo é representada pelos restos de animais e vegetais em todos seus estágios de decomposição. A matéria orgânica decompõe-se até constituir o húmus, que é a matéria orgânica na forma coloidal, com características benéficas e atribui ao solo uma coloração escura. Particularmente no solo, os microrganismos desempenham um papel fundamental na formação do húmus e na degradação da lignocelulose, que representa o biopolímero mais abundante no nosso planeta. A lignocelulose serve como proteção para as células de plantas verdes fortalecendo as diferentes estruturas que compõem a planta. A lignocelulose consiste, de maneira geral, da lignina, uma macromolécula (> 10 KDa) altamente aromática e hidrofóbica, e da celulose que é um carboidrato polimérico que compreende cadeias longas de beta-glucose (Figura 13). A hidrólise de polímeros complexos de celulose permite a disponibilização de glicose para o estabelecimento de outros organismos 35

55 incapazes de degradá-la. Dessa maneira, microrganismos celulolíticos dirigem o fluxo de energia no solo. Figura 13. Estrutura da lignocelulose. O principal componente de lignocelulose é a celulose, ab (1-4) ligada cadeia de moléculas de glicose. A lignina é sintetizado através da polimerização dos componentes e sua relação dentro do polímero varia entre diferentes plantas, tecidos e camadas de madeira da parede celular. Celulose, hemicelulose e lignina formam estruturas chamadas microfibrilas, que são organizados em macrofibrilas que medeiam a estabilidade estrutural da parede celular vegetal (retirado de Rubin, 2008). A celulose é um polissacarídeo formado por unidades residuais de -D-glucose, que interagem entre si através de ligações -1,4, mantendo uma estrutura linear e plana. A celulose é muito rígida, podendo ser encontrados em sua estrutura cerca de 4000 a 8000 moléculas de glucose (Aristidou and Penttilä, 2000). A orientação das microfibras de celulose na parede celular é influenciada por vários fatores que podem influenciar das enzimas microbianas (celulases) ao substrato (celulose). 36

56 Em um ecossistema tipicamente degradador de celulose como o solo, uma variedade de microrganismos trabalham em conjunto para converter substratos celulósicos insolúveis em açúcares solúveis, principalmente celobiose e glicose, que são então assimiladas pelas células. A decomposição da celulose pode ocorrer tanto em condições aeróbicas quanto anaeróbicas. Bactérias anaeróbicas desenvolveram um sistema altamente sofisticado e complexo para a degradação deste polímero chamado de celulossoma (Bayer et al., 2008). Celulossomas são complexos multienzimáticos produzidos por várias bactérias celulolíticas. O primeiro exemplo desta estrutura foi descoberto na bactéria anaeróbia termofílica, Clostridium thermocellum (Bayer et al., 2008; Lamed et al., 1983). A degradação bacteriana aeróbica da celulose pode ser realizada por bactérias filamentosas (ex: Streptomyces e Micromonospora) e não filamentosas (ex: Bacillus, Cellulomonas e Ruminococcus). Entretanto, a habilidade de degradar celulose aerobicamente é muito mais difundida entre fungos. O crescimento em forma de hifa, apresentado por fungos e actinomicetos, representa uma estratégia que favorece a degradação da celulose, através da penetração na estrutura cristalina da celulose e secreção das enzimas necessárias para a degradação do composto. A despolimerização da celulose representa a etapa que gera o maior rendimento energético para a fermentação. Entretanto, este polímero encontra-se embebido numa matriz de lignina (10-25%), que apresenta uma estrutura química bastante complexa, incluindo anéis fenólicos (Lee, 1997). A exigência de um consórcio de enzimas reflete a dificuldade de acesso aos polissacarídeos da parede celular das plantas. A degradação completa da celulose requer um complexo formado principalmente por três classes enzimáticas, que devem atuar de maneira sinérgica. Este complexo é composto por endoglucanases, que hidrolisam randomicamente a fibra de celulose nas ligações β- 1,4 internas reduzindo o tamanho do polímero; exoglucanases que hidrolisam a celulose a partir dos terminais não-redutores, liberando unidades de celobiose; e 37

57 β glicosidases que clivam os oligossacarídeos ou as celobioses livres, gerando glicose (Han et al., 1995; Lynd et al., 2002). A degradação das substâncias orgânicas e das substâncias húmicas é mediada pelos microrganismos dos grupos Proteobacteria, Firmicutes, Actinobacteria, Verrucomicrobia e Acidobacteria. Esses grupos taxonômicos são amplamente encontrados em solos e têm papel importante na ciclagem de biodisponibilização de C e N nestes ambientes. Os filos Acidobacteria, juntamente com Proteobacteria, são dominantes em solos de florestas (Faoro et al., 2010a; Janssen, 2006). Os solos ácidos são dominados por poucos táxons, principalmente Acidobacteria e Alphaproteobacteria. A distribuição espacial de alguns táxons está relacionada com a heterogeneidade do solo (Philippot et al., 2009). A diversidade e a riqueza das comunidades bacterianas no solo mostraram ser influenciadas pelas variáveis edáficas do solo, principalmente o ph, dos diferentes ecossistemas (Fierer and Jackson, 2006; Griffiths et al., 2011). A diversidade bacteriana é menor em solos ácidos, como da Amazônia, que foi identificado como o mais ácido e menos diversificado ao longo das Américas do Norte e do Sul. Os representantes desses filos apresentam alta versatilidade metabólica e são capazes de degradar fontes complexas de carbono com a celulose. As Streptomyces e Clostridium, também são conhecidas produtoras de celulases (Kato et al., 2004; Semedo et al., 2004). Enzimas produzidas por estes microrganismos são bastante exploradas economicamente em processos biotecnológicos, em especial pela indústria de energia. Até o momento, vários laboratórios estão empenhados na construção de microrganismos alterados geneticamente para a obtenção de enzimas de alto rendimento para a conversão de biomassa em biocombustível (Galbe and Zacchi, 2002; Lynd et al., 2002; Schubert, 2006). A biomassa celulósica representa uma matéria-prima alternativa às matrizes energéticas atuais como combustíveis fósseis, nuclear e hidroelétrica devido à sua disponibilidade em larga, menor 38

58 custo de produção e produz menor impacto ao meio ambiente (Lynd et al., 1999). Estima-se que toneladas de biomassa vegetal, são hidrolisadas anualmente por enzimas microbianas e a energia liberada equivale a 640 bilhões de barris de petróleo (Ragauskas et al., 2006). Desta forma, a aplicação a produção de energia com base em biomassa celulósica colabora com a diminuição do efeito estufa, reduzindo o custo ambiental em função da produção de energia, pois representa uma fonte mais limpa do que as matrizes energéticas baseadas em queima de comustíveis fósseis. O principal obstáculo impedindo a produção mais generalizada de energia a partir de fontes de biomassa é a ausência geral de tecnologias de baixo custo e de baixo impacto ambiental para superar a recalcitrância desses materiais. Atualmente tratamentos físico-químicos são bastante utilizados no pré-tratamento da biomassa, entretanto ainda são métodos caros e que produzem um significativo passivo ambiental. Microrganismos capazes de produzir enzimas com aplicação na degradação de resíduos agrícolas, como a celulose presente no bagaço da cana-de-açúcar, por exemplo, podem reduzir significativamente os custos associados à produção do combustível e, por isso, apresentam grande interesse econômico. O emprego de sistemas biológicos, a partir da diversidade genética das comunidades microbianas do solo da Mata Atlântica, capazes de degradar compostos celulósicos permite a otimização da produção de energia a partir de biomassa. A utilização eficiente da celulose permite o aumento da produção de etanol do país, diminuindo a necessidade de expansão da área de plantio de monoculturas como a cana-de-açúcar. Isso representa a diminuição da pressão das fronterias agrícolas sobre os biomas brasileiros e seus recursos naturais. 39

59 1.4 Biodiversidade O termo biodiversidade refere-se à variedade de vida no planeta Terra, incluindo a variedade genética dentro das populações e espécies e suas funções ecológicas desempenhadas pelos organismos nos ecossistemas (Wilson, 1985; Wilson et al., 2007). O conceito de biodiversidade envolve dois parâmetros: riqueza e equitabilidade. Riqueza é a quantidade de espécies e equitabilidade é a quantidade de indivíduos de determinada espécie que ocorre em um local ou em uma amostra. A maioria das políticas públicas e não-governamentais de projetos conservacionistas utiliza medidas de diversidade e de riqueza para apoiar os dados que subsidiarão as medidas de preservação e manejo ambiental. Áreas reconhecidas como hotspot de diversidade ou ecoregiões críticas são usualmente identificadas usando dados sobre a riqueza de espécies endêmicas (Brooks et al., 2006). O conceito dos Hotspots, criado em 1999 por Mitermeier e reforçado em 2004 (Mittermeier and Mittermeier, 2004), estabelece atualmente 25 áreas críticas para conservação em todo o mundo (Myers et al., 2000) (Figura 14). Essa estratégia foi adotada pela Conservação Internacional para estabelecer prioridades em seus programas de conservação. O critério mais importante na determinação dos Hotspots é a existência e o grau de ameaça de espécies endêmicas, isto é, que são restritas a um ecossistema específico e, portanto, sofrem maior risco de extinção. Os Hotspots sustentam até metade da diversidade biológica do planeta em apenas 1% da sua superfície da Terra (Myers et al., 2000). O estabelecimento de áreas protegidas para conservação da biodiversidade in situ é uma estratégia de manejo, podendo permitir a preservação de (micro) biota com grande potencial biotecnológico e ambiental. A estratégia dos hotspots é justificada pelo fato que os conservacionistas estão longe de conseguir proteger todas as espécies ameaçadas do mundo. Essa abordagem prioriza as ações nas áreas mais ricas, como as florestas tropicais da Mata Atlântica brasileira e as savanas do 40

60 Cerrado brasileiro, os ecossistemas do tipo mediterrâneo e outros, protegendo espécies em extinção e mantendo o amplo espectro de vida no planeta. Consequentemente, a riqueza observada nos hotspots pode capturar uma alta diversidade de espécies, mas nem sempre as espécies raras ocorrem nessas regiões (Prendergast et al., 1993). Muitas áreas mantêm apenas 3 a 8% do que existia inicialmente, como a Mata Atlântica, que hoje guarda entre 7 a 8% de sua extensão original. Figura 14. Localização dos hotspots de riqueza de espécies ao redor do mundo considerados áreas prioritárias para conservação (Meyers, 2000). Existem diferentes hipóteses que explicam a importância da biodiversidade para a estabilidade de um ecossistema. Entretanto, todas assumem que a diversidade é fundamental na sua manutenção. A hipótese da diversidade-estabilidade postula que os ecossistemas são tanto mais estáveis, quanto maior a diversidade no sistema (Stiling, 1996). A simplificação dos ecossistemas, em termos de redução de espécies (redução da diversidade), induz uma redução da estabilidade e aumenta a susceptibilidade a invasões biológicas. Este argumento sustenta importantes políticas de conservação aplicadas à gestão do meio ambiente. Neste sentido, 41

61 índices de diversidade poderiam ser ferramentas importantes na delimitação de áreas estratégicas para a proteção ambiental. A hipótese da redundância sugere que as espécies se agrupam em unidades funcionalmente equivalentes (Stiling, 1996). Segundo esta hipótese, o funcionamento dos ecossistemas não é afetado pela remoção de elementos redundantes, mas sim pelo efeito sobre as espécies com papel preponderante no funcionamento dos ecossistemas. Por exemplo, com o aumento de determinados grupos de espécies que tem papel negativo para um determinado bioma, pode levar a degradação deste bioma. Nesta seção serão apresentadas as principais características dos biomas aquáticos e terrestres que foram exploradas neste trabalho. O termo bioma foi utilizado de uma forma ampla para definir um conjunto de ecossistemas. No caso, abordaremos os ecossistemas de manguezais, lagoas costeiras, sistemas recifais e solos de floresta Biomas aquáticos: zona costeira Metade do oxigênio existente no ar que respiramos é produzida nos oceanos. Além disso, os oceanos absorvem grande parte do CO 2 lançado na atmosfera. Essas duas funções são primordiais para a manutenção do equilíbrio ambiental. Por isso, biomas aquáticos como a Zona Costeira representa ecossistemas prioritários para conservação e preservação dos recursos naturais. A Zona Costeira é a região de interface entre o continente e o mar, sendo dominada por processos oceanográficos e atmosféricos originados nas bacias de drenagem dos rios afluentes. A elevada concentração de nutrientes e outros fatores ambientais como gradientes térmicos, salinidade variável e condições para a reprodução e alimentação da maioria das espécies que habitam os oceanos, fazem com que esse ecossistema desempenhe uma importante função de ligação e de trocas genéticas entre os ecossistemas terrestres e marinhos. 42

62 Por ser uma região de transição, a zona costeira registra expressiva sobreposição territorial, mantendo também interface com os biomas terrestres. Por isso, não se caracteriza como uma unidade, mas sim como complexos de ecossistemas, onde os fenômenos regionais determinam as características de cada ecossistema. Essas regiões englobam menos de 20% da superfície do planeta, mas acomodam mais de 45% da população humana, hospedando 75% das grandes cidades com mais de 10 milhões de habitantes e produzindo cerca de 90% da pesca global (Lemay, 1998). Cerca de 60 % dos 475 milhões de habitantes da America Latina vivem em estados costeiros, assim como a maioria das cidades economicamente mais importantes. A região costeira é uma importante zona de produção de alimentos e é foco de desenvolvimento industrial. As zonas costeiras são áreas submetidas à forte pressão ambiental, pois representam áreas intensamente povoadas e com altos níveis de industrialização. Os efeitos do desenvolvimento desordenado contribuem para a desestabilização dos ecossistemas tornando a demanda por recursos não sustentável. A Zona Costeira brasileira ocupa aproximadamente, três milhões de km 2, sob jurisdição brasileira. O país possui uma das maiores faixas costeiras do mundo, com mais de km entre a foz dos rios Oiapoque ( N) e Chuí ( S). Os ecossistemas são extraordinariamente diversos. Tal fato torna a Zona Costeira brasileira um ambiente complexo e diversificado, uma vez que a faixa terrestre que compõe a costa do Brasil está inserida em diferentes biomas (Amazônia, Caatinga, Mata Atlântica, Cerrado e Pampas). Consequentemente, a diversidade biológica não é igualmente distribuída ao longo dos diversos ecossistemas costeiros e marinho como as lagoas costeiras, manguezais e recifes de corais. Lagoas costeiras e estuários constituem sistemas férteis, servindo de abrigo e região de criadouro para um grande número de espécies. Os manguezais apresentam elevada diversidade estrutural e funcional, atuando, juntamente com os estuários, como exportadores 43

63 de biomassa para os sistemas adjacentes. Finalmente, os recifes de corais comportam uma variedade de espécies animais próxima àquela observada nas florestas tropicais úmidas e constituem os ambientes mais diversos do planeta (Reaka-Kudla, 1997). A Zona Costeira representa um dos principais focos de atenção para a conservação ambiental e manutenção da biodiversidade, tanto terrestre como aquática. O impacto de rejeitos domésticos e industriais associados à expansão de atividades predatórias são as maiores ameaças dos ecossistemas costeiros, principalmente os mangues e recifes de coral que representam os ecossistemas com maior diversidade. O crescimento desordenado e o adensamento das populações costeiras no Brasil tiveram sua origem na colonização do país. O papel de colônia de exploração promoveu a ocupação do território brasileiro do litoral para o interior, tendo em vista facilitar o escoamento do comércio e o trânsito de pessoas entre colônia e metrópole. Estas áreas foram alvos de um processo de ocupação acelerado que teve como vetores básicos a urbanização, o turismo e a industrialização. Com o surgimento de grandes centros urbanos próximos a faixa litorânea, têm-se observado mudanças significativas na qualidade das águas costeiras e estuários, principalmente em função do despejo de esgoto doméstico e efluentes industriais não tratados, diretamente nos corpos de água em todo o mundo (Bound and Voulvoulis, 2006; Medeiros et al., 2005; Nakada et al., 2006; Petrovic et al., 2003). Dados do (IBGE, 2000) mostram uma grande concentração de áreas com potencial poluidor ao longo do litoral brasileiro e próximo a corpos de água (Figura 15) Manguezais e lagoas Manguezais e lagoas representam ecossistemas costeiros de transição diretamente influenciados pelo oceano. Caracterizam-se por serem extremamente dinâmicos em função das flutuações das características físico-químicas associadas ao encontro da água doce com a 44

64 água salgada. No planeta existem aproximadamente Km² de manguezais, sendo Km² distribuídos pela costa brasileira. O manguezal é um ecossistema costeiro, característico de regiões tropicais e subtropicais, sujeito ao regime das marés, constituído de organismos adaptados à flutuação de salinidade e capazes de colonizar sedimentos com baixos teores de oxigênio. Ocorre em regiões abrigadas e apresenta condições propícias para alimentação, proteção e reprodução de muitas espécies animais. Figura 15. Áreas no território brasileiro com potencial impacto poluidor, localizadas próximas a corpos d água. Os pontos vermelhos indicam as áreas com potencial impacto poluidor. A maior concentração dessas áreas encontra-se ao longo da costa, onde observamos maior concentração de atividades humanas e industriais. Fonte: (IBGE, 2000). O ecossistema manguezal está associado às margens de baías, enseadas, barras, desembocaduras de rios, lagunas e reentrâncias costeiras, onde haja encontro de águas de rios com a do mar, ou diretamente expostos à linha da costa. 45

65 Este é um ecossistema submetido a intenso impacto antropogênico em virtude de sua proximidade com áreas intensamente urbanizadas e industrializadas. A ocupação urbana, associada às atividades humanas e industriais, resulta em exploração inadequada dos recursos disponíveis e a consequente degradação de áreas de mangue (Kennish, 1992; Pelletier et al., 2006) (Figura 16). A Baía de Guanabara é localizada no estado do Rio de Janeiro. A baía abrange parte da região metropolitana do estado do Rio de Janeiro que se caracteriza por ser uma região de intensa atividade urbana e industrial. Essa região sofreu uma das maiores catástrofes ambientais do Brasil com o vazamento de cerca de 1,3 milhões de litros de óleo da Refinaria Duque de Caxias em janeiro de 2000 (Gabardo et al., 2000). A Baía de Sepetiba também está inserida numa região de intensa atividade industrial, contaminada pela dissolução de metais sulfetados. Figura 16. Ecossistemas costeiros sob impacto antropogênico. A) Manguezal da Baía de Guanabara (foto: Erick Aniszewski) e B) Ocupação industrial na Baía de Sepetiba (fonte: Já as lagoas costeiras se encontram distribuídas ao redor do mundo e ocupam 13 % das regiões costeiras no mundo. Uma lagoa costeira é um corpo de água costeira rasa, separada do oceano por uma barreira e ligada pelo menos de forma intermitente, por restritas conexões com o oceano (Kjerfve, 1994). Elas apresentam extensões variadas, podendo alcançar 70 km 2 como a Lagoa do Rocha no Uruguai até Km 2, como a Lagoa dos Patos no Rio Grande do Sul, a maior do Brasil e uma das maiores da América Latina. Lagoas costeiras são 46

66 utilizadas para recreação e turismo, apresentam valor cultural e o seu valor econômico (Costanza et al., 1997). Entretanto, assim como os manguezais, lagoas costeiras também se encontram ameaçadas pelo despejo de efluentes domésticos e industriais. O intercâmbio entre lagoa e oceano é impulsionado pela ação das marés e das ondas e é muitas vezes o principal componente do balanço de água da lagoa (Smith, 1994). A quantidade e qualidade da água de uma lagoa são influenciadas pelas taxas de evaporação, precipitação, entrada das águas subterrâneas, escoamento superficial e intercâmbio com o oceano. A salinidade da água e os nutrientes atuam como os principais reguladores da distribuição de diversos organismos tais como bactérias, plantas, microcrustáceos e peixes (De Macedo- Soares et al., 2010; Farjalla et al., 2009; Santangelo et al., 2007; Santos et al., 2006). A constante variação da salinidade exige que os organismos sejam capazes de se adaptar a esta condição. Esta é uma das características que influenciam o alto grau de endemismo desses ecossistemas. A Lagoa de Araruama, maior lagoa hipersalina do mundo, apresenta variação na salinidade durante o ano entre 45 e 55 % (Kjerfve, 1994). A comunidade microbiana associada à lagoa apresenta uma diversidade de procariotos adaptados a viver em condições hipersalinas (Clementino et al., 2008). Lagoas costeiras também apresentam um alto grau de conectividade aos ecossistemas terrestres adjacentes, exibindo uma troca significativa de água e material particulados e dissolvidos. Esse material se acumula nos sedimentos ou são removidos para o oceano. Lagoas costeiras no norte fluminense (Farjalla, 2002) apresentam altas concentrações de carbono orgânico dissolvido (COD), comparáveis às concentrações normalmente encontradas em pântanos e em ecossistemas considerados ricos em matéria orgânica dissolvida (MOD). A origem desse carbono está relacionada à decomposição parcial de macrófitas e principalmente pela a decomposição de plantas terrestres nos arredores. Stepenauskas (Stepanauskas, 1999) 47

67 mostrou que a biodisponibilidade do MOD é reforçada após a mistura do lago e da água do oceano. No entanto, a MOD do oceano é mais biodisponível que o das lagoas (Søndergaard et al., 1995). Sendo assim, essas regiões são ecossistemas altamente produtivos que suportam uma variedade de habitats. As lagoas costeiras representam uma fonte de energia e nutrientes para as áreas adjacentes. O carbono orgânico dissolvido (COD) derivado de plantas aquáticas fornece uma importante fonte de energia para bacterioplâncton marinho costeiro (Moran et al., 1991) Sistemas recifais Os recifes de corais são estruturas geológicas de origem biogênica, construídas a partir do crescimento de organismos que secretam esqueletos de carbonato de cálcio. Essas estruturas representam um habitat que permite a interação de milhares de espécies que dependem da manutenção das estruturas recifais, permitindo o estabelecimento de relações entre diversos taxa. Os ecossistemas recifais abrigam quase um terço dos peixes marinhos (McAllister et al., 1994). Os maiores responsáveis pela edificação dos recifes são os corais escleractíneos e, secundariamente, os hidróides calcários ou hidrocorais e as algas calcárias (Muscatine, 1990). Os recifes cobrem, aproximadamente, de 0,1 a 0,5% do assoalho oceânico, com áreas variando de km 2 (Spalding and Grenfell, 1997) a km 2 (Copper, 1994). Os recifes de corais estão entre os mais diversos, mais complexos e mais produtivos ecossistemas do planeta (Odum and Odum, 1955). Os corais são animais pertencentes ao Filo Cnidária, com cerca de espécies pertencentes a 24 famílias (Brusca and Brusca, 2003). A capacidade dos corais de construir recifes está intimamente relacionada à atividade fotossintética de algas microscópicas chamadas zooxantelas (gênero Symbiodinium) que vivem em simbiose com o coral. Estas algas fornecem carbono orgânico para os corais aumentando sua capacidade de secreção de carbonato de cálcio. Isso permite que estes animais cresçam e forneçam matéria prima para a 48

68 construção da base da estrutura recifal, em uma velocidade mais rápida do que a taxa de destruição por erosão. O fenômeno conhecido como branqueamento de coral ocorre quando as algas simbiontes zooxantelas abandonam o tecido do coral ou quando elas perdem seus pigmentos (Glynn, 1991). O aumento da temperatura da água nos últimos anos, associado ao aumento do efeito estufa, é apontado como a principal causa do branqueamento (Fitt et al., 2001; Glynn, 1991; Goreau et al., 2000). O branqueamento de corais representa um impacto significativo nos recifes, pois os corais, principais construtores, sofrem déficit energético tornando-se vulneráveis a doenças, predação e morte (Glynn, 1991; Hoegh-Guldberg, 1999). O branqueamento atinge ainda a saúde dos corais afetando sua reprodução, diminuindo o crescimento linear e reduzindo a taxa de calcificação do seu exoesqueleto (Nyström et al., 2000). E como consequência, a manutenção e o desenvolvimento da estrutura recifal pode ser seriamente comprometida (Goreau et al., 2000). Além das questões globais, os impactos locais também podem promover prejuízos aos sistemas recifais As atividades pesqueiras ao redor do mundo mostraram um significativo aumento nos últimos 50 anos (Swartz et al., 2010) (Figura 17). Isso representa uma ameaça aos sistemas recifais, pois a retirada de organismos que ocupam níveis superiores na cadeia alimentar, provocando alteração no equilíbrio do ecossistema (Sandin et al., 2008). Mais de 100 países tem recifes de corais na sua linha de costa, e pelo menos dez milhões de pessoas têm seus recursos ou fonte protéica oriunda dos recifes (Salvat, 1992). Nestes recifes a base das cadeias alimentares é seriamente comprometida, afetando toda a estrutura recifal e as comunidades que deles dependem. 49

69 Figura 17. A produção primária requerida para sustentar a produção pesqueira mundial de pesca, expresso em percentagem da produção primária local. Os mapas representam o total de desembarques anuais de 1950 (acima) e 2005 (abaixo) (Swartz, 2010). A pesca predatória provoca a mudança de uma comunidade recifal dominada por corais para uma comunidade dominada por algas devido à retirada dos peixes herbívoros que, em ecossistemas equilibrados, controlam o crescimento das algas (Figura 11). A mudança de fase, para predomínio de algas ocorre porque a taxa de crescimento das algas e bactérias heterotróficas é muito superior a do coral. O resultado desta competição é a diminuição da cobertura de corais e aumento da cobertura de algas. Sendo assim, esses organismos podem ser utilizados como indicadores de degradação ambiental nos sistemas recifais. A alteração na relação entre a cobertura de bentos (corais e algas) em sistemas recifais pode ser observada 50

70 em regiões com maior concentração de atividades humanas (Dinsdale et al., 2008b; Sandin et al., 2008). Esse fenômeno tem sido observado em vários recifes do mundo, em consequência não somente da sobre pesca, mas também da poluição marinha e do crescente incidência de doenças em função do efeito estufa e acidificação dos oceanos (Hughes, 1994; Hughes et al., 2007). No Brasil, episódios de doença em corais têm sido relatados nos últimos anos (Leão (Francini-Filho et al., 2008; Leão et al., 2008). A proximidade dos recifes da costa, onde se concentra a maior parte da população constitui um fator determinante para o aumento da incidência de doenças, aliado ao aumento da temperatura global. Estimativas sugerem que a manutenção do ritmo de degradação dos sistemas recifais pode levar os corais brasileiros à extinção em torno de 50 anos (Francini-Filho et al., 2008) Embora raros, os recifes brasileiros ocupam uma área de cerca de 890 km 2 sendo que a maior parte das espécies está localizada na costa do estado da Bahia (Prates, 2003) (Figura 18). Recifes coralíneos brasileiros são considerados como área prioritária para a conservação da biodiversidade no Atlântico devido ao tamanho reduzido deles (5% de recifes do Atlântico) e um alto nível de endemismo (Francini-Filho and de Moura, 2008). 51

71 Figura 18. Mapa com a distribuição dos recifes na costa brasileira. (Fonte: RECOR) O Banco de Abrolhos é um alargamento de km 2 da plataforma continental dos estados da Bahia e Espírito Santo, representando o maior e mais rico complexo recifal do Atlântico Sul (Leão et al., 2003). Os recifes de corais têm sido formados nos últimos cinco mil anos nesta área e distribuídos sobre a plataforma continental. Mussismilia braziliensis e M. híspida representam mais de 70% da massa formadora do recife em algumas áreas. Os recifes de Abrolhos crescem a partir de uma estrutura característica com a forma de cogumelo chamada de "chapeirão", o qual é construído por uma fauna coralina rica em espécies endêmicas. Existem chapeirões com diferentes alturas e dimensões laterais (altura < 1 a >25 m, diâmetros <1 a >50 m) e em diferentes fases de crescimento (Hartt, 1871). Essas estruturas assemelhamse a cogumelos com o topo mais pronunciado no lado dos ventos dominantes. Com apenas 1 m de altura e 1 a 2 m de diâmetro no topo, podem já apresentar a forma cogumelar desde sua fase inicial de crescimento, assim como uma simples colônia do coral Mussismilia 52

72 braziliensis com diâmetro de cerca de 20 cm já pode apresentar a forma de um pequeno cogumelo. Nos chapeirões maduros, os quais podem alcançar alturas de até 25 m com uma área na superfície de cerca de 50 m, o aumento do diâmetro do topo é acentuado quando estas estruturas alcançam o nível do mar. Esta forma de crescimento cogumelar dos recifes de Abrolhos não é uma característica comumente encontrada nos recifes de corais de outros mares tropicais. Recifes costeiros rasos são sujeitos a uma alta pressão da pesca e acúmulo de sedimentos, enquanto recifes mais afastados da costa são menos impactados (Francini-Filho and de Moura, 2008). O Banco de Abrolhos sustenta uma grande diversidade de vida marinha, potencialmente desempenhando um papel principal na homeostase de todo o oceano Atlântico Sul como uma importante área produtora e berçário de espécies. A região hospeda importantes peixes alvos de pesca como Caranhas (família Lutjanidae), garoupas (família Serranidae) e outros recursos costeiros valiosos (marisco) (Francini-Filho and de Moura, 2008). De acordo com o Programa de Avaliação do Potencial Sustentável de Recursos Vivos na Zona Econômica Exclusiva do Ministério do Meio Ambiente, a produção pesqueira anual no banco de Abrolhos é de aprox. 15 mil toneladas de pescado, gerando divisas na ordem de R$ 150 milhões reais/ano e envolvendo pelo menos 20 mil famílias de pescadores Bioma terrestre: o solo da Mata Atlântica O solo é a camada mais superficial da crosta terrestre. Ele abriga a maior parte da diversidade de organismos vivos do planeta. Em consequência, processos ecológicos fundamentais para a manutenção dos ecossistemas, como os processos biogeoquímicos (Ex. ciclo do carbono e nitrogênio) ocorrem no solo. O solo desempenha diversas funções primordiais em nossos ecossistemas, incluindo a capacidade de ciclagem das moléculas orgânicas e inorgânicas. O solo apresenta grande capacidade para assimilar grandes quantidades de matéria orgânica, transformando-a em húmus, uma associação de matéria orgânica com minerais em 53

73 decomposição. Os padrões do processo de decomposição da matéria orgânica se refletem na forma de húmus. Na Mata Atlântica, são encontradas diferentes formas de húmus (Kindel and Garay, 2002). O solo apresenta grande variedade de nichos e habitats. Os poros do solo, aliado aos agregados particulares oferecem uma ampla variedade de microhabitats, permitindo o desenvolvimento de organismos como insetos, protozoários, fungos e bactérias. Microzonas com alguma aeração podem se formar apenas alguns milímetros de distância de regiões anóxicas. Diferentes áreas podem ser enriquecidas com diferentes compostos orgânicos e inorgânicos, tornando esses ambientes mais ácidos ou básicos de acordo com a variação de aporte dessas moléculas no solo. O solo funciona como um meio de crescimento para as planta superiores, permitindo a fixação e proteção às raízes, provendo nutrientes. O solo é capaz de reter e armazenar a água da chuva e disponibiliza os nutrientes inorgânicos em forma de íons dissolvidos, permitindo sua utilização pelas plantas de forma contínua. O solo funciona como um regulador do suprimento de água uma vez que, de acordo com suas características, pode reter mais ou menos água. Isto influencia no controle dos níveis dos corpos d água como bacias, rios e lagos. Aliado a isto, o solo também pode influenciar a qualidade da água. Processos de lixiviação e run-off podem ocasionar o transporte de nutrientes, ou mesmo substâncias tóxicas para os reservatórios de água. Por outro lado, também podem executar a depuração de águas contaminadas, a partir da retenção de substâncias tóxicas. Isso irá depender das caractterísticas do solo Características do solo Os principais eventos relacionados ao processo de formação do solo são efeitos da atuação do clima e de organismos vivos sobre um material parental ao longo do tempo, sob a influência de uma topografia. O solo pode ser considerado uma interface entre quatro componentes 54

74 fundamentais para a vida. Os quatro principais componentes do solo são matéria orgânica, matéria mineral, água e ar. A proporção relativa desses componentes pode influenciar nas características e na produtividade do solo. A matéria orgânica é representada pelos restos animais e restos vegetais em todos seus estágios de decomposição, apresentando fundamental importância como fonte de matéria orgânica para o solo. A matéria orgânica decompõe-se até constituir o húmus, que é a matéria orgânica na forma coloidal, com características benéficas e atribui ao solo uma coloração mais escura. A matéria mineral do solo é representada pelos minerais constituintes da rocha de origem, e pelos minerais formados como resultado do seu intemperismo. A organização estrutural é bastante heterogênea, essencialmente formada por agregados resultantes da associação da matéria orgânica e mineral de diferentes tamanhos e estabilidade (Tisdall and Oades, 1982). Esses agregados por sua vez, promovem a formação de microhabitats, caracterizados pela presença de diferentes substratos, concentração de nutrientes e água, bem como variações de ph (Ladd et al., 1996). O componente líquido do solo representa uma solução iônica (cátions e ânions). A água fica retida em microporos e é drenada para as camadas mais profundas do solo, pela ação da gravidade, através de macroporos, responsáveis pela aeração. Maiores quantidades de matéria orgânica permitem maior retenção da água no solo. Há uma tendência dos solos mais argilosos em apresentar maiores quantidades de biomassa microbiana capaz de promover maior retenção de umidade, formando complexos organo-minerais ou servindo de tampão às mudanças de ph (Smith and Paul, 1990). A quantidade de água tem uma relação próxima com o conteúdo de ar no solo, uma vez que os poros são preenchidos pela água, desalojando o ar do seu interior. A umidade relativa do ar 55

75 do solo costuma ser próxima de 100 %, a não ser em solos extremamente secos. Além disso, o conteúdo de CO 2 é mais elevado enquanto à concentração de O 2 é menor que a observada no ar atmosférico. Esta tendência é explicada pela atividade metabólica no solo. Um corte seccional vertical do solo revela a presença de regiões distintas, conhecidas por horizontes. A camada mais próxima da superfície do solo é conhecida como Horizonte A, que é rica em matéria orgânica proveniente da decomposição de matéria viva, de plantas e de raízes. As camadas situadas abaixo do Horizonte A apresentam menores níveis de matéria orgânica à medida que se distanciam da superfície e se aproximam da rocha de origem. O material parental influencia em características do solo, como, cor, textura, estrutura, mineralogia e ph. Atualmente, os solos brasileiros estão distribuídos em 14 classes de acordo com a Nova Classificação de Solos (EMBRAPA, 2006). O tipo de solo mais frequente no território brasileiro é o latossolo (Figura 19). Os latossolos são solos comumente encontrados em áreas tropicais. São altamente intemperizados e se caracterizam por apresentar um horizonte mineral composto por uma subsuperfície rica em hidróxidos de ferro e alumínio. Esses tipos de solo apresentam alto teor de argila e baixa capacidade de troca iônica, além de baixa concentração de silicato. A maior parte se forma sob a floresta de Mata Atlântica, sendo submetido às chuvas intensas. Além disso, apresentam baixo teor de nutrientes para plantas, especialmente após a remoção de parte da cobertura nativa. Figura 19. Os latossolos representam um dos tipos mais comumente encontrados no Mata Atlântica. 56

76 A Mata Atlântica A Mata Atlântica é uma formação vegetal brasileira que originalmente acompanhava o litoral do país do Rio Grande do Sul ao Rio Grande do Norte. Nas regiões Sul e Sudeste, chegava até Argentina e Paraguai. A Mata Atlântica apresentava cerca de km², ou cerca de 15% do território nacional, englobando 17 estados brasileiros (Figura 20). Na porção litorânea, a maior parte da Mata Atlântica tem áreas de transição com os ecossistemas que compõem a Zona Costeira. Depois de séculos de exploração madeireira, avanço agrícola e crescimento urbano, mais de 90% da mata original foi destruída (Figura 20). Atualmente, a Mata Atlântica encontra-se extremamente reduzida, sendo uma das florestas tropicais mais ameaçadas do globo.. Figura 20. Cobertura do bioma Mata Atlântica. Aproximadamente 90 % do bioma já foi devastado (Fonte: Atlas dos Remanescentes Florestais da Mata Atlântica. SOS Mata Atlântica e Instituto Nacional de Pesquisas Espaciais INPE. Apesar de reduzida a poucos fragmentos, na sua maioria descontínuos, a biodiversidade de seu ecossistema é uma dos maiores do planeta e declarada pela UNESCO como Reserva da 57

77 Biosfera, um Patrimônio da Humanidade. Nas regiões onde ainda existe, a Mata Atlântica caracteriza-se pela vegetação exuberante, com acentuado higrofitismo. É uma das áreas mais sujeitas a precipitação no Brasil. As chuvas são orográficas, em função das elevações do planalto e das serras. Há subdivisões da mata, devidas a variações de latitude e altitude e possui formações pioneiras. Além disso, vale destacar ainda a existência de sete das nove maiores bacias hidrográficas brasileiras neste bioma A interface com estas áreas cria condições particulares de fauna e flora. Entre as espécies mais comuns encontram-se algumas briófitas, cipós, e orquídeas. Mais de 50% das plantas vasculares conhecidas da Mata Atlântica são endêmicas, ou seja, não ocorrem em nenhum outro lugar no planeta. Estima-se que há no bioma 1,6 milhão de espécies de animais, em sua maioria insetos. A fauna endêmica é formada principalmente por anfíbios, mamíferos e aves das mais diversas espécies. Estima-se que a Mata Atlântica detenha mais que 30 % das espécies existentes no país. Apesar desta grande biodiversidade, das 396 espécies de animais consideradas oficialmente ameaçadas de extinção no Brasil (Instrução Normativa MMA nº 03 de 27 de maio de 2003), 350 são da Mata Atlântica. Do total de 265 espécies de vertebrados ameaçados, 185 ocorrem na Mata Atlântica (69,8%), sendo 100 (37,7%) deles endêmicos. Das 160 aves da relação, 118 (73,7%) ocorrem nesse bioma, sendo 49 endêmicas. Entre os anfíbios, as 16 espécies indicadas como ameaçadas são consideradas endêmicas da Mata Atlântica. Das 69 espécies de mamíferos ameaçados, 38 ocorrem nesse bioma (55%), sendo 25 endêmicas (Ministério do Meio Ambiente, 2007). A Mata Atlântica é um dos 5 hotspots de diversidade na lista de áreas prioritárias de conservação. A maior ameaça ao delicado equilíbrio da biodiversidade é a ação humana através de sua ocupação e os impactos de suas atividades. Os rios e lagos da Mata Atlântica abrigam ainda ricos ecossistemas aquáticos, grande parte deles ameaçados pelo desmatamento 58

78 das matas ciliares e consequente assoreamento dos mananciais, pela poluição da água, e pela construção de represas sem os devidos cuidados ambientais. Parte considerável da Mata Atlântica está conservada sob a forma de parques nacionais e estaduais.. O Parque Nacional da Serra dos Órgãos (PARNASO) é uma região de preservação da Mata Atlântica que foi criada em 1939 para proteger a biodiversidade de parte do trecho da Serra do Mar na região serrana do Rio de Janeiro, envolvendo os municípios de Teresópolis, Petrópolis, Magé e Guapimirim. O PARNASO apresenta florestas de encosta e campos de altitude que variam de 200 a 2.263m de altitude. A grande e brusca variação de altitude criou ambientes únicos e grande diversidade biológica (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis, 2007). A região da Serra dos Órgãos está inserida no domínio morfo-climático Tropical Atlântico. O clima do Parque é tropical superúmido (com 80 a 90% de umidade relativa do ar), com média anual variando de 13º a 23º C (atingindo valores de 38ºC a 5ºC negativos nas partes mais altas). No verão há uma concentração de chuvas, com variação pluviométrica de a mm e no inverno, o período de seca é característico (Instituto Brasileiro do Meio Ambiente e dos Recursos Naturais Renováveis, 2007). A consolidação do Encontro de Pesquisadores do PARNASO, que ocorre anualmente desde 2007, organizado pela direção do parque, mostra a importância do PARNASO como área de estudo em diversas áreas da biologia. Entretanto, a literatura sobre a microbiologia da área do estado fluminense ainda é incipiente e conta com poucos trabalhos abordando a diversidade de microrganismos do estado fluminense. Alguns dos poucos trabalhos realizados com amostras coletadas da Mata Atlântica com enfoque microbiológico consideram a diversidade de bactérias não cultiváveis (Lambais et al., 2006) e o isolamento de grupos bacterianos específicos (Lima-Bittencourt et al., 2007; Semedo et al., 2004; Souchie et al., 2006) 59

79 2. OBJETIVOS 2.1 Objetivo geral Caracterizar a diversidade taxonômica e funcional de comunidades microbianas, demonstrando o potencial biotecnológico da microbiota de diferentes biomas brasileiros. 2.2 Objetivos específicos Caracterizar a diversidade do bacterioplâncton de águas costeiras na América Latina (Caribe ao Atlântico Sul); Caracterizar a diversidade taxonômica e funcional da microbiota aquática dos sistemas de recifes de corais do banco de Abrolhos; Analisar a diversidade de comunidades bacterianas do solo da Mata Atlântica brasileira; Avaliar o potencial biotecnológico do metagenoma do solo da Mata Atlântica para fins de produção de celulase; Estabelecer um panorama sobre o estudo da diversidade microbiana a fim de determinar os tipos microbianos mais frequentes nos biomas brasileiros. 60

80 3. MATERIAIS E MÉTODOS 3.1 Gradiente latitudinal de diversidade do bacterioplâncton da costa da América latina Foram analisados os dados referentes a Puerto Rico, Brasil, Argentina e Uruguai. As amostras e suas localizações foram: Bioluminescent Bay (17 58'18 N '52 W), Guanabara Bay (22 55'43 S '51 W), Amazon estuary (00 42' 26 S ' 18 W), Uruguay Fresh (34 39'48 N '55 W), Uruguay Brackish (34 39'48 N '07 W), Rio de la Plata (36 06'32 S '20 W) e Argentinian Shelf (38 16'59 S '36 W) (Figura 21). Os dados analisados foram depositados no banco do VAMPS (Visualization and Analysis of Microbial Population Structure) (http://vamps.mbl.edu) e disponibilizados pelo IcoMM (International Census of Marine Microbes). Todas as amostras foram submetidas à pirosequenciamento (454) em colaboração com o Laboratório de Biologia Marinha (Woods Hole, MA, EUA) através do Latin American and Caribbean Cooperative Run. 61

81 Figura 21. Localização geográfica dos pontos de coleta ao longo da costa da America Latina. A região V6 do gene rrna foi amplificada por um conjunto de iniciadores contendo 5 versões do iniciador 967 forward e 4 versões do iniciador 1046 reverse foi utilizado (Huber et al. 2007). O pirosequenciamento foi realizado na plataforma GS20 de acordo com o protocolo descrito por Sogin et al. (2006). Sequências de iniciadores e de baixa qualidade foram Brasil Baía de Guanabara removidas, como descrito em Huse et al. (2008). A metodologia Global Alignment for Sequence Taxonomy (GAST) (Sogin, 2006) foi usada para atribuir classificação taxonômica das tags de V6 tags (Figura 22). A GAST compreende um banco de genes rrna de referência com base no banco de dados SILVA (Al Pruesse al. 2007). Após submeter ao BLAST, os 100 melhores hits de cada sequência gerada foram utilizados para compor o banco de dados. A classificação taxonômica foi realizada com a ferramenta Classifier do RDP (Wang, 2007). Sequências com pelo menos 97 % de identidade foram classificadas como OTUs pertencentes à mesma espécie. Esta classificação foi realizada para todos os pares alinhados. As OTUs endêmicas foram aquelas que não apresentaram sequências compartilhadas em outras localidades. Por outro lado, OTUs cosmopolita são aquelas que têm compartilhado mais de sete sequências, com pelo menos uma de cada localidade amostrada. As sequências duplicadas, com cópias exatas, foram removidas das análises por representarem artefatos do sequenciamento. 62

82 Figura 22. Sistema GAST de classificação taxonômica utilizado para implementação de um banco de dados curados da região V6 do gene rrna 16S (Retirada de https://vamps.mbl.edu/) 3.2 Avaliação da saúde do Banco de Abrolhos através da metagenômica Amostras de água de recifes de corais de áreas não protegidas e protegidas (Parque Marinho de Abrolhos) foram coletadas entre janeiro e fevereiro de O DNA foi extraído e o metagenoma foi pirosequenciado e as sequências foram anotadas através de tecnologia de subsistemas. 63

83 3.2.1 Área de estudo e coleta Cinco recifes entre 25 e 70 km da costa foram selecionados para este estudo. Os recifes mais próximos da costa são Sebastião Gomes (17 54'42.49 "/ 39 7'45.94 ), Pedra de Leste (17 47'01.3 "/ 39 03'05") e Timbebas (17 28'42 0,3 "/ 39 01'41.1 ) e os mais distantes da costa são dos Parcel dos Abrolhos (17 57'32.7 "/ 38 30'20.3 ) e California (18 º 06 '7,8 "S/38 º 35' 26,0") foram o foco desta pesquisa (Figura. 23). Os recifes desprotegidos são locais próximos de comunidades de pescadores e outras comunidades humanas. Por outro lado, Parcel dos Abrolhos e California estão completamente dentro do Parque Nacional de Abrolhos, e o acesso é restrito e controlado pelo governo brasileiro. Os três recifes próximos da costa estão desprotegidos e estão submetidos à pesca intensiva, inclusive o recife de Timbebas que, teoricamente, está dentro de uma área de proteção marinha do Banco de Abrolhos. Amostras de água foram coletadas próximas a superfície (<1 m) de corais do recife, entre 6 e 10 m de profundidade em Sebastião Gomes, e aos 20 m nos recifes de Timbebas Parcel dos Abrolhos e em California. Cerca de 20 litros de água foram coletados em garrafas previamente lavadas com água de superfície (Figura. 24). Parte da água coletada foi utilizada na extração de DNA e outra nas análises físico-químicas, realizadas pelo Laboratório de Hidrobiologia da UFRJ. Em janeiro de 2010, amostras do recife Pedra de Leste foram coletadas a 10 m de profundidade em vez do recife California por causa de condições meteorológicas instáveis. 64

84 Figura 23. Região do Banco de Abrolhos e os pontos de coleta. Em azul, as áreas não protegidas e em vermelho as áreas protegidas. As linhas vermelhas representam os limites do Parque Marinho de Abrolhos (Foto: Pedro Meirelles). Figura 24. Mergulhador coletando a água dos recifes de Abrolhos a aproximadamente 20 m de profundidade (Foto: Ronaldo Francini-Filho). 65

85 3.2.2 Extração do DNA metagenômico da água do mar Quatro repetições independentes da água do mar foram filtradas através de redes de 100 mm e 20 mm por gravidade. A água pré-filtrada foi filtrada através de Sterivex (0,22 µm) (Millipore). Entre 2 e 4 litros foram filtradas em cada filtro Sterivex. A filtração foi realizada por pressão positiva aplicada ao sistema de garrafas Niskin (Figura 25) A B Figura 25. Sistem de filtração Niskin. A) Sistema de filtração com os filtros Sterivex já acoplados. B) Filtros Sterivex durante o processo de filtração (Foto: Rodrigo Moura). O material coletado nos filtros foi preservado com aproximadamente 1,5 ml de tampão SET (sacarose 20%, 50 mm EDTA e 0,5 mm Tris-HCl, ph 7.6). A extração do DNA foi realizada no interior do Sterivex. Os procedimentos de extração do DNA estão no anexo 7.1, item Pirosequenciamento dos metagenomas do Banco de Abrolhos O sequenciamento dos metagenomas foi realizado utilizando a tecnologia de pirosequenciamento (Margulies et al., 2005). Bibliotecas foram geradas através de fragmentação mecânica do DNA em pedaços na faixa de 400 a 2000 pb (shotgun library). Após a ligação ao adaptador, os fragmentos foram desnaturados e amplificado por PCR em 66

86 emulsão (empcr). Os produtos de amplificação foram sequenciados no sistema 454 GS FLX (Roche, Life Sciences) através da química de sequenciamento GS FLX Titanium. As principais etapas de preparação do pirosequenciamento são: purificação e quantificação do DNA metagenômico, preparação das bibliotecas, empcr, quebra das emulsões, enriquecimento e sequenciamento. Todas as reações foram preparadas com kits para de volume médio (MV). Esta seção apresenta os procedimentos realizados Purificação e quantificação do DNA metagenômico A quantificação do DNA metagenômico representa uma etapa crítica para a construção das bibliotecas. Por isso, a concentração deve ser medida por fluorímetria através do método PicoGreen (Invitrogen), um corante que apresenta alta sensibilidade e especificidade pelo DNA de fita dupla (Ahn et al., 1996). Outros métodos (ex. espectrofotometria) podem superestimar a concentração, levando a uma biblioteca de baixa qualidade. A quantificação foi realizada utilizando o método PicoGreen Preparação de bibliotecas pelo método shotgun O protocolo (Rapid library preparation kit) parte de 500 ng de DNA metagenômico para produzir fragmentos de fitas através de nebulização com nitrogênio em alta pressão. Esses fragmentos são reparados por atividade DNA polimerase e adição de fosfato, produzindo extremidades com cortes retos (blunt end). Dois adaptadores (A e B) são ligados às pontas reparadas dos fragmentos de DNA. O adaptador A apresenta um iniciador do sequenciamento e o adaptador B apresenta uma molécula de biotina. Os procedimentos realizados para a construção das bibliotecas estão no anexo 7.1, item Após a fragmentação do DNA foi utilizado o Mini eluate PCR purification kit (Qiagen) para purificar os fragmentos. 67

87 Quantificação e checagem da qualidade da fragmentação das bibliotecas A quantificação da biblioteca foi feita por fluorometria. É necessário fazer uma curva padrão utilizando os padrões do kit (rapid library preparation). Com isso, foi determinada a concentração das bibliotecas e o volume necessário para os ensaios de empcr. A checagem da qualidade da fragmentação das bibliotecas foi realizada através de eletroforese em chip (Bio Analyzer 2100, Agilent Technologies), utilizando DNA LabChip (Agilent Technologies). Os procedimentos realizados para a quantificação estão no anexo 7.1, item Reação em cadeia da polimerase em emulsão (em-pcr) O em-pcr ocorre em um ambiente microfluídico onde os reagentes ficam limitados ao interior de micelas da emulsão. Desta forma, ocorre a reação de amplificação dos fragmentos de DNA ligados as esferas revestidas por streptavidina pelo adaptador B (biotina). Apenas as esferas que apresentarem um, e somente um, fragmento de DNA será capaz de gerar sequências. Os procedimentos realizados para a montagem das reações para em-pcr de estão no anexo 7.1, item Quebra da emulsão (break emulsion) Após a amplificação é necessário recuperar as esferas contendo os produtos de amplificação (haired esferas) para realizar a quebra das emulsões e retirada do óleo emulsificado. As seções a seguir descrevem como deve ser realizado o processo de quebra das emulsões. Os procedimentos realizados para a quebra das emulsões estão no anexo 7.1, item

88 Enriquecimento (Enrichment) As esferas recuperadas são contadas (utilizando contador de partículas) no início e após o procedimento de enriquecimento. Nesta etapa são eliminadas as esferas que falharam na amplificação e que, portanto não contém DNA amplificado ligado à superfície. A faixa de enriquecimento utilizada foi de 5 20 % das esferas que iniciaram o em-pcr. Os procedimentos realizados para o enriquecimento estão no anexo 7.1, item Preparação e sequenciamento A última etapa do sequenciamento pode ser dividida em duas partes principais: a preparação da placa Pico Tilter Plate (PTP) onde são depositadas as esferas e ocorre o sequenciamento de fato e a preparação do sequenciador GS FLX 454 e seus reagentes que serão consumidos durante o procedimento. Foi utilizado ¼ de placa por amostra. Antes de preparar as DNA e Control beads, foi preciso calcular o volume de esferas (DNA beads) necessárias para ocupar os 4 quartos da placa, ou seja, aproximadamente esferas. Foi utilizado o volume de sobrenadante necessário para reduzir o volume de DNA beads para 20 µl. Foi utilizado o seguinte programa: 1 ciclo de 4 minutos a 94 C; 50 ciclos por 30 segundos a 94 C, 4,5 minuto a 58 C, 30 segundos a 68 C (rampa de aquecimento: 1,5); 10 C em espera Os procedimentos detalhados para a preparação da corrida estão no anexo 7.1, itens e Análises Computacionais dos metagenomas da água dos recifes do Banco de Abrolhos Os metagenomas foram submetidos no MG-RAST com os seguintes números de acesso: 8181 (Sebastião Gomes 2009); 7673 (Timbebas 2009); 7309 (California); 7376 (Parcel dos 69

89 Abrolhos 2009); (Sebastião Gomes 2010); (Timbebas 2010); (Pedra de Leste); (Parcel do Abrolhos 2010) Filtragem das sequências de baixa qualidade A checagem da qualidade e filtragem de sequências de baixa qualidade foram realizadas utilizando programa PRINSEQ (Schmieder and Edwards, 2011), disponível na rede através do endereço Arquivos nos formatos FASTA e QUAL são utilizados como entrada para a análise. O programa oferece um resumo estatístico de características como tamanho das sequências, conteúdo GC, distribuição dos scores de qualidade, número de duplicatas, ocorrência de N e cauda poli-a/t. Os filtros oferecidos pelo programa são capazes de remover sequências curtas, de baixa qualidade com grande quantidade de N e homopolímeros. As sequências menores que 100 pb e aquelas que continham N e homopolímeros (repetição de pelo menos 20 nucleotídeos ou dinucleotídeos) foram retiradas das análises. Além disso, foram retiradas todas as duplicatas, que são artefatos gerados durante diferentes etapas do processo de sequenciamento. Esses artefatos podem ocorrer quando uma molécula de DNA amplificado pode se ligar a uma esfera vazia durante o em-pcr, ou quando o sinal ótico de um poço interfere em um vazio adjacente (Gomez-Alvarez et al., 2009) Anotação dos metagenomas pela tecnologia de subsistemas Os metagenomas foram anotados pelo servidor MG-RAST (MetaGenomic Rapid Annotation by Subsystem Technology) (Meyer et al., 2008). Apesar dos esforços ainda concentrados na anotação de um genoma único, a análise comparativa das variações de um único componente da maquinaria celular e seu contexto genômico em uma coleção de genomas completos e curados permite uma anotação mais rápida e acurada. Um subsistema é um conjunto de papéis funcionais que, juntos, implementam um determinado processo biológico ou estrutural 70

90 (Overbeek et al., 2005). Cada subsistema é curado por um grupo de cientistas especializados em vias metabólicas específicas, estabelecendo quais os principais genes envolvidos e sua arquitetura genômica. Dados no formato gerado pelo GS 454 FLX e arquivos FASTA podem ser carregados no servidor. O fluxo de informações, bem como a interação com os dados e ferramentas de análise ocorre dentro de um ambiente virtual (SEED). Este ambiente abriga o servidor RAST que contém um banco de genomas completos anotados, bem como a lista de subsistemas já caracterizados. As proteínas que compõem os subsistemas formam famílias de homólogos isofuncionais (FIGfam Fellowship Interpretation of Genomes family) (Gerlt and Babbitt, 2001). Sendo assim, existem 3 componentes principais que tornam essa estratégia de anotação rápida e acurada: o servidor RAST, os subsistemas e as FIGfam. Após carregar os dados, foi gerado um número identificador para cada sequência. Em uma segunda etapa, as sequências foram submetidas a um BLASTX contra um banco de dados não-redundante no SEED com e-value A partir desses resultados é possível realizar uma análise taxonômica e funcional. A análise taxonômica é baseada na correlação entre as proteínas identificadas e seu organismo de origem nos bancos de dados, permitindo o cálculo da abundância relativa de cada táxon identificado. A classificação funcional das proteínas de genes codificantes é calculada pela projeção das FIGfam, baseada na similaridade das buscas Análises comparativas As análises comparativas foram realizadas baseadas nos perfis taxonômicos e funcionais gerados pelo MG-RAST. As tabelas em formato.tsv foram utilizadas como arquivo de entrada para o programa STAMP (Statistical Analysis of Metagenomic Profiles). O STAMP é um programa que suporta práticas de análises estatísticas para metagenômica comparativa. 71

91 Foi realizado teste exato de Fisher (two-side) com valor de p < 0,05 e intervalo de confiança de 95 %, calculado pelo método Newcombe-Wilson. Neste caso, o teste exato de Fisher visa verificar se o número de sequências relativas a um subsistema ou táxon é equivalente em dois metagenomas diferentes. O intervalo de confiança fornece a mesma informação que é geralmente contido em um teste de significância. A classificação de patogenicidade foi atribuída com base nas informações disponíveis para genomas de organismos microbianos no National Center for Biotechnology Information (NCBI, A classificação de organismos autotróficos / heterotróficos não está disponível online em uma única fonte. Portanto, um sistema de classificação do estado trófico (autotrófica e heterotrófica) foi desenvolvido com base no filo dos organismos identificados nas amostras. Todos os organismos decorrentes do mesmo filo foram definidos como tendo o mesmo tipo trófico. Por exemplo, Proteobactérias podem crescer como heterótrofos ou autótrofos facultativos, dependendo das condições ambientais, mas eles foram classificados como heterótrofos neste trabalho para permitir uma classificação única para cada filo. Os parâmetros físico-químicos foram submetidos a análises estatísticas. A Análise de Variância (ANOVA de ANalysis Of VAriance ) é utilizada com o propósito de modelar a média de diferentes grupos. O modelo de Análise de Variância permite testar se as médias entre os diferentes grupos apresentam diferença significativa. Porém não nos permite indicar entre quais grupos de fato ocorreu diferença significativa. Desta forma, os testes de comparação de médias funcionam como um complemento para o estudo da análise de variância (são chamados de testes post-hoc, ou testes a posteriori, por serem utilizados após a comparação por ANOVA). Frequentemente é possível determinar quais médias diferem testando as diferenças entre todos os pares de médias de tratamentos. O teste de Tukey foi o procedimento utilizado para construir intervalos de confiança de diferenças entre todos os 72

92 pares de médias. Em alguns casos, os dados coletados não foram suficientes para possibilitar o uso do método para comparação das localidades, e em alguns outros a variabilidade foi muito pequena, o que também não possibilita o uso do método estatístico. As análises estatísticas foram realizadas em colaboração com os alunos Paulo Dick e Felipe Veiga sob supervisão da Professora Marina Silva Paez do Instituto de Matemática da UFRJ. 3.3 Diversidade Microbiana do solo da Mata Atlântica O metagenoma dos solos da Floresta da Mata Atlântica foi acessado para avaliação da diversidade taxonômica e funcional da microbiota. Para isso, foram construídas bibliotecas do gene rrna 16S, marcador filogenético, e outra de médios insertos clonados aleatoriamente para busca de atividade celulolítica. Os clones foram sequenciados automaticamente pelo método de Sanger através do sistema 3130 (Applied Biosystems). Esta seção apresenta os experimentos realizados com as amostras coletadas no Parque Nacional da Serra dos Órgãos (PARNASO) em junho de Área de estudo e coleta O Parque Nacional da Serra dos Órgãos (PARNASO) é uma região de preservação da Mata Atlântica que fica localizado no estado do Rio de Janeiro, entre 22º 52 e 22º54 S e 42º09 W (Figura 26). Em julho de 2007, 6 amostras de solo contendo características edáficas distintas foram coletadas. Foram realizadas coletas em pontos distribuídos ao longo da trilha da Travessia Petrópolis-Teresópolis localizada no PARNASO (figura 26). Os pontos de coleta foram definidos baseados na classificação de solos da EMBRAPA. As amostras escolhidas são representativas dos principais tipos de solo que compõem a Mata Atlântica brasileira (Martins et al., 2007). Os solos coletados nas regiões 1 e 2 (Bonfim) são os mais prevalentes no solo do PARNASO. O solo foi obtido de uma profundidade máxima de 11 cm, peneirado (2 mm de diâmetro) para remoção de partículas grandes e acondicionado em sacos plásticos 73

93 estéreis, sendo processado menos de 12 h após a coleta. As análises químicas e microbiológicas foram realizadas a partir das amostras de solo coletadas do campo. As análises químicas do solo, assim como os mapas georeferenciados, foram realizadas em colaboração com Professor Eder Martins, na Empresa Brasileira de Pesquisa Agropecuária (Embrapa), no Centro de Pesquisa Agropecuária dos Cerrados (Cpac), de acordo com padrões estabelecidos (EMBRAPA, 2006). Figura 26. Mapa do Parque Nacional da Serra dos Órgãos com a localização geográfica dos pontos analisados. 74

94 3.3.2 Construção de bibliotecas de rdna 16S das comunidades microbianas dos solos do PARNASO Um dos principais desafios na construção de uma biblioteca de rdna 16S é a obtenção de DNA de alta qualidade. Muitos microrganismos do solo estão intimamente associados com a matriz orgânica das partículas do solo, e produzem substâncias poliméricas extracelulares que promovem a adesão irreversível das células às partículas do solo (Amorim et al., 2008; Robe et al., 2003) Extração do DNA metagenômico A extração do DNA metagenômico dos 6 solos foi realizada utilizando o kit comercial Mo Bio Power soil. As extrações foram realizadas em triplicata para cada solo, utilizando 0,25g por amostra e a eluição do material foi realizada em 100µL. A efetividade da extração foi verificada em gel de agarose 1% em TBE 1X; 90 V / 45 min. A quantificação foi realizada através de biofotômetro no qual a qualidade do DNA foi verificada através do resultado da razão dos comprimentos de onda 260/280 nm, que correspondem à contaminação por proteínas. A concentração média obtida foi de 120 ng/µl de DNA e o grau de pureza variou entre Os procedimentos detalhados para concentração e purificação do DNA estão no anexo 7.1, item Amplificação do gene rrna 16S A reação de PCR para amplificação do gene rrna 16S foi realizada utilizando-se iniciadores desenhados para o anelamento em regiões conservadas dentro de rrna 16S específicos para o domínio Eubacteria, gerando fragmentos de aproximadamente 1,5kb. O programa utilizado foi: 95º C por 3 minutos; seguido de 25 ciclos de 95º C por 1 minuto, 51º C por 1 minuto e 30 segundos, 72º C por 3 minutos. A extensão final ocorre na temperatura de 72º C por 30 75

95 minutos. Reação: 10, 8 L água milli Q; 2 L Tampão 10X; 2 L dntp (10mM); 2 L BSA 10X; 1 L PR (5mM); 1 L PF (5mM); 0,2 L Taq (5U/µL); 1 L DNA (50ng) para um volume total de 20 L. As sequências dos iniciadores são: PF: 27F 5 - AGA GTT TGA TCM TGG CTC 3 e PR: 1492R 5 - GGY TAC CTT GTT ACG ACT 3. Para obtenção de grande quantidade de fragmentos e, assim, maximizar a cobertura da diversidade, 10 reações para cada solo foram posteriormente concentradas. Foram utilizados 100 ng do DNA metagenômico por reação. Após a verificação do material amplificado, uma corrida em gel de agarose 1% TAE 1X foi realizada para sacar as bandas correspondentes aos produtos de amplificação do gene rrna 16S. A purificação foi realizada com kit comercial Ultra Clean DNA Purification (Mo Bio). A efetividade da purificação foi verificada em gel de agarose 1% TBE 1X Clonagem dos genes rrna 16S O vetor de clonagem utilizado foi o pgem-t easy (Promega) (Figura 27). O vetor comercial se apresenta linearizado, com uma eficiente região de ligação única 3 - timidina terminal para produtos de PCR. Este vetor apresenta alto número de cópias e contém os promotores T7 e SP6 RNA polimerase flanqueando o sítio múltiplo de clonagem, que está localizado em uma região de codificação de um α-peptídeo da enzima β-galactosidase. Uma vez que as linhagens de células utilizadas na transformação apresentam deleção da subunidade α da enzima β- galactosidase, a inativação por inserção do produto de PCR nesta região permite a identificação de recombinantes. Os recombinantes são selecionados pela resistência a ampicilina (em meio S-gal + ampicilina (100 µg / µl) A perda de função do gene é indicada por alterações colorimétricas nas colônias bacterianas, indicando a inserção (colônias brancas) ou não (colônias pretas) do fragmento de interesse em meio contendo substrato adequado. 76

96 Figura 27. Vetor de clonagem pgemt Easy Sistema de ligação O sistema de ligação consiste nos produto de amplificação do rrna 16S concentrado e purificado, ligados ao plasmídeo vetor de clonagem pgemt easy (Promega). A reação foi incubada por 16 horas a 16 C e depois a enzima foi inativada a 65 C por 20 minutos. Os procedimentos detalhados para a montagem da reação e precipitação do sistema de ligação estão no anexo 7.1, item Preparação de células eletrocompetentes Células da linhagem E. coli EPI300 foram utilizadas nos experimentos de transformação e clonagem. Todo material utilizado durante o procedimento (ponteiras, tubos e soluções) foi colocado em freezer ou geladeira para garantir a eficiência do procedimento. As células devem permanecer em gelo enquanto não estiverem sendo manuseadas e todo o procedimento deve ser realizado em ambiente estéril. O protocolo detalhado bem como a composição dos meios LB e GYT está no anexo 7.1, item

97 Transformação A transformação foi realizada com eletroporação a 1,8kV de corrente, em cubas de 1mm de distância entre os eletrodos. O tempo de passagem da corrente variou entre 4 e 6 milissegundos. Foram utilizados 5μL do sistema de ligação precipitado (o restante foi estocado em freezer) em 50 μl de células competentes. Após eletroporação, as células foram recuperadas em 900 μl meio SOC e incubadas durante 1 h a 37 C. Posteriormente, as culturas foram plaqueadas (100 μl) em meio S-Gal (Sigma Aldrich) para seleção dos clones positivos Montagem das bibliotecas e estocagem dos clones Após o crescimento dos clones em placa contendo meio S-gal, as colônias brancas foram coletadas aleatoriamente e inoculadas individualmente em placas de 96 poços utilizando palitos estéreis. Cada poço continha 130 μl de meio LB com ampicilina numa concentração final de 300 μg/ml do antibiótico. As placas foram incubadas 37 C durante a noite. O crescimento foi observado através da formação de botões no fundo da placa devido à decantação das células. As células foram ressuspendidas com 50 μl de glicerol 50 %, antes de estocá-las a -80 C Confirmação dos clones Foram escolhidas colônias por placa e crescidas em meio LB suplementado com ampicilina durante 18 horas. A extração plasmidial foi realizada com o kit QIAprep spin miniprep (Qiagen). A confirmação da presença dos insertos foi realizada pela amplificação de fragmentos de aproximadamente 1,4 kb utilizando iniciadores que se anelam aos flancos do plasmídeo vetor. 78

98 Programa utilizado: 95 C 3 minutos para desnaturação inicial; 95 C 1 minuto; 50 C 1 minuto e 30 segundos (25 vezes); 72 C 2 minutos 30 segundos; com extensão final a 72 C por 15 minutos. Reação: 10 μl água milliq; 2 μl Tampão 10x; 1,6 μl dntp (10mM); 0,5 μl BSA 10 x; 2 μl PR (5mM); 2 μl PF (5mM); 0,4 μl Taq (5U/μL); 1 μl DNA (50ng), para um volume total de 20 μl. As sequências dos iniciadores são: PF - SP6 5 - TACGATTAGGGACGTATAG 3 e PR - T7 5 GTAATAGGACTCACTATAGGG Extração plasmidial em placa As extrações plasmidiais para sequenciamento foram realizadas através do método da lise alcalina em placas de 96 poços. O procedimento detalhado, bem como a preparação das soluções e meios, está no anexo 7.1, item Sequenciamento dos clones A partir dos plasmídeos extraídos por lise alcalina em placa de 96 poços, 1-5 µl da amostra foram misturados com 1-3 µl de ABI Prism Big Dye Terminator ready reaction mix, versão 3.1 (Applied Biosystems), 3 µl de iniciadores de sequenciamento (4 µm), 1,5 µl de tampão de diluição (5 X) e 1,5 µl de água milliq. O programa consiste de 30 ciclos de 15s a 96º C, 1s a 35º C e 4 min. a 60º C. A separação dos fragmentos de DNA foi realizada com ABI PRISM 3100 genetic analyzer (Applied Biosystems) Análises Computacionais de Sequências do gene rrna 16S do solo da Mata Atlântica As sequências geradas foram depositadas no NCBI com os números de acesso: FJ FJ As sequências representativas das OTUs mais frequentes forma depositadas com os números GU GU

99 Filtragem de sequências Quimeras foram identificadas através do identificador Bellerophon (http://greengenes.lbl.gov/cgi-bin/nph-bel3_interface.cgi). Quimeras são produtos de PCR originados por mais de uma fita de DNA molde e se formam durante a amplificação, quando a síntese das sequências de um modelo é interrompida e continua em outro. Uma janela de 300 pb foi utilizada para detectar as quimeras e o modelo de correção Huber-Hungeholtz foi aplicado. Índices de qualidade phred foram calculados para as bases das sequências geradas. Esse índice determina a probabilidade de uma base ter sido incorporada incorretamente (Ewing and Green, 1998). As análises foram realizadas com o programa Phred/Prhap disponível em As sequências com phred menor que 20 (probabilidade de 1 erro a cada 100 bases incorporadas) e com menos que 400 pares de base foram retiradas das análises. Além disso, homopolímeros e sequências com mais de 2 % de N (base não identificada) foram identificados e retiradas manualmente das análises Estrutura das comunidades microbianas (classificação taxonômica) A classificação taxonômica das sequências do gene rrna 16S foi realizada através de buscas no Ribosomal Database Project (RDP) versão 9.21 (Cole et al., 2005). O RDP fornece à comunidade científica, dados, ferramentas e serviços de análise e inferência filogenética de sequências de RNA ribossômico através do site O banco de dados é composto por mais de 100 mil sequências do gene rrna 16S alinhadas e anotadas. O RDP oferece a ferramenta Classifier (Wang et al., 2007), baseado em inferência Bayesiana simples, que permite a classificação rápida e precisa das sequências de rrna 16S de acordo com a taxonomia proposta no Bergey s Manual. Foi utilizado o limite de 80% de confiança na 80

100 análise das sequências de rrna 16S da microbiota dos solos da Mata Atlântica. As sequências identificadas abaixo do limite de confiança estabelecido foram classificadas como Unclassified. Esta classificação é qualificada de acordo com o limite do nível taxonômico identificado (ex. Unclassified Proteobacteria e Unclassified Alphaproteobacteria) Estimativa de riqueza e diversidade A sequências foram alinhadas pelo programa MEGA4 (Tamura et al., 2007) utilizando o algoritmo clustalw. O alinhamento foi checado e otimizado manualmente e foram retiradas possíveis sequências de baixa qualidade (contendo N s, homopolímeros e sequências muitos gaps). As matrizes de distância dos alinhamentos foram geradas pelo programa BioEdit e convertidas para o formato.phy, que corresponde ao formato de entrada para o programa DNADIST do pacote de ferramentas Phylip para análises filogenéticas (Felsenstein, 1989). As matrizes foram utilizadas como arquivo de entrada para o programa DOTUR (Distance based OTU Richness) (Schloss and Handelsman, 2005). DOTUR agrupa as sequências em diferentes níveis de OTUs (Operacional Taxonomic Unity - Unidade taxonômica Operacional), baseado na homologia entre as sequências do gene rrna 16S. O agrupamento foi determinado pelo algoritmo do vizinho mais distante (furthest neighbor clustering). A frequência das OTUs em diferentes níveis de distância genética (97, 90 e 80% de similaridade entre as sequências do gene rrna 16S) foi utilizada para a construção de curvas de rarefação. A técnica de Rarefação consiste em calcular o número esperado de espécies em cada amostra para um tamanho de amostra padrão. A obtenção de uma curva desse tipo permite a comparação de amostras, mesmo que com intensidades amostrais diferentes. O número esperado de espécies é obtido pela equação: 81

101 Onde E(S) é o número esperado de espécies em uma amostragem aleatória, S é o número total de espécies registradas, N é o número total de indivíduos registrados, Ni é o número de indivíduos da espécie i, e n é o tamanho padronizado da amostra escolhido. As OTUs mais frequentes foram definidas como grupos de pelo menos 6 sequências com mais que 97 % de similaridade entre os genes rrna 16S. O estimador de riqueza não paramétrico Chao 1 foi calculado nos mesmos níveis de distância genética das análises de rarefação. É baseado na abundância de OTUs únicas (singletons) e raras (doubletons) para estimar a diversidade de uma população de tamanho desconhecido. O cálculo foi realizado de acordo com a equação: Onde S Chao1 é a estimativa de riqueza, S obs é o número de espécies observadas, n 1 é o número de OTU representada por apenas um indivíduo e n 2 é o número de OTU representadas por apenas dois indivíduos. O índice de Shannon é utilizado em situações em que uma comunidade inteira não pode ser inventariada. Seu cálculo leva em consideração que as espécies apresentam abundâncias diferentes. O índice foi calculado de acordo com a equação: 82

102 Onde S obs é o número de espécies observadas, S i é o número de sequências da OTU i e N é o número de sequências amostradas. A identidade entre as bibliotecas foi verificada utilizando o programa -LIBSHUFF (Schloss et al., 2004), que realiza o teste estatístico Cramer-von Mises. A aplicação deste teste em um par de bibliotecas exige duas comparações para determinar se as bibliotecas são um subconjunto ou independentes umas das outras. O programa utiliza a matriz de distância gerada pelo programa DNADIST. As bibliotecas foram comparadas utilizando sorteios, p < e 95 % de intervalo de confiança Análises filogenéticas Para a reconstrução filogenética foram selecionadas sequências representativa para cada uma das OTUs mais frequentes definidas pelo DOTUR. Essas sequências foram submetidas à busca por similaridade no GenBank (http://www.ncbi.nlm.nih.gov) e no RDP para a determinação dos vizinhos filogenéticos mais próximos. As buscas foram realizadas através de alinhamento local (BLAST) e através da ferramenta SeqMatch, respectivamente. Foram identificados tanto os microrganismos mais próximos não cultivados como os cultivados. O número de acesso das linhagens tipo mais próximas foi obtido com base na lista de nomes validados publicada no LPSN (List of Prokaryotic names with Standing in Nomenclature) (Tindall et al., 2006). Isso permitiu o uso de linhagens tipo caracterizadas e validadas taxonomicamente como âncoras filogenéticas nas árvores. As sequências das bibliotecas somadas àquelas dos vizinhos filogenéticos mais próximos foram submetidas a alinhamento no programa MEGA4 através do algoritmo ClustalW (Thompson et al., 1994). As reconstruções filogenéticas, bem com as matrizes de distância foram geradas com a opção de deleção completa. O modelo de reconstrução das árvores filogenéticas utilizado foi o Neighbor Joining (Saitou and Nei, 1987). As árvores foram 83

103 construídas utilizando a distância correta de Jukes & Cantor, com base em uma matriz de similaridade calculada através da distância p (análise par a par). A topologia da árvore filogenética não enraizada resultante foi analisada com um valor de bootstrap baseado em 1000 réplicas Construção da biblioteca metagenômica de médios insertos A biblioteca metagenômica foi construída para a triagem de clones com atividade celulolítica. Fragmentos na faixa de 4 12 Kb foram clonados em plasmídeo pcf430 (Newman and Fuqua, 1999) que apresenta resistência a tetraciclina e um sítio PstI de clonagem adjacente ao gene promotor arac (Figura 28). O plasmídeo pcf430 é um vetor de ampla variedade de hospedeiros de aproximadamente 10 kb (Figura 28) e apresenta uma origem de replicação e capacidade de conjugação. Ele apresenta um promotor P BAD associado ao regulador arac, que são comumente utilizados para controlar a expressão de genes em E.coli. Figura 28. Plasmídeo pcf Extração e purificação do DNA metagenômico O DNA foi extraído de 5 g (aprox. 0,8 g de cada amostra) da mistura dos 6 tipos de solo coletados através de lise mecânica, utilizando esferas de vidro ( mícrons), aliado ao tratamento com CTAB (brometo de hexadecilmetilamônio) e SDS (dodecil sulfato de sódio). A eficiência da extração foi analisada em gel de agarose a 1% em TBE 1X (p/v). Em seguida, foi construído um gel para a excisão das bandas contendo os fragmentos de DNA com o 84

104 tamanho esperado. Os fragmentos foram purificados com o kit Ultra Clean DNA purification (Mo Bio). O procedimento detalhado de extração e purificação do DNA metagenômico dos solos está no anexo 7.1, item Preparação do vetor de clonagem pcf430 O plasmídeo pcf430 foi obtido através de Max Prep utilizando Qiagen Plasmid Maxi kit (Qiagen) a partir de 50ml de cultura de células. A verificação da extração foi realizada através de gel de agarose 1 % TBE 1X. Após extração o plasmídeo foi linearizado com enzima de restrição EcoRI, A reação foi incubada a 37 º C durante 4 horas e posteriormente a 65 º C por 20 minutos. A verificação da linearização do plasmídeo foi realizada através de gel de agarose 1 % TBE 1X. Após linearização, o plasmídeo foi tratado com fosfatase alcalina (SAP Shrimp alcaline phosphatase) para retirada dos resíduos de fosfato que permanecem na molécula de DNA após a ação da endonuclease. Os, os vetores foram submetidos à eletroforese em gel de agarose Low melting 1% TAE 1X (sem brometo de etídeo) durante 4 horas e baixa voltagem (aprox. 40 V). A banda referente ao plasmídeo circularizado é sacada do gel e usando sistema comercial Qiaex II (Qiagen). A verificação da obtenção do plasmídeo pcf430 tratado e pronto para ser utilizado nos experimentos de clonagem foi realizada em gel de agarose 1% TBE 1X. As reações utilizadas para a preparação do vetor estão no anexo 7.1, item Preparação dos médios insertos O DNA metagenômico foi submetido a ensaios de restrição parcial com a enzima PstI e em seguida tratado com fosfatase alcalina para a retirada dos resíduos de fosfato, permitindo a clonagem de fragmentos de aproximadamente 10 kb no plasmídeo vetor pcf

105 Após a purificação, o DNA metagenômico foi submetido à digestão parcial pela enzima de restrição PstI. A região do gel correspondente aos fragmentos de 4 10 Kb foi purificada com Ultra Clean DNA Purification (Mo Bio). Foi realizada reação de ligação entre os insertos de 4 10 Kb purificados com o plasmídeo pcf430 tratado. A transformação foi realizada conforme a seção , e os clones foram plaqueados em meio LB contendo tetraciclina (40 mg / ml). A qualidade da biblioteca foi avaliada através de extração plasmidial (QIAprep Spin Miniprep Kit - Qiagen) de colônias escolhidas aleatoriamente para reações de restrição com EcoRI. A digestão foi verificada em gel de agarose 1 % TBE 1 X. Os clones plaqueados em meio LB foram reunidos e fracionadas em alíquotas de 1 ml em criotubos após adição de 1/3 de glicerol. O banco metagenômico foi estocado a 80 º C. As reações de digestão parcial e clonagem dos insertos estão no anexo 7.1, itens e Análise funcional da Biblioteca Metagenômica do solo da Mata Atlântica Clones de E.coli da linhagem EPI300, transformadas com plasmídeos (pcf430), contendo insertos variando entre 4 e 10 kb foram selecionados para busca de atividade celulolítica. A seleção foi realizada em meio mínimo contendo carboximetil celulose (CMC) e a atividade celulolítica foi avaliada pelo aparecimento de halos de degradação associado ao crescimento bacteriano. A determinação da atividade enzimática foi realizada para as atividades FPásica (feita com papel de filtro), β glicosidásica (feita com celobiose 2%) e CMCásica (ou endoglucanásica, feita com CMC 2%). As análises foram realizadas a partir dos estoques preservados a - 80 C. 86

106 Triagem de clones com atividade celulolítica Na triagem para verificação da degradação de celulose, o revelador de vermelho congo foi adicionado a fim de se avaliar a extensão e a intensidade das zonas hidrolíticas formadas (Teather and Wood, 1982). Foram adicionados aproximadamente 10 ml de solução aquosa de Vermelho Congo a 0,1%, as quais ficaram em contato com o meio por aproximadamente 5 minutos. Em seguida, o excesso de vermelho congo foi removido, e as placas foram lavadas por até 3 vezes com 15 ml de tampão fosfato ph 7,0 a 50 mm com 1M de NaCl. As regiões onde ocorreu a degradação de celulose, foram evidenciadas pelo aparecimento de zonas claras (halos de degradação) pois o corante vermelho congo deixava de se associar em função de sua especificidade por ligações do tipo β- 1,4 glucose. O procedimento de reativação dos clones bem como a composição do meio CMC está no anexo 7.1, item Determinação da atividade celulolítica As curvas de crescimento foi construída com o objetivo de determinar a fase log de crescimentos dos clones onde ocorre maior atividade metabólica das células, e com isso maior produção de celulases. Os ensaios para determinação das atividades Fpásica, CMcásica e ß-glicosidásica estão nos anexos 7.1, itens , e Curva de crescimento A As curvas foram realizadas em triplicata e medições da densidade ótica da cultura e alíquotas do sobrenadante foram coletados a cada 3 horas em um total de 16 h de crescimento em paralelo com a contagem das unidades formadoras de colônias (CFU) em meio CMC. A biomassa foi calculada ao final do crescimento submetendo as culturas (2 ml) à centrifugação (14000rpm) durante 5 minutos e secagem do material a 55 C por aproximadamente 3 dias. 87

107 Atividade FPásica (celulose total) Pedaços de folha de papel de filtro Watmann nº 1 (1x6 cm) foram utilizados como substrato. Os experimentos foram realizados em duplicata e duas reações controle e um branco foram utilizados nos ensaios Atividade CMCásica (endoglucanásica) O substrato utilizado foi solução CMC 2 %. Os experimentos foram realizados em duplicata e duas reações controles e um branco foram utilizados nos ensaios e preparados da seguinte maneira: Atividade β-glicosidásica O substrato utilizado foi solução de celobiose 2 %. Os experimentos foram realizados em duplicata e duas reações controles e um branco foram utilizados nos ensaios e preparados da seguinte maneira: 3.4 Diversidade microbiana dos biomas brasileiros As buscas dos trabalhos publicados foram realizadas através do Pub Med (http://www.ncbi.nlm.nih.gov/pubmed/) e Web of Science (http://science.thomsonreuters.com) entre os anos 2005 e As palavras-chave utilizadas foram: Brazil, microbiology, bacteria, fungi, archea, microbial, community, diversity, ecology, environment, marine, aquatic, soil, terrestrial, microbial diversity. Diferentes combinações dos termos foram utilizadas para maior amplitude das buscas A classificação taxonômica das sequências do gene rrna 16S foi realizada através de buscas no Ribosomal Database Project (RDP) versão 9.21 (Cole et al., 2005). 88

108 As Análises de coordenadas principais (PCoA) foram realizadas usando FastUniFrac matriz de distância do pareamento não ponderado. Foram utilizadas apenas sequências de trabalhos que amplificaram a região V1 e V2 maiores que 400 pb. As árvores filogenéticas de sequências do gene rrna 16S não classificadas de ecossistemas terrestres e aquáticos foram baixada e submetidas no banco de dados RDP. Todas as sequências foram alinhadas utilizando software Muscle. Análises filogenéticas foram realizadas com o programa Mega4, utilizando o modelo de neighbor joining. Valores de bootstrap > 50% são mostrados para os ramos que em uma análise de bootstrap de 1000 repetições. 89

109 4. RESULTADOS E DISCUSSÃO 4.1 Diversidade da comunidade de bacterioplâncton ao longo de uma gradiente latitudinal na costa da América Latina por meio de pirosequenciamento da região V Resultados Com exceção do Estuário do Rio Amazonas (salinidade = 0), todos os locais apresentaram características de águas marinhas (Tabela 2). A Baía de Guanabara mostra maior concentração de compostos nitrogenados indicando certo nível de eutrofização do sistema. As altas concentrações estão possivelmente correlacionadas com o impacto antropogênico nesta região, como por exemplo, por esgoto doméstico. A diversidade de comunidades microbianas foi avaliada através da tecnologia 454 de pirosequenciamento, aplicada na região V6 do gene rrna 16S. Foram observadas temperaturas mais elevadas nos locais de latitudes baixas. A caracterização da diversidade microbiana confirmou a existência de um gradiente latitudinal ao longo da costa da América Latina. Foram obtidas sequências de alta qualidade, com tamanho médio de aproximadamente 60 nucleotídeos das 7 localidades (Tabela 3). Foi utilizada a ferramenta de análise de dados The Visualization and Analysis of Microbial Population Structures (VAMPS) (http://vamps.mbl.edu/). Foram observadas diferenças marcantes entre as 7 localidades estudadas. Foi observada a diminuição da equitabilidade de acordo com o gradiente latitudinal, com tendência de maior equitabilidade nas regiões tropicais e menor equitabilidade em áreas subtropicais (Figura 29 A). Além disso, foi possível observar o enriquecimento de organismos autotróficos no mesmo sentido do gradiente latitudinal de equitabilidade. Esses dados sugerem que a produção primária microbiana é maior nas regiões tropicais (ex. Puerto Rico), onde a abundância foi até 100 vezes maior que nas regiões subtropicais (Ex. Argentinian shelf) (Figura 29 B). 90

110 Tabela 2. Parâmetros biológicos e físico-químicos dos locais de amostragem. Puerto Rico Amazon Laguna de Rio de la Argentinia Guanabara Bay estuary Rocha (1 e 2) Plata n Shelf Data 22/09/ /11/ /09/ /04/ /06/ /09/2006 Latitude N 0 70 S S S S S Longitude W W W W W W Profundidade (m) Temperatura ( C) Salinidade NH 4 (µm) 3.1* ** < 2.0 NO 2 +NO 3 (µm) 0.25* < 1.0** 2.13 Nitrogênio total (µm) # # # # PO 4 (µm) 0.05* * 0.77 Fósforo total (µm) # # # # Silicato (µm) 2.3* # * 4.02 Chlorofila a (µg/l) * # Contagem de bactérias (x10 6 células.ml -1 ) (1.34) # dados não disponíveis; * Dados de Artigas, 2008 Tabela 3. Número de sequências, diversidade e cobertura das bibliotecas da região V6 do gene rrna 16S das comunidades microbianas ao longo do gradiente latitudinal. Puerto Rico Guanabara Bay Amazonas Uruguay- Uruguay- Rio de Estuary Fresh Brackish la Plata Argentinian shelf Número de sequências Estimador Chao (0.03) Cobertura de Good (%) As sequências foram distribuídas em 36 filos. Os filos mais comuns nos sete locais foram Proteobacteria, Bacteroidetes, Cyanobacteria, e Actinobacteria (Figura 30), correspondendo a aproximadamente 80% do número total de sequências. Cyanobacteria e Bacteroidetes 91

111 foram mais abundantes em Porto Rico, Argentina e Uruguai. O maior número de sequências identificadas como Actinobacteria e Acidobacteria foi obtido no estuário Amazônico. A B Figura 29. Influência do gradiente latitudinal na equitabilidade e produção primária bacteriana ao longo da costa da América Latina. A) Os dados indicam uma tendência de diminuição da uniformidade de distribuição das OTUs no nível de espécie, de acordo com a diminuição da latitude (R 2 = 0,9451). B) A produtividade primária é maior nas regiões tropicais e tende a diminuir em direção as regiões subtropicais (o eixo Contribuição (%) está em escala logarítimica). 92

112 A fração de sequências que se conserva ao longo do gradiente latitudinal corresponde a aproximadamente 58% de todas as sequências identificadas. Vinte e um grupos foram identificados em todas as amostras (Figura 31; Tabela 4). Alguns destes táxons foram tentativamente classificados em grupos taxonômicos conhecidos como Acinetobacter, Flavobacteriaceae, SAR11 e Enterobacteriaceae, de acordo com a classificação taxonômica do banco de dados VAMPS. A classificação definiu grupos mais profundos mas nenhum desses táxons foi identificado comoespécies. Figura 30. Estrutura das comunidades bacterianas nos sete locais. Os filos mais comumente encontrados são indicados. Sequências Unknown representam aquelas as quais não foi possível atribuir uma classificação taxonômica pelo VAMPS. A fração de OTUs (OTU é definida com um grupo de sequências da região V6 do rrna 16S com > 97 % de similaridade) comuns entre os sete locais é de pelo menos 0,6 %, chegando até 93 % (entre as duas amostras da Argentina) da sua microbiota, sugerindo ampla dispersão microbiana no meio marinho (Figura 32). A fração endêmica das sequências, ou seja, OTUs 93

113 com ocorrência limitada a apenas uma localidade, correspondeu a apenas uma pequena parcela (2%) de todas as sequências. Os táxons endêmicos foram distribuídos em um total de 245 grupos. Os primeiros 40 táxons endêmicos mais abundantes em todo o conjunto de dados são listados (Tabela 5). Figura 31. Número de sequências identifiicadas na fração conservada do gradiente latitudinal. Nível taxonômico mais profundo identificados pelo VAMPS. Figura 32. Fração de sequências comuns de um local para outro usando 97% de similaridade para definir OTUs. 94

114 Tabela 4. Distribuição e identificação da fração cosmopolita do gradiente latitudinal. Os números representam a fração de sequências agrupadas por táxons em relação ao total de seqüências classificadas pelo GAST. A identificação foi possível em diferentes níveis taxonômicos. Identificação Taxonômica Puerto Rico (%) Brazil Amazon estuary (%) Brazil Guanabara Bay (%) Urugauy Laguna do Rocha 1 (%) Uruguay Laguna do Rocha 2 (%) Argentina Rio de la Plata (%) Argentina Argentinian shelf (%) Unknown 0,211 0,171 0,268 4,429 4,604 1,132 1,068 Gammaproteobacteria (Classe) Flavobacteriaceae (Família) Alphaproteobacteria (Classe) Actinobacteria (Filo) Flavobacteriales (Ordem) SAR11 (Ordem) Bacteroidetes (Filo) Methylophilus (Gênero) Proteobacteria (Filo) Rhodospirillales (Ordem) 1,810 0,008 3,146 2,161 1,403 1,627 1,644 0,354 0,001 0,427 0,853 2,425 3,125 2,061 0,519 0,885 1,000 0,816 0,286 3,305 2,148 0,220 0,589 0,416 0,167 0,006 0,987 0,508 0,148 0,013 0,208 0,136 0,386 0,429 0,660 0,104 0,183 0,179 0,618 0,399 0,154 0,057 0,126 0,099 0,155 0,232 0,009 0,369 0,334 0,082 0,001 0,172 0,107 0,006 0,538 0,389 0,035 0,118 0,144 0,157 0,004 0,338 0,287 0,068 0,013 0,327 0,151 0,052 0,227 0,165 95

115 Enterobacteriaceae (Família) Cyanobacteria (Filo) Bacteria (Domínio) Burkholderiales (Ordem) Acinetobacter (Gênero) Fluviicola (Família) Sphingobacteriales (Ordem) Opitutus (Gênero) Ralstonia (Gênero) Prochlorales (Ordem) Planctomycetaceae (Família) 0,002 0,004 0,410 0,381 0,034 0,064 0,041 0,390 0,043 0,132 0,087 0,005 0,219 0,033 0,053 0,116 0,214 0,357 0,032 0,075 0,048 0,007 0,197 0,060 0,001 0,003 0,428 0,175 0,001 0,019 0,045 0,227 0,264 0,007 0,012 0,020 0,010 0,004 0,012 0,055 0,250 0,039 0,008 0,074 0,032 0,081 0,117 0,046 0,008 0,021 0,042 0,051 0,011 0,004 0,018 0,004 0,004 0,015 0,077 0,001 0,001 0,003 0,003 0,047 0,015 0,017 0,001 0,002 0,003 0,009 0,036 0,001 0,014 0,003 0,003 0,016 0,012 Tabela 5. Distribuição e identificação da fração endêmica ao longo do gradientelatitudinal. *PR Puerto Rico; AM Amazon estuary; GB Guanabara Bay; LG1 Laguna do Rocha 1; LG2 Laguna do Rocha 2; RP Rio de la Plata and AS Argentinian shelf. Número de Número de Fração do conjunto de Identificação taxonômica sequências unique Localização* dados (%) Neisseria (Gênero) GB 0,

116 Gp8 (Gênero) AM 0,1623 Curvibacter (Gênero) AM 0,0692 Rubrobacter (Gênero) 60 8 GB 0,0477 Cryobacterium (Gênero) 53 6 LR1 0,0421 Solibacteraceae (Família) 39 5 LR1 0,0310 Neisseria gonorrhoeae (Espécie) 35 1 GB 0,0278 Terrimonas (Gênero) 30 3 AM 0,0238 Herbaspirillum (Gênero) 25 4 AM 0,0199 Owenweeksia hongkongensis (Espécie) 24 3 GB 0,0191 Tenacibaculum (Família) 20 7 LR2 0,0159 Roseateles (Gênero) 13 3 AM 0,0149 Pseudoalteromonas elyakovii (Espécie) 12 3 LR1 0,0095 Chitinophaga sancti (Espécie) 10 4 AM 0,0079 Dorea (Gênero) 9 4 GB 0,0071 Thalassobacter (Gênero) 9 4 LR2 0,0071 Chloroflexi 8 1 PR 0,

117 (Filo) Kordiimonas (Gênero) 8 1 RP 0,0063 Dietzia (Gênero) 7 3 GB 0,0055 Fusibacter (Gênero) 7 2 AS 0,0055 Turneriella (Gênero) 6 4 LR1 0,0047 Aquimarina brevivitae (Espécie) 5 3 RP 0,0039 Faecalibacterium (Gênero) 5 2 GB 0,0039 Cystobacteraceae (Família) 5 4 AM 0,0039 Klebsiella (Gênero) 5 3 GB 0,0039 Gemmata (Ordem) 4 1 AM 0,0031 Beijerinckiaceae (Família) 4 3 AM 0,0031 Hydrogenophilus (Gênero) 4 3 AM 0,0031 Desulfosarcina (Gênero) 4 1 PR 0,0031 Methylococcaceae (Família) 4 2 AS 0,0031 Pseudomonas fluorescens (Espécie) 4 5 LR1 0,0031 Kocuria (Gênero) 3 3 GB 0,

118 Parabacteroides (Gênero) 3 3 GB 0,0023 Myroides (Gênero) 3 2 AS 0,0023 Wautersiella (Gênero) 3 1 GB 0,0023 Atopococcus tabaci (Espécie) 3 4 AM 0,0023 Lactobacillus luminis (Espécie) 3 1 GB 0,0023 A identificação taxonômica fornecida pelo VAMPS indicou que as OTUs identificadas como Acidobacteriaceae GP8, Methylophilaceae, Curvibacter, Terrimonas, Aquitalea e Hongkongensis Fangia só aparecem no estuário do Rio Amazonas. Bactérias potencialmente patogênicas, tais como Neisseria foram observadas na Baía de Guanabara. A maioria dos endêmicos foi tentativamente identificada no nível de gênero, e somente oito táxons foram identificados em espécies conhecidas. A grande maioria dos endêmicos foi obtida no Brasil (Tabela 5). O estuário Amazônico é muito diferente dos outros locais, compartilhando a menor fração de suas sequências com outras localidades. Foram construídas curvas de rarefação para verificação da cobertura da diversidade amostrada para o nível taxonômico de espécie (Figura 33A). Além disso, os estimadores não paramétricos de diversidade Good e Chao também foram utilizados para verificar a cobertura da diversidade estimada pela amostragem. A estimativa da cobertura variou entre 92 e 97% com o número de espécies estimado entre 1323 (Argentinian Shelf) e 4850 (Uruguay Laguna do Rocha 1) (Tabela 3). O número de OTUs no nível de espécie (similaridade > 97 %) encontradas variou entre 1000 e 2500, enquanto o número de famílias oscilou entre 287 e 966 (Figura 33B). Os locais de água doce do estuário do Uruguai e do Rio de la Plata 99

119 apresentaram maior número de sequências únicas. Esses locais também tiveram o maior número de sequências analisadas. Em todos os sete locais, observou-se cauda nas curvas de abundância de classificação, indicando a presença de um grande número de organismos raros em todos os locais, corroborando que as comunidades do bacterioplâncton apresentam alta equitabilidade, de uma forma geral (Figura 34). 100

120 Figura 33. Análise de agrupamento das sequências. A ) Curvas de rarefação; B) Número de OTUs a diferentes níveis de similaridade correspondente a diferentes níveis taxonômicos (linhagens, espécies, gêneros e famílias). 101

121 Figura 34. Análise baseada na distribuição de filos, demonstrando a existência de táxons dominantes distribuídos por poucos grupos taxonômicos. Por outro lado, mostra a contribuição de um grande número de táxons em baixa frequênciaque representa a biosfera rara da microbiota aquática. A capacidade de resolução taxonômica da região V6 foi avaliada através da análise filogenética comparativa de dois gêneros de Cyanobacteria filogeneticamente relacionados, Procholrococcus e Synechococcus (Figura 35). Foram comparadas as sequências das diferentes cópias do gene rrna 16S de ambos os gêneros, observando-se baixa resolução taxonômica. Sequências de referência de Synechococcus agruparam com sequências de Prochlorococcus. Além disto, as sequências obtidas neste estudo e identificadas pelo VAMPS como Prochlorococcus também agruparam de maneira difusa em ambos os gêneros. Apesar da resolução taxonômica da região V6 ser limitada para alguns grupos taxonômicos, vários estudos vem demonstrando a utilidade desta estratégia para estudos abrangentes de diversidade. 102

122 Pela primeira vez na America Latina, foi determinada a diversidade das comunidades microbianas em um gradiante latitudinal empregando pirosequenciamento da região V6. Foi observado que a microbiota da água tem alta dispersão, com grande parte da microbiota tendo distribuição cosmopolita na água. A maior proporção de endêmicos na região Amazônica se deve possivelmente a contribuição de microrganismos de origem terrestre. 88 C y a n o b a c te r ia T a g C y a n o b a c te r ia T a g 1 2 P ro c h l o ro c o c c u s T a g P ro c h lo r o c o c c u s T a g 1 5 P ro c h l o ro c o c c u s T a g 5 P ro c h l o ro c o c c u s T a g 1 1 P ro c h l o ro c o c c u s T a g 6 P r o c h lo ro c o c c u s T a g 7 P r o c h lo ro c o c c u s T a g 8 P ro c h l o ro c o c c u s m a ri n u s s tr. M IT P r o c h lo r o c o c c u s m a ri n u s s tr. A S P ro c h l o ro c o c c u s T a g 2 P ro c h l o ro c o c c u s T a g 4 P ro c h l o ro c o c c u s T a g 3 P r o c h lo r o c o c c u s T a g 1 2 P r o c h lo r o c o c c u s T a g 1 3 P ro c h l o ro c o c c u s m a ri n u s s tr. M IT P ro c h l o ro c o c c u s m a ri n u s s t r. N A T L 1 A C y a n o b a c te ri a T a g 7 S y n e c h o c o c c u s s p. R C C S y n e c h o c o c c u s s p. W H S y n e c h o c o c c u s s p. W H (2 ) C y a n o b a c te r ia T a g 1 4 P ro c h lo r o c o c c u s T a g 1 P ro c h lo r o c o c c u s T a g 1 0 P r o c h l o ro c o c c u s m a ri n u s s t r. M IT C y a n o b a c te ri a T a g 9 C y a n o b a c te ra T a g 1 5 C y a n o b a c te r i a T a g 6 S y n e c h o c o c c u s s p. C C S y n e c h o c o c c u s s p. C C (2 ) S y n e c h o c o c c u s s p. C C (2 ) S y n e c h o c o c c u s s p. C C C y a n o b a c te ri a T a g 3 C y a n o b a c te ri a T a g 8 C y a n o b a c te r ia T a g 4 C y a n o b a c te r ia T a g 4 (2 ) P ro c h lo r o c o c c u s T a g 9 S y n e c h o c o c c u s e l o n g a tu s P C C S y n e c h o c o c c u s e l o n g a tu s P C C (2 ) C y a n o b a c te r ia T a g 1 3 A n a b a e n a va ri a b i l is A T C C A n a b a e n a va ri a b i l is A T C C (3 ) A n a b a e n a va ri a b i l is A T C C (2 ) A n a b a e n a va ri a b i l is A T C C (4 ) C y a n o b a c te r i a T a g 1 C y a n o b a c te ri a T a g 2 S y n e c h o c o c c u s s p. P C C S y n e c h o c o c c u s s p. P C C ( 2 ) B o rr e li a d u tto n i i L y C y a n o b a c te ri a T a g A c i d o b a c t e ri u m c a p s u la t u m A T C C 5

123 Figura 35. Análise filogenética demonstrando a resolução taxonômica da região v6 do gene rrna 16S para os gênero relacionados Prochlorococcus e Synechococcus. Foi utilizado método neighbor join, corrigido pelo modelo Juckes-Cantor e bootstrap com 1000 replicatas Discussão Este estudo traz novas informações sobre a diversidade de bacterioplâncton de águas costeiras da América Latina. Nós descrevemos a estrutura do bacterioplâncton costeiro ao longo de um gradiente latitudinal, abrangendo sete locais distintos, principalmente no meio marinho. O pirosequenciamento da região hipervariável V6 correspondentes às posições (sequência rrna 16S de Escherichia coli) resultou em um número ineditamente elevado de sequências que foram utilizadas para identificar a diversidade de bactérias planctônicas da América Latina. Padrões globais de distribuição de microrganismos ainda são pouco conhecidos e os fatores envolvidos ainda precisam ser mais profundamente investigados. Sabe-se que os aspectos ecológicos e evolutivos são os principais fatores que influenciam nos padrões de distribuição de microrganismos. A existência de um gradiente latitudinal foi identificada recentemente para o bacteriplâncton de águas superficiais dos oceanos (Fuhrman et al., 2008; Pommier et al., 2007). Os principais mecanismos envolvidos para o estabelecimento de um gradiente latitudinal são a temperatura e a produtividade primária. Esses mecanismos não são excludentes. Os dados deste trabalho mostram que ambos estão atuando sobre as comunidades de bacterioplâncton ao longo da costa da América Latina. Por um lado, as maiores temperaturas nas regiões tropicais influenciam na cinética dos processos biológicos, agindo no estabelecimento de grupos microbianos. Por outro, a maior abundância de microrganismos autotróficos nos trópicos sugere uma maior produtividade primária microbiana. Entretanto, medidas de produtividade (como taxa de respiração e fotossintética) precisam ser realizadas para confirmação desta hipótese. 104

124 Ecossistemas mais produtivos são capazes de suportar um maior número e tipos de organismos adaptados as condições locais. A energia é um bom preditor de riqueza de espécies de plantas e animais (Rohde, 1992). Os resultados mostram que a predominância de organismos autotróficos no bacterioplâncton varia de acordo com o gradiente latitudinal de diversidade. Isso sugere que a produção primária pode ser utilizada como um preditor de diversidade ao longo da costa da America Latina. Em geral, a mais profunda resolução taxonômica obtida foi no nível de gênero. Estudos anteriores também sugeriram que a resolução taxonômica das sequências V6 pode permitir a discriminação de gêneros afins, mas não de espécies relacionadas (Huber et al., 2007; Huse et al., 2007). O número de OTUs, correspondente a espécies, em sete locais variou entre 937 e Estas estimativas podem ser consideradas conservativas, pois espécies diferentes podem ter sequências idênticas nas regiões V6. Apenas um número reduzido de sequências foi atribuído a espécies formalmente conhecidas. Aproximadamente, 11% do número total de sequências conservadas foram classificadas como Gammaproteobacteria sem espécies conhecidas ou identidade de gênero. À primeira vista, os resultados sugerem que existe uma grande diversidade de táxons novos que circulam nas áreas de estudo à espera de ser formalmente descrita, mas claramente, mais sequências rrna 16S mais longas são necessárias para estabelecer a posição exata dos novos grupos taxonômicos, evitando os inconvenientes da atual metodologia quanto à sua relativamente baixa resolução taxonômica. As sequências de região V6 identificadas como Prochlorococcus foram indistinguíveis daquelas sequências tentativamente identificadas como Synechococcus e Cyanobacteria, sugerindo que uma fração das sequências de V6 de Cyanobacteria pode ser realmente relacionada com Prochlorococcus. Não é inesperado que esses grupos não possam ser diferenciados porque o gênero Synechococcus é um dos vizinhos mais próximos de Prochlorococcus são diferenciados através da aplicação da metodologia ARISA (Automated 105

125 rrna Intergenic Spacer Analysis) (Rocap et al., 2002). O fato de a região V6 não permitir a diferenciação de gêneros pode ilustrar uma resolução taxonômica limitada. Por outro lado, os filos proximamente relacionados (Acidobacteria, Proteobacteria) foram claramente diferenciados dos grupos Prochlorococcus / Cyanobacteria a partir das sequências da região V6. Uma parcela significativa das OTUs parece ser conservada ao longo do gradiente latitudinal, abrangendo entre Puerto Rico e Argentina, de estuários de águas salobras a marinhas. Todos os sete locais analisados neste estudo podem ser considerados ricos em nutrientes. Entretanto, o aporte de nitrogênio na Baía de Guanabara é aparentemente enriquecido pelo despejo de efluentes domésticos e industriais. A temperatura parece ser o parâmetro mais variável entre os pontos, variando entre 10,6 e 27,5 C. Alguns táxons conservados foram classificados em grupos taxonômicos conhecidos, ou seja, SAR11. Este grupo é dominante nos ambientes marinhos (Brown et al., 2009; Morris et al., 2002). Acinetobacter também foi observada entre os grupos conservados que apresentam versatilidade metabólica e foi recuperado em diferentes biomas, incluindo do Mar Antártica, Região sub-saariana, e Amazônia (Demba Diallo et al., 2004; O Neill et al., 2009; Van Trappen et al., 2002). Acinetobacter também tem sido implicado com infecções nosocomiais em diferentes países (Towner, 2009). Um estudo recente sobre a diversidade de Bactérias e Arquéias do Oceano Ártico mostrou que as espécies raras (ou então chamadas filotipos) não têm uma distribuição conservada (Galand et al., 2009). No presente estudo, utilizando critérios mais rigorosos para a definição do táxon (97% de identidade em vez de 94% de identidade do estudo no Ártico), mostramos que várias OTUs consideradas conservadas (tentativamente identificado como Fuviicola, Sphingobacteriales, Cyanobacteria, e Prochlorales) aparecem em baixa frequência (<1%). A baixa freqüência pode ser explicada, em parte, por causa da amplitude 106

126 latitudinal de nosso conjunto de dados, a partir de 10 N a 38 S, e assim com uma grande mudança nos regimes de temperatura e ambiente. A ampla distribuição destas bactérias pode ser explicada pela sua plasticidade genômica, permitindo sua sobrevivência em condições ambientais variáveis. OTUs endêmicas representaram apenas 1,96% de todas as sequências. A maioria destas sequências foi tentativamente identificada apenas no nível de gênero. Apesar da baixa abundância, OTUs endêmicas podem desempenhar um papel fundamental no meio ambiente. Mudanças nos regimes biogeoquímicos podem determinar variações na comunidade microbiana, e os grupos dominantes podem surgir a partir da biosfera rara. O maior endemismo foi observado em locais brasileiros. Várias OTUs endêmicas (tentativamente identificada como Acidobacteriaceae GP8 e Terrimonas), que apareceram apenas nas regiões estuarinas amazônicas, são microrganismos típicos do solo, possivelmente levados pelo rio Amazonas em direção ao Oceano Atlântico. Outros parâmetros físicos (temperatura, por exemplo) também podem influenciar a diversidade da comunidade bacteriana. Uma OTU tentativamente designada como pertencente ao gênero psicrófilo Cryobacterium foi a mais abundante nos locais com as temperaturas mais baixas ao longo do gradiente latitudinal. Algumas OTUs endêmicas encontradas na Baía de Guanabara tentativamente identificadas como Neisseria refletem um ambiente impactado por ação antropogênica. A Baía de Guanabara é uma conhecida área impactada e intensamente urbanizada, onde vivem aproximadamente 8 milhões de pessoas em seu entorno. Este local teve a maior quantidade de nutrientes no presente estudo. Descargas de nutrientes orgânicos e inorgânicos podem promover o crescimento de bactérias de crescimento rápido. Ambientes ricos em nutrientes tendem a favorecer o crescimento de bactérias patogênicas oportunistas e resultam na perda de homeostase (Dinsdale et al., 2008b). 107

127 Além de parâmetros químicos, o estado autotrófico dos diferentes locais pode influenciar a riqueza de espécies (Fuhrman et al., 2008). Aumento da produtividade primária resulta na entrada de matéria e energia no sistema, permitindo o crescimento microbiano e diversificação. Houve um aumento acentuado nos autótrofos (Cyanobacteria) em Porto Rico, sugerindo uma maior atividade fotossintética. Apesar das controvérsias em relação ao pirosequenciamento da região V6 para avaliar a diversidade bacteriana e identificação das espécies (Claesson et al., 2009; Quince et al., 2009), o presente estudo é uma primeira tentativa de levantamento da diversidade de bactérias em áreas costeiras do Caribe e no Atlântico Sul. A divulgação de conservação de grupos de bactérias é um achado importante que sugere novos estudos. Outro aspecto interessante deste trabalho é o possível aparecimento de organismos indicadores dentro da fração endêmica, sugerindo que áreas impactadas, como a Baía de Guanabara, podem influenciar a composição da comunidade bacteriana. Trabalhos futuros serão necessários para determinar as relações entre os parâmetros ambientais (por exemplo, nutrientes) e mudanças temporais da comunidade microbiana de composição no Atlântico Sul Ocidental. 4.2 Avaliação da saúde do Banco de Abrolhos através da metagenômica Resultados Neste segundo capítulo foi realizado o estudo da diversidade microbiana em uma área geográfica mais restrita do que a abordada no capítulo anterior: o Banco dos Abrolhos. Foi determinada a diversidade microbiana em um dos principais hotspots de diversidade do Atlântico Sul, bem como o efeito de áreas marinhas protegidas na abundância e diversidade microbiana. 108

128 Tabela 6. Características gerais dos locais de coleta e dos metagenomas. Média ± erro padrão. Número de replicatas entre parênteses. DOC (Carbono orgânico diddolvido); POC (Carbono orgânico particulado). A abundância de bactérias totais variou entre 4,88 x 10 5 e 6,62 x 10 5 células / ml (Tabela 6). A menor contagem de células ocorreu nas áreas protegidas (California e Parcel dos Abrolhos). As contagens de Vibrios foram maiores nos recifes desprotegidos, variando entre 10 2 e 10 4 UFC / ml. A contagem de Vibrios variou entre 0 e 10 2 UFC / ml nos recifes protegidos. Os recifes protegidos (Parcel dos Abrolhos e California) apresentam maiores concentrações de COD que as áreas desprotegidas (p < 0,001) (Figura 36). 109

129 A B C D Figura 36. Comparação dos valores dos parâmetro Carbono Orgânico Dissolvido (COD) (acima) e Clorofila (abaixo) entre os recifes protegidos e desprotegidos. Foi observada maior concentração de COD nos recifes protegidos. A) ANOVA e B) Visualização gráfica dos resultados do teste de Tukey. PAB - Parcel dos Abrolhos; SG - Sebastião Gomes; TIM Timbebas e CAL California.. Comparação dos valores do parâmetro Clrofila entre os recifes mostra maiores concentrações no recife protegido. A) ANOVA e B) Visualização gráfica dos resultados do teste de Tukey. PAB - Parcel dos Abrolhos; SG - Sebastião Gomes; TIM Timbebas 110

130 O nível de clorofila é um indicativo do nível de autotróficos na área. O recife Parcel dos Abrolhos apresentou maiores concentrações que os recifes desprotegidos, principalmente entre Parcel dos Abrolhos e Sebastião Gomes (p < 0,001) (Figura 36 C). Através do teste de Tukey, observa-se que os três recifes são diferente entre eles (Figura 36 D). O número total de sequências geradas variou entre (Sebastião Gomes em 2009) e (California, em 2009) (Tabela 6). O número total de sequências identificadas variou entre e , através de Blastx com um valor de corte (E-value) de 10-5, contra o banco de dados MG-RAST. Foi observada maior abundância relativa de sequências identificadas como Arquéia (3-7% de contribuição) e vírus (3-7% de participação) nos recifes desprotegidos, em comparação com os recifes protegidos (1% de contribuição) (Figura 37 A). A Arquéia Maripaludis Methanococcus foi identificada como a espécie mais frequente em Sebastião Gomes (N = 75; 42% das Arquéias). Methanococcoides burtonii foi abundante em Timbebas (N = 148; 5%), enquanto Archaeoglobus fulgidus foi abundante na California (N = 47; 5%). A fração de vírus identificada nos metagenomas consistiu principalmente de Cyanophages (N = 95, 84% em Sebastião Gomes, N = 404, 61% em Pedra de Leste; N = 693, 38% em Timbebas; N = 731, 68% no Parcel dos Abrolhos, e N = 610, 70% na California). Os principais tipos de fagos foram fagos de Prochlorococcus. É possível observar maior contribuição de sequências associadas a vírus nos recifes não protegidos (Figura 37 A). 111

131 A B C Figura 37. Estrutura da comunidade microbiana dos recifes de Abrolhos. A). Contribuição dos diferentes domínios. Enriquecimento de vírus é observada em amostras de recifes desprotegidos. B) Nível trófico dos microrganismos dos cinco pontos. A classificação foi realizada com base na identificação dos filos. Enriquecimento do metabolismo autotrófico é observado nos recifes protegidos. C) Distribuição dos patógenos comumente encontrados. A classificação foi realizada baseada na identificaçãodas taxonômica espécies/ linhagens. A contribuição da Vibrios está relacionada a sequências atribuídas como Gammaproteobacteria. N corresponde ao número total de sequências para cada local 112

132 O número de sequências identificadas como bactérias variou entre 92% (N = 5.297) em Timbebas e 97% (N = ), em California. Proteobacteria foi o filo mais abundante em cada local: Sebastião Gomes (63%, N = 1.212), Pedra de Leste (76%, N = ), Timbebas (76%, N = ), Parcel dos Abrolhos (57%, N = ) e California (68%, N = ) (Figura 38 A). Gammaproteobacteria correspondeu a 21-45% das sequências em todos os recifes. Deltaproteobacteria foram mais abundantes (8%) no recife de Sebastião Gomes desprotegidos do que em proteger recife California (1%). A Proteobacteria Pelagibacter ubique foi a mais abundante nos recifes desprotegidos (11 a 16%, N = ), mas contribuiu com apenas 2-8% em locais protegidos (Figura 38 B). Pelagibacter ubique, Alteromonas macleodii, Synechococcus sp. CC9605 e Gammaproteobacteria KT71 estavam presentes nos cinco recifes. Alteromonas macleodii foi a espécie mais abundante nos recifes protegidos (10 a 24% no Parcel dos Abrolhos e da California, N = e , respectivamente). Por outro lado, se encontra em baixa frequência em Sebastião Gomes (0,2%, N = 238). Não foram observadas diferenças significativas entre os índices de diversidade entre a composição das comunidades de Arquéia, vírus e Bactéria dos recifes protegidos e não protegidos. Porém, houve tendência de menor riqueza de espécies em Sebastião Gomes (área não protegida), sugerindo que a diversidade microbiana tem papel importante nas áreas marinhas protegidas, promovendo a saúde ambiental. Sequências relacionadas aos sistemas autotróficos foram mais abundantes nos recifes protegidos (9 a 21%, no Parcel dos Abrolhos e da California, N = a ) do que nos recifes desprotegidos (5-7% em Pedra de Leste e Timbebas, N = 1101 a 5581) (Figura 37 B). Em comparação, a contribuição de sequências relacionadas ao metabolismo heterotrófico foi maior nos recifes desprotegidos, alcançando 93% em Pedra de Leste. Sequências classificadas como Bacteroidetes foram encontradas em todos os cinco recifes, mas a contribuição mais baixa foi no recife California (3%, N = 2594). A sua contribuição chegou a 24% (N = ) 113

133 em Parcel dos Abrolhos. Actinobacteria correspondeu a cerca de 3% nos recifes desprotegidos e 2% em recifes protegidos (Figura 38 A). A maior abundância de sequências relacionadas a patógenos humanos (7-11%), patógenos animais (6-8%), e Vibrios (5-7%) foram observadas nos metagenomas dos recifes desprotegidos (Fig. 37 C). Entre 5 e 8% de todas as sequências de patógenos humanos foram identificados como Pseudomonas mendocina em todos os locais. Os metagenomas foram classificados em 24 subsistemas envolvidos com ampla diversidade de funções metabólicas (Figura 39). Os cinco processos mais abundantes (carboidratos, aminoácidos e derivados, proteínas, co-fatores e virulência) contribuíram com mais de 50% de todas as sequências do DNA metagenômico anotado. O número total de sequências identificadas variou entre a em Sebastião Gomes e California (Tabela 3). Diferença entre os recifes desprotegidos e protegidos ocorreu apenas para a síntese de macromoléculas e a fotossíntese. Os recifes protegidos mostraram maior abundância de subsistemas envolvidos na fotossíntese (Figura 40 A). A contribuição total de subsistemas identificados envolvidos com a fotossíntese variou de 0,3 a 0,97% no conjunto de dados (Tabela 8). Fotossistemas I e II foram mais abundantes nos recifes protegidos (0,17-0,18 e 0,28 e 0,4%, respectivamente) do que nos recifes desprotegidos (0,02 a 0,07% e 0,17 a 0,14, respectivamente). Sequências do subsistema ficobilisoma foram mais abundantes nos recifes protegidos (0,07 a 0,3%) do que nos recifes desprotegidas (entre 0,005 e 0,03%). Por outro lado, a contribuição de sequências do subsistema proteorodopsina foi semelhante em todos os locais (0,04 a 0,1%). A maioria das sequências de proteorodopsinas foram relacionadas com Pelagilbacter ubique (SAR11), Vibrionaceae e Flavobacteriales (Figura 40 B). 114

134 A B Figura 38. Estrutura das comunidades microbianas nos níveis de A) Filos e B) espécies / linhagens mais frequentes (contribuição >1% do conjunto de sequências da amostra). A classificação taxonômica foi realizada usando o servidor Mg-Rast. A identificação taxonômica é realizada baseada no resultado do BLAST X realizado contra as sequências do banco de dados SEED (banco de genomas completos). A origem taxonômica do melhor hit para a proteína identificada foi relacionada a abundância do táxon identificado. N é o número de sequências utilizadas nas análises. 115

135 A fim de determinar a contribuição dos diferentes microrganismos para os diferentes tipos de subsistemas, seis subsistemas (carboidrato, fósforo, nitrogênio, virulência, resposta ao estresse, e fotossíntese), foram submetidos à identificação taxonômica utilizando MG RAST (Figura 41). Esses subsistemas foram selecionados porque eles são relevantes para o funcionamento do recife de coral. Alguns subsistemas (como carboidratos e resposta ao estresse) foram mais generalistas, em diferentes grupos taxonômicos, enquanto outros subsistemas (por exemplo, de fotossíntese) ficaram restritos a poucos grupos taxonômicos. As principais vias de cada um dos seis subsistemas pertenciam a diferentes processos celulares (Tabela 8). Figura 39. Contribuição dos subsistemas (hierarquia 1) nos diferentes recifes. As barras indicam a contribuição das sequências para cada subsistema nos recifes protegidos e não protegidos. A coluna contribuição é relativa ao número total de sequências identificadas para cada subsistema. Somente sequências informativas foram utilizadas para identificação subsistemas. Sequências atribuído como subsistemas miscelaneus, unknown e clustered based subsystems não foram incluídos nas análises. 116

136 Figura 40. Subsistemas do metabolismo de fotossíntese (média dos anos ). A) Contribuição dos subsistemas (hierarquia 3) relativa a todas as sequências anotadas pelo Mg-Rast. Os subsitemas mostraram diferença (p<0,5; CI 95%) entre os recifes protegidos e não protegidos. B) Contribuição de diferente táxons para o subsistema das proteorodopsinas. 117

137 Tabela 7. Diversidade nas areas protegidas e não protegidas. Os valores foram obtidos usando o número total de sequências classificadas como Bacteria, Virus ou Archeae pelo MG-RAST. Abaixo, o resumo das análises estatísticas aplicadas aos valores encontrados mostra que houve diferença significativa apenas para os valores relacionados a riqueza de espécies. NS - diferença não significativa; DS - Diferença significativa. Tabela 8. Diversidade e abundância dos subsistemas (metabolismo do carboidrato, nitrogênio, virulência, resposta a estresse e fotossíntese). Os dez primeiros subsistemas (hierarquia 1) de cada subsistemas. Anotação pelo Mg-rast Hierarquia 1 Hierarquia 3 Carboidratos (87, 89) Ciclo de Serina Glioxilato Metabolismo do Piruvato II: Acetil- CoA, acetogênese de piruvato Não protegido # sequências Contribuição (%) ,80 701,00 7,07 Ciclo TCA 480,00 4,84 Biosíntese de Butanol Utilização de Maltose e 471,00 4,75 459,00 4,63 Hierarquia 3 Ciclo de Serina Glioxilato Metabolismo do Piruvato II: Acetil- CoA, acetogênese de piruvato Utilização de Maltose e Maltodextrina Biosíntese de Butanol Via Entner- Doudoroff Protegido # Sequências Contribuição (%) , , , , ,84 118

138 Maltodextrina Nitrogênio (9, 8) Fósforo (6, 8) Via Entner- Doudoroff 435 4,39 Ciclo TCA 613 3,86 Complexos da Complexos da 403 4,06 desidrogenase desidrogenase 581 3,66 Metabolismo do Metabolismo da Piruvato I: reações 375 3,78 sacarose anapleróticas, PEP 542 3,41 Fermentação de Acetil-CoA a 346 3,49 Metabolismo do Piruvato I: reações 492 3,10 Butirato anapleróticas, PEP Metabolismo de D- Metabolismo da 327 3,30 gliconato e cetogliconato sacarose 456 2,87 Assimilação de Assimilação de ,50 Amônia Amônia ,49 Degradação de Amonificação de ,92 Alantoína Nitrito e de Nitrato ,27 Amonificação de Degradação de ,49 Nitrito e de Nitrato Alantoína ,37 Óxido nítrico Óxido nítrico 58 9,85 sintetase sintetase 77 8,12 Desnitrificação 11 1,87 Desnitrificação 28 2,95 Hidrólise de Cianato 6 1,02 Hidrólise de Cianato 27 2,85 Estresse Nitrosativo 5 0,85 Fixação de Nitrogênio 7 0,74 Fixação de Nitrogênio 2 0,34 Estresse Nitrosativo 2 0,21 Síntese de novo da Pirimidina 1 0, Metabolismo do Metabolismo do ,39 Fosfato Fosfato ,61 Transportadores de Fosfato de Alta Utilização de 40 3,05 Afinidade e controle Alquilfosfonato 46 2,27 de PHO Regulon Transportadores de Utilização de 33 2,51 Fosfato de Alta Alquilfosfonato Afinidade e controle de 33 1,63 119

139 Virulência (73, 70) PHO Regulon Captação de Fósforo Captação de Fósforo 14 1,07 (Cyanobacteria) (Cyanobacteria) 32 1,58 Fosfoenolpiruvato Metabolismo do 13 0,99 Fosfomutase Fosfonato 24 1,18 Metabolismo do Fosfoenolpiruvato 13 Fosfonato Fosfomutase 13 0, Modificação de Lipídio A 1 0, Biosíntese Global de Cofator NAD e NADP 1 0,05 Sistemas de Sistemas de ,99 Transporte Tol e Transporte Tol e Ton Ton ,31 Grupo Resistente à Resistência Cobalto ,03 Acriflavina Zinco-Cádmio ,70 Resistência Cobalto- Grupo Resistente à 379 9,68 Zinco-Cádmio Acriflavina 762 8,82 Bombas de Efluxo Resistência às 343 9,17 para Multidroga Fluoroquinolonas Resistência 722 8,36 Bombas de Efluxo Resistência às para Multidroga 290 8,30 Fluoroquinolonas Resistência 477 5,52 Transporte de Ferro 205 7,02 Transporte de Ferro 380 4,40 Beta-lactamase 188 4,96 Beta-lactamase 346 4,01 Pilus Tipo IV 161 4,55 Pilus Tipo IV 320 3,70 Resposta a estresse (29, 30) Ilhas de Patogenicidade de 97 3,90 Ilhas de Patogenicidade de 173 2,00 Estafilococos (SaPI) Estafilococos (SaPI) Pilus Hemaglutinina Nova Biosíntese de 87 2,35 Tipo 4 Manosesensíveis Pioverdine 146 1,69 Estresse Oxidativo 317 2,11 Homeostase de Cobre ,70 Homeostase de Cobre ,18 Estresse Oxidativo ,51 Metabolismo ,58 Metabolismo Redox ,12 120

140 Redox da da Glutationa Glutationa Gene do choque Gene do choque ,01 térmico DNA K térmico dnak 292 9,16 Operon HFL 127 9,56 Resposta ao Estresse Periplasmático 202 6,34 Resposta ao Estresse Mecanismos de 118 7,68 Periplasmático Resistência de Acido 180 5,65 Flavo Hemoglobina 76 7,14 Flavo Hemoglobina 137 4,30 Mecanismos de Resistência de Acido 64 4,60 HFL Operon 137 4,30 Regulação da Resposta ao estresse 44 3,87 Regulação da Resposta ao estresse 104 3,26 Sigma B Sigma B Metabolismo da Dimetilarginina 37 2,66 Estarvação 97 3,04 Fotosistema II ,77 Fotosistema II ,40 Proteorodopsina 72 25,09 Ficobilissoma ,15 Fotosistema I 56 19,51 Fotosistema I ,88 Fotossíntese (6, 6) Ficobilissoma 29 10,10 Proteorodopsina 78 6,89 Fotosistema tipo II- Centro de Reação 11 3,83 Fotosistema tipo II- Centro de Reação 18 1,59 Fotossintética Fotossintética Proteínas Bacterianas de captação de Luz 2 0,70 Proteínas Bacterianas de captação de Luz 1 0,09 Um total de 14 grupos taxonômicos teve uma maior contribuição em pelo menos um dos subsistemas nos recifes desprotegidos em relação aos recifes protegidos. Alphaproteobacteria e Gammaproteobacteria tiveram maior contribuição nos subsistemas envolvidos em processos fototróficos nos recifes desprotegidos do que nos recifes protegidos (Figura 41). O metabolismo fotototrófico ocorre nesses organismos em situação de limitação de recursos, reforçando o valor ecológico de genes como as proteorodopsinas. Alphaproteobacteria também apresentaram maior contribuição para a virulência e Bacteroidetes tiveram uma 121

141 maior contribuição à virulência, carboidratos e resposta ao estresse. Entre os Gammaproteobacteria, Vibrios contribuíram com apenas 1-2% das sequências de subsistemas de metabolismo de nitrogênio e de resposta ao estresse, mas até 6% dos subsistemas de fotossíntese nos recifes desprotegidos. Seis grupos taxonômicos tiveram maior contribuição nos recifes protegidos, em pelo menos um dos subsistemas, do que nos recifes não protegidos (Figura 41). Entre os mais abundantes, Gammaproteobacteria apresentou uma maior contribuição para a composição dos subsistemas de virulência, metabolismo nitrogênio, fósforo e de resposta ao estresse. Cyanobacteria contribuíram para os seis subsistemas, enquanto Actinobacteria mostrou maior contribuição para o subsistema de virulência nos recifes protegidos. Viridiplantae contribuiu para as diferenças nos subsistemas de carboidratos, fotossíntese e subsistemas de resposta ao estresse. Stramenopiles apresentou maior contribuição para os subsistemas de carboidratos e fostossíntese. Apesar dobaixo número de sequências, foi identificada maior contribuição de seqüências de Korarcheota para o subsistema de carboidratos nos recifes protegidos. Os dados sugerem que diferentes populações de Vibrios estão associadas aos recifes protegidos e desprotegidos. Foi possível observar um comprometimento metabólico diferencial entre os metagenomas para os subsistemas de nitrogênio, fósforo, resposta a estresse e fotossíntese entre áreas protegidas e não protegidas. Os Vibrios das áreas não protegidas apresentaram maior abundância de genes dos subsistemas de nitrogênio, resposta a estresse e fotossíntese enquanto os de áreas protegidas apresentam maior abundância de genes envolvidos nos subsistema de fósforo (Figura.42) A contribuição de Vibrios para estes subsistemas foi indetectável nos recifes protegidos, mas eles contribuíram com 1,5% para o subsistema de fósforo nesses locais. 122

142 Figura 41. Contribuição dos diferentes grupos taxonômicos para seis subsistemas relevantes (carboidrato, fósforo, nitrogênio, virulência, resposta ao estresse, e fotossíntese), utilizando MG- RAST. As estrelas coloridas representam maior abundância (p <0,5, IC 95%) de taxa para o respectivo subsistema em áreas desprotegidas e protegidas. N representa o número de sequências analisadas. 123

143 Figura 42. Versatilidade metabólica dos Vibrios. O gráfico mostra que os grupos de Vibrios nas áreas não protegidas apresentam maior comprometimento com metabolismo fototrófico. Em suma, neste capítulo está demonstrado, pela primeira vez, a diversidade metagenômica no Banco de Abrolhos. Este estudo levou a uma maior compreensão do impacto de áreas marinhas protegidas na abundância e diversidade microbiana. A maior abundância de sequências metagenômicas oriundas de patógenos potenciais e de bactérias de crescimento rápido em áreas não protegidas reflete a tendência de degradação destas áreas. O recife de Timbebas aparece em posição intermediária em termos de uso e degradação, não sendo totalmente protegido ou desprotegido. Deste forma, podemos concluir que a diversidade microbiana identificada nos metagenomas pode ser ferramenta importante no manejo de áreas marinhas protegidas, apresentando potencial comoestratégia de biomonitoramento Discussão Nossos resultados vão ao encontro dos achados que sugerem que recifes de corais saudáveis como California, por exemplo, apresentam maior cobertura de corais que macroalgas. Coral e cobertura de macroalgas em recifes desprotegidos em todo o mundo variam de forma significativa. A proliferação de macroalgas pode resultar no aumento de bactérias com potencial patogênico através da produção de COD (carbono orgânico 124

144 dissolvido). O contato físico entre algas carnudas e coral pode causar descoloração ou necrose próximo à interface devido a toxinas (metabólitos lipossolúveis), especialmente na ausência de peixes herbívoros (Barott et al., 2009; Rasher and Hay, 2010). A proliferação de macroalgas no recife desprotegido dentro do Banco Abrolhos pode ser uma consequência da diminuição de peixes herbívoros nestes locais. Compostos solúveis (carbono orgânico dissolvido), liberados pelas algas podem promover a mortalidade de coral através da atividade microbiana (Sekar et al., 2006a). A menor concentração de COD observada nos recifes desprotegidos neste estudo sugere que este conjunto de nutrientes é convertido rapidamente em biomassa bacteriana pelo rápido crescimento das bactérias heterotróficas. Assim, as maiores contagens Vibrios foram observadas nos recifes desprotegidos. Padrões similares de baixa concentração de COD e alta contagem de UFC de heterotróficos (Vibrios) em recifes degradados foram observadas em recifes no Oceano Pacífico (Dinsdale et al., 2008b). O COD biodisponível pode ser necessário para a degradação do COD semi-lábil. Estes compostos são resistentes ao rápido ataque microbiano (Cherrier et al., 1996; Sondergaard et al., 2000). Um aumento de nutrientes inorgânicos por si só não é suficiente para permitir que as comunidades bacterianas utilizem o COD refratário (Carlson et al., 2002). Assim, a baixa concentração de COD em recifes desprotegidos do Banco dos Abrolhos pode ser um efeito combinado do aumento da produtividade de algas fotossintéticas e maior consumo de COD lábil pelos heterotróficos. Além disso, a maior número relativo de heterótrofos nos recifes desprotegidos pode contribuir para a maior concentração de CO 2 nestes sítios. Ambientes ricos em CO 2 parecem reforçar a capacidade competitiva das macroalgas sobre os corais (Diaz-Pulido et al., 2011). Os elevados níveis de nutrientes dissolvidos detectados no sistema de recifes de Abrolhos, em especial NID (11,3 mm) e FID (0,6 mm), sugerem um processo de 125

145 eutrofização nesta área. A biomassa do fitoplâncton deduzida a partir da concentração de clorofila (0,23-0,34 mg / L) também foi alta em todos os cinco recifes e se aproximam do limiar que define a eutrofização de sistemas recifais (Bell et al., 2007; Costa et al., 2008). Os níveis desses nutrientes foram até dez vezes maiores do que a limiar de concentração sugerida para NOD (1,0 mm) e FOD (0,2 m) na Grande Barreira de Corais (Bell, 1992). Estes limiares determinam o processo de eutrofização não só neste recife, mas também em outros recifes (por exemplo, Barbados e Florida Keys). As concentrações de nutrientes observadas neste estudo são comparáveis com os obtidos em estudos anteriores realizados em uma área próxima, a norte do Banco de Abrolhos, em Porto Seguro (Costa et al., 2006a). Eles encontraram até 8,19 mm e 1,42 mm NIP e FID e concluíram que pode haver uma fonte permanente de fósforo nessa área, enquanto o crescimento de microrganismos pode ser limitado por nitrogênio (Costa et al., 2006a). Nosso estudo também sugere que os recifes do Banco de Abrolhos (Timbebas, Sebastião Gomes, Parcel dos Abrolhos e California) estão sob impacto de fontes de fósforo e nitrogênio, indicada pelos altos teores destes nutrientes. As verdadeiras fontes de nutrientes são desconhecidas, mas podem ser de escoamento da costa (ou seja, efluentes domésticos e agrícolas), o acoplamento bento-pelágico, ou da descarga de águas subterrâneas. A descarga de águas subterrâneas parece ser uma fonte importante no norte do Banco de Abrolhos (Costa et al., 2006a). A alta concentração de nitrogênio na Sebastião Gomes e de silicatos nos recifes desprotegidos pode ser devido à proximidade do rio Caravelas e da cidade de Caravelas. Na Ilha Kiritimati, uma das ilhas que compõem um atol no Oceano Pacífico, os mais altos níveis de nitrogênio foram encontrados em áreas com maior densidade humana (Dinsdale et al., 2008b). Altas cargas de nutrientes podem promover o crescimento massivo de macroalgas. Mudanças na fase de recifes de coral para macroalgas têm sido observadas em diferentes locais, incluindo Kaneohe Bay (Smith 1981), Brasil (Costa et al., 2000), Bahamas (Lapointe et al., 2004), e a Grande 126

146 Barreira de Corais (Bell et al., 2007). Proliferação de algas pode por sua vez, promover o crescimento microbiano, devido à produção de matéria orgânica dissolvida altamente lábil (Barott et al., 2009; Rasher and Hay, 2010; Smith et al., 2006). A contagem total de bactérias (4,88 e 5,63 x 105 x 105 células / ml) ficou dentro da faixa observada para outros sistemas recifais (Dinsdale et al., 2008b). A menor contagem foi observada no recife California e as mais altas no recife de Sebastião Gomes. Observamos maior contagem de Vibrios (tanto de UFC como nas sequências metagenômicas) nos recifes desprotegidos (Sebastião Gomes, Timbebas e Pedra de Leste), possivelmente em resposta a pulsos de nutrientes. Microrganismos com taxas de crescimento rápido, como Vibrios podem ser bom indicador da saúde do recife, pois podem responder rapidamente a eutrofização. Como alguns Vibrios são capazes de fixar N 2 é esperado que eles não sejam limitados por nitrogênio. Além disso, Vibrios são capazes de gerar a energia a partir da luz usando proteorodopsinas (Gómez-Consarnau et al., 2010). Genes de proteorodopsinas encontrados nos recifes de Abrolhos pareciam pertencer a Vibrios, indicando a plasticidade genômica dessas bactérias. As bactérias patogênicas são abundantes em áreas de recifes desprotegidos. O predomínio de diferentes tipos de microrganismos pode resultar em diferentes níveis tróficos nos sistemas recifais do Banco dos Abrolhos. As bactérias heterotróficas dominam as comunidades microbianas dos recifes desprotegidos: a análise metagenômica revelou uma maior abundância de bactérias patogênicas humanas e animais (Bacteroidetes, Pseudoalteromonas e Alteromonas macleodii), e menos genes fotossintéticos. Em contrapartida, uma maior abundância de Picocyanobacteria fotossintética foi observada nos recifes protegidos. Picocyanobacteria marinha são os organismos fotossintéticos mais abundantes na Terra, com apenas dois gêneros, Prochlorococcus e Synechococcus, numericamente dominantes na maioria das águas oceânicas (Johnson et al., 2006; Partensky et 127

147 al., 1999). Os recifes protegidos tiveram um número maior de sequências associadas com microrganismos autotróficos. Vários estudos têm detectado um enriquecimento de Bacteroidetes em diferentes espécies de corais doentes e nos sistemas de recifais (de Castro et al., 2010a; Jones et al., 2004; Pantos et al., 2003; Sekar et al., 2006a; Thurber et al., 2009). Estes organismos foram mais representados em dois dos metagenomas desprotegidos, e em um dos metagenomas dos recifes protegidos, de modo que nenhum padrão foi identificado no nível de classe para estes recifes. As áreas protegidas apresentaram maior número de bactérias, Arquéia, e táxons virais. Sugerimos que os recifes de coral protegidos têm uma maior riqueza microbiana e homeostase mais elevada (Tabela 7), enquanto que os recifes desprotegidos criam condições favoráveis que promovam o crescimento de patógenos de coral e patógenos oportunistas. O recife de Sebastião Gomes, o mais impactado entre os analisados neste trabalho, apresentou menor riqueza de espécies do que os outros recifes. Foi estabelecido um panorama sobre a metagenômica e funcionamento do Banco de Abrolhos. O recife de Abrolhos está em um acelerado processo de deterioração, com recifes desprotegidos apresentando baixa biomassa de peixes e alta contagem de microrganismos patogênicos de coral. Em todos os pontos amostrados houve uma alta carga de NID e FID. Esses parâmetros, isoladamente, não explicam as grandes mudanças de fase observadas entre recifes desprotegidos (Sebastião Gomes, Pedra de Leste e Timbebas) e protegidos (Parcel dos Abrolhos e California). A ocorrência de cobertura mais elevada das algas e menor cobertura de peixes com maior contagem de Vibrios sugerem que a remoção dos peixes pode promover a proliferação de algas e crescimento de bactérias. O maior número de microrganismos heterotróficos nos recifes desprotegidos, particularmente, as de rápido crescimento (por exemplo, Vibrios e outras bactérias patogênicas para humanos), sugere uma rápida conversão de energia dentro dos recifes desprotegidos. A maior abundância de vírus 128

148 identificada no metagenoma dos recifes desprotegidos reforça a sugestão de uma rápida mudança da comunidade microbiana e uso de energia nestes recifes. Os recifes desprotegidos têm sofrido com a pesca predatória na última década. O recife de Timbebas, que oficialmente pertence à área do Parque Nacional de Abrolhos protegida pela marinha, é na verdade uma área sujeita à pesca, um exemplo de má gestão que leva à mudança das linhas de base do sistema recifal. Por outro lado, a pesca nos recifes protegidos é rara devido à aplicação dos regulamentos por parte da guarda do parque. Nossos dados indicam que as áreas protegidas também estão em diferentes estágios do processo de degradação. Observa-se que a microbiota do recife de Timbebas apresenta características de recifes impactados em áreas não protegidas (Sebastião Gomes) como o enriquecimento de vírus, archaea e os organismos heterotróficos. No entanto, Timbebas ainda preserva biomassa de peixes e cobertura bentônica de áreas protegidas menos degradadas (California), em comparação com Sebastião Gomes, que representa uma área desprotegida com o maior grau de impacto. Embora em níveis mais baixos, também foi possível detectar no recife de Parcel dos Abrolhos apresenta uma fase inicial de degradação. Assim como Timbebas, Parcel dos Abrolhos também apresentou biomassa de peixes e cobertura bentônica compatíveis com áreas menos degradadas como a California. No entanto, a microbiota revelou uma alta abundância de Bacteroidetes. O enriquecimento deste filo bacteriano tem sido observado nos corais doentes (de Castro et al., 2010a). Além disso, o de dados metagenômicos apontam para uma redução significativa de genes envolvidos na produtividade primária (fotossíntese). Genes de proteorodopsinas foram amplamente distribuídos pelas bactérias heterotróficas relacionados à família Vibrionaceae. Nossa análise sugere que os dados moleculares são mais precisos na detecção de alterações em curto prazo da qualidade da saúde dos recifes do Banco dos Abrolhos. A 129

149 análise integrada em diferentes níveis sistêmicos atua como um eficiente marcador e preditor de processos ecológicos (Raes et al., 2011). A criação e execução de áreas marinhas protegidas parecem ser ferramentas valiosas para manter a homeostase do sistema de recife dos Abrolhos. Como foi visto nas Northern Line Islands (Dinsdale et al., 2008b), as modificações na cadeia alimentar do Banco dos Abrolhos, com a redução de peixes herbívoros e aumento de macroalgas, parece afetar a diversidade microbiana e a abundância desse bioma. As comunidades microbianas, por sua vez influenciam a saúde de todo o bioma através de seu metabolismo, o que ilustra a importância das AMPs como instrumentos para manter a homeostase dos recifes de corais em Abrolhos. 4.3 Diversidade das comunidades microbianas dos solos da Mata Atlântica e o seu potencial biotecnológico Resultados Neste capitulo descrevo os resultados da análise da diversidade microbiana de um bioma típico brasileiro, a Mata Atlântica. Este estudo permite estabelecer diferenças entre o grau de endemismo da microbiota da Mata Atlântica e o meio marinho, onde foi observada aparente fração microbiana ubíqua como foi observado nos capítulos anteriores. Além disso, foi possível demonstrar o potencial biotecnológico da microbiota do solo da Mata Atlântica através da triagem funcional para a busca de genes envolvidos na degradação de celulose Diversidade da das comunidades microbianas dos solos da Mata Atlântica A extração do DNA metagenômico dos diferentes tipos de solo do PARNASO permitiu o estabelecimento de bibliotecas de clones do gene rrna 16S. Um total de 13 filos foram delineados com base em 894 sequências parciais do gene rrna 16S das seis localidades através de comparação com o banco de dados RDP (Figura 42). 130

150 Acidobacteria, Proteobacteria e Verrucomicrobia foram os filos mais abundantes, correspondendo a 70% de todas as sequências analisadas (Figura 44 A). A contribuição de Acidobacteria, variou entre 29% em Campo Úmido e 54% no site Cavalinho. As 379 sequências identificadas como Acidobacteria foram distribuídas em 154 grupos (definida como "grupos" com pelo menos três sequências, com similaridade de pelo menos 97% entre elas), 81 singletons e 29 doubletons. Nove subgrupos foram identificados em Acidobacteria. Os subgrupos Gp1 s e GP2 foram os mais frequente, representando mais de 70% das sequências identificadas como Acidobacteria (Figura 44 B). Sequências de Acidobacteria do grupo GP3 estavam presentes em seis localidades, variando entre 2%e 16%. 131

151 Figura 43. Diversidade de filos encontrados nas bibliotecas do gene rrna 16S. O tamanho dos triângulos corresponde ao número de sequências identificadas. Unclassifieddesigna as sequências para as quais não foi possível obter uma classificação taxonômica através do RDP (Ribosomal Database Project). 132

152 A B C Figura 44. Estrutura das comunidades microbianas do solo da Floresta da Mata Atlântica do PARNASO baseada no sequenciamento de bibliotecas de clones do gene rrna 16S de acordo com o RDP (limite de confiança em 80 %). A) Abundância de filos; B) Contribuição (%) de subgrupos do filo Acidobacteria (Acidobacteria Gp 1 ao Gp 17) e C) Contribuição (%) das classes de Proteobacteria. N representa o número te sequências analisadas. 133

153 O segundo grupo mais frequentemente recuperado em todos os locais foi Proteobacteria (Figura 44 C). A classe Alphaproteobacteria correspondeu a 28% das sequências de Bonfim Vermelho e 74% das sequências do site do Ajax. Vários outros filos, por exemplo, Actinobacteria, Bacteroidetes, Planctomycetes, Gemmatimonadetes e Verrucomicrobia, ocorreram em uma frequência relativamente baixa, geralmente abaixo de 10%. Cerca de 15% de todas as sequências do gene rrna 16S (N = 134) foram atribuído às bactérias não classificada pela RDP (Unclassified). Estas sequências foram distribuídas em 105 e 41 OTUs com 3% e 20% de distância genética como níveis de corte, respectivamente, e representando potenciais espécies e filos novos. As curvas de rarefação mostraram que a taxa de cobertura atingiu uma assíntota nos níveis de filo e de classe em todos os locais, mas não atingiu a saturação ao nível de espécie (Figura 45). O número de filos variou entre 54 e 98, utilizando o limite de 80 % de similaridade (Figura 45 C). As curvas de rarefação referente às espécies mostraram números entre 93 (no Ajax solo) e 123 (no solo Vermelho Bonfim) (Figura 45 A). O estimador de riqueza não paramétricos Chao1 indicou a existência de 263 a 446 espécies (Figura 45 D) e filos (Figura 45 F). O número de sequências foi suficiente para fornecer uma estimativa aproximada do número de filos, mas não foi o suficiente para ter uma estimativa robusta do número de espécies no solo da Mata Atlântica. O baixo número de grupos delineados (N = 155) frente ao estimados pode muito bem ilustrar esse fato. Dezoito grupos mais frequentes, correspondente às espécies, foram delineados usando todas as 894 sequências de gene rrna 16S (Figura 46; Tabela 9 e 10). Os grupos mais frequentes foram definidos como grupos contendo pelo menos seis sequências com mais de 97% similaridade entre elas. A comparação com sequências disponíveis no GenBank mostrou que esses grupos estão relacionados com clones de diferentes eocssitemas. Esses grupos representaram apenas 17% de todas as sequências do 134

154 rrna 16S. Onze grupos (1, 3, 4, 5, 6, 7, 8, 9, 12, 16 e 17) foram divididos em Acidobacteria. Quatro grupos (2, 10, 11 e 13) foram divididos em Proteobacteria e apenas um grupo (14) foi identificado como Verrucomicrobia. Dois grupos (15 e 18) não apresentaram similaridade significativa de sequência de rrna 16S com qualquer outro bacteriano já formalmente descrito. O baixo nível de semelhança entre as sequências do gene rrna 16S dos grupos delineados e as sequências de banco de dados impede a sua identificação em espécies conhecidas. Seis grupos (1, 2, 3, 8, 12 e 18) apresentaram mais de 97% similaridade entre as sequência do rrna 16S com sequências de bactérias não cultivadas e não classificadas taxonomicamente. A maioria dos grupos apareceu em quatro locais diferentes (Tabela 10). Em contrapartida, os grupos 7 e 18 apareceram em apenas uma localidade. Uma baixa co relação entre as características físico químicas, por exemplo o ph do solo, e o índice de diversidade Shannon (H) foi verificada. A maior correlação correu com o aumento da concentração de potássio (R 2 = 0,395 (Figura 47). 135

155 Figura 45. Análise da cobertura e estimativa da diversidade baseada na análise da bibliotecas de clones do gene rrna 16S. Foram utilizados os níveis de corte de 97% (acima), 90% (meio) e 80% (abaixo) de similaridade entre as sequências.curvas de rarefação (A, B e C) e curvas coletoras (estimador Chao 1) (D, E, e F). Em comparação com a coleção de isolados do solo da Mata Atlântica estabelecida no Laboratório de Microbiologia da UFRJ, foi observada a sobreposição de gêneros dos filos Proteobacteria, Actinobacteria e Firmicutes entre os métodos dependentes e independentes de cultivo. Foi encontrado um clone proximamente relacionado a um isolado que pertence ao gênero Cupriavidus entre as Proteobacteria (Figura 48). Entre as Actinobacteria foram identificados clones relacionados com a ordem Actinomycetales, porém sem espécies conhecidas relacionadas. Apenas um clone relacionado com o gênero Bacillus foi identificado nos isolados atribuídos ao filo Firmicutes. 136

156 Tabela 9. Os grupos mais frequentes encontrados nas bibliotecas e seus vizinhos filogenéticos mais próximos (cultivados e não cultivados). Os agrupamentos representam pelo menos seis sequências com similaridade > 97 % entre elas. Vizinho filogenético mais próximo Classificação pelo RDP Linhagem tipo Número de Resultado BLAST Número de Grupo (% de similaridade) acesso (% de similaridade) acesso Acidobacterium Capsulatum ATCC Uncultured soil bacterium 1 Acidobacteria (95) D26171 clone (97) AY Bradyrhizobium japonicum ATCC Bradyrhizobium 2 Alphaproteobacteria (94) U69638 sp. KO14 (97) AB Acidobacterium Capsulatum ATCC Uncultured Acidobacteria 3 Acidobacteria (92) D26171 bacterium clone FAC9 (97) DQ Acidobacterium Capsulatum ATCC Uncultured bacterium clone 4 Acidobacteria (85) D26171 AS66 (95) AY Acidobacterium Capsulatum ATCC Uncultured bacterium clone 5 Acidobacteria (84) D26171 PW290 (95) GQ Acidobacterium Capsulatum ATCC Uncultured bacterium clone 6 Acidobacteria (93) D26171 JH-WH215 (97) EF Acidobacteria Acidobacterium Capsulatum ATCC (94) D26171 Uncultured bacterium clone S7-82 (95) EU Acidobacterium Capsulatum ATCC Uncultured bacterium clone 8 Acidobacteria (93) D26171 FCPT602 (96) EF Acidobacteria Acidobacterium Capsulatum ATCC D26171 Uncultured bacterium clone Amb_16S_775 (94) EF

157 51196 (85) Rhodoplanes elegans Uncultured bacterium clone 10 Alpharoteobacteria ATCC (90) D25311 KGB (97) EU Uncultured delta Stigmatella erecta proteobacterium clone 437T3 11 Deltaproteobacteria DSM 16858T (86) AJ (91) DQ Acidobacterium Uncultured Acidobacteriaceae Capsulatum ATCC bacterium clone 12 Acidobacteria (95) D26171 Elev_16S_571 (96) EF Methylosarcina fibrata Uncultured bacterium clone 13 Gammaproteobacteria ATCC (82) AF AS44 (96) AY Candidatus Xiphinematobacter Uncultured bacterium clone 14 Verrucomicrobia rivesi (95) AF FCPS466 (95) EF Unclassified bacteria N/A N/A Uncultured soil bacterium clone FACE.R4.AC.D01 (95) FJ Acidobacterium Capsulatum ATCC Uncultured bacterium clone 16 Acidobacteria (93) D26171 GASP-38KB-91-C04 (98) EU Acidobacterium Uncultured 17 Acidobacteria Capsulatum ATCC bacterium clone (92) D26171 AS63 (96) AY Uncultured Unclassified bacterium clone 18 bacteria N/A N/A BacC-u_068 (93) EU

158 Tabela 10. Distribuição das sequências dos grupos mais frequentes nos diferentes tipos de solo da Mata Atlântica. Número de sequências Bonfim Bonfim Campo Grupo Classificação RDP Vermelho Amarelo Ajax Torto Úmido Cavalinho Total 1 Acidobacteria Alphaproteobacteria Acidobacteria Acidobacteria Acidobacteria Acidobacteria Acidobacteria Acidobacteria Acidobacteria Alpharoteobacteria Deltaproteobacteria Acidobacteria Gammaproteobacteria Verrucomicrobia Unclassified bacteria Acidobacteria Acidobacteria Unclassified bacteria

159 Figura 46. Análise filogenética baseada nas sequências do gene rrna 16S dos grupos de clones mais frequentes nas bibliotecas Os grupos apresentam pelo menos seis sequências com similaridade > 97 % entre elas. Os círculos pretos representam uma sequência representativa de cada grupo e entre parêntesis o número de sequências representadas. As linhagens tipo e sequências relacionadas como vizinhos filogenéticos mais próximos foram determinadas pelos bancos de dados RDP e GenBank. A fonte de identificação das sequências dos bancos de dados do NCBI estão indicados. 140

160 Figura 47. Relação entre diversidade H (índice de Shannon) e parâmetros físico químicos do solo. Unidades: Matéria Orgânica (%); Alumínio (me/100cm³); Fósforo (mg/l); Potássio (mg/l). 141

161 Proteobacteria Firmicutes Actinobacteria Figura 48. Fração de sequências dos filos Proteobacteria, Firmicutes e Actinobacteria compartilhada pelos métodos dependentes e independentes de cultivo. Portanto, foi demonstrado que Acidobacteria e Proteobacteria são abundantes no solo da Mata Atlântica. A existência de novos filos e espécies potenciais reflete a tremenda diversidade microbiana presente no solo da Mata Atlântica, representando um vasto repertório genético para descobertas biotecnológicas Potencial biotecnológico do DNA metagenômico do solo da Mata Atlântica O potencial biotecnólogico do DNA metagenômico da Mata Atlântica foi demonstrado por meio de procedimentos de extração, clonagem e expressão heteróloga, visando descobrir sequências de DNA metagenômico com atividade enzimática. Foram realizados dois métodos 142

162 de preparação do DNA metagenômico dos solos que compõem o PARNASO para o estabelecimento de uma biblioteca metagenômica visando a prospecção de moléculas bioativas. O método de extração através de esferas de vidro mostrou-se mais eficaz que o kit comercial Power Soil da Mo Bio (Figura 49). A B Figura 49. Extração do DNA metagenômico pelos métodos A) Kit comercial Mo Bio e B) Esferas de vidro. A1) Mistura de DNA metagenômico dos diferentes tipos de solo da Mata Atlântico do PARNASO; A2) Resultado da digestão parcial do DNA metagenômico pela enzima PstI, gerando quantidades insuficientes para a construção da biblioteca metagenômica. B1) Resultado da extração do DNA metagenômico dos solos ainda com contaminantes em diferentes concentrações (1, 3, 5 e 10 μl); B2)Resultado da purificação e B3) Resultado da digestão parcial. A linha vermelha mostra a região excisadacontendo os fragmentos para clonagem no plasmídeo pcf430. Entretanto, foi necessário realizar uma etapa adicional de purificação do DNA metagenômico para os ensaios de digestão parcial. Os volumes de inserto e vetor foram determinados após a 143

163 purificação de ambos. A eficiência da clonagem foi alta conforme o número de clones estocados (estimativa de clones) e a diversidade de fragmentos clonados (Figura 50). Apesar de parecer trivial, a extração de DNA metagenômico de alta qualidade é um grande desafio pois este DNA esta associados com material húmico e metais do solo que resultam na sua rápida degradação Figura 50. Extração plasmidial de colônias aleatórias demonstrando a variedade de insertos com diferentes tamanhos. 1. pcf430 circular diferentes colônias (5μL). A partir da biblioteca metagenômica foram triados clones com atividade celulolítica em meio mínimo de sais suplementado com carboximetil celulose (CMC), um polímero solúvel derivado da celulose, para a triagem da atividade celulolítica. A atividade foi avaliada através da ocorrência de halos de degradação revelados pelo reagente vermelho congo, capaz de se associar as ligações tipo β- 1,4 glucose (Teather and Wood, 1982). A formação de discretos halos foi observada em torno da maioria dos clones selecionados, após três etapas de repique. Aproximadamente mil clones foram triados e três clones foram escolhidos aleatoriamente para avaliação da atividade enzimática. Estes clones apresentaram crescimento em meio mínimo suplementado com CMC (carboxi metil celulose), como única fonte de carbono. Após três passagens em meio mínimo, ficou evidente que estes clones possuíam DNA metagenômico com sequências gênicas codantes de genes envolvidos na degradação de celulose. Curvas de crescimento foram avaliadas para a determinação e padronização da fase 144

164 ótima de produção de celulases da cultura bacteriana ao longo de 16 horas. A fase estacionária foi alcançada aproximadamente após 4 horas (Figura 51). Figura 51. Curva de crescimento dos clones em meio CMC. Em aproximadamente 2 horas foi observada maior atividade enzimática para as atividades Cmcásica (ligação ß, 1-4). A atividade máxima alcançada corresponde com o início da fase log de crescimento dos clones em cultura. Além de 3 clones, 3 isolados ambientais da Floresta da Mata Atlântica foram selecionados em meio mínimo de sais suplementado com CMC para determinação da atividade celulolítica. Os resultados da atividade enzimática dos clones e isolados foram comparados com fungo filamentoso Penicillium funiculosum, reconhecido produtor de celulases com alta atividade enzimática. As atividades apresentadas na Tabela 11 mostram que foi detectada atividade celulolítica nos clones e isolados analisados. Um importante aspecto do clone Cel 1A foi a presença de atividade -glucosidásica, em proporção equilibrada em relação às atividades FPásica e CMCásica. Além disso é importante destacar que as atividades FPásica e CMCásica dos clones alcançaram níveis bem próximos das observadas nos isolados.desta forma, demonstramos que existem clones com sequências gênicas codantes de enzimas relacionadas com a degradação da celulose. 145

165 Tabela 11. Ensaios de atividade enzimática. A1, A2 e A3 são clones selecionados da biblioteca de pequenos insertos. Cel 1A e Cel CAAB são isolados do solo da Mata Atlântica que apresentaram capacidade de formar halos de degradação no meio de cultura. Atividades (U/L) Clones FPásica CMCásica -glucosidásica A1 21,66 ± 2,56 92,19 ± 1,94 0 A2 19,84 ± 0,40 111,44 ± 4,54 0 A4 20,12 ± 0,40 98,15 ± 5,18 0 Cel 1A 24,04 ± 1,98 148,09 ± 7,13 80,79 ± 5,21 Cel CAAB 20,40 ± 1,59 134,35 ± 1,94 0 Penicillium funiculosum Discussão A utilização de uma abordagem independente de cultivo não mostrou uma sobreposição significativa com o método dependente de cultivo, demonstrando que esses métodos são capazes de recuperar diferentes frações da diversidade de bactérias do solo da Mata Atlântica.. Os grupos bacterianos identificados neste estudo são habitantes típicos do solo (Janssen, 2006). A fisiologia e as características de microrganismos pouco estudados do solo apresentam grande relevância para a microbiologia ambiental, seja para estudos de diversidade filogenética ou funcional (Gray and Head, 2001; Hugenholtz, 2002; Palleroni, 1997; Rappé and Giovannoni, 2003; Zinder and Salyers, 2005). A abordagem metagenômica permite relacionar a identificação dos principais grupos microbianos e seu papel ecológico no solo da Mata Atlântica. Por isso, não é possível desconsiderar a possibilidade de que a fração até então não bem caracterizada pode apresentar papel relevante nos processos ecológicos que ocorrem no solo. Embora a atribuição de 146

166 funções e de genes associados a marcadores filogenéticos, seja possível na ausência de culturas (Gray and Head, 2001; Liesack and Dunfield, 2003), ela pode ser mais bem avaliada em bactérias cultivadas Acidobacteria são genética e metabolicamente versáteis, apresentam capacidade de degradar a celulose e outros compostos normalmente encontrados em solos da floresta (Davis et al., 2005). A abundância relativa de grupos Acidobacteria GP1 e GP2 sugere que estas bactérias de crescimento lento podem desempenhar um papel fundamental nos processos microbianos no solo. Acidobacteria também são capazes de crescer em baixo ph e ambientes com baixa tensão de oxigênio como solos florestais, o que talvez explique a predominância destas bactérias nas bibliotecas de clones de rrna 16S. O ph parece ser um dos principais fatores que afetam a diversidade de bactérias do solo (Fierer and Jackson, 2006). Entretanto, a estreita faixa de ph observada no presente estudo pode ter obscurecido uma clara correlação entre distâncias genéticas e geográficas entre as seis localidades. Acidobacteria e Proteobacteria têm distribuição ubíqua no solo. O solo do tipo Terra Preta da Amazônia indicou uma predominância de Proteobacteria e Acidobacteria em bibliotecas de clones de rrna 16S, o que compreende aproximadamente 30% das sequências do último (Kim et al., 2007). Em outro estudo sobre a diversidade de bactérias do solo do Cerrado brasileiro, a contribuição de Acidobacteria e Proteobacteria foi de 22% e 30%, respectivamente (Quirino et al., 2009). No entanto, a contribuição da Acidobacteria foi baixa nos solos de canaviais do sul do Brasil (Roesch et al., 2007). Um número significativo de rrna 16S (82,6%) foram agrupados como singletons ou doubletons (similaridade > 97 %). Eles pertencem a Acidobacteria e Proteobacteria, bem como a grupos com baixa frequência de ocorrência (Gemmatimonadetes, Planctomycetes, Cyanobacteria, Chloroflexi, DO1 e 147

167 OP10). Estas sequências podem ser consideradas membros da biosfera rara da microbiota do solo da Mata Atlântica. A análise de rarefação indica que apenas uma fração de toda a diversidade de espécies foi recuperada (N = ). Os números encontrados são extremamente conservadores e parecem mostrar uma subestimativa da diversidade microbiana no solo da Mata Atlântica. A complexidade genética da comunidade microbiana de solo, estimada por experimentos de reassociação de DNA, mostrou que o tamanho da comunidade de uma amostra de solo é equivalente a cerca de genomas de E., coli (Torsvik et al., 1990; Torsvik et al., 2002). Outro estudo baseado em análises moleculares mostrou que 30 g do solo podem conter mais de espécies (Doolittle, 1999). As estimativas baseadas em análises não paramétricas apontam um número de espécie entre e espécies por grama de solo (Curtis et al., 2002; Schloss and Handelsman, 2006). Estes resultados mostram que a totalidade dos genomas microbianos encontrados em amostras de solo, pode ser extremamente variado e na maioria das vezes a comunidade é altamente diversa. Estudos utilizando sequenciamento de massivo serão necessários para descobrir a diversidade da biosfera rara e o número exato de espécies por grama de solo da Mata Atlântica. É importante perceber que as bibliotecas de rrna 16S podem não representar uma imagem completa ou exata da comunidade bacteriana. Entretanto, são capazes de estabelecer um sólido panorama sobre os grupos dominantes. A diversidade de espécies é tão grande que, geralmente, as bibliotecas de com cerca de sequências clonadas são capazes de representar apenas uma amostragem incompleta. Mesmo as análise do banco de dados RDP (cerca de sequências) não foi capaz de constituir um censo completo de todos os genes rrna 16S no planeta (Schloss and Handelsman, 2004). O número significativo de sequências atribuída às bactérias não classificadas, de acordo com RDP 148

168 e GenBank no presente estudo, reforça a visão de que o solo da Mata Atlântica brasileira é um grande reservatório de novos grupos de bactérias. Dois grupos potencialmente novos foram identificados entre as OTUs mais frequentes. A sequência completa do rrna 16S do grupo 15 mostrou 98% de similaridade com sequências do solo de relva na California e em agregados de solos agrícolas (Cruz-Martinez et al., 2009; Hansel et al., 2008). Por outro lado,o grupo 18 mostrou apenas 95% de similaridade para as sequências obtidas em solos do tipo Tundra (Costello and Schmidt, 2006; Nemergut et al., 2008). Esses resultados sugerem ampla distribuição desses grupos no ambiente. O bioma Mata Atlântica pode ser uma fonte potencial de novas biomoléculas, especialmente aqueles com atividade celulolítica. O presente estudo é o primeiro levantamento global sobre a diversidade da comunidade bacteriana em solos de Mata Atlântica. Este estudo mostra claramente que o bioma Mata Atlântica representa um grande reservatório para a descoberta da diversidade bacteriana. Isso representa um forte indício de que pode existir alta riqueza de espécies que desempenham papel no ciclo do carbono através da degradação de celulose da matéria orgânica depositada nos solos de Mata Atlântica. No entanto, o solo também é rico em ácidos húmicos, que desnaturam o DNA e se ligam a grupos fenólicos. Esta interações prejudicam a qualidade do DNA extraído por métodos enzimáticos (Bertrand et al., 2005; Liles et al., 2008; Lombard et al., 2011; Robe et al., 2003; Rondon et al., 2000). O DNA de alto peso molecular e livre dessas substâncias produz bons resultados para reações enzimáticas como, amplificação, digestão e ligação. Esses processos são cruciais na construção de uma biblioteca metagenômica para busca de moléculas bioativas (Bertrand et al., 2005). Os resultados apresentados mostram que os melhores resultados foram alcançados através da aplicação de um método de extração direta do DNA, utilizando esferas de vidro, para obtenção de DNA de qualidade em concentração necessária para a construção da biblioteca metagenômica do solo. Métodos de extração 149

169 direta de DNA são mais rápidos que indiretos e alcançam rendimentos até 100 vezes maiores DNA (Gabor et al., 2003). Embora grande parte das buscas por celulases através de abordagem metagenômica se concentre em ambientes extremos (por exemplo, rúmen bovino), a busca em ambientes não extremos, como o solo da Mata Atlântica, oferecem maior diversidade genética de celulases altamente estáveis e adequadas para aplicações industriais (Voget et al., 2006). Considerando a estimativa de 10 4 espécies de bactérias presentes no solo (Torsvik et al., 2002), uma biblioteca metagenômica de milhões de clones (com tamanho médio de inserção de kb) é necessária para obtenção de pelo menos um representante de cada espécie bacteriana (utilizando o tamanho do genoma de E.coli como referência). Neste sentido, a biblioteca construída nesse trabalho precisa ser expandida para obter uma maior cobertura da diversidade, uma vez que foi construída com um número estimado de clones. As técnicas de extração de DNA atualmente em uso dão acesso, principalmente, às populações dominantes no solo. Foi possível recuperar cerca de milhares de clones com potencial atividade celulolítica através do enriquecimento da biblioteca em meio mínimo contendo CMC. Estratégias de triagem funcional têm como objetivo detectar a reação biocatalítica primeiro e, em seguida, caracterizar o gene responsável. A expressão heteróloga em linhagens de E. coli pode limitar a atividade enzimática em caso de possíveis diferenças de repertório metabólico e mecanismos de regulação moleculares em relação ao microrganismo de origem. Uma pesquisa com 32 genomas procarióticos constatou que apenas 40% dos genes podem ser expressas utilizando E. coli (Gabor et al., 2004). Além disso, mesmo quando um gene é expresso, o nível de expressão pode ser tão baixo que não pode ser detectada através de triagem funcional. Alguns trabalhos mostram um enorme esforço de triagem para a detecção de poucos clones positivos (Daniel, 2004). As atividades avaliadas mostram que 150

170 foi detectada atividade celulolítica nos clones e isolados analisados. Um importante aspecto do clone Cel 1A foi a presença de atividade -glucosidásica, em proporção equilibrada em relação às atividades FPásica e CMCásica. Alguns trabalhos mostraram sucesso no isolamento de genes envolvidos na degradação da celulose a partir de amostras de solo (Kim et al., 2008; Voget et al., 2006; Wang et al., 2009). A utilização de promoters de indução pode aumentar a probabilidade de encontrar enzimas através da seleção funcional. Entretanto, não são capazes de influenciar na triagem caso a atividade celulolítica de um gene dependa da atividade de outras enzimas para disponibilização de substrato específico, quando em seu ambiente natural. Neste trabalho foi utilizado um vetor com promotor induzido por arabinose, entretanto não realizamos sua indução, testando o potencial de degradação do gene apenas em celulose como fonte de carbono. Testes de indução devem ser realizados com os clones selecionados para otimização da capacidade de degradação em experimentos posteriores. Embora as abordagens independentes de cultivo permitam o isolamento de genes de celulases a partir de amostras ambientais, incluindo metagenomas do solo, a maioria dos estudos relata o isolamento de endocelulases (Feng et al., 2007; Healy et al., 1995; Kim et al., 2008; Voget et al., 2006; Wang et al., 2009). Até o momento, o isolamento e caracterização de genes de exocelulase da microbiota ruminal têm sido realizado com sucesso (Ferrer et al., 2005). No entanto, como o taxa de descoberta de genes de celulase nesses estudos alcançou apenas de 0,001% a 0,5%. O isolamento de exocelulases a partir de metagenomas do solo parece uma promissora fonte de novos genes celulolíticos (Fujii et al., 2011). A detecção de atividade celulolítica em uma amostragem relativamente pequena de clones demonstra o enorme potencial do metagenoma da microbiota do solo na busca de moléculas bioativas. A possibilidade de manipulação da expressão de genes triados na Floresta de Mata Atlântica brasileira representa um enorme potencial biotecnológico no que 151

171 diz respeito à utilização de enzimas celulolíticas na produção de biocombustíveis. Portanto, demonstrado que o DNA metagenômico do solo da Mata Atlântica é uma fonte rica para a descoberta e desenvolvimento biotecnológico. O número limitado de linhagens que geralmente podem ser simultaneamente testados na triagem com base em métodos de cultivo em grande volume inviabiliza uma triagem mais ampla, eficaz e rápida de isolados ambientais e clones de bibliotecas metagenômicas. O desenvolvimento de estratégias destinadas a permitir a miniaturização e avaliação paralela de um grande número de linhagens representa uma importante ferramenta na busca de novos genes codantes de enzimas microbianas com atividade celulolítica (Cianchetta et al., 2010). 4.4 Diversidade microbiana dos biomas brasileiros Resultados Neste capitulo realizei uma análise exploratória da diversidade microbiana de ecossistemas tipicamente brasileiros abordada por métodos independente de cultivo. Foi realizada uma busca bibliográfica baseada nos principais bancos de dados de publicações científicas (Pub Med e Web os Science) para levantamento das publicações e sequências disponíveis no NCBI (National Center for Biotechnology Information). Por meio da análise de sequencias de rrna 16S oriundas de diferentes estudos foi possivel estabelecer um panorama geral sobre os principais grupos microbianos associados aos biomas brasileiros. Foi demonstrado que a microbiota associada é característica e adaptada as condições ambientais. Foram analisados mais de 70 trabalhos sobre o estudo da diversidade microbiana utilizando métodos independentes de cultivo em todos os sete principais biomas brasileiros (Amazônia, Mata Atlântica, Cerrado, Pantanal, Caatinga e Zona Costeira) nos últimos 5 anos (Tabelas 12 e 13). Além disso, foi listada a produção sobre descrição de espécies microbianas através de 152

172 métodos moleculares (aproximadamente 30 artigos). A compilação desses dados fornece um panorama geral sobre a diversidade microbiana identificada no Brasil nos últimos anos. Existe diferenciação clara entre a microbiota (Bactéria e Arquéia) de biomas terrestres e aquáticos de acordo com analises de sequências do gene ribossomal rrna 16S (Figuras 52 A e B). As análises de componentes principais mostraram que as sequências agruparam de acordo com o ecossitema associado (Figura 52 C e D). Foram distinguidos três grupos. O primeiro grupo consistiu de três bibliotecas de amostras de solo (Araujo and Kruger; Bruce et al., 2010; Faoro et al., 2010b). O segundo grupo, constituído de quatro bibliotecas da água do mar (Clementino et al., 2008; Cury et al., 2011; de Castro et al., 2010b; Reis et al., 2009) e o terceiro grupo foi composto por quatro bibliotecas de microorganismos associados com animais marinhos (de Castro et al., 2010b; Hardoim et al., 2009; Lins-de-Barros et al., 2010b; Reis et al., 2009). As diferenças mais evidentes entre os ambientes terrestres e de água do mar estão relacionadas ao fato de que Acidobacteria, Actinobacteria e Firmicutes foram mais comuns em solos, enquanto que Cyanobacteria e Bacteroidetes foram mais abundantes em água (Figura 52 C e D). Grande número de rrna 16S (cerca de 10% no solo e 20% em água) não foram classificadas e portanto representam diversidade desconhecida, possivelmente novas espécies ou até mesmo famílias ou filos. Entre as Arquéias, Euryarchaeota predominam em ecossitemas terrestres, enquanto Crenarchaeota são dominantes nos ecossitemas marinhos e uma grande fração (> 40 %) é desconhecida. Um total de 18 espécies bacterianas, 32 de fungos 12 protozoários foram descritas no Brasil nos últimos 5 anos (Tabela 14 e 15). A descrição taxonômica de espécies de protozoários é escassa e é realizada principalmente baseada em características morfológicas (Dias et al., 2010b; Siqueira-Castro et al., 2009). Enquanto a descrição de novas espécies de bactérias e fungos é submetida à taxonomia polifásica. Os novos táxons foram isolados de diferentes fontes e localidades de biomas brasileiros terrestres e aquáticos. 153

173 Atualmente, existem mais de genomas completos de procarioto sequenciados e cerca projetos genoma em andamento de acordo com o NCBI (http://www.ncbi.nlm.nih.gov/sites/genome). Cerca de 35 genomas estão depositados no NCBI por projetos brasileiros. Mais de 20 genomas estão publicados. Há 52 genomas de Leptospira oriundos da FIOCRUZ que foram sequenciadas pelo J. Craig Venter Institute. 154

174 Figura 52. Parte superior: análise das componentes principais (PCoA) do pareamenteo unweight através da matriz de distância do FastUniFrac. Cada ponto corresponde a comparação da presença ou ausência dos grupos taxonômicos de bactérias em diferentes biomas. Triângulos verdes, círculos roxos e hexágonos vermelhos representam microrganismos associados a solo, água e organismos marinhos. Comunidades de (A) Bactérias e (B) Archaea, respectivamente. A porcentagem de variação explicada pelo traçado das componentes principais está indicada nos eixos. Um total de e sequências do gene 16S rrna foram alinhadas para Bacterias e Archaea, respectivamente. Foram selecionadas sequências referentes as regiões V1 e V2 do gene rrna 16S. Sequências curtas menores que 300 pb foram retiradas da análise. Archeas do solo não foram incluídas. Parte inferior: classifcação taxonômica baseada nas sequências do gene rrna 16S através da ferramenta Classifier do RDP. (C) Contribuição dos principais filos bacterianos e (D) Contribuição de filos do domínio Archeae. 155

175 Tabela 12. Lista de estudos de diversidade microbiana nos principais biomas brasileiros por abordagens independentes de cultivo em ambientes terrestres. Bioma Local Abordagem Molecular Amostras Referências Solo Agrícola Paraná PCR e DGGE do gene rrna 16S Solo (Nakatani et al., 2011) Mangue Bahia PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Rizosfera e Sedimentosos (Peixoto et al., 2011) Cerrado Mato Grosso do Sul ITS, PCR e sequenciamento do gene rrna 16S Solo (Alves-Prado et al., 2010) Mata Atlântica Rio de Janeiro Sequenciamento de biblioteca de clones do gene rrna 16S Solo (Bruce et al., 2010) Mangue São Paulo PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Sedimentos (Dias et al., 2010a) Mata Atlântica Paraná Sequenciamento de biblioteca de clones do gene rrna 16S Solo (Faoro et al., 2010b) Mangue Rio de Janeiro Pirosequenciamento do gene rrna 16S Rizosfera (Gomes et al., 2010a) PCR, DGGE e sequenciamento de Mangue Rio de Janeiro biblioteca de clones do gene rrna 16S; PCR, DGGE e sequenciamento de Rizosfera (Gomes et al., 2010b) biblioteca de clones do gene ndo Amazônia Amazonas PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S e análise por T-RFLP Solo (Grossman et al., 2010) Campo de Cana de Açúcar São Paulo Sequenciamento dos genes rrna 16S e gyrb Rizosfera e Raiz (Luvizotto et al., 2010) Mangue São Paulo PCR, DGGE e sequenciamento de biblioteca de clones dos genes dsrb e mcra Sedimentos (Taketani et al., 2010b) Mangue Bahia PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Sedimentos (Taketani et al., 2010a) Amazônia Amazonas T-RFLP e sequenciamento de biblioteca de clones do gene rrna 16S; Real- Solo (Taketani and 156

176 Time PCR e sequenciamento do clone Tsai, 2010) do gene amoa Cultivo de Eucalipto Transgênico São Paulo Real-Time PCR quantitativo, PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Rizosfera (Andreote et al., 2009) Amazônia Rondônia PCR e DGGE do gene rrna 16S Solo (Cenciani et al., 2009) Amazônia Amazonas T-RFLP e sequenciamento de biblioteca de clones do gene rrna 16S Solo (Jesus et al., 2009) Amazônia Amazonas Sequenciamento de clones do gene rrna 16S Nódulos de raízes (Lima et al., 2009) Mata Atlântica Bahia PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Solo (Maciel et al., 2009) Caatinga Sergipe PCR, ARDRA, DGGE e sequenciamento do gene rrna 16S Rizosfera (Monteiro et al., 2009) Mata Atlântica Rio de Janeiro PCR quantitativo, PCR e sequenciamento de biblioteca de clones dos genes rpob e gyrb Solo Sedimentos (Rodrigues et al., 2009) Mata Atlântica Rio de Janeiro PCR e DGGE do gene rpob Solo (Aboim et al., 2008) Transgenic Tobacco cultivar São Paulo PCR, ARDRA, DGGE e sequenciamento do gene rrna 16S Rizosfera (Andreote et al., 2008) Campo de Trigo Rio Grande do Sul PCR, RFLP do gene nifh e sequenciamento do gene rrna 16S Rizosfera e massa de solos (Beneduzi et al., 2008a) Campo de Arroz Rio Grande do Sul PCR, RFLP do gene nifh e sequenciamento do gene rrna 16S Rizosfera e massa de solos (Beneduzi et al., 2008b) Mangue Rio de Janeiro PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Sedimentos (Gomes et al., 2008) Campo de Rio Grande do Sul Sequenciamento de biblioteca de clones Rizosfera, (Roesch et 157

177 Milho do gene nifh Raízes e Caule al., 2008) Cerrado Minas Gerais PCR, DGGE e sequenciamento do gene rpob Rizosfera (Coelho et al., 2007) Amazônia Amazonas Sequenciamento de biblioteca de clones do gene rrna 16S Solo (Kim et al., 2007) Campo de Cana de Açúcar São Paulo BOX PCR do gene rrna 16S e sequenciamento do gene RecA Rizosfera e Raiz (Mendes et al., 2007) Plantio de Soja Paraná PCR, DGGE ; RFLP e BOX - PCR do gene rrna 16S Solo e nódulo (Pereira et al., 2007) Campo de Cana de Açúcar Rio Grande do Sul Pirosequenciamento do gene rrna 16S Solo (Roesch et al., 2007) Mata Atlântica Paraná e São Paulo BOX-PCR do gene nifh e sequenciamento do gene rrna 16S Raízes (Albino et al., 2006) Mangue Rio de Janeiro T-RFLP e sequenciamento do gene rrna 16S Sedimentos (Brito et al., 2006) Campo de Milho Rio de Janeiro PCR e DGGE do gene rrna 16S Rizosfera (Costa et al., 2006b) Cerrado São Paulo ITS, PCR, DGGE e sequenciamento do clone do gene rrna 16S Solo (de Oliveira et al., 2006) Solo Agrícola PR, RS, DF, AM, MG e GO ERIC-REP PCR, RAPD PCR, RFLP e sequenciamento de biblioteca de clones do gene rrna 16S Solo (Hungria et al., 2006) Mata Atlântica São Paulo Sequenciamento de biblioteca de clones do gene rrna 16S Filosfera (Lambais et al., 2006) Mangue Rio de Janeiro Sequenciamento do gene rrna 16S Rizosfera Mata Atlântica Rio de Janeiro Sequenciamento do gene rrna 16S Solo Pantanal Mato Grosso do Sul PCR e ARDRA do gene rrna 16S Raízes (Maciel- Souza et al., 2006) (Souchie et al., 2006) (Brasil et al., 158

178 2005) Cultivo de Milho Minas Gerais PCR, DGGE e sequenciamento de biblioteca de clones do gene rpob Solo (da Mota et al., 2005) Amazônia Amazonas Sequenciamento do gene rrna 16S Sedimentos (Fiore et al., 2005) Tabela 13. Lista de estudos de diversidade microbiana dos principais biomas brasileiros por abordagens independentes de cultivo em ambientes aquáticos nos últimos anos. Bioma Local Abordagem Molecular Amostras Referências Zona de ressurgências de Cabo Frio Rio de Janeiro PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Água (Cury et al., 2011) Baía de Guanabara Rio de Janeiro Pirosequenciamento do gene rrna 16S Água Lagoa da Conceição Santa Catarina PCR e DGGE do gene rrna 16S Água Banco de Abrolhos Bahia Sequenciamento do gene pyrh Muco de Coral (Thompson et al., 2011) (Fontes et al., 2011) (Alves et al., 2010) Banco de Abrolhos Bahia PCR e sequenciamento de biblioteca de clones do gene rrna 16S Coral (de Castro et al., 2010b) Bacia de Campos Rio de Janeiro PCR e sequenciamento de biblioteca de clones do gene rrna 16S Água (Korenblum et al., 2010) Praia da Tartaruga Rio de Janeiro PCR e sequenciamento de biblioteca de clones do gene rrna 16S Coral (Lins-de- Barros et al., 2010b) Praia de Guaecá, Ilhota da Prainha e Ilha de Toque-Toque São Paulo ITS, PCR, ARDRA e sequenciamento do gene rrna 16S Esponjas, ascídias e algas (Menezes et al., 2010) Arquipélago das Cagarras Praia Vermelha Rio de Janeiro PCR e sequenciamento do gene rrna 16S Esponjas (Fontana et al., 2010) 159

179 Baía de Guanabara e Zona Costeira Rio de Janeiro sequenciamento de biblioteca de clones dos genes rrna 16S e amoa Água do mar e esponjas (Turque et al., 2010) Baía de Sepetiba Rio de Janeiro PCR e sequenciamento de biblioteca de clones do gene rrna 16S Água (Almeida et al., 2009) Grande, Portinho e Praia Preta São Paulo REP PCR e sequenciamento dos genes pyrh, reca e rrna 16S Muco de Mussismilia hispida (Chimetto et al., 2009) Ilha do Caboclo e Praia da Tartaruga Rio de Janeiro PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Esponjas Aplysina fulva (Hardoim et al., 2009) Rio Paraná Paraná e Mato Grosso do Sul PCR e sequenciamento de biblioteca de clones do gene rrna 16S Água (Lemke et al., 2009) Banco de Abrolhos Bahia PCR e sequenciamento de biblioteca de clones do gene rrna 16S Coral mucus (Reis et al., 2009) Grande, Portinho e Praia Preta São Paulo Sequenciamento dos genes pyrh e rrna 16S Muco de Coral (Chimetto et al., 2008) Lagoa Araruama Rio de Janeiro Sequenciamento dos genes nifh e rrna 16S Água (Clementino et al., 2008) Poços domésticos e Rio Pará PCR e RFLP do gene RecA Água (Dall'Agnol et al., 2008) Baía de Guanabara Rio de Janeiro Sequenciamento de biblioteca de clones do gene rrna 16S Água,sedimento e esponjas (Turque et al., 2008) Baía de Guanabara Rio de Janeiro Sequenciamento de biblioteca de clones do gene rrna 16S Água (Vieira et al., 2008) Rio Itanhaém São Paulo PCR e sequenciamento de biblioteca de clones do gene rrna 16S Água (Carvalho et al., 2007) Campos e Campos Rio de Janeiro PCR, ARDRA e sequenciamento de biblioteca de clones do gene rrna 16S Óleo (Sette et al., 2007) Baía de Guanabara Rio de Janeiro ITS, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Água (Clementino et al., 2007) Estuário da Baía de Guanabara Rio de Janeiro PCR, DGGE e sequenciamento de biblioteca de clones do gene rrna 16S Água (Vieira et al., 2007) 160

180 Mangue Ceará PCR e DGGE do gene rrna 16S Água (Sousa et al., 2006) Rio Negro Manaus REP PCR e sequenciamento dos genes 16S e 23S rrna Água (Hungria et al., 2005) Tabela 14. Lista de novos táxons de ambientes terrestres descritos nos últimos 5 anos. Espécies Bioma Local Abordagem Amostra Referências Burkholderia mimosarum Mata Atlântica Sudeste brasileiro Polifásica Nódulos de raízes (Mimosa pigra e M. scabrella) (Chen et al., 2006) Paenibacillus riograndensis Rizosfera Rio Grande do Sul Polifásica Rizosfera de trigo (Triticum aestivum) (Beneduzi et al., 2010) Stenotrophomonas pavanii Cana de Açúcar Paraná Polifásica Caule de Cana de Açúcar (Saccharum officinarum) (Ramos et al., 2010) Streptomyces lunalinharesii Cerrado Brasil central Polifásica Acid orthic ferralsol (Souza et al., 2008) Bactéria Burkholderia sabiae Cultivo Agrícola Brasil Polifásica Árvore Leguminosa (Mimosa caesalpiniifolia) (Chen et al., 2008) Metschnikowia cerradonensis Cerrado Tocantins Polifásica Flores (Ipomoea carnea) e besouro (Conotelus beetle) (Rosa et al., 2007a) Nódulos de raízes Burkholderia nodosa Mata Atlântica Sudeste Brasil Polifásica (Mimosa bimucronata e (Chen et al., 2007) Mimosa scabrella) Ceidatus Magnetoglobus multicellularis Lagoa de Araruama Rio de Janeiro Morfologia e gene 16S rdna Lagoa costeira hipersalina (Abreu et al., 2007) 161

181 Azorhizobium doebereinerae Raízes Minas Gerais e Rio de Janeiro Polifásica Nódulos de raízes de espécies lenhosas (Sesbania virgata) (Maria de Souza Moreira et al., 2006) Burkholderia ferrariae Minério de Ferro Minas Gerais Polifásica Suspensão de minério de Ferro rica em Fósforo (Valverde et al., 2006) Cana de Burkholderia silvatlantica Açúcar e Cultivo de Rio de Janeiro Polifásica Rizosfera (Perin et al., 2006) Milho Análise da região D1/D2 Ceida queiroziae Mata Atlântica Minas Gerais da subunidade maior do gene rrna do gene Madeira podre e insetos de madeira (Santos et al., 2011) rdna e Morfologia Análise da região D1/D2 Fungi Lachancea mirantina Processo de Fermentação Pernambuco da subunidade maior dos genes rrna e rdna, região ITS e gene Processo de fermentação na produção de cachaça (Pereira et al., 2011) EFA1 Análise da Wickerhamiella pagnoccae e Ceida jalapaonensis Cerrado Tocantins região D1/D2 da subunidade maior do gene rrna e Néctar de flores de plantas brácteas (Heliconia psittacorum) (Barbosa et al., 2011) Morfologia Ophiocordyceps rufipedis, O. balzani, O. melanotici e Mata Atlântica Minas Gerais Morfologia Formigas carpinteiras (Evans et al., 2011) O.novogranadensis 162

182 Madeira de árvore Hypochnella verrucospora Mata Atlântica Rio Grande do Sul Morfologia angiosperma apodrecida (Piptadenia (Coelho et al., 2010) gonoacanthae) Análise da região D1/D2 Trichosporon chiarellii Formigueiro São Paulo da subunidade maior do gene Formiga Saúva (Atta capiguara) (Pagnocca et al., 2010) rrna e ITS e Morfologia Análise da região D1/D2 Ceida golubevii Pantanal Mato Grosso do Sul da subunidade maior do gene Flor de Ipomoea sp. (Rosa et al., 2009b) rrna e Morfologia Análise da Folhas de bromélias região D1/D2 (Aechmea recurvata Ceida aechmeae e Ceida vrieseae Parque Itapuã Rio Grande do Sul da subunidade maior do gene e Billbergia nutans) e água de tanque de (Landell et al., 2010) rrna e bromélia Vriesea Morfologia gigantea Análise da região D1/D2 Spathaspora arborariae Mata Atlântica e cerrado Minas Gerais da subunidade maior do gene Madeira Podre (Cadete et al., 2009) rrna e Morfologia Wickerhamomyces queroliae e Ceida jalapaonensis Cerrado Tocantins Análise da região D1/D2 da subunidade maior do gene rrna e Morfologia Larva de Anastrepha mucronata de frutos maduros de Peritassa campestris e flores de Centropogon cornutus (Rosa et al., 2009c) 163

183 Análise da Cryptococcus bromeliarum Praia da Pedreira no Parque Itapuã Rio Grande do Sul região D1/D2 da subunidade maior do gene rrna e ITS; Bromélias Vriesea procera, V. friburgensis e Tillesia gardneri (Landell et al., 2009) Morfologia Análise da região D1/D2 Ceida materiae Mata Atlântica Minas Gerais da subunidade maior do gene Madeira podre (Barbosa et al., 2009) rrna e Morfologia Análise da região D1/D2 Moniliella fonsecae Fragmentos da Floresta Ipuca Tocantins, Lago verde da subunidade maior do gene Flores Byrsonima orbigniana (Rosa et al., 2009a) rrna e Morfologia Pseuodocercospora cryptostegiaemadagascariensis Planta Minas Gerais Morfologia Manchas nas folhas da planta Cryptostegia madagascariensis (da Silva et al., 2008) Análise da região D1/D2 Trichosporon insectorum Queijo Brasil da subunidade maior do gene Queijo artesanal (Fuentefria et al., 2008) rrna e fisiologia Aspergillus brasiliensis Solo Brasil Região ITS e análise AFLP Solo (Varga et al., 2007) Ceida flosculorum e Ceida floris Mata Atlântica e Pantanal São Paulo e Mato Grosso do Sul Análise da região D1/D2 da subunidade maior do gene rrna e Flores de Heliconia velloziana, H. episcopalis e Ipomoea sp. (Rosa et al., 2007b) Morfologia e 164

184 fisiologia Folhas de Bromeliads Dyckia Farysizyma itapuensis, F. setubalensis e F. taiwanian Parque Itapuã Rio Grande do Sul Polifásica sp., Tillesia gardneri,t. geminiflora, Vrisea (Inácio et al., 2008) friburgensis e V. procera Análise da região D1/D2 Ceida heliconiae C. picinguabensis e C. saopaulonensis Mata Atlântica São Paulo da subunidade maior do gene rrna e Água de flores brácteas Heliconia velloziana (Ruivo et al., 2006) Morfologia e fisiologia Morfometria, Protozoa Trypanosoma serpentis Pantanal Mato Grosso do Sul ultraestrutura e análise dos genes rrna e Cobra Pseudoboa nigra (Viola et al., 2009) GAPDH Tabela 15. Lista de novos táxons de ambientes aquáticos descritos nos últimos 5 anos. Espécies Bioma Local Abordagem Amostra Referências Marinobacterium coralli Canal de São Sebastião na Praia Preta São Paulo Polifásica Coral Mussismilia hispida (Chimetto et al., 2011c) Canal de São Sebastião nas Corais e zoantídeos (M. Bactéria Vibrio communis sp. nov. Praias Grande, Preta e Portinho e São Paulo e Bahia Polifásica hispida, Phyllogorgia dilatata, Palythoa caribaeorum e P. (Chimetto et al., 2011b) Banco de variabilis) Abrolhos Vibrio variabilis e V. Canal de São Sebastião nas São Paulo Polifásica Zoantídeos (Palythoa (Chimetto et 165

185 marinus praias Grande, Preta e Portinho caribaeorum) al., 2011a) Marinomonas brasilensis Canal de São Sebastião na Praia Grande São Paulo Polifásica Coral (M. hispida) (Chimetto et al., 2010a) Banco de Abrolhos e Photobacterium jeanii Canal de São Sebastião nas Praias Bahia e São Paulo Polifásica Corais e zoantídeos (Phyllogorgia dilatata e Palythoa caribaeorum) (Chimetto et al., 2010b) Portinho e Preta Limnohabitans australis Lagoa São Paulo Polifásica Lagoa de água doce (Hahn et al., 2010) Kabatana rondoni Peixe da Amazônia Amazônia Ultra-estrutural e molecular Peixe Gymnorhamphichthys rondoni (Casal et al., 2010) Fungi Microscopia Potaspora morhaphis Rio Amazonas Pará ótica, ultra estrutura e região Peixe Potamorhaphis guianensis (Casal et al., 2008) ITS e18s rdna Myxobolus brycon Pantanal Mato Grosso do Sul Morfologia e ultra-estrutural Peixe Brycon hilarii (Azevedo et al., 2011) Protozoa Myxobolus oliveirai Pantanal Mato Grosso do Sul Morfologia, ultra-estruturais,e gene 18S rdna Peixe Brycon hilarii (Milanin et al., 2010) Myxobolus sciades Rio Poti Piauí Microscopia ótica e eletrônica Peixe Sciades herzbergii (Azevedo et al., 2010) Henneguya hemiodopsis Rio Poti Piauí Ultra-estrutural Peixe Hemiodopsis microlepes (Azevedo et al., 2009c) 166

186 Chloromyxum riorajum Costa atlântica Costa atlântica do Sul do Brasil Microscopia ótica e eletrônica e filogenética Peixe Rioraja agassizii (Azevedo et al., 2009a) Loma psittaca Rio Amazonas Pará Microscopia ótica e eletrônica e filogenética Peixe Colomesus psittacus (Casal et al., 2009b) Myxobolus heckelii Rio Tocantins Pará Microscopia ótica e eletrônica Peixe Centromochlus heckelii (Azevedo et al., 2009b) Pantanal Morfologia, Myxobolus cordeiroi (Rios Aquidauna e Mato Grosso Microscopia eletrônica e Bagre (Zungaro jahu) (Adriano et al., 2009) Mirea) molecular Costa Chloromyxum menticirrhi atlântica do Sul do Brasil (Barra da Santa Catarina Microscopia ótica e eletrônica Peixe Menticirrhus americanu (Casal et al., 2009a) Lagoa) Henneguya rondoni Rio Amazonas Pará Microscopia ótica e eletrônica Peixe Gymnorhamphichthys rondoni (Azevedo et al., 2008) Myxobolus metynnis Rio Amazonas Pará Microscopia ótica e eletrônica Peixe Metynnis argenteus (Casal et al., 2006) Discussão O Brasil é um país detentor de megabiodiversidade, com cerca de 20% do número total de espécies descritas no planeta (Mittermeier and Mittermeier, 2004). Ele tem a maior cobertura de floresta tropical (> 6 Km2 milhões, correspondente a aprox. 30 vezes a área do Reino Unido ou aprox. 20 vezes a área da Alemanha) e um dos mais extensos patrimônios marinhos (> 4 milhões de Km 2 ) do planeta. A diversidade de biomas (Amazônia, Mata Atlântica, Pampas, Cerrado, Pantanal, Caatinga e Zona Costeira (ecossistemas como recifes de corais, 167

187 ilhas oceânicas, manguezais, marismas e de mar profundo)) (IBGE, 2004), permite a diversificação de uma variedade de formas de vida. Há de fato uma quantidade considerável de literatura sobre a biodiversidade de plantas e animais no Brasil. Sua diversidade é usada como um parâmetro fundamental na implementação das ações de gestão em áreas prioritárias para a conservação (Myers et al., 2000). Estudos sobre a diversidade microbiana brasileira são relativamente escassos. Por exemplo, só recentemente a diversidade microbiana dos solos da Amazônia e do Cerrado e do meio marinho tem sido estudada de maneira sistemática. O objetivo deste capítulo foi estabelecer uma visão geral sobre os estudos de diversidade microbiana (cerca de 100 trabalhos publicados) realizados no Brasil, principalmente nos últimos cinco anos, incluindo estudos taxonômicos baseados em microrganismos cultivados e não cultivados (baseada em perfis moleculares e rrna 16S bibliotecas de clones). O capítulo se concentrou principalmente em procariontes ambientais (meio aquático e associados a organismos marinhos), aplicados à agricultura (culturas de promotores de crescimento de plantas) e de importância biotecnológica (biorremediação). Entre os mais de 70 estudos sobre comunidades microbianas levantados, destacamos os ecossistemas mais amostrados nos últimos anos. Este levantamento permitiu a obtenção de um panorama da pesquisa nacional sobre a diversidade microbiana dos principais biomas brasileiros Diversidade microbiana nos biomas terrestres Pelo menos um estudo foi realizado em cada grande brasileiro Bioma brasileiro (Tabela 12). A Amazônia é um dos principais hostspots da biodiversidade global. No entanto, a atenção para a biodiversidade microbiana foi rara nas últimas décadas (Borneman and Triplett, 1997). Na região da Amazônia Ocidental um tipo de solo, conhecido como "Terra Preta" é capaz de acumular matéria orgânica estável (Lima et al., 2002). Este tipo de solo tem sido manejado com sucesso por comunidades indígenas pré-colombianas (cerca de 800 anos 168

188 atrás) (Mann, 2002). Este solo caracteriza-se pela alta fertilidade e armazenamento de carbono. Estas características fazem desta região interessante para a investigação de microrganismos promotores de crescimento de plantas. A indução do crescimento ocorre pela síntese de compostos microbianos (por exemplo, vitaminas, antibióticos) que facilita a absorção de nutrientes. Um total de 14 filos foram identificados na Terra Preta e apenas 9 filos foram identificadas em solos adjacentes inalterados, com uma prevalência de Acidobacteria (Kim et al., 2007). O tipo de solo Terra Preta apresenta riqueza de espécies 25% maior que no solo da floresta. Crenarchaeota apresentou predominância no solo adjacente inalterado (Cenciani et al., 2009; Grossman et al., 2010; Jesus et al., 2009). Este grupo de Arquéia tem uma contribuição significativa no ciclo de nitrogênio do solo por meio de oxidação da amônia (Taketani and Tsai, 2010). Até agora, o isolamento e caracterização taxonômica microbiana não foram realizados neste solo, a fim de encontrar possíveis novos microrganismos que possam ser utilizados na fertilização de solos, como já foi visto para outros biomas (Adesemoye et al., 2009; Beneduzi et al., 2008a; Miransari, 2011). Claramente, a pesquisa visando à biodiversidade microbiana na Floresta Amazônica, tem apenas começado a divulgar o enorme potencial do reservatório inexplorado da diversidade microbiana. A Mata Atlântica é também um hotspot de diversidade, e apenas 10% de sua cobertura original ainda está preservada (Myers et al., 2000). A diversidade de comunidades microbianas da Mata Atlântica nos estados do Rio de Janeiro, Paraná e São Paulo foram analisadas. Há um claro domínio do filo Acidobacteria (Bruce et al., 2010; Faoro et al., 2010b). Bactérias como Enterobacteriaceae e Bacillus sp. e fungos micorrízicos como Aspergillus sp., Glomus macrocarpum e Glomus etunicatum foram identificados e parecem executar funções essenciais para a saúde do solo da Mata Atlântica (Souchie et al., 2006). A microbiota do solo da Mata Atlântica pode reduzir sulfatos e promover a reabilitação de 169

189 ambientes contaminados por metais pesados (Muyzer and Stams, 2008). Sulfatos de metais (por exemplo, cádmio, cobalto, cobre, ferro, níquel e zinco) são altamente solúveis, enquanto que os sulfetos de metais correspondentes de baixa solubilidade permitem a precipitação e remoção de contaminantes por microrganismos do solo. Ecossistemas de mangue estão incluídos no bioma Mata Atlântica, e são encontrados em zonas de transição entre os ecossistemas terrestres, marinhos e de água doce por mais de 6 mil quilômetros de costa. Os manguezais são considerados berçários de diversidade, embora estes ecossistemas estejam sujeitos à intensa interferência antrópica modificação no ecossistema através das atividades urbanas e industriais (Amado-Filho et al., 2008). Em janeiro de 2000, as áreas de mangue da Baía de Guanabara sofreram uma das maiores catástrofes ambientais da região devido ao vazamento de cerca de 1,3 milhões de litros de petróleo (Gabardo et al., 2000). A caracterização da diversidade bacteriana e biorremediação pelos microorganismos que habitam o manguezal representam importantes abordagens que podem melhorar a gestão desses ambientes. As comunidades microbianas do manguezal refletem a variação espacial da composição dos sedimentos (Peixoto et al., 2011; Taketani et al., 2010a). A maior abundância de plasmídeos (por exemplo, RIPC-1a, 1b-RIPC, RIPC RIPC-7 e-9) e genes funcionais (naftaleno e intradiol dioxigenases extradiol) envolvidos na degradação de hidrocarbonetos foram identificados nas comunidades microbianas após a exposição ao petróleo (Gomes et al., 2010b). Aparentemente, os níveis elevados de petróleo estão significativamente associados com Betaproteobacteria, enquanto os níveis de hidrocarbonetos aromáticos policíclicos estão associados com Actinobacteria. Gêneros aeróbios envolvidos na degradação do óleo e anaeróbias, incluindo Alteromonadales, Burkholderiales, Pseudomonadales, Rhodobacterales, Rhodocyclales, Marinobacter, Alcanivorax, Microbulbifer, Sphingomonas, Micrococcus, Cellulomonas, Dietzia e Gordonia foram detectados em áreas impactadas (Brito et al., 2006; Gomes et al., 2008). Áreas de 170

190 mangue não impactado apresentam comunidade dominada por Alphaproteobacteria, Gammaproteobacteria e Acidobacteria, enquanto os componentes secundários das comunidades foram identificados como Betaproteobacteria e Actinobacteria (Dias et al., 2010a). Além disso, as baixas concentrações de oxigênio e alta concentração de matéria orgânica criam condições propícias para o estabelecimento de organismos anaeróbicos. Bactérias redutoras de enxofre e Arquéia metanogênicas foram identificadas em diferentes profundidades de sedimentos. Os padrões de distribuição de genes relacionados a esses processos metabólicos (redutase sulfato - dsrb e metil-coenzima A redutase M-mcrA) mostraram uma maior diversidade em sedimentos de profundidades superiores (Taketani et al., 2010b). Estudos sobre os campos de Cerrado incidiram sobre os grupos de microrganismos que desempenham um papel na ciclagem de nutrientes em sistemas agrícolas. O Cerrado é um campo de tipo savana, que está sendo convertida em culturas como soja, milho e café (Marris, 2005) A adubação química muitas vezes resulta em efeitos ambientais inesperados e prejudiciais, incluindo a lixiviação de nitrato para águas subterrâneas, o escoamento superficial de fósforo e nitrogênio e eutrofização dos ecossistemas aquáticos. A fixação biológica do nitrogênio mediada por microrganismos permite uma redução significativa da entrada de fertilizantes nitrogenados. A diversidade de Paenibacillus é mais influenciada pelo tipo de plantio que pela adubação nitrogenada (Coelho et al., 2007). As subpopulações foram identificadas por métodos moleculares, o que representa uma ferramenta útil para monitorar o efeito das práticas agrícolas (de Oliveira et al., 2006). Comunidades fúngicas apresentam 50% de perda da diversidade em solos convertidos em plantações de soja (de Castro et al., 2008). Esse achado reforça a necessidade de preservação do Cerrado, a fim de evitar a perda da diversidade microbiana pela transformação dos 171

191 solos originais em de pastagem. Atualmente, o bioma Cerrado tem apenas cerca de 20% de sua cobertura original e, portanto, está entre os hotspots de conservação (Myers et al., 2000) Diversidade microbiana em ambientes marinhos Ambientes marinhos como recifes de coral, águas costeiras, zonas de ressurgência lagoa hipersalina foram analisados nos últimos anos (Tabela 13). Os primeiros estudos sobre a microbiota do ambiente marinho, centrado na análise do coral holobionte Mussismilia. O gênero Mussismilia compreende 3 espécies (M. hispida, M. braziliensis and M. hartii). Um dos primeiros estudos que investigaram a diversidade microbiana deste coral endêmico do litoral brasileiro, utilizando o gene rrna 16S, foi realizado por Reis et al. (2009) (Reis et al., 2009). As análises revelaram a dominância dos membros do Alphaproteobacteria em M. hispida saudável. A prevalência desse grupo de bactérias do gênero Favia Siderastrea e recifes no Caribe e no Mar Vermelho estão relacionados à doença da banda preta (Barneah et al., 2007; Sekar et al., 2006b). Os gêneros mais comumente encontrados na M. hispida foram Azospirillum, Fabibacter, Blastochloris, Stella, Vibrio, Flavobacterium, Ochrobactrum, Terasakiella, Alkalibacter, Azospirillum, Propionibacterium, Arcobacter e Paenibacillus (de Castro et al., 2010b). Observou-se um enriquecimento de Bacteroidetes em M. braziliensis doentes em comparação com os corais saudáveis e água (de Castro et al., 2010b). A microbiota de corais saudáveis e água do mar circundante apresentam composições diferentes. Além disso, um estudo abrangente sobre a diversidade microbiana das três espécies de Mussismilia por meio de pirosequenciamento da região intergênica dos genes ribossomais revelou uma microbiota residente associada para cada espécie de Mussismilia (em fase de submissão). Esta microbiota residente pode representar endossimbiontes da Mussismilia que co-evoluíram em estreita relação com este holobionte. Esses dados reforçam o modelo de mudança de fase da 172

192 comunidade microbiana em indivíduos saudáveis e doentes (Mao-Jones et al., 2010). Estudos recentes mostraram também que a maioria das comunidades de Arquéia associada à M. hispida parecem incluir novas espécies do filo Crenarchaeota, indicando a necessidade de isolamento microbiano e mais estudos taxonômicos (Lins-de-Barros et al., 2010a; Wegley et al., 2007) Diversidade microbiana em áreas urbanas costeiras A Baía de Guanabara abrange parte da região metropolitana do Rio de Janeiro, que é caracterizada por uma zona de atividade urbana e industrial intensa, com impactos na microbiota associada (Clementino et al., 2007). Os principais parâmetros bióticos envolvidos na formação dessas comunidades microbianas não são completamente compreendidos. Aparentemente, o vazamento de óleo e de esgoto influencia a estrutura da comunidade de bactérias e arquéias, com a dominância de microrganismos indicadores em potencial (Vieira et al., 2007; Vieira et al., 2008). Na Baía de Sepetiba (localizado nas proximidades da cidade do Rio de Janeiro), houve uma redução da diversidade microbiana, possivelmente devido ao despejo de efluentes industriais contaminados por metais (Ex. zinco). Os principais grupos são formados por organismos acidófilos como Acidocella, Acidosphaera e Acidiphilium. A maioria das Arquéias pertence ao filo Crenarchaeota, relacionados aos gêneros Sulfolobus e Metallosphaera (Almeida et al., 2009). Esta lagoa fica nas proximidades da Baía de Guanabara. O primeiro estudo sobre a diversidade de comunidades microbianas da Lagoa de Araruama mostrou os principais grupos taxonômicos e possíveis padrões espaciais relacionadas com a concentração de sal. Os gêneros Methanomicrobia e Methanothermococcus (Arquéia Euryarcheota) foram encontrados em áreas de menor concentração de sal (Clementino et al., 2008). Por outro lado, os gêneros Haloarcula 173

193 (Arquéia) e Salinibacter (bactérias) foram dominantes nas zonas hipersalinas. A comunidade bacteriana da água da lagoa mostrou predomínio de sequências relacionadas com Gammaproteobacteria, Actinobacteria e Synechococcus (Clementino et al., 2008). Estes microrganismos podem estar envolvidos na fixação de nitrogênio e carbono nesta lagoa. O ambiente hipersalino da Lagoa de Araruama mostrou influência sobre o procarionte magnetotático multicelular Candidatus Magnetoglobus multicellularis (Martins et al., 2009). É uma bactéria Gram-negativa, filogeneticamente relacionada às Deltaproteobacteria redutoras de sulfato que foi descrita pela primeira vez na Lagoa de Araruama (Abreu et al., 2007). Essa bactéria se caracteriza por ser capaz de formar um agregado de células bacterianas flageladas, organizado em forma de esfera, que nadam em trajetórias helicoidais ou retas. A composição e abundância dos magnetossomos e o fato de que os magnetossomos podem ser digeridas por seus predadores ciliados sugerem um papel para o Ca. M. multicellularis nos ciclos biogeoquímicos de ferro e enxofre. Sequências de rrna 16S de sequências não classificadas (pelo RDP) foram utilizadas na reconstrução filogenética, a fim de revelar os vizinhos filogenéticos mais próximos. Amostras de solo foram mais heterogêneas do que as sequências da água (Figura 53 e 54). Foram observadas sequências altamente relacionadas filogeneticamente, porém identificadas em diferentes trabalhos. Esse achado reforça a idéia de que existem grupos microbianos desconhecidos que são frequentes e, possivelmente, estão envolvidos com funções ecológicas primordiais nesses ambientes. Porém, esses grupos ainda não foram caracterizados taxonomicamente e merecem novos estudos, pois representam novos filos ou classes em potencial. A abundância relativa de filos dominantes como as Cyanobacteria da microbiota aquática e Bacteroidetes associados a organismos aquáticos é heterogênea entre os ecossitemas analisados (Figura 55). Por outro lado, filos dominantes em biomas terrestres 174

194 como Acidobacteria e Actinobacteria são distribuídos de maneira relativamente uniforme entre os solos da Mata Atlântica e Cerrado. Figura 53. Análise filogenética de sequências não classificadas, recuperadas da água. As sequências foram comparadas com sequências tipo a aprtir de comparação com o RDP. Todas as sequências foram alinhadas usando o programa Muscle. As análises filogenéticas foram realizadas com o programa Mega, usando o método de neighbor joining. Valores de bootstrap (1000 repetições) > 50 % são mostrados. A linha azul corresponde a OTUs com alta similaridade (> 97 %) entre os genes rrna 16S encontrados por diferentes autores em ambientes aquáticos. É importante salientar os longos ramos, 175 que representam novos grupos taxonômicos em potencial.

195 Figura 54. Análise filogenética de sequências não classificadas, recuperadas do solo. As sequências foram comparadas com sequências tipo a aprtir de comparação com o RDP. Todas as sequências foram alinhadas usando o software Muscle. As análises filogenéticas foram realizadas com o software Mega, usando o método de neighbor-joining. Valores de bootstrap (1000 repetições) > 50 % são mostrados. A linha verde corresponde ao exemplo de sequências singletons, com grande distância evolutiva em comparação com as sequências do gene 16S rrna linhagens de tipo, demonstrando a heterogeneidade da diversidade de Bactérias dos solos. 176

196 Figura 55. Estrutura das comunidades bacterianas associadas ao solo, água e organismos marinhos.a classificação foi realizada através de comparação com o RDP. A análise foi realizada com sequências de ecossistemas terrestres e 1864 sequências marinhas. 177

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

Abordagens moleculares no estudo da diversidade microbiana

Abordagens moleculares no estudo da diversidade microbiana A vida sem microrganismos não seria possível! Abordagens moleculares no estudo da diversidade microbiana Teresa Lino Neto tlneto@bio.uminho.pt Departamento de Biologia Universidade do Minho 1 Importantes

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

DNA barcoding é um método que utiliza um trecho do DNA de cerca de 650 nucleotídeos como marcador para caracterizar espécies. Trata-se de uma sequência extremamente curta em relação à totalidade do genoma,

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal Fepagro em foco Samuel Mazzinghy Alvarenga Histórico recente da Agropecuária Era científica: a partir de ~ 1.700 Rotação de culturas e métodos de cultivo intensivo Drenagem Utilização de arado, máquinas

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Aula 2 Transformações de Carbono e Energia

Aula 2 Transformações de Carbono e Energia 1.018/7.30J Outono 2003 Fundamentos da Ecologia Aula 2 Transformações de Carbono e Energia LEITURAS PARA A PRÓXIMA AULA: Krebs, Capítulo 25: Ecosystem Metabolism I: Primary Productivity Luria. 1975. Overview

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA GENÉTICA BACTERIANA INTRODUÇÃO O DNA existe como uma hélice de fita dupla, mantidas pelo pareamento de bases nitrogenadas específicas (AT; CG). - A seqüência de bases codifica a informação genética; -

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

4 Monitoramento ambiental

4 Monitoramento ambiental 4 Monitoramento ambiental O monitoramento ambiental é uma importante ferramenta para a administração dos recursos naturais. Este oferece conhecimento e informações básicas para avaliar a presença de contaminantes,

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

EDITAL N 01/2008/INPA CONCURSO PÚBLICO ANEXO I VAGAS CONFORME AS CARREIRAS E PERFIS CORRESPONDENTES E LISTA DE TEMAS PARA PROVA ESCRITA.

EDITAL N 01/2008/INPA CONCURSO PÚBLICO ANEXO I VAGAS CONFORME AS CARREIRAS E PERFIS CORRESPONDENTES E LISTA DE TEMAS PARA PROVA ESCRITA. EDITAL N 01/2008/INPA CONCURSO PÚBLICO ANEXO I VAGAS CONFORME AS CARREIRAS E PERFIS CORRESPONDENTES E LISTA DE TEMAS PARA PROVA ESCRITA. 1. CARREIRA DE PESQUISA EM CIÊNCIA E TECNOLOGIA CARGO DE PESQUISADOR

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Bioinformática. Trabalho prático enunciado complementar. Notas complementares ao 1º enunciado

Bioinformática. Trabalho prático enunciado complementar. Notas complementares ao 1º enunciado Bioinformática Trabalho prático enunciado complementar Neste texto, enunciam- se algumas considerações adicionais ao 1º enunciado e uma lista de possíveis tarefas que complementam o enunciado original

Leia mais

O USO DA BIODIVERSIDADE COMO PRESERVAÇÃO AMBIENTAL

O USO DA BIODIVERSIDADE COMO PRESERVAÇÃO AMBIENTAL O USO DA BIODIVERSIDADE COMO PRESERVAÇÃO AMBIENTAL Stefani de Souza Patricia de Freitas Co-autor - Prof. MSc. Cristian Coelho Silva cristian_coelho@yahoo.com.br luscheuer@hotmail.com Palavras-chave: sustentabilidade,

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

BIOLOGIA NO ENEM: CONTEÚDO PROGRAMÁTICO

BIOLOGIA NO ENEM: CONTEÚDO PROGRAMÁTICO BIOLOGIA NO ENEM: CONTEÚDO PROGRAMÁTICO O ENEM, Exame Nacional do Ensino Médio, em sua versão 2012, apresentará uma redação e 180 questões objetivas, divididas nas quatro áreas do conhecimento: - Ciências

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

Recursos Genéticos brasileiros. Derly José Henriques da Silva Professor do Departamento de Fitotecnia Universidade Federal de Viçosa

Recursos Genéticos brasileiros. Derly José Henriques da Silva Professor do Departamento de Fitotecnia Universidade Federal de Viçosa Recursos Genéticos brasileiros Derly José Henriques da Silva Professor do Departamento de Fitotecnia Universidade Federal de Viçosa Acesso aos recursos genéticos (antes da CDB ECO - RIO 1992) recursos

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

Formas do fósforo: -Ortofosfatos: PO 4 3-, HPO 4 2-, H 2 PO 4 -, H 3 PO 4

Formas do fósforo: -Ortofosfatos: PO 4 3-, HPO 4 2-, H 2 PO 4 -, H 3 PO 4 CICLO DO FÓSFORO O fósforo é um não-metal multivalente pertencente à série química do nitrogênio (grupo 15 ou 5 A) que se encontra na natureza combinado, formando fosfatos inorgânicos, inclusive nos seres

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

1º ano. Construir um modelo para representar o processo de duplicação do DNA. Livro 1- Unidade 5 - p. 136

1º ano. Construir um modelo para representar o processo de duplicação do DNA. Livro 1- Unidade 5 - p. 136 Estudo das Origens O que é a Biologia? A Biologia no contexto histórico. A Biologia e suas áreas de atuação. Os Métodos científicos utilizados em pesquisas nas áreas da Biologia em Roraima, no Brasil e

Leia mais

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Darwin Voltar Filogenia anatômica e fisiológica Filogênia Molecular A teoria da evolução de Darwin gerou o conceito

Leia mais

TRANSFERÊNCIA DE GENES EM BACTÉRIAS

TRANSFERÊNCIA DE GENES EM BACTÉRIAS TRANSFERÊNCIA DE GENES EM BACTÉRIAS SEXO BACTERIANO Bactérias podem trocar ou transferir DNA entre elas por três diferentes vias. Em todos os casos, as células que fornecem o DNA são chamadas de DOADORAS

Leia mais

Analise filogenética baseada em alinhamento de domínios

Analise filogenética baseada em alinhamento de domínios Analise filogenética baseada em alinhamento de domínios Moléculas biológicas e evolução Como já foi comentado anteriormente sabemos que o DNA de qualquer espécie de ser vivo sofre mutações ao longo do

Leia mais

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!!

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!! Miguel Rocha Dep. Informática - Universidade do Minho BIOINFORMÁTICA: passado, presente e futuro!! Bragança, 11 de Maio de 2006 Porquê a Bioinformática?! Novas tecnologias experimentais da Biologia Molecular

Leia mais

Escola Secundária de Forte da Casa

Escola Secundária de Forte da Casa Escola Secundária de Forte da Casa Informação - Prova de Equivalência à Frequência / 2012 2013 (Decreto Lei nº 139/2012, de 5 de Julho e Portaria nº 243/2012, de 10 de agosto) 12ºAno Cursos Científico-Humanísticos

Leia mais

DESPERDÍCIO - Gaivotas disputam peixes jogados ao mar por barco britânico em 2013: a pesca superou a cota fixada pela União Europeia

DESPERDÍCIO - Gaivotas disputam peixes jogados ao mar por barco britânico em 2013: a pesca superou a cota fixada pela União Europeia 1 de 5 31/01/2014 23:42 Aumentar a fonte Diminuir a fonte BIODIVERSIDADE Martha San Juan França DESPERDÍCIO - Gaivotas disputam peixes jogados ao mar por barco britânico em 2013: a pesca superou a cota

Leia mais

PROCESSO SELETIVO BIOLOGIA ÁREA: CIÊNCIAS DA NATUREZA, MATEMÁTICA E SUAS TECNOLOGIAS

PROCESSO SELETIVO BIOLOGIA ÁREA: CIÊNCIAS DA NATUREZA, MATEMÁTICA E SUAS TECNOLOGIAS PROCESSO SELETIVO BIOLOGIA ÁREA: CIÊNCIAS DA NATUREZA, MATEMÁTICA E SUAS TECNOLOGIAS Perceber e utilizar os códigos intrínsecos da Biologia. Relacionar o conhecimento das diversas disciplinas para o entendimento

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

Histórico e conceitos em conservação e uso de recursos

Histórico e conceitos em conservação e uso de recursos Histórico e conceitos em conservação e uso de recursos genéticos 1. Introdução Os recursos fitogenéticos são as bases da subsistência da humanidade. Suprem as necessidades básicas e ajudam a resolver problemas

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS. ECOLOGIA Conceitos e Sucessão Ecológica

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS. ECOLOGIA Conceitos e Sucessão Ecológica UFRGS ECOLOGIA Conceitos e Sucessão Ecológica 1. (Ufrgs 2014) Considere as seguintes afirmações sobre conceitos utilizados em ecologia. I. Nicho ecológico é a posição biológica ou funcional que um ecossistema

Leia mais

ECOSSISTEMA INDIVÍDUO

ECOSSISTEMA INDIVÍDUO Biodiversidade O diversidade biológica - descreve a riqueza e a variedade do mundo natural. As plantas, os animais e os microrganismos fornecem alimentos, remédios e boa parte da matéria-prima industrial

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Bacteria Archaea Eukarya

Bacteria Archaea Eukarya PROVA PARA AVALIAÇÃO DE CAPACIDADE PARA FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS 2014/2015 Instituto Superior de Engenharia Licenciatura em Tecnologia e Segurança Alimentar Componente específica

Leia mais

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano)

Mutações. Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Disciplina: Fundamentos de Genética e Biologia Molecular Turma: Fisioterapia (1 o Ano) Mutações Docente: Profa. Dra. Marilanda Ferreira Bellini E-mail: marilanda_bellini@yahoo.com Blog: http://marilandabellini.wordpress.com

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Epigenética e Memória Celular

Epigenética e Memória Celular Epigenética e Memória Celular Por Marcelo Fantappié Fonte www.revistacarbono.com A epigenética é definida como modificações do genoma que são herdadas pelas próximas gerações, mas que não alteram a sequência

Leia mais

Disciplinas. Dinâmica de Potássio no solo e sua utilização nas culturas

Disciplinas. Dinâmica de Potássio no solo e sua utilização nas culturas Disciplinas Solos nos domínios morfoclimáticos do cerrado Ementa: Solos em ambientes de Cerrado. Sistema Brasileiro de Classificação do Solo. Caracterização morfológica das principais classes de solo inseridas

Leia mais

The next generation sequencing

The next generation sequencing The next generation sequencing Cesar Martins (cmartins@ibb.unesp.br) Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP 1 Métodos Atuais Sequenciamento

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE

BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE BIOINDICADORES E BIOMARCADORES DE AGROQUÍMICOS NO CONTEXTO DA RELAÇÃO SAÚDE-AMBIENTE Cláudio Martin Jonsson Vera Lúcia Castro Jaguariúna, outubro 2005. O modelo de agricultura utilizado atualmente visa

Leia mais

ALUNO(a): Observe o esquema a seguir, no qual I e II representam diferentes estruturas citoplasmáticas.

ALUNO(a): Observe o esquema a seguir, no qual I e II representam diferentes estruturas citoplasmáticas. GOIÂNIA, / / 2015 PROFESSOR: DISCIPLINA: SÉRIE: 3º ano ALUNO(a): Lista de Exercícios NOTA: No Anhanguera você é + Enem Questão 01) Observe o esquema a seguir, no qual I e II representam diferentes estruturas

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Proposta de 20 Metas Brasileiras de Biodiversidade para 2020

Proposta de 20 Metas Brasileiras de Biodiversidade para 2020 Proposta de 20 Metas Brasileiras de Biodiversidade para 2020 Propostas encaminhadas pela sociedade brasileira após consulta envolvendo cerca de 280 instituições dos setores: privado, ONGs, academia, governos

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL. O 2(g) O 2(aq)

QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL. O 2(g) O 2(aq) QUESTÕES DE CARACTERIZAÇÃO E ANÁLISE AMBIENTAL Questão 01 O agente oxidante mais importante em águas naturais é, sem a menor dúvida, o oxigênio molecular dissolvido, O 2. O equilíbrio entre o oxigênio

Leia mais

Novas Tecnologias de Sequenciamento

Novas Tecnologias de Sequenciamento Novas Tecnologias de Sequenciamento Tecnologias de sequenciamento Sanger (Capilaridade) Uma das inovações tecnológicas de maior influência na pesquisa biológica, desde que foi lançada em 1977 Abordagem

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

CICLOS BIOGEOQUÍMICOS

CICLOS BIOGEOQUÍMICOS CICLOS BIOGEOQUÍMICOS O fluxo de energia em um ecossistema é unidirecional e necessita de uma constante renovação de energia, que é garantida pelo Sol. Com a matéria inorgânica que participa dos ecossistemas

Leia mais

Rio de Janeiro, 23 de junho de 2008.

Rio de Janeiro, 23 de junho de 2008. Rio de Janeiro, 23 de junho de 2008. A presente nota objetiva auxiliar na discussão acerca da definição da expressão derivados dos recursos genéticos no âmbito da internalização do terceiro objetivo da

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Escola Secundária de Camões

Escola Secundária de Camões Escola Secundária de Camões INFORMAÇÃO - PROVA DE EQUIVALÊNCIA À FREQUÊNCIA BIOLOGIA Código 302 Curso Científico-Humanístico de Ciências e Tecnologias- 12ºano Duração da prova escrita: 90 min Duração da

Leia mais

QUESTÕES ENVOLVENDO ASPECTOS GERAIS DA CITOLOGIA COM ÊNFASE NA IMPORTÂNCIA DAS MEMBRANAS BIOLÓGICAS PARA O MUNDO VIVO. Prof.

QUESTÕES ENVOLVENDO ASPECTOS GERAIS DA CITOLOGIA COM ÊNFASE NA IMPORTÂNCIA DAS MEMBRANAS BIOLÓGICAS PARA O MUNDO VIVO. Prof. Questão 01 QUESTÕES ENVOLVENDO ASPECTOS GERAIS DA CITOLOGIA COM ÊNFASE NA IMPORTÂNCIA DAS MEMBRANAS BIOLÓGICAS PARA O MUNDO VIVO Prof. Cláudio Góes O mundo vivo é construído de tal forma que podemos estabelecer

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Desenvolvimento de novas leveduras para o desafio da fermentação alcoólica

Desenvolvimento de novas leveduras para o desafio da fermentação alcoólica Desenvolvimento de novas leveduras para o desafio da fermentação alcoólica Osmar Vaz de Carvalho Netto osmar@lge.ibi.unicamp.br Laboratório de Genômica e Expressão Instituto de Biologia - UNICAMP V Semana

Leia mais

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1001 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B100010RJ Observe o esquema abaixo. 46 23 46 23 46 23 23 Disponível em: . Acesso

Leia mais

Genômica. O que chamou mais atenção no filme?

Genômica. O que chamou mais atenção no filme? Genômica O que chamou mais atenção no filme? Tempo para sequenciamento do genoma Predição do fenótipo com base no genótipo Como este conhecimento pode ser usado para gerar novas tecnologias? Sequenciamento

Leia mais

MUTAÇÃO E REPARO DO DNA

MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Aula 8 META Discutir os principais mecanismos geradores de mutação e suas conseqüências, assim como o papel dos mecanismos de reparo do DNA na manutenção da estabilidade e sobrevivência

Leia mais

Antigas doutrinas da Índia, da Babilônia e do Egito ensinavam que rãs, cobras e crocodilos eram gerados pelo lodo dos rios.

Antigas doutrinas da Índia, da Babilônia e do Egito ensinavam que rãs, cobras e crocodilos eram gerados pelo lodo dos rios. 1 2 Antigas doutrinas da Índia, da Babilônia e do Egito ensinavam que rãs, cobras e crocodilos eram gerados pelo lodo dos rios. Esses seres, que apareciam inexplicavelmente no lodo, eram encarados como

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Uso de Microorganismos na Produção de Álcool.

Uso de Microorganismos na Produção de Álcool. Uso de Microorganismos na Produção de Álcool. Microorganismos são fontes ricas de produtos naturais, podem ser usadas como combustíveis, produtos químicos: polímeros e drogas. A habilidade de manipular

Leia mais

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula

BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

O desmatamento das florestas tropicais responde por 25% das emissões globais de dióxido de carbono, o principal gás de efeito estufa.

O desmatamento das florestas tropicais responde por 25% das emissões globais de dióxido de carbono, o principal gás de efeito estufa. Biodiversidade Introdução Na Estratégia Nacional para a Biodiversidade, desenvolvida pelo Ministério do Meio Ambiente, acordou-se que o Brasil deve dar ênfase para seis questões básicas: conhecimento da

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Simulado Biologia UNICAMP 2014-2013

Simulado Biologia UNICAMP 2014-2013 1. (Unicamp 2014) Considere os seguintes componentes celulares: I. parede celular II. membrana nuclear III. membrana plasmática IV. DNA É correto afirmar que as células de a) fungos e protozoários possuem

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais