Módulo I Bio 1 Cap 1 composição química

Tamanho: px
Começar a partir da página:

Download "Módulo I Bio 1 Cap 1 composição química"

Transcrição

1 Módulo I Bio 1 Cap 1 composição química QUESTÕES OBJETIVAS 1. (PUC) O citoplasma celular é composto por organelas dispersas numa solução aquosa denominada citosol. A água, portanto, tem um papel fundamental na célula. Das funções que a água desempenha no citosol, qual NÃO está correta? a) Participa no equilíbrio osmótico. b) Catalisa reações químicas. c) Atua como solvente universal. d) Participa de reações de hidrólise. e) Participa no transporte de moléculas. 2. A principal substância INORGÂNICA que encontramos nas células dos seres vivos é (são): a) a água. b) gorduras. c) proteínas. d) sais. e) vitaminas. 3. (PUC) Recentes descobertas sobre Marte, feitas pela NASA, sugerem que o Planeta Vermelho pode ter tido vida no passado. Esta hipótese está baseada em indícios a) da existência de esporos no subsolo marciano. b) da presença de uma grande quantidade de oxigênio em sua atmosfera. c) de marcas deixadas na areia por seres vivos. d) da existência de água líquida no passado. e) de sinais de rádio oriundos do planeta. 4. (ENEM) A água é um dos componentes mais importantes das células. A tabela a seguir mostra como a quantidade de água varia em seres humanos, dependendo do tipo de célula. Em média, a água corresponde a 70% da composição química de um indivíduo normal. Durante uma biópsia, foi isolada uma amostra de tecido para anáiise em um laboratório. Enquanto intacta, essa amostra pesava 200 mg. Após secagem em estufa, quando se retirou toda a água do tecido, a amostra passou a pesar 80 mg. Baseado na tabela, pode-se afirmar que essa é uma amostra de a) tecido nervoso - substância cinzenta. b) tecido nervoso - substância branca. c) hemácias. d) tecido conjuntivo. e) tecido adiposo. 5. A água apresenta inúmeras propriedades que são fundamentais para os seres vivos. Qual, dentre as características a seguir relacionadas, é uma propriedade da água de importância fundamental para os sistemas biológicos? a) Possui baixo calor específico, pois sua temperatura varia com muita facilidade. b) Suas moléculas são formadas por hidrogênios de disposição espacial linear. c) Seu ponto de ebulição é entre 0 e 100 C. d) É um solvente limitado, pois não é capaz de se misturar com muitas substâncias. 1

2 e) Possui alta capacidade térmica e é solvente de muitas substâncias. 6. (UEL) O gráfico a seguir mostra as taxas de absorção e de transpiração de uma planta durante 24 horas. A análise do gráfico permite afirmar que a) a absorção é sempre mais intensa do que a transpiração. b) a absorção só ocorre durante as horas iluminadas do dia. c) a transpiração cessa totalmente durante a noite. d) os dois processos são mais intensos em torno das 16 horas. e) os dois processos apresentam valores idênticos às 6 horas 7. (UFMG) Esta figura representa um fenômeno observado após a poda anual das videiras. A alternativa que melhor explica o fenômeno é a) a abertura dos estômatos provocando a eliminação da seiva. b) a sucção de água pelas células dos ramos da planta. c) o deslocamento da seiva devido à pressão de raiz. d) o transporte ativo da seiva pelas células das raízes da videira. 8. Considere as seguintes afirmativas: I. A ocorrência do processo Z é independente do processo X. II. Os vasos lenhosos são responsáveis pelo processo Y. III. A ocorrência do processo Z é dependente do processo X. Está(ão) correta(s) a) apenas I. b) apenas II. c) apenas III. d) apenas I e II. e) apenas II e III. 2

3 Cap 02 Sais minerais 1.(UFG) Leia o texto a seguir. As três décadas de estudos sobre os alimentos, o metabolismo humano e a fisiologia do esporte mostram que as dietas radicais não funcionam. Na busca do corpo saudável e esbelto, a melhor dieta é a do bom senso. Uma das dietas mundialmente conhecidas proíbe o consumo de leite e derivados e limita muito o consumo de proteínas. Essas restrições levam à carência de minerais, especialmente o cálcio e ferro. (VEJA, São Paulo, mar. 2007, n. 11, p. 62. [Adaptado]). Um indivíduo adulto que adotou essa dieta por um período prolongado pode apresentar a) hemorragia e escorbuto. b) cegueira noturna e xeroftalmia. c) beribéri e pelagra. d) bócio endêmico e cãibras. e) osteoporose e anemia. 2. No tipo mais comum de hemofilia, há a incapacidade de produção do fator VIII, necessário ao processo de coagulação sangüínea. Esse processo envolve enzimas que, para seu funcionamento, devem estar associadas a(à) a) íons Cl - b) vitamina A. c) vitamina E. d) íons Ca +2. e) vitamina D. 3. Referindo-se à composição química da célula, é correto afirmar que os (as) a) sais minerais, dentre outras funções, mantêm o controle osmótico das células. b) lipídios são compostos orgânicos de função energética, com alta solubilidade em água. c) carboidratos são os principais produtos orgânicos a desempenhar função estrutural na composição das células. d) proteínas presentes na membrana plasmática desempenham a função de reserva celular, sendo normalmente utilizadas como fonte de energia primária. 4. (UFU) Os íons cálcio (Ca +2 ) estão presentes no corpo humano com diferentes funções, sendo fundamentais em atividades do dia-a-dia, como uma simples caminhada ou o ato de falar. São importantes, ainda, na hemostasia e podem aparecer como co-responsáveis por patologias. Sobre os Ca +2, leia as opções a seguir e marque a correta. a) Durante o repouso, antes da contração muscular, os Ca +2 são liberados no músculo, para retirar o excesso de ácido lático produzido na contração anterior. b) O Ca +2 está presente na cascata de coagulação sangüínea, atuando, juntamente com a tromboplastina, na conversão de protrombina em trombina. c) O excesso de Ca +2 retirado dos ossos devido à hipofunção das glândulas paratireóides e a grande reabsorção de água pelos túbulos coletores retos, ocasionada por glomerulonefrites e cistites, são os fatores responsáveis pela calculose renal. d) O tecido ósseo, tipo de tecido conjuntivo, além de importantes funções como proteção do sistema nervoso central, também constitui a segunda maior reserva de Ca +2 do organismo, perdendo apenas para os dentes. 5. Associe os elementos químicos da coluna superior com as funções orgânicas da coluna inferior. 1. Magnésio 2. Potássio 3. Iodo 4. Cálcio 5. Sódio 6. Ferro ( ) formação do tecido ósseo ( ) transporte de oxigênio ( ) assimilação de energia luminosa ( ) equilíbrio de água no corpo ( ) transmissão de impulso nervoso 3

4 A seqüência numérica correta, de cima para baixo, na coluna inferior, é a) b) c) d) e) (UNESP) Considere um grupo de pessoas com características homogêneas no que se refere à cor de pele. Assinale a alternativa, dentre as apresentadas, que corresponde às pessoas desse grupo que têm maior chance de apresentar deficiência de vitamina D e que estão mais sujeitas a fraturas ósseas. a) Indivíduos que ingerem alimentos ricos em cálcio, como ovos e derivados do leite, e que freqüentemente tomam sol. b) Indivíduos que ingerem alimentos pobres em cálcio, como ovos e derivados do leite, e que freqüentemente tomam sol. c) Indivíduos que ingerem alimentos pobres em cálcio, como ovos e derivados do leite, e que raramente tomam sol. d) Indivíduos que ingerem alimentos ricos em cálcio, como frutas cítricas e arroz, e que raramente tomam sol. e) Indivíduos que ingerem alimentos pobres em cálcio, como frutas cítricas e arroz, e que raramente tomam sol. 7. (MACKENZIE) "Durante todo o ano de 1995, o governo deixou de fornecer iodato de potássio aos fabricantes de sal. O iodo é essencial para o ser humano. Problemas, porém, só se manifestam em populações subnutridas, que não incluem em sua alimentação produtos do mar, uma rica fonte natural de iodo." (Revista VEJA - 03/04/96) Assinale a alternativa que apresenta, respectivamente, o nome da glândula afetada e a doença provocada pela falta desse elemento. a) adeno-hipófise e nanismo b) tireóide e bócio c) supra-renal e doença de Cushing d) pâncreas e 'diabetes mellitus' e) neuro-hipófise e 'diabetes insipidus' 8. No processo de contração e relaxamento muscular, o elemento mineral mais diretamente presente é o: a) cálcio b) iodo c) mercúrio d) ferro 9. (UERJ) A força de contração da fibra muscular estriada é definida pela tensão desenvolvida pelos filamentos de miosina e actina do sarcômero e sofre influência do grau de superposição desses filamentos. (GUYTON, A. C. & HALL, J. E. "Tratado de Fisiologia Médica" Rio de Janeiro: Guanabara Koogan, 1997.) De acordo com o gráfico, podemos dizer que a molécula de miosina apresenta uma interação mais eficiente com a actina entre os seguintes segmentos: a) O e A b) A e B c) B e C d) C e D 4

5 10. (UERJ) O balanço de cálcio é a diferença entre a quantidade de cálcio ingerida e a quantidade excretada na urina e nas fezes. É usualmente positivo durante o crescimento e a gravidez e negativo na menopausa, quando pode ocorrer a osteoporose, uma doença caracterizada pela diminuição da absorção de cálcio pelo organismo. A baixa concentração de íon cálcio (Ca++) no sangue estimula as glândulas paratireóides a produzirem hormônio paratireóideo (HP). Nesta situação, o hormônio pode promover a remoção de cálcio dos ossos, aumentar sua absorção pelo intestino e reduzir sua excreção pelos rins. (Adaptado de ALBERTS, B. et al., Biologia Molecular da Célula. Porto Alegre: Artes Médicas, 1997.) O gráfico que melhor pode expressar a relação entre a produção do hormônio pelas paratireóides e a concentração de íon cálcio no sangue, é: a) b) c) d) Cap. 03 glicídios 1. (UFEPEL)Durante muito tempo acreditou-se que os carboidratos tinham funções apenas energéticas para os organismos. O avanço do estudo desses compostos, porém, permitiu descobrir outros eventos biológicos relacionados aos carboidratos. "Ciência Hoje". V. 39., [adapt.]. Baseado no texto e em seus conhecimentos, é INCORRETO afirmar que a) os carboidratos são fundamentais no processo de transcrição e replicação, pois participam da estrutura dos ácidos nucléicos. b) os carboidratos são importantes no reconhecimento celular, pois estão presentes externamente na membrana plasmática, onde eles formam o glicocálix. c) os triglicérides ou triacilglicerídeos, carboidratos importantes como reserva energética, são formados por carbono, hidrogênio e oxigênio. d) tanto quitina, que forma a carapaça dos artrópodes, quanto a celulose, que participa da formação da parede celular, são tipos de carboidratos. e) o amido, encontrado nas plantas, e o glicogênio, encontrado nos fungos e animais, são exemplos de carboidratos e têm como função a reserva de energia. 2. (UFMG) Os possíveis ancestrais das plantas com flor descendem de um grupo de algas verdes. Considerando-se essa informação, é INCORRETO afirmar que os DOIS grupos mencionados têm EM COMUM 5

6 a) a clorofila como pigmento fotossintetizante. b) a parede celular com celulose. c) o glicogênio como fonte de energia. d) os pigmentos acessórios de diversas cores. 3. Uma dieta alimentar pobre em carboidratos e rica em proteínas deve conter respectivamente: a) Pouca carne e muitos farináceos. b) Pouco leite e muitas verduras. c) Pouca carne e muitas verduras. d) Pouco leite e muito açúcar. e) Poucos farináceos e muita carne. 4. (PUC) A figura mostra cinco tipos de moléculas de grande importância para uma célula animal. Analise o esquema, reflita sobre esse assunto e assinale a afirmativa INCORRETA. a) Uma das moléculas apresentadas pode fornecer informações para a produção de uma outra representada. b) Uma das moléculas representadas no desenho não é normalmente encontrada no citoplasma celular. c) Apenas duas das moléculas indicadas na figura podem ser quebradas e fornecer energia para as células. d) Uma das moléculas representadas pode favorecer a captação do carboidrato indicado no esquema. 5. A ingestão diária de leite pode causar perturbações digestivas em milhões de brasileiros que apresentam intolerância a esse alimento, a qual é provocada pela deficiência de lactase no adulto, uma condição determinada geneticamente e de prevalência significativa no Brasil. "CIÊNCIA HOJE", v. 26, n. 152, ago. 1999, p. 49. [Adaptado]. Tendo em vista o tema apresentado acima, é INCORRETO afirmar: a) A lactose, presente no leite, bem como outros carboidratos de origem animal representam uma importante fonte de energia na dieta humana. b) A lactase, assim como outras enzimas, tem sua atividade influenciada por diversos fatores, tais como a temperatura e o ph. c) A lactase é uma enzima que age sobre a lactose, quebrando-a em duas moléculas, sendo uma de maltose e outra de galactose. d) O efeito simultâneo da desnutrição e das infecções intestinais pode resultar em deficiência secundária de lactase, aumentando ainda mais o número de pessoas com intolerância à lactose. 6. Pesquisadores franceses identificaram um gene chamado de RN, que, quando mutado, altera o metabolismo energético do músculo de suínos, provocando um acúmulo de glicogênio muscular, o que prejudica a qualidade da carne e a produção de presunto (Pesquisa "FAPESP", n. 54, p. 37, 2000). Com base nos conhecimentos sobre o glicogênio e o seu acúmulo como reserva nos vertebrados, é correto afirmar: a) É um tipo de glicolipídeo de reserva muscular acumulado pela ação da adrenalina. b) É um tipo de glicoproteína de reserva muscular acumulado pela ação do glucagon. c) É um polímero de glicose estocado no fígado e nos músculos pela ação da insulina. d) É um polímero de frutose, presente apenas em músculos de suínos. e) É um polímero protéico estocado no fígado e nos músculos pela ação do glucagon. 7. Inmetro: ovo diet não alerta que contém lactose. "O rótulo de um determinado ovo de Páscoa diet, além de não informar sobre a presença de lactose, afirmava que o produto não continha açúcar. Segundo o fabricante, a lactose encontrada no ovo era proveniente do leite utilizado na confecção do chocolate e não adicionada aos ingredientes." (Adaptação - "O Globo", 2003) 6

7 A falta de informações precisas sobre a composição dos alimentos pode trazer complicações à saúde e, neste caso, principalmente à dos diabéticos, pois a) a lactose, após ser absorvida pelo intestino, é utilizada da mesma forma que a glicose. b) a concentração alta de lactose acabará fornecendo elevado teor de glicose no sangue. c) a lactose se prende aos mesmos receptores celulares da insulina, aumentando a entrada de glicose nas células. d) os diabéticos não metabolizam a lactose, aumentando sua concentração sanguínea. e) a lactose, após ser absorvida, estimula a liberação de glucagon, aumentando a taxa de glicose sanguínea. 8. (UERJ) Em uma determinada etapa metabólica importante para geração de ATP no músculo, durante a realização de exercícios físicos, estão envolvidas três substâncias orgânicas - ácido pirúvico, gliceraldeído e glicose - identificáveis nas estruturas X, Y e Z a seguir. Na etapa metabólica considerada, tais substâncias se apresentam na seguinte seqüência: a) X - Y - Z b) Z - Y - X c) X - Z - Y d) Z - X Y 9. (UNIFESP) Uma dieta com consumo adequado de carboidratos, além de prover energia para o corpo, ainda proporciona um efeito de "preservação das proteínas". A afirmação está correta porque: a) os carboidratos, armazenados sob a forma de gordura corpórea, constituem uma barreira protetora das proteínas armazenadas nos músculos. b) se as reservas de carboidratos estiverem reduzidas, vias metabólicas sintetizarão glicose a partir de proteínas. c) as enzimas que quebram os carboidratos interrompem a ação de outras enzimas que desnaturam proteínas. d) o nitrogênio presente nos aminoácidos das proteínas não pode ser inativado em presença de carboidratos. e) a energia liberada pela quebra de carboidratos desnatura enzimas que degradam proteínas. 10.(UFF) Considerando que uma célula tenha parede celular sem quitina, fuso mitótico sem presença de centríolos e membrana citoplasmática composta de proteínas, fosfolipídios e carboidratos, pode-se concluir que essa célula e de um(a) a) alface b) bactéria c) cogumelo d) cachorro e) levedura Cap.04 lipídeos 1. Encontro em lanchonetes ou no intervalo das aulas é uma das atividades de lazer de crianças e de adolescentes, e a comida preferida é o lanche à base de hambúrguer com maionese e ketchup, batata frita, salgadinhos, refrigerantes, entre outros. Porém esses alimentos vêm sofrendo condenação pelos médicos e nutricionistas, em especial por conterem componentes não recomendados, que são considerados "vilões" para a saúde dessa população jovem como, por exemplo, as gorduras trans e o excesso de sódio. Entre os componentes da gordura presentes nesses alimentos, o que oferece maior risco à saúde humana é aquele que contém os ácidos graxos saturados e gorduras trans. Segundo especialistas no assunto, as gorduras são necessárias ao corpo, pois fornecem energia e ácidos graxos essenciais ao organismo, porém a trans é considerada pior que a gordura saturada, pois está associada ao aumento do nível do colesterol LDL (indesejável) e à diminuição do HDL (desejável). A Anvisa (Agência Nacional de Vigilância Sanitária) determinou que, a partir de 1. de agosto de 2006, as empresas devem especificar nos rótulos o teor de gordura trans de seus produtos. 7

8 É válido afirmar que a finalidade dessa determinação é a) esclarecer ou alertar sobre a quantidade de gorduras saturadas e de gordura trans. b) eliminar a adição de gorduras ou de ácidos graxos nos alimentos industrializados. c) substituir as gorduras ditas trans por gorduras saturadas desejáveis ao organismo humano. d) estimular o consumo de outros alimentos, em especial à base de carboidratos. e) alertar sobre a necessidade dos ácidos graxos essenciais ao organismo. 2. Os lipídios são substâncias insolúveis em água e solúveis em solventes orgânicos que desempenham diversas funções nos seres vivos. Um dos importantes papéis dos lipídios nos seres vivos é: a) atuar como catalisadores biológicos. b) servir como fonte de reserva energética. c) formar proteínas celulares. d) garantir a solubilidade dos outros compostos em água. e) conter as informações genéticas dos seres vivos. 3. São substâncias do grupo dos lipídeos: a) colesterol, cera, glicogênio, glicídeos b) fosfatídeos, glicogênio, colesterol, celulose c) amido, glicogênio, ceras, glicérides d) fosfatídeos, glicerídeos, ceras, colesterol e) glicogênio, colesterol, ceras, glicerídeos 4. Os lipídeos apresentam importantes funções nos seres vivos, destacando-se, entre eles, os triglicerídeos. Apresenta uma molécula presente na formação de um triglicerídeo: a) monossacarídeo b) aminoácido c) glicerol d) dipeptídeo e) dissacarídeo 5. Leia as informações a seguir. A ingestão de gordura trans promove um aumento mais significativo na razão: lipoproteína de baixa densidade/lipoproteína de alta densidade (LDL/HDL), do que a ingestão de gordura saturada. Aued-Pimentel, S. et al. "Revista do Instituto Adolfo Lutz", 62 (2): , [Adaptado]. Para a Agência Nacional de Vigilância Sanitária, um alimento só pode ser considerado "zero trans" quando contiver quantidade menor ou igual a 0,2 g desse nutriente, não sendo recomendado consumir mais que 2 g de gordura trans por dia. O quadro abaixo representa um rótulo de um biscoito comercialmente vendido que atende às especificações do porcentual de gorduras trans, exigidas pela nova legislação brasileira. As informações apresentadas permitem concluir que o consumo diário excessivo do biscoito poderia provocar alteração de a) triglicéride, reduzindo sua concentração plasmática. b) triacilglicerol, diminuindo sua síntese no tecido adiposo. c) LDL-colesterol, aumentando sua concentração plasmática. d) HDL-colesterol, elevando sua concentração plasmática. e) colesterol, reduzindo sua concentração plasmática. 8

9 6.(PUC) O colesterol tem sido considerado um vilão nos últimos tempos, uma vez que as doenças cardiovasculares estão associadas a altos níveis desse composto no sangue. No entanto, o colesterol desempenha importantes funções no organismo. Analise os itens a seguir. I. O colesterol é importante para a integridade da membrana celular. II. O colesterol participa da síntese dos hormônios esteróides. III. O colesterol participa da síntese dos sais biliares. São corretas: a) somente I. b) somente II. c) somente III. d) somente I e II. e) I, II e III. 7. O uso de óleos vegetais na preparação de alimentos é recomendado para ajudar a manter baixo o nível de colesterol no sangue. Isso ocorre porque esses óleos a) têm pouca quantidade de glicerol. b) são pouco absorvidos no intestino. c) são pobres em ácidos graxos saturados. d) têm baixa solubilidade no líquido extracelular 8.(PUC) Lipoproteínas são proteínas transportadoras de lipídios na corrente sangüínea. O esquema adiante representa a captação hepática e o controle da produção dessas lipoproteínas que podem ser: de baixa densidade (LDL), de muito baixa densidade (VLDL), de densidade intermediária (IDL) e ainda a de alta densidade (HDL), que não está representada no desenho. Com base na figura e em seus conhecimentos, assinale a afirmativa INCORRETA. a) Altos níveis plasmáticos de LDL favorecem a redução dos riscos de enfarto do miocárdio. b) Em uma dieta rica em colesterol, o fígado fica repleto de colesterol, o que reprime os níveis de produção de receptores de LDL. c) A deficiência do receptor, por origem genética ou dietética, eleva os níveis plasmáticos de LDL. d) Em uma dieta normal, a VLDL é secretada pelo fígado e convertida em IDL nos capilares dos tecidos periféricos. Cap.05 Proteínas 1. (UFF) Dos vinte aminoácidos constituintes das proteínas dos vertebrados, alguns são chamados essenciais por que: a) participam da síntese de vitaminas. b) são importantes como co-enzimas. c) são precursores na formação de hormônios. d) não são absorvidos pelo aparelho digestivo. e) não são sintetizados por esses animais. 9

10 2. São inúmeras as substâncias que fazem parte da composição química da célula, incluindo os componentes inorgânicos e orgânicos. Dentre os constituintes orgânicos, existe um que é responsável pela liberação de energia. Este composto é conhecido pelo nome de: a) lipídios b) ácidos nucléicos c) nucleotídeos d) glicídios e) proteínas 3. Os meios de comunicação, recentemente, divulgaram que a venda de carne para a população caiu em 60%, sem haver aumento no consumo de aves e peixes. Esse fato é preocupante porque indica que foi reduzida a ingestão de nutrientes com função plástica, que são: a) glicídios. b) lipídios c) vitaminas d) sais minerais e) proteínas 4. (UNIFICADO) Ceará joga fora opção alimentar Segundo pesquisas da UFC, a cada ano 800 toneladas de carne de cabeça de lagosta não são aproveitados sendo lançadas ao mar. O estudo sobre hidrólise enzimática de desperdício de lagosta, título do pesquisador Gustavo Vieira, objetiva o uso de material de baixo custo para enriquecer a alimentação de populações carentes. O processo consiste na degradação de moléculas orgânicas complexas em simples por meio de um catalisador e na posterior liofilização. O pó resultante é de alto teor nutritivo, com baixa umidade e resiste, em bom estado de conservação, por longos períodos. (Jornal do Brasil 27/08/94) Com base nos processo descritos no artigo acima, assinale a opção correta: a) As moléculas orgânicas simples obtidas são glicerídeos que são utilizados pelo organismo com função reguladora. b) As moléculas orgânicas complexas empregadas são proteínas que, ao serem digeridas em aminoácidos são utilizadas pelo organismo com função estrutural. c) O catalisador do processo é uma enzima capaz de degradar proteínas em monossacarídeos essenciais a liberação de energia para as atividades orgânicas. d) A hidrólise enzimática de moléculas orgânicas complexas é realizada por um catalisador inorgânico em presença de água. e) O alto teor nutritivo do produto é devido ao fato de as moléculas orgânicas simples obtidas serem sais minerais indispensáveis ao desenvolvimento orgânico. 5. Cada vez mais, rações balanceadas têm sido utilizadas como alimento para um grande número de espécies de animais domésticos. Dentre os componentes destas rações, encontramos grande percentual de proteínas. Sobre as proteínas, assinale a alternativa CORRETA: a) São compostos formados por carboidratos e lipídios unidos por pontes de hidrogênio. b) São macromoléculas compostas de aminoácidos, que desempenham diversas funções no organismo, tais como a função de defesa, a estrutural e a catalisadora. c) São compostos orgânicos responsáveis pela transmissão da informação genética, fazendo parte da constituição química dos cromossomos. d) São compostos de tamanho muito pequeno (micromoléculas) e ocorrem em baixa concentração dentro da célula. e) São substâncias de grande importância para os animais: muitas representam fontes energéticas para as suas células. 6. As proteínas são formadas por moléculas orgânicas denominadas: a) monossacarídeos b) bases nitrogenadas c) ácidos graxos d) aminoácidos e) dissacarídeos 7. (UERJ) A síndrome conhecida como "vaca louca" é uma doença infecciosa que ataca o sistema nervoso central de animais e até do homem. O agente infeccioso dessa doença é um príon - molécula normal de células nervosas - alterado em sua estrutura tridimensional. Os príons assim alterados têm a propriedade de transformar príons normais em príons infecciosos. 10

11 Os príons normais são digeridos por enzimas do tipo da tripsina. Curiosamente, os alterados não o são, o que, entre outras razões, permite a transmissão da doença por via digestiva. Tais dados indicam que a molécula do príon é de natureza: a) glicolipídica. b) polipeptídica. c) polissacarídica. d) oligonucleotídica.. 8. (PUC) Responder à questão relacionando as proteínas da coluna 1 com suas respectivas funções, apresentadas na coluna Coluna 1 1. Queratina 2. Insulina 3. Miosina 4. Hemoglobina Coluna 2 ( ) Proteína motriz, que gera movimento nas células. ( ) Proteína sinalizadora, que controla os níveis de glicose no sangue. ( ) Proteína transportadora, que transporta oxigênio nas células sangüíneas. ( ) Proteína estrutural, que reforça as células epiteliais. A ordem correta dos parênteses da coluna 2, de cima para baixo, é a) b) c) d) e) (PUC) A Gota é um distúrbio fisiológico que causa dor e inchaço nas articulações, por acúmulo de ácido úrico, um resíduo metabólico nitrogenado. Considerando-se a composição química dos diferentes nutrientes, que tipo de alimento um indivíduo com Gota deve evitar? a) O rico em gordura. b) O pobre em gordura. c) O pobre em proteínas. d) O rico em sais de sódio. e) O rico em proteínas. 10. (UFMG) Observe esta figura: Os nódulos formados nas raízes das leguminosas resultam da colonização por bactérias fixadoras de nitrogênio. Devido à presença desses nódulos nas raízes, as sementes de leguminosas - como a soja, por exemplo - são boas armazenadoras de a) amido. b) carboidratos. c) lipídios. d) proteínas. 11. Outros vertebrados, além dos mamíferos, podem produzir "leite". A tabela abaixo apresenta dados sobre a composição do "leite" de pombos e pingüins, como porcentagem do total de matéria seca, que podem ser comparados com a composição do leite de coelhos. 11

12 Analise a tabela acima e assinale a afirmativa INCORRETA. a) O "leite" de pingüins apresenta maior conteúdo de componentes que podem ser utilizados como fonte de energia. b) Apesar da ausência de carboidratos no "leite" de pombos, ele constitui uma importante fonte energética para o filhote. c) Filhotes de mamíferos que vivem exclusivamente do leite normalmente necessitam de complementação nutricional, para o seu desenvolvimento normal. d) A composição do leite pode variar muito entre as espécies de mamíferos, estando relacionada à velocidade de crescimento do filhote. 12. A toxina produzida pelo gene introduzido na mangueira, além de matar o nematóide, também causava efeitos tóxicos nos seres humanos. Após uma investigação, descobriu-se que, na forma de doces e compotas, as mangas poderiam ser consumidas sem risco para a saúde. O consumo de mangas na forma de doces e compotas torna-se seguro porque, durante o processo de fabricação, a toxina sofre a) cristalização. b) evaporação. c) desnaturação. d) dissolução. 13. A composição do leite de cada espécie de mamífero é adequada às necessidades do respectivo filhote. O gráfico a seguir apresenta a composição do leite humano e do leite de uma espécie de macaco. Considere dois filhotes de macaco: um alimentado com leite de macaco e o outro com o mesmo volume de leite humano. A partir da análise do gráfico, pode-se dizer que o filhote de macaco que for alimentado com o mesmo volume de leite humano provavelmente apresentará a) deformidades ósseas. b) carência energética. c) menor crescimento. d) diarréias freqüentes. 14.(ENEM) Quando o corpo humano é invadido por elementos estranhos, o sistema imunológico reage. No entanto, muitas vezes o ataque é tão rápido que pode levar a pessoa à morte. A vacinação permite ao organismo preparar sua defesa com antecedência. Mas, se existe suspeita de mal já instalado, é recomendável o uso do soro, que combate de imediato os elementos estranhos, enquanto o sistema imunológico se mobiliza para entrar em ação. Considerando essas informações, o soro específico deve ser usado quando a) um idoso deseja se proteger contra gripe. b) uma criança for picada por cobra peçonhenta. c) um bebê deve ser imunizado contra poliomielite. d) uma cidade quer prevenir uma epidemia de sarampo. e) uma pessoa vai viajar para região onde existe febre amarela. 12

13 15. (ENEM) Na embalagem de um antibiótico, encontra-se uma bula que, entre outras informações, explica a ação do remédio do seguinte modo: O medicamento atua por inibição da síntese protéica bacteriana. Essa afirmação permite concluir que o antibiótico a) impede a fotossíntese realizada pelas bactérias causadoras da doença e, assim, elas não se alimentam e morrem. b) altera as informações genéticas das bactérias causadoras da doença, o que impede manutenção e reprodução desses organismos. c) dissolve as membranas das bactérias responsáveis pela doença, o que dificulta o transporte de nutrientes e provoca a morte delas. d) elimina os vírus causadores da doença, pois não conseguem obter as proteínas que seriam produzidas pelas bactérias que parasitam. e) interrompe a produção de proteína das bactérias causadoras da doença, o que impede sua multiplicação pelo bloqueio de funções vitais. 16. (UERJ) As variações das cargas elétricas das moléculas das proteínas W, X, Y e Z, em função do ph do meio, estão representadas no gráfico a seguir. A molécula do DNA, em ph fisiológico, apresenta carga elétrica negativa, devido a sua natureza ácida. No núcleo celular, ela está associada a proteínas, de caráter básico, denominadas histonas. De acordo com o gráfico, a proteína que apresenta propriedades compatíveis com as de uma histona é a representada pela seguinte letra: a) W b) X c) Y d) Z 17. (UERJ) Um estudante recebeu um quebra-cabeça que contém peças numeradas de 1 a 6, representando partes de moléculas. Para montar a estrutura de uma unidade fundamental de uma proteína, ele deverá juntar três peças do jogo na seguinte seqüência: a) 1, 5 e 3 b) 1, 5 e 6 c) 4, 2 e 3 d) 4, 2 e 6 13

14 Cap. 06 Enzimas 1. As enzimas, proteínas aceleradoras das reações químicas nas células, atuam nessas reações biológicas por serem pouco espontâneas e muito lentas. NÃO é característica de uma enzima a) permanecer intacta após a reação. b) ser específica em relação ao substrato. c) diminuir a energia de ativação das reações. d) estar presente em grande quantidade nos organismos. 2. As enzimas são catalisadores orgânicos e atuam na ativação das reações biológicas. Em relação às enzimas, podemos afirmar que: a) seu poder catalítico resulta da capacidade de aumentar a energia de ativação das reações. b) são catalisadores eficientes a qualquer substrato. c) atuam em qualquer temperatura, pois sua ação catalítica independe de sua estrutura espacial. d) sendo proteínas, por mudanças de ph, podem perder seu poder catalítico ao se desnaturarem. e) não podem ser reutilizadas, pois reagem como substrato, tornando-se parte do produto. 3.(PUC) O leite talhado é resultado da ação de microrganismos que: a) alcalinizam o meio, precipitando a lactose do leite. b) acidificam o meio, precipitando as proteínas do leite. c) reduzem a lactose do leite, transformando-a em gordura. d) oxidam as proteínas do leite ao aumentar a concentração de O no meio. e) acidificam o meio, precipitando a gordura do leite ao torná-la solúvel em água. 4. No tubo 1 existe uma solução contendo células de fígado de boi. Em 2, há uma solução de células extraídas de folhas de bananeira. Você deseja eliminar completamente todos os constituintes dos envoltórios celulares presentes em ambos os tubos. Para isso, dispõe de três enzimas digestivas diferentes: C: digere carboidratos em geral. L: digere lipídios. P: digere proteínas. Para atingir seu objetivo gastando o menor número possível de enzimas, você deve adicionar a 1 e 2, respectivamente: a) 1 = C; 2 = P. b) 1 = L; 2 = C. c) 1 = C e P; 2 = C e L. d) 1 = C e P; 2 = C, L e P. e) 1 = L e P; 2 = C, L e P. 5. (UERJ) Em um experimento, em condições adequadas, foram medidas as velocidades de reação V de uma enzima, em função do aumento da concentração de seu substrato S. O gráfico a seguir indica variações de 1/V em função de S. A curva que deve representar o resultado experimental é a identificada por: a) W b) X c) Y d) Z 14

15 6. (UERJ) Num experimento, mediu-se, em condições ideais de temperatura e ph, a variação da velocidade de reação de uma enzima em função de concentrações crescentes de seu substrato. A concentração da enzima foi mantida constante e igual a [E ]. Os resultados estão mostrados no gráfico a seguir, no qual, para a concentração de substrato [S ], determinou-se a velocidade V. Considere, agora, a realização de experimento similar, nas mesmas condições de temperatura e ph, utilizando, apenas, a concentração de substrato [S] e diminuindo a concentração da enzima para um valor igual a [E 2 ]. A nova velocidade, V 2, seria igual ao resultado da multiplicação de V por: a) [E ]/[E ] b) [E ]. [S ]/[E ] c) [E ]/[E ] d) [E ]/[E ]. [S ] 7. O gráfico adiante representa o perfil básico da reação bioquímica de uma catálise enzimática. Observe o gráfico e assinale a afirmativa INCORRETA: a) II representa o estado de transição, com o máximo de energia. b) III representa a energia de ativação para desencadear a reação. c) V pode ser um produto final da reação enzimática. d) IV representa a diferença de energia entre a enzima e o produto. e) I pode ser representado pelos substratos da catálise. 8.( MACKENZIE) Para inibir a ação de uma enzima, pode-se fornecer à célula uma substância que ocupe o sítio ativo dessa enzima. Para isso, essa substância deve: a) estar na mesma concentração da enzima. b) ter a mesma estrutura espacial do substrato da enzima. c) recobrir toda a molécula da enzima. d) ter a mesma função biológica do substrato da enzima. e) promover a desnaturação dessa enzima. 9. Considere as quatro frases seguintes. I - Enzimas são proteínas que atuam como catalisadores de reações químicas. II - Cada reação química que ocorre em um ser vivo, geralmente, é catalisada por um tipo de enzima. III - A velocidade de uma reação enzimática independe de fatores como temperatura e ph do meio. IV - As enzimas sofrem um enorme processo de desgaste durante a reação química da qual participam. São verdadeiras as frases a) I e III, apenas. b) III e IV, apenas. c) I e II, apenas. d) I, II e IV, apenas. e) I, II, III e IV. 10. O gráfico a seguir representa a atividade enzimática de uma determinada reação em função da temperatura: 15

16 A seta indica o ponto: a) ótimo de temperatura para a atividade enzimática. b) de desnaturação da enzima. c) de desnaturação do produto. d) mínimo da temperatura para a reação enzimática. e) máximo de substrato obtido. 11. Considere a rota metabólica que produz o aminoácido arginina na figura adiante. Em um experimento, três linhagens de bactérias foram irradiadas com raios X, que causaram mutações nos genes envolvidos na rota metabólica acima representada. Para descobrir quais enzimas da rota metabólica foram afetadas, as três linhagens foram cultivadas em meios suplementados com ornitina, citrulina e arginina, obtendo-se o resultado mostrado na tabela acima: Sobre esse experimento, podemos afirmar que a) o gene que codifica a enzima 1 na linhagem I foi afetado. b) o gene que codifica a enzima 2 na linhagem I foi afetado. c) o gene que codifica a enzima 3 na linhagem II foi afetado. d) o gene que codifica a enzima 1 na linhagem II foi afetado. e) o gene que codifica a enzima 3 na linhagem III foi afetado. 12.(UFF) Considere um gato siamês, que difere de outras raças de gatos por sua pelagem característica: escura nas patas, no focinho e no pavilhão auditivo, contrastando com o resto do corpo, onde é clara. As regiões escuras são as mais frias e nelas a substância que controla a produção do pigmento responsável pela pelagem escura é ativa, enquanto nas claras, que são quentes, essa substância é inativa. Pela sua ação no escurecimento da pelagem do animal, conclui-se que essa substância é: a) um glicídio b) um lipídio c) uma enzima d) um glicosaminoglicano e) uma vitamina Cap. 07 Vitaminas 1. OSTEOPOROSE AFETA 25% DAS MULHERES NA MENOPAUSA. ("Folha de São Paulo", ) Para prevenção da osteoporose recomendam-se, entre outras medidas, caminhadas e sol. Esse tratamento preventivo leva o organismo a produzir a) estrogênios, que reduzem a atividade osteoclástica dos ossos. b) estrogênios, que são necessários para uma maior absorção de cálcio e de fosfato nos ossos. c) vitamina A, que é o radical prostético de enzimas que atuam na absorção de cálcio e fósforo. d) vitamina C, necessária nos processos de cicatrização das fraturas, por aumentar a atividade osteoblástica dos ossos. e) vitamina D, que aumenta a absorção do cálcio pelo intestino. 16

17 2. Uma das doenças mais comuns entre as tripulações que participaram das grandes navegações apresenta, como sintomas, hemorragia nas mucosas, sob a pele e nas articulações. Essa doença, causada pela falta de vitamina C, é conhecida como: a) beribéri. b) anemia. c) escarlatina. d) escorbuto. e) raquitismo. 3. Em 16/08/94 o jornal "FOLHA DE SÃO PAULO" apresentou uma reportagem sobre a vitamina A. O artigo dava destaque às conseqüências benéficas de suplemento periódico dessa vitamina. Porém abordava, também, problemas causados pela ingestão excessiva da mesma, e doenças provenientes de sua ingestão deficitária. A vitamina A, por sua "natureza química", armazena seu excesso ingerido em determinado "órgão" do corpo humano gerando problemas orgânicos, bem como sua falta acarreta "problemas carenciais". Com base na afirmação destacada, assinale a opção correta que relaciona, respectivamente, a natureza química, o órgão acumulador do excesso e a hipovitaminose (problema carencial), correspondentes a esta vitamina. a) lipossolúvel, fígado e cegueira noturna. b) lipossolúvel, baço e bócio endêmico. c) lipossolúvel, pâncreas e escorbuto. d) hidrossolúvel, pâncreas e beribéri. e) hidrossolúvel, fígado e raquitismo. 4. As vitaminas são usualmente classificadas em dois grupos, com base em sua solubilidade, o que, para alguns graus determina sua estabilidade, ocorrência em alimentos, distribuição nos fluídos corpóreos e sua capacidade de armazenamento no tecidos. (MAHAN, L. K. & ESCOTT-STUMP, S. "Alimentos, nutrição e dietoterapia". 9.ed. São Paulo: Roca, p. 78.) Com base no texto e nos conhecimentos sobre o tema, assinale a alternativa correta. a) A vitamina E é lipossolúvel, age como um antioxidante, protege as hemácias da hemólise, atua na reprodução animal e na manutenção do tecido epitelial. b) A vitamina A é hidrossolúvel, auxilia na produção de protrombina - um composto necessário para a coagulação do sangue - e apresenta baixa toxicidade quando consumida em grande quantidade. c) A vitamina D é hidrossolúvel, auxilia no crescimento normal, melhora a visão noturna, auxilia o desenvolvimento ósseo e influencia a formação normal dos dentes. d) A vitamina B6 é lipossolúvel, auxilia na resposta imunológica, na cicatrização de feridas e reações alérgicas, além de estar envolvida na glicólise, na síntese de gordura e na respiração tecidual. e) A vitamina C é lipossolúvel, auxilia na resposta imunológica, na cicatrização de feridas e reações alérgicas, na síntese e quebra de aminoácidos e na síntese de ácidos graxos insaturados. 5. O beribéri, doença identificada no século XIX, tem como sintomas: dormência, inchaço das pernas, dificuldade de caminhar e fraqueza. Ela evolui para insuficiência respiratória e cardíaca, levando à morte, mas, quando é tratada no início, não é fatal. De janeiro a julho de 2006, morreram 33 pessoas dessa enfermidade no oeste do Maranhão, e outras estão gravemente doentes. Esse fato se explica porque a) os moradores da região desconhecem como evitar os transmissores da doença. b) as campanhas de vacinação não atingem as pessoas que vivem no sertão, área de difícil acesso. c) os alimentos ricos em vitamina C se deterioram facilmente, devido à falta de energia elétrica naquela região. d) a região é muito pobre e as pessoas não consomem alimentos ricos em vitamina B, como carne, ovos e feijão. 6.(ENEM) A obesidade, que nos países desenvolvidos já é tratada como epidemia, começa a preocupar especialistas no Brasil. Os últimos dados da Pesquisa de Orçamentos Familiares, realizada entre 2002 e 2003 pelo IBGE, mostram que 40,6% da população brasileira estão acima do peso, ou seja, 38,8 milhões de adultos. Desse total, 10,5 milhões são considerados obesos. Várias são as dietas e os remédios que prometem um emagrecimento rápido e sem riscos. Há alguns anos foi lançado no mercado brasileiro um remédio de ação diferente dos demais, pois inibe a ação das lipases, enzimas que aceleram a reação de quebra de gorduras. Sem serem quebradas elas não são absorvidas pelo intestino, e parte das gorduras ingeridas é eliminada com as fezes. Como os lipídios são altamente energéticos, a pessoa tende a emagrecer. No entanto, esse remédio apresenta algumas contra-indicações, pois a gordura não absorvida lubrifica o intestino, causando desagradáveis diarréias. Além do mais, podem ocorrer casos de baixa absorção de vitaminas lipossolúveis, como as A, D, E e K, pois a) essas vitaminas, por serem mais energéticas que as demais, precisam de lipídios para sua absorção. b) a ausência dos lipídios torna a absorção dessas vitaminas desnecessária. 17

18 c) essas vitaminas reagem com o remédio, transformando-se em outras vitaminas. d) as lipases também desdobram as vitaminas para que essas sejam absorvidas. e) essas vitaminas se dissolvem nos lipídios e só são absorvidas junto com eles. 7. Embora o excesso de radiação UV possa provocar câncer, uma certa quantidade dessa radiação é necessária para a saúde, porque ela está relacionada com a a) transformação de um derivado do colesterol em calciferol. b) absorção do ácido fólico encontrado nos alimentos. c) síntese da vitamina K, que atua na coagulação sanguínea. d) ativação da vitamina E, que inibe as reações de oxidação. 8.(UFF) As embalagens comerciais das margarinas, que são produzidas a partir de óleos vegetais, freqüentemente indicam a adição de vitamina E. Além de sua importância nutricional, tal vitamina tem papel importante na conservação desse alimento, pois o protege contra: a) contaminação por colesterol b) hidrólise das proteínas c) esterificação de ácidos graxos d) redução dos radicais ácidos a aldeídos e) oxidação das gorduras insaturadas 9. "A descoberta recente de que grandes doses de vitamina C podem ter efeito contrário ao que se pretende foi apenas mais um balde de água fria nesse modismo de dieta. [...] A conclusão é de Barry Halliwell da Universidade de Londres. [...] A vitamina C tem sido muito alardeada comercialmente como solução para problemas de "estresse oxidativo" das células, provocado pelos radicais livres. [...] Vários estudos demonstraram o papel antioxidante da vitamina C in vitro - isto é, em tubos de ensaio em laboratórios. Já os resultados sobre esse efeito "in vivo" - isto é, em organismos vivos - ainda são pouco reveladores. [...] A vitamina C é essencial à dieta humana, mas muitas questões sem resposta permanecem, concluiu Halliwell" ("Folha de São Paulo", 03 de maio de 1998). Pode-se ver, pelo texto acima, que supostos efeitos da vitamina C são questionáveis. No entanto, não há nenhuma dúvida de que ela: a) previne todos os tipos de câncer. b) atua na coordenação motora. c) atua na coagulação do sangue. d) evita a cegueira noturna. e) é essencial à dieta humana. 10.(UERJ) VITAMINAS "Megadoses de desconfiança" Utilização de tratamento alternativos e práticas de terapia ortomolecular provocam polêmica entre médicos. ("Época", 14/09/98) Algumas vitaminas, entre elas o ácido ascórbico e o tocoferol, ou vitamina E, são preconizadas em doses elevadas pelos defensores da chamada medicina ortomolecular, com o objetivo de prevenir uma série de doenças provocadas, segundo eles, por um acúmulo de radicais livres no organismo. A utilização com essa finalidade está baseada na seguinte propriedade química dos compostos citados: a) oxidante b) redutora c) detergente d) emulsionante Cap. 08 ácidos nucleicos 1. O DNA e o RNA são biopolímeros constituídos de unidades menores denominadas nucleotídeos. Essas unidades são compostas de um grupo fosfato, um açúcar e uma base nitrogenada. Os açúcares presentes no DNA e no RNA são, respectivamente: a) glucose e ribose b) desoxirribose e ribose c) ribose e desoxirribose d) desoxirribose e glucose e) glicose e rafinose 18

19 2. (UERJ) Compartimentos e estruturas que contêm ácidos nucléicos, em uma célula eucariota, estão apresentados na seguinte alternativa: a) mitocôndria - aparelho de Golgi - lisossomo b) mitocôndria - retículo endoplásmico rugoso - cloroplasto c) retículo endoplásmico liso - aparelho de Golgi - cloroplasto d) retículo endoplásmico rugoso - retículo endoplásmico liso lisossomo 3. Observe este trecho de molécula de RNA, que ilustra as ligações entre seus nucleotídios: A função química decorrente da ligação entre a ribose e o fosfato denomina-se: a) éter b) éster c) álcool d) cetona 4.(UNIFESP) O gráfico mostra o espectro de absorção de raios ultravioleta (U.V.) por uma proteína e por um ácido nucléico. Considerando a ação desses raios na célula, o comprimento de onda em que será obtida maior taxa de mutação é a) Angstrons. b) Angstrons. c) Angstrons. d) Angstrons. e) Angstrons. 5. Um fabricante afirma que um produto disponível comercialmente possui DNA vegetal, elemento que proporcionaria melhor hidratação dos cabelos. Sobre as características químicas dessa molécula essencial à vida, é correto afirmar que o DNA a) de qualquer espécie serviria, já que têm a mesma composição. b) de origem vegetal é diferente quimicamente dos demais, pois possui clorofila. c) das bactérias poderia causar mutações no couro cabeludo. d) dos animais encontra-se sempre enovelado e é de difícil absorção. e) de características básicas assegura sua eficiência hidratante. 19

20 6. Os ácidos nucléicos são moléculas formadas pelo encadeamento de um grande número de unidades chamadas nucleotídeos. Cada nucleotídeo é formado por uma base nitrogenada, uma pentose e um radical fosfato. Em relação às substâncias químicas que formam os nucleotídeos, considere as assertivas: I. Existem cinco tipos principais de bases nitrogenadas: adenina (A), guanina (G), citosina (C), timina (T) e uracila (U). II. A adenina e a guanina são bases pirimídicas por possuírem em comum um anel da substância conhecida como pirimidina. III. O açúcar presente nos ácidos nucléicos pode ser a ribose ou desoxirribose. IV. O RNA aparece associado à proteína nos cromossomos, possuindo filamento de nucleotídeos duplo. Assinale a alternativa correta: a) Apenas I está correta. b) Apenas II e IV estão corretas. c) Apenas I e III estão corretas. d) Todas estão corretas. e) Todas estão INCORRETAS. 7. No ano de 2003 comemorou-se 50 anos da publicação do trabalho de Francis Crick e James Watson, que estabeleceu o modelo da estrutura da molécula de ácido desoxirribonucléico (DNA). Dentre as afirmativas abaixo, assinale a alternativa CORRETA: a) Uma cadeia simples de DNA é constituída de nucleotídeos, compostos por uma desoxirribose ligada a um fosfato e a um aminoácido. b) A polimerização de uma fita simples de DNA é dita semiconservativa, pois independe da existência de uma fita molde. c) Os nucleotídeos são polimerizados por meio de ligações fosfodiéster entre o fosfato e a base nitrogenada. d) Duas cadeias simples de DNA formam uma dupla-hélice, por meio da formação de pontes de hidrogênio entre as bases nitrogenadas. e) As duas cadeias de uma dupla-hélice possuem a mesma orientação, e suas seqüências de bases são complementares. 8. (UERJ) É como se em cada quarto de um imenso prédio existisse uma estante contendo os planos do arquiteto para todo o prédio. (...) No homem, os planos do arquiteto montam 46 volumes. Nessa analogia, proposta por Richard Dawkins no livro "O gene egoísta", cada página de cada volume contém um texto formado por uma seqüência de: a) fenótipos b) aminoácidos c) cromossomos d) bases nitrogenadas 9. (UNIRIO) Censores do Genoma / RNA de Interferência (RNAi) "Quase todas as células animais e vegetais apresentam um mecanismo interno que utiliza formas distintas do RNA, a molécula mensageira genética, para naturalmente silenciar determinados genes. Esse mecanismo se desenvolveu tanto para proteger as células de genes hostis como para regular a atividade de genes normais durante o crescimento e desenvolvimento. Novos medicamentos poderão ser desenvolvidos para explorar o mecanismo do RNAi na prevenção e no tratamento de doenças." ("Scientific American-Brasil", 2003) Uma das formas distintas de RNA citada no texto, que participa do silenciamento dos genes é um tipo de RNA de filamento duplo, cujo emparelhamento das bases obedece ao critério padrão (base púrica Ì base pirimídica). Neste tipo de molécula, a relação entre suas bases nitrogenadas é: a) (U + C) / (G + A) = 1 b) (U + A) / (C + G) = 1 c) (T + C) / (A + G) > 1 d) (T + C) / (A + G) = 1 e) (U + C) / (A + G) Assinale a alternativa que traz, na seqüência correta, os termos que preenchem as lacunas do texto: "Os retrovírus, como o HIV, são partículas portadoras de RNA, que possuem a característica especial de ter a enzima e cujo comanda a síntese de Este último, uma vez formado, passa a comandar a síntese de novas moléculas de , que irão constituir o material genético de novos retrovírus". 20

21 a) 1-transcriptase reversa 2-DNA 3-RNA 4-RNA b) 1-transcriptase reversa 2-RNA 3-DNA 4-RNA c) 1-RNA polimerase 2-DNA 3-RNA 4-DNA d) 1-DNA polimerase 2-DNA 3-RNA 4-RNA e) 1-DNA ligase 2-RNA 3-DNA 4-RNA 11. Em nosso intestino delgado, as moléculas de DNA (ácido desoxirribonucléico) presentes no alimento são digeridas e originam a) apenas aminoácidos. b) fosfato, glicídio e bases nitrogenadas. c) glicídio, bases nitrogenadas e aminoácidos. d) RNA transportador, RNA mensageiro e RNA ribossômico. e) átomos livres, de carbono, nitrogênio, oxigênio, hidrogênio e fósforo. 12. Cinco amostras com ácidos nucléicos foram analisadas quimicamente e apresentaram os seguintes resultados: I - 1 amostra: ribose II - 2 amostra: mina III - 3 amostra: dupla hélice IV- 4 amostra: uracila V - 5 amostra: 20% de guanina e 30% de citosina Entre estas amostras, quais se referem a DNA? a) Apenas I e II. b) Apenas I e III. c) Apenas II e III. d) Apenas II e IV. e) Apenas II e V. 13. A análise da composição dos nucleotídeos do ácido nucléico que constitui o material genético de quatro diferentes organismos mostrou o seguinte resultado: Com base nos resultados, marque a afirmativa correta em relação à identificação das moléculas. a) I é uma molécula de DNA porque tem o mesmo percentual de A e T e de G e C. b) I e III são moléculas que contêm somente uma fita de nucleotídeos. c) IV é uma molécula de RNA, cópia de uma das fitas da molécula I. d) II e IV são moléculas responsáveis pela tradução protéica. e) III é uma molécula RNA de fita dupla. 14. Uma das hipóteses mais amplamente aceitas na Biologia considera que mitocôndrias e cloroplastos se originaram de uma relação mutualística entre procariontes e eucariontes primitivos. Qual das seguintes observações constituiria evidência correta para apoiar essa hipótese? a) As mitocôndrias são responsáveis pela respiração, e os cloroplastos, pela fotossíntese. b) Mitocôndrias e cloroplastos apresentam ribossomas, que são responsáveis pela síntese protéica. c) Cloroplastos e mitocôndrias são organelas membranosas presentes no citoplasma da célula. d) Essas organelas apresentam enzimas responsáveis por reações de oxidação e redução de moléculas. e) Tanto mitocôndrias quanto cloroplastos apresentam DNA circular, distinto do DNA do núcleo. Cap. 09 DNA 1. (ENEM) Nos dias de hoje, podemos dizer que praticamente todos os seres humanos já ouviram em algum momento falar sobre o DNA e seu papel na hereditariedade da maioria dos organismos. Porém, foi apenas em 1952, um ano antes da descrição do modelo do DNA em dupla hélice por Watson e Crick, que foi confirmado sem sombra de dúvidas que o DNA é material genético. No artigo em que Watson e Crick descreveram a molécula de DNA, eles 21

22 sugeriram um modelo de como essa molécula deveria se replicar. Em 1958, Meselson e Stahl realizaram experimentos utilizando isótopos pesados de nitrogênio que foram incorporados às bases nitrogenadas para avaliar como se daria a replicação da molécula. A partir dos resultados, confirmaram o modelo sugerido por Watson e Crick, que tinha como premissa básica o rompimento das pontes de hidrogênio entre as bases nitrogenadas. GRIFFITHS, A. J. F. et al. Introdução à Genética. Rio de Janeiro: Guanabara Koogan, Considerando a estrutura da molécula de DNA e a posição das pontes de hidrogênio na mesma, os experimentos realizados por Meselson e Stahl a respeito da replicação dessa molécula levaram à conclusão de que: a) a replicação do DNA é conservativa, isto é, a fita dupla filha é recém-sintetizada e o filamento parental é conservado. b) a replicação de DNA é dispersiva, isto é, as fitas filhas contêm DNA recém-sintetizado e parentais em cada uma das fitas. c) a replicação é semiconservativa, isto é, as fitas filhas consistem de uma fita parental e uma recém-sintetizada. d) a replicação do DNA é conservativa, isto é, as fitas filhas consistem de moléculas de DNA parental. e) a replicação é semiconservativa, isto é, as fitas filhas consistem de uma fita molde e uma fita codificadora. 2. Leia o texto a seguir. O mamífero-símbolo da Idade do Gelo provavelmente tinha dois tipos de pelagem: castanho-escuro e loiro. A inferência vem diretamente do DNA do mamute-lanoso ('Mammuthus primigenius'), de exemplares mortos há 43 mil anos na Sibéria. É uma das primeiras vezes em que os genes de um bicho extinto dão pistas sobre características suas em vida. Mamutes podem ter tido pêlo "loiro", sugere análise de DNA. "Folha de São Paulo", 07/07/2006. Em relação às características genéticas deste mamífero, é possível afirmar corretamente que: a) seus genes estavam dispostos em cromossomos circulares. b) seu DNA era composto por bases nitrogenadas, ribose e fosfato. c) seus genes estavam organizados nos plasmídeos. d) suas moléculas de DNA apresentavam estrutura helicoidal. e) seus genes para o tipo de pelagem localizavam-se no DNA mitocondrial. 3. Se um segmento de DNA possui a seqüência de bases nitrogenadas TTA CCG ATT ATG, pode-se afirmar que a cadeia complementar a esse segmento terá a seqüência a) AAT GGC TAA TAC. b) UUT GGC TUU UAC. c) TTA CCG ATT ATG. d) AAT GGC TAA UAC. e) AAU GGC UAA UAC. 4. Considere que um cientista esteja, em um laboratório, tentando reproduzir "in vitro" a síntese de moléculas de DNA. Com base nos conhecimentos sobre o tema, assinale a alternativa que indica, corretamente, as moléculas imprescindíveis que ele deve utilizar para que possa atingir o seu objetivo. a) Quatro diferentes tipos de nucleotídeos, contendo as bases nitrogenadas adenina, timina, citosina e guanina; a enzima DNA polimerase e DNA. b) Os nucleotídeos contendo as bases nitrogenadas timina, guanina, adenina e citosina; a enzima RNA polimerase; RNA mensageiro e DNA. c) As enzimas RNA e DNA polimerase; os três tipos de RNA (mensageiro, transportador e ribossômico) e DNA. d) A enzima DNA polimerase; os vinte tipos diferentes de aminoácidos, DNA e RNA. e) As enzimas RNA e DNA polimerase; vinte tipos diferentes de aminoácidos; DNA e RNA. 5. (UEL) Considere a seqüência de bases da fita não molde do DNA de um organismo procarioto: - AAT CCG ACG GGA. Quais seriam as seqüências de bases da fita complementar do DNA, que serve de molde para transcrição, e da fita simples de RNAm transcrito? a) Fita molde - 3' - TTA GGC TGC CCT- 5' e RNA 5'- UUTCCGUCGGGU - 3'. b) Fita molde - 3' - UUA GGC UGC CCU - 5' e RNA 5' - TTAGGCTGC CCT- 3'. c) Fita molde - 3' - AAT CCG ACG GGA - 5' e RNA 5'- UUAGGCUGCCCU - 3'. d) Fita molde - 3' - TTA GGC TGC CCT- 5' e RNA 5' - AAUCCGACGGGA - 3'. e) Fita molde - 3' - AAU CCG ACG GGA - 5' e RNA 5' -TTAGGCTGCCCT - 3'. 22

23 6. (UFMG) A composição de bases nitrogenadas do DNA total isolado de células de tecido epitelial de um vertebrado apresenta estes percentuais: A = 20%; T = 20%; G = 30%; C = 30%. Considerando-se essas informações e outros conhecimentos sobre o assunto, é INCORRETO afirmar que essa composição de bases nitrogenadas a) é igual à de outras células somáticas. b) permanece inalterada ao longo da vida. c) se reduz à metade nos gametas. d) varia entre indivíduos de espécies diferentes. 7. A figura a seguir ilustra uma cromatina, complexo formado por DNA associado a proteínas. A respeito dessa estrutura, é INCORRETO afirmar que a) a cromatina condensada é denominada cromossomo. b) a heterocromatina constitui uma região de genes em atividade. c) a eucromatina representa uma região de intensa síntese de RNA. d) o DNA na forma de cromossomo está presente na célula em divisão. 8. Na década de 1980, a análise de dados genéticos passou a fazer parte das investigações científicas a respeito da origem dos humanos modernos. Uma ferramenta importante para essa investigação é o DNA mitocondrial. Sobre o DNA mitocondrial (mtdna), é INCORRETO afirmar: a) A herança do mtdna difere dos padrões de herança do DNA nuclear, pois as organelas citoplasmáticas de um zigoto, inclusive as mitocôndrias, vêm apenas do gameta feminino. b) A variabilidade de uma população pode ser considerada resultado do acúmulo de mutações gênicas e de recombinação entre os genes paternos e maternos do mtdna. c) O mtdna apresenta uma taxa de mutação elevada, e a comparação entre moléculas homólogas pode informar o tempo de divergência entre elas a partir de uma condição ancestral. d) Por meio do conhecimento adquirido sobre a estrutura do mtdna, o estudo da evolução humana experimentou enormes avanços, tendo em vista a possibilidade de se analisar, com êxito, restos humanos antigos, como o tecido cerebral. 9. (ENEM) A figura seguinte representa um modelo de transmissão da informação genética nos sistemas biológicos. No fim do processo, que inclui a replicação, a transcrição e a tradução, há três formas protéicas diferentes denominadas a, b e c. Depreende-se do modelo que a) a única molécula que participa da produção de proteínas é o DNA. b) o fluxo de informação genética, nos sistemas biológicos, é unidirecional. c) as fontes de informação ativas durante o processo de transcrição são as proteínas. d) é possível obter diferentes variantes proteicas a partir de um mesmo produto de transcrição. e) a molécula de DNA possui forma circular e as demais moléculas possuem forma de fita simples linearizadas. 10. (ENEM) Todas as reações químicas de um ser vivo seguem um programa operado por uma central de informações. A meta desse programa é a auto-replicação de todos os componentes do sistema, incluindo-se a duplicação do próprio programa ou mais precisamente do material no qual o programa está inscrito. Cada reprodução pode estar associada a pequenas modificações do programa. M. O. Murphy e l. O'neill (Orgs.). "O que é vida? 50 anos depois - especulações sobre o futuro da biologia". São Paulo: UNESP (com adaptações). São indispensáveis à execução do "programa" mencionado acima processos relacionados a metabolismo, autoreplicação e mutação, que podem ser exemplificados, respectivamente, por: a) fotossíntese, respiração e alterações na seqüência de bases nitrogenadas do código genético. b) duplicação do RNA, pareamento de bases nitrogenadas e digestão de constituintes dos alimentos. c) excreção de compostos nitrogenados, respiração celular e digestão de constituintes dos alimentos. 23

24 d) respiração celular, duplicação do DNA e alterações na seqüência de bases nitrogenadas do código genético. e) fotossíntese, duplicação do DNA e excreção de compostos nitrogenados. 11. Responda com base na representação gráfica da formação do nucleotídeo e nas informações a seguir. 12. Os ácidos nucléicos (DNA e RNA) são compostos de monômeros chamados nucleotídeos, os quais são formados por subunidades representadas por um retângulo, um pentágono e um círculo. As formas geométricas citadas no texto anterior representam, respectivamente, base...,... e grupo.... a) pirimídica - ribose - fosfato b) nitrogenada - desoxirribose - nitrato c) púrica - ribose - fosfato d) pirimídica - desoxirribose - nitrato e) nitrogeneda - pentose - fosfato 13. A identificação da estrutura do DNA foi fundamental para compreender seu papel na continuidade da vida. Na década de 1950, um estudo pioneiro determinou a proporção das bases nitrogenadas que compõem moléculas de DNA de várias espécies. A comparação das proporções permitiu concluir que ocorre emparelhamento entre as bases nitrogenadas e que elas formam a) pares de mesmo tipo em todas as espécies, evidenciando a universalidade da estrutura do DNA. b) pares diferentes de acordo com a espécie considerada, o que garante a diversidade da vida. c) pares diferentes em diferentes células de uma espécie, como resultado da diferenciação celular. d) pares específicos apenas nos gametas, pois essas células são responsáveis pela perpetuação das espécies. e) pares específicos somente nas bactérias, pois esses organismos são formados por uma única célula. 14. O cientista britânico Francis Crick, um dos descobridores da estrutura da molécula de DNA, morto em julho de 2004, será lembrado como um dos mais influentes cientistas de todos os tempos. Em 1958, publicou um manifesto sobre a síntese de proteínas, apresentando suas hipóteses sobre a estrutura teórica da biologia molecular, lançando, assim, as bases para a descoberta do código genético. Entre as hipóteses apresentadas naquele texto, destaca-se o dogma central da Biologia. Segundo esse dogma, a) o código genético é degenerado, pois um aminoácido pode ser codificado por mais de uma trinca. b) a transferência de informações genéticas ocorre do DNA para o RNA, e deste para a proteína. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. d) cada molécula de DNA é formada pela reunião de nucleotídeos, que podem ser de quatro tipos diferentes. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. 15. Algumas células de cultura de tecido foram deixadas em um meio contendo um precursor radioativo de RNA. Posteriormente, essas células foram transferidas para um meio sem essa substância. Após 3 minutos, algumas células foram fixadas e radioautografadas. Esse procedimento se repetiu após 15 e após 90 minutos. Os esquemas representam as células radioautografadas nos três momentos, revelando a distribuição do precursor radioativo nas mesmas. 24

25 Esses resultados ocorrem porque a) o RNA transportador leva o isótopo até o nucléolo e posteriormente ao núcleo e citoplasma celular. b) a substância, ao ser deixada em situação de desequilíbrio osmótico em relação à cultura sem isótopo, dirige-se gradativamente para o citoplasma celular, buscando a situação de equilíbrio. c) a síntese de RNA, que se intensifica aos 90 minutos, esgota toda a substância presente no núcleo, restando apenas no citoplasma. d) a produção de RNA, que ocorre inicialmente no núcleo celular, prossegue posteriormente no citoplasma da célula. e) a síntese de RNA ocorre no núcleo, sendo que posteriormente o RNA aí produzido migra para o citoplasma celular. 16. O esquema resume parcialmente as relações funcionais dos ácidos nucleicos que ocorrem na maioria das células vivas. Considerando-se apenas células eucariontes, as etapas que representam, respectivamente, transcrição, duplicação e tradução são: a) I, II e III. b) I, III e II. c) II, I e III. d) III, I e II. e) II, III e I. 17. Existe um número muito grande de substâncias com funções antibióticas. Essas substâncias diferem quanto à maneira pela qual interferem no metabolismo celular. Assim, a TETRACICLINA liga-se aos ribossomos e impede a ligação do RNA transportador; a MITOMICINA inibe a ação da polimerase do DNA e a ESTREPTOMICINA causa erros na leitura dos códons do RNA mensageiro. Essas informações permitem afirmar que I - a TETRACICLINA impede a transcrição e leva a célula bacteriana à morte por falta de RNA mensageiro. II - a MITOMICINA, por inibir a duplicação do DNA, impede a multiplicação da célula bacteriana. III - a ESTREPTOMICINA interfere na tradução e leva a célula bacteriana a produzir proteínas defeituosas. Assinale a alternativa que reúne as afirmações corretas. a) apenas I é correta. b) apenas I e II são corretas. c) apenas II e III são corretas. d) apenas I e III são corretas. e) I, II e III são corretas. 25

26 18. Sobre o esquema a seguir, foram feitas algumas afirmações. I. O esquema representa o mecanismo da tradução, onde interagem os três tipos de RNAs. II. O pareamento do códon com anticódon específico resulta na entrada do aminoácido correto, determinado pela seqüência codificadora. III. Toda molécula de RNAm possui um códon de iniciação, que é sempre o mesmo - AUG. IV. A perda de um único nucleotídeo no gene que dá origem ao RNAm pode alterar a tradução a partir daquele ponto. V. A associação entre aminoácidos para formar proteínas depende de ligações peptídicas. Estão CORRETAS as afirmativas: a) I, IV e V apenas. b) I, II e III apenas. c) II, III e IV apenas. d) I, II, III, IV e V. 19. (UFMG) Os gráficos a seguir revelam o NÚMERO DE GENES e a relação entre RNA CODIFICADOR (que contém as seqüências que podem ser traduzidas em proteínas) e RNA NÃO-CODIFICADOR (seqüências que são transcritas, mas não são traduzidas em proteínas) de seis espécies de organismos. Analisando os resultados anteriores de acordo com seus conhecimentos sobre o assunto, é correto afirmar, EXCETO: a) Não existe uma relação de proporcionalidade direta absoluta entre o número de genes e a complexidade dos organismos relacionados. b) Os vertebrados citados apresentam menor percentual de transcrição em relação aos outros animais. c) Os íntrons são exemplos de RNA não-codificador, e nos éxons estão presentes seqüências codificadoras. d) Seqüências transcritas, mas não traduzidas, poderiam desempenhar alguma função no núcleo celular. 20. O cientista britânico Francis Crick, um dos descobridores da estrutura da molécula de DNA, morto em julho de 2004, será lembrado como um dos mais influentes cientistas de todos os tempos. Em 1958, publicou um manifesto sobre a síntese de proteínas, apresentando suas hipóteses sobre a estrutura teórica da biologia molecular, lançando, assim, as bases para a descoberta do código genético. 26

27 Entre as hipóteses apresentadas naquele texto, destaca-se o dogma central da Biologia. Segundo esse dogma, a) o código genético é degenerado, pois um aminoácido pode ser codificado por mais de uma trinca. b) a transferência de informações genéticas ocorre do DNA para o RNA, e deste para a proteína. c) cada polipeptídeo tem uma seqüência específica de nucleotídeos determinada pelo gene. d) cada molécula de DNA é formada pela reunião de nucleotídeos, que podem ser de quatro tipos diferentes. e) uma molécula de DNA difere de outra pela seqüência de seus nucleotídeos. 21. (PUC) Tradicionalmente, os tomates são colhidos ainda verdes para que sua firmeza seja mantida no transporte. Antes de chegarem às prateleiras, os tomates são pulverizados com etileno para acelerar o amadurecimento e torná-los vermelhos. O tomate Flavr Savr foi desenvolvido pela empresa de biotecnologia Calgene para amadurecer no pé mantendo a firmeza de sua pele. Dessa forma, o tomate pode ser transportado já maduro e apresenta um maior tempo de prateleira. Os pesquisadores utilizaram a metodologia "anti-sense" (veja o quadro a seguir) para diminuir os níveis da enzima poligalacturonase, cuja expressão gênica é induzida pelo etileno. Essa enzima promove a hidrólise de componentes da parede celular, o que compromete a firmeza dos frutos. Assinale a alternativa INCORRETA. a) Essa metodologia visa reduzir os níveis de etileno nos frutos evitando seu amadurecimento. b) O RNAm do gene "anti-sense" é capaz de parear com o RNAm da poligalacturonase, impedindo sua expressão. c) O maior tempo de prateleira a que o texto se refere se deve aos baixos níveis da enzima poligalacturonase. d) A tecnologia "anti-sense" para genes necessários à síntese do etileno poderia ser utilizada para se evitar o amadurecimento de frutos. 22. (PUC) A célula muscular cardíaca e a esquelética têm a mesma origem, porém são diferentes, tanto do ponto de vista estrutural como funcional. Ao longo do processo de diferenciação das células do mesmo organismo ocorre a) duplicação de alguns genes. b) perda dos genes não expressos. c) expressão diferencial dos genes. d) indução de mutações específicas. e) recombinação entre genes ativados. 23. A mutação em um gene, por conseqüência da substituição de uma única base na estrutura do DNA, pode acarretar modificações importantes na atividade biológica da proteína codificada por esse gene. Considere que a estrutura normal de um RNA mensageiro de um peptídio e sua estrutura alterada em virtude da troca de uma única base no gene correspondente são: 5' AUGUGGUUUGCACACAAAUGAUAA 3' (normal) 5' AUGUGGUUUGAACACAAAUGAUAA 3' (alterada) A tabela a seguir identifica alguns códons. 27

28 Observe que: - o códon da metionina é também o do início da tradução; - os códons de término da tradução são UAA, UAG e UGA. O aminoácido encontrado no peptídio normal e aquele que o substituiu no peptídio mutante são, respectivamente: a) lisina e cisteína b) treonina e triptofano c) alanina e ácido glutâmico d) fenil alanina e ácido aspártico 23. (PUC) Diversas doenças estão relacionadas a mutações no material genético. Porém, mutações pontuais, com a alteração de apenas uma base nitrogenada, muitas vezes não resultam em substituição efetiva do aminoácido correspondente ao códon mutado na proteína produzida. Isto se dá devido ao fato de: a) o código genético ser universal. b) o código genético ser repetitivo ou degenerado. c) o erro ser corrigido pela célula durante a tradução. d) o código genético não poder sofrer alterações. e) os genes mutados não serem transcritos ou traduzidos. 24. (PUC) Em 1987, foi oficialmente fundado o Projeto Genoma, que visa decifrar e mapear o código genético humano. Indique a alternativa ERRADA relativa ao código genético e à síntese de proteínas: a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula, determinando as características de um ser vivo. b) Todas as células do corpo têm a mesma coleção de genes, mas, apesar disto, encontramos células com formas e funções diferentes. c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas. d) As mudanças na programação genética de um organismo não alteram a produção de proteínas, nem as suas características. e) A Engenharia Genética, que é uma técnica de manipulação dos genes, pode corrigir defeitos no código genético de um organismo. 25. (UFF) A determinação da seqüência de aminoácidos de todas as proteínas da espécie humana e de outros seres vivos é de extrema importância. A partir da seqüência de aminoácidos de uma proteína, podem-se identificar as possíveis seqüências de DNA que a originaram. Considere o quadro: 28

29 Com base no quadro apresentado, assinale a opção que indica a seqüência do DNA responsável pela síntese do peptídeo mostrado a seguir: Met - Asn - Glu - Cys - Tyr - Phe a) ATG - AAT - GAA - TGT - TAC - TTT b) ATG - AAC - GAA - TTC - TAC - TTT c) ATC - AAT - GAA - TGT - TAC - TTT d) ATG - AAT - GCC - TGT - TAC - TTC e) ATC - AAT - GAA - TGT - TAC TTC 26) (UERJ) A gripe conhecida popularmente como gripe suína é causada por um vírus influenza A. Esse tipo de vírus se caracteriza, dentre outros aspectos, por: - ser formado por RNA de fita simples (-), incapaz de atuar como RNA mensageiro ou de sintetizar DNA nas células parasitadas; - os RNA complementares do RNA viral poderem ser traduzidos em proteínas pelo aparelhamento celular. Os esquemas a seguir apresentam um resumo de etapas dos processos de replicação de alguns dos vírus RNA, após penetrarem nas células. O tipo de replicação encontrado no vírus infuenza A está representado no esquema de número: a) I b) II c) III d) IV 29

30 Módulo I Bio 2 Cap 1 Citologia, Membrana e transporte 1. Considere os seguintes componentes celulares: I. parede celular II. ribossomos III. núcleo IV. membrana plasmática V. mesossomo VI. DNA Uma célula bacteriana é desprovida, apenas, de a) I b) III c) I e III d) II e V e) III, IV e VI 2. Comparando uma célula procariótica com células eucarióticas vegetal e animal, em comum as três apresentam: a) mitocôndrias, centríolos e flagelos b) membrana plasmática, ribossomos e cromatina c) membrana esquelética, ribossomos e cromatina d) parede celular celulósica, membrana plasmática e lisossomos e) membrana esquelética, membrana plasmática e cromatina 3. A multicelularidade caracteriza-se por uma associação de células com interdependência estrutural e funcional. Considere as seguintes afirmações sobre as vantagens da multicelularidade dos eumetazoários. I - Ela propicia uma grande diversificação de seres vivos adaptados a diferentes ambientes. II - Ela favorece uma maior independência dos seres vivos em relação ao meio ambiente, mantendo as condições do seu meio interno. III - Ela fornece uma maior proteção às colônias de procariontes. Quais estão corretas? a) Apenas I. b) Apenas II. c) Apenas I e II. d) Apenas II e III. e) I, II e III. 4. (PUC) Em relação aos envoltórios celulares, podemos afirmar que: a) todas as células dos seres vivos têm parede celular. b) somente as células vegetais têm membrana celular. c) somente as células animais têm parede celular. d) todas as células dos seres vivos têm membrana celular. e) os fungos e bactérias não têm parede celular. 5. (UFJF) Observe a figura a seguir, que ilustra uma célula humana e seus principais constituintes citoplasmáticos, e analise as afirmativas. I. As células do fígado inativam substâncias nocivas ao organismo, porque possuem grande quantidade da estrutura 1. II. As hemácias não se multiplicam, porque não apresentam a estrutura 2. III. As células do pâncreas possuem acentuada síntese protéica, porque apresentam a estrutura 3 desenvolvida. IV. As células do músculo estriado utilizam prótons (H ) liberados pela estrutura 4 para realizar a contração. V. Os espermatozóides se locomovem, porque possuem flagelos originados da estrutura 5.

31 Assinale a opção que apresenta somente afirmativas CORRETAS. a) I, II e III b) I, II e IV c) I, IV e V d) II, III e V e) III, IV e V 6. A membrana plasmática, além de exercer importante papel na seleção e no transporte de substâncias para dentro e fora da célula, tem em sua constituição moléculas que trabalham na identificação de outras células iguais ou estranhas. Analise as afirmativas a seguir sobre a estrutura e função da membrana plasmática, e marque a alternativa correta. a) A bomba de sódio e potássio é um exemplo de transporte passivo, em que a despolarização e repolarização acontecem sem gasto de energia. b) Os glicídios, que aparecem apenas na face externa da membrana, participam na identificação de células do mesmo tecido ou de células estranhas. c) No modelo de membrana de Singer e Nicholson, as proteínas estão fixas entre uma camada dupla de lipídios, não se movendo em lateralidade, o que confere à estrutura da membrana um caráter estático. d) Difusão e osmose são sinônimos e exemplos de transporte passivo. 7. Os reinos monera, protista, fungo, vegetal e animal constituem cinco categorias que agrupam os seres vivos. Embora os indivíduos apresentem diferentes níveis de organização, eles compartilham a seguinte característica: a) Parede celular b) Carioteca c) Vacúolo contráctil d) Membrana citoplasmática e) Plastídeo com pigmentos 8. Analise a figura a seguir: Com base na figura e nos conhecimentos sobre o tema, analise as afirmativas a seguir: I. Graças a seus receptores específicos, a membrana tem a capacidade de reconhecer outras células e diversos tipos de moléculas como, por exemplo, hormônios. Este reconhecimento, pela ligação de uma molécula específica com o receptor da membrana, desencadeia uma resposta que varia conforme a célula e o estímulo recebido. II. Os lipídios das membranas são moléculas longas com uma extremidade hidrofílica e uma cadeia hidrofóbica. As macromoléculas apresentam uma região hidrofílica e, portanto, solúvel em meio aquoso e uma região hidrofóbica, insolúvel em água, porém solúvel em lipídios. III. A membrana celular é permeável à água. Colocadas em uma solução hipertônica, as células aumentam de volume devido à penetração de água. Se o aumento de volume for acentuado, a membrana plasmática se rompe e o conteúdo da célula extravasa, fenômeno conhecido como desplasmólise. IV. Quando colocadas em solução hipotônica, as células diminuem de volume devido à saída de água. Havendo entrada ou saída de água, a forma da célula fica inalterada, por ser, em parte, determinada pelo estado de hidratação dos colóides celulares e pela rigidez oferecida pela parede celular. Assinale a alternativa que contém todas as afirmativas corretas. a) I e II. b) I e III. c) II e IV. d) I, III e IV. e) II, III e IV.

32 9. A seguir, pode-se observar a representação esquemática de uma membrana plasmática celular e de um gradiente de concentração de uma pequena molécula "X" ao longo dessa membrana. Com base nesse esquema, considere as seguintes afirmativas: I. A molécula "X" pode se movimentar por difusão simples, através dos lipídios, caso seja uma molécula apolar. II. A difusão facilitada da molécula "X" acontece quando ela atravessa a membrana com o auxílio de proteínas carreadoras, que a levam contra seu gradiente de concentração. III. Se a molécula "X" for um íon, ela poderá atravessar a membrana com o auxílio de uma proteína carreadora. IV. O transporte ativo da molécula "X" ocorre do meio extracelular para o citoplasma. Assinale a alternativa correta. a) Somente as afirmativas I e II são verdadeiras. b) Somente as afirmativas II e IV são verdadeiras. c) Somente as afirmativas I e III são verdadeiras. d) Somente as afirmativas I, III e IV são verdadeiras. e) Somente a afirmativa III é verdadeira. 10. Sabe-se que, para as células exercerem suas funções, é necessário haver um controle da concentração interna de água e íons. Em 2003, o prêmio Nobel de química foi justamente para dois médicos norte-americanos que estudaram de que forma a água é transportada através da membrana celular de alguns tipos de tecidos, como o epitélio das glândulas lacrimais. Eles descobriram proteínas (aquaporinas), ao nível da membrana plasmática, que formam poros passivos para a água se movimentar. O sentido do movimento é dado pelo gradiente osmótico e a seleção das moléculas de água é feita pelo seu tamanho e carga elétrica. "Ciência Hoje", n. 200, 2003 [adapt.] Baseado(a) nos textos e nos seus conhecimentos, assinale a alternativa INCORRETA. a) O processo de difusão de moléculas, representado nas figuras, é chamado de osmose. Em células vegetais na condição 2 ocorre a plasmólise. b) Uma das formas de diferenciar o transporte ativo do passivo é quanto ao gasto de energia (ATP) e direção do transporte (contra ou a favor do gradiente eletroquímico). c) Células animais e vegetais, na condição 1, absorvem água, por isso 'incham', o que pode levar ao rompimento celular. d) Na difusão facilitada, um tipo de transporte passivo, as proteínas de membrana transportam substâncias do meio mais concentrado para o menos concentrado. e) Baseado nas figuras, pode-se considerar que, na condição 1, o meio é hipotônico e, na condição 2, é hipertônico em relação à celula.

33 11. (UFF) Considere a experiência relatada a seguir: -Incubaram-se células de camundongo com anticorpos marcados com rodamina (fluorescência vermelha), os quais reagem com proteínas de membrana de células de camundongo. -Incubaram-se células humanas com anticorpos marcados com fluoresceína (fluorescência verde), os quais reagem com proteínas de membrana de células humanas. -Promoveu-se a fusão das células de camundongo com as células humanas, ambas já ligadas aos anticorpos. -Observaram-se, ao microscópio de fluorescência, as células híbridas formadas logo após a fusão e quarenta minutos depois. Com base nessas informações, conclui-se que a membrana citoplasmática tem características: a) elásticas b) glicolipoproteicas c) fluidas d) rígidas e) semipermeáveis 12. (PUC) Muitas membranas celulares contêm apreciável quantidade de ésteres de ácidos graxos insaturados, derivados do ácido fosfórico e proteínas. Essas substâncias têm na membrana, uma distribuição definida, isto é, cadeias hidrofóbicas se estendem para dentro de uma bicamada e os grupos hidrofílicos são orientados para fora em contato com a água. Devem fazer parte da "cabeça" e da "cauda", respectivamente, a) grupos polares e grupos fosfóricos. b) longas cadeias carbônicas e grupos polares. c) grupos polares e longas cadeias carbônicas. d) longas cadeias carbônicas e grupos apolares. e) grupos apolares e grupos polares. 13. No início da década de 70, dois cientistas (Singer e Nicholson) esclareceram definitivamente como é a estrutura das membranas celulares, propondo-se o modelo denominado mosaico-fluido. Neste conceito, todas as membranas presentes nas células animais e vegetais são constituídas basicamente pelos seguintes componentes: a) ácidos nucléicos e proteínas. b) ácidos nucléicos e enzimas. c) lipídios e enzimas. d) enzimas e glicídios. e) lipídios e proteínas. 14. O uso de vinagre e sal de cozinha em uma salada de alface, além de conferir mais sabor, serve também para eliminar microorganismos causadores de doenças, como as amebas, por exemplo. O inconveniente do uso desse tempero é que, depois de algum tempo, as folhas murcham e perdem parte de sua textura. Esses fenômenos ocorrem porque

34 a) as amebas morrem ao perderem água rapidamente por osmose. Já as células da alface possuem um envoltório que mantém sua forma mesmo quando perdem água por osmose e, por isso, murcham mais lentamente. b) tanto as amebas quanto as células da alface não possuem barreiras para a perda de água por difusão simples. Ocorre que, no caso da alface, trata-se de um tecido e não de um único organismo e, portanto, a desidratação é notada mais tardiamente. c) as amebas morrem ao perderem água por osmose, um processo mais rápido. Em contrapartida, as células da alface perdem água por difusão facilitada, um processo mais lento e, por isso, percebido mais tardiamente. d) o vinagre, por ser ácido, destrói a membrana plasmática das amebas, provocando sua morte. No caso da alface, o envoltório das células não é afetado pelo vinagre, mas perde água por difusão simples, provocada pela presença do sal. e) nas amebas, a bomba de sódio atua fortemente capturando esse íon presente no sal, provocando a entrada excessiva de água e causando a morte desses organismos. As células da alface não possuem tal bomba e murcham por perda de água por osmose. 15. Sabe-se que no transporte de substâncias através da membrana plasmática: 1) Certos íons são conservados com determinadas concentrações dentro e fora da célula, com gasto de energia. 2) Caso cesse a produção de energia, a tendência é de distribuírem-se homogeneamente as concentrações destes íons. As frases 1 e 2 referem-se, respectivamente, aos seguintes tipos de transporte: a) difusão facilitada e osmose b) transporte ativo e difusão simples c) transporte ativo e osmose d) difusão facilitada e difusão simples 16. As curvas A e B representam transportes de sódio (Na+) entre os meios intra e extracelulares de um neurônio. Pela análise do gráfico e de acordo com seus conhecimentos, é correto afirmar, EXCETO: a) A curva A representa transporte ativo. b) Em B está ocorrendo difusão através de canais. c) O uso de uma droga que bloqueie a produção de ATP é essencial para que B ocorra. d) A transmissão de impulsos nervosos depende da alternância entre as curvas A e B. 17. transporte de potássio (K+) através da membrana da célula pode ser feito por diferentes processos de transporte transmembrana. Analise a variação na taxa de transporte de K+ através da membrana de uma célula em função da temperatura. De acordo com os resultados apresentados na figura, a) a curva A representa o transporte feito por um mecanismo de difusão facilitada. b) a curva B representa a passagem do K+ por um processo de difusão simples. c) podemos afirmar que ambas as curvas estão relacionadas a processos de transporte ativo. d) a curva B reflete um processo de transporte por difusão facilitada. e) em A devemos ter a presença de uma permease, atuando no transporte do K+.

35 18. (UFF) Uma nova descoberta brasileira pode ajudar no tratamento da malária. Essa descoberta mostrou que, ao invadir o eritrócito, o plasmódio carrega parte do sistema de transporte de Ca existente na membrana dessa célula vermelha. Dessa forma, o parasita consegue regular o nível de Ca que é um fator importante na sua multiplicação e que normalmente encontra-se baixo no interior do eritrócito. (Modificado de "Ciência Hoje" Vol 33, NŽ196, agosto de 2003) Um pesquisador, ao ler a reportagem acima, resolveu fazer uma experiência para entender como se comportava o nível de Ca nos eritrócitos. Para isso, submeteu hemácias normais, em meio de cultura contendo glicose, às seguintes condições: I - oxigenação adequada (controle) II - ausência de oxigênio III - oxigenação adequada em presença de fluoreto (inibidor da glicólise) Os resultados obtidos foram descritos na tabela a seguir: Os resultados indicam que o transporte de Ca+2 pela membrana do eritrócito normal é: a) por difusão passiva e independente da síntese de ATP b) por difusão facilitada dependente da síntese de ATP em condições aeróbicas c) ativo e dependente da síntese mitocondrial de ATP d) por difusão facilitada e dependente da energia derivada da fermentação láctica e) ativo e dependente de energia derivada da glicólise Sobre a fibrose cística, é CORRETO afirmar que: a) é uma doença caracterizada por abundante secreção de muco na pele. b) é uma doença relacionada com a ausência de uma proteína normal nas membranas celulares responsável pelo transporte de íon sódio. c) caracteriza-se como doença genética, relacionada com a ausência de uma proteína normal nas membranas celulares responsável pelo transporte do íon cloro. d) no combate à fibrose cística, o organismo envia, inicialmente, os eosinófilos e, em seguida, os macrófagos. e) é caracterizada por intensa hemorragia nos pulmões. 19. (UERJ) Um pesquisador verificou que a substância por ele estudada apresentava como efeito, em meio de cultura de linfócitos, a diminuição da concentração intracelular do íon potássio. A explicação admitida pelo pesquisador para essa diminuição foi a ocorrência de alterações na função de, pelo menos, um dos seguintes sistemas: a bomba de sódio-potássio, os canais de transporte passivo de potássio ou a síntese de ATP na célula. Os gráficos a seguir mostram possíveis alterações nas funções de cada um desses sistemas; o ponto 0 representa a função normal, na ausência da substância estudada, e o sinal positivo e o negativo representam, respectivamente, o aumento e a diminuição da função. O gráfico no qual cada um dos três sistemas apresenta uma alteração compatível com o efeito da substância é o de número:

36 a) I b) II c) III d) IV 20. (UERJ) Células do tipo X absorvem a substância S apenas por transporte ativo. Essa absorção, em células do tipo Y, é feita por transporte passivo mediado por um transportador específico. Num experimento, foram medidas as velocidades iniciais de transporte de S através das membranas plasmáticas de X e de Y, em função de concentrações crescentes dessa substância no meio extracelular. O experimento foi repetido, então, em presença de um inibidor da geração de ATP nas células. Observe a tabela, que resume as condições do experimento, e o gráfico a seguir. As curvas que representam as medidas obtidas, respectivamente, nas condições experimentais I, II, III e IV, são: a) b) c) d) (UERJ) Em um experimento realizado em um laboratório escolar, duas tiras de batata foram mergulhadas por 10 minutos, uma na solução A e a outra na solução B. Os resultados, após este tempo, estão resumidos na tabela adiante. Em relação à tonicidade do citoplasma das células de batata, as soluções A e B são respectivamente classificadas como: a) hipotônica e isotônica b) isotônica e hipertônica c) hipertônica e hipotônica d) hipotônica e hipertônica 22. Um experimento sobre absorção intestinal foi utilizado o seguinte procedimento: - fechar um pedaço de alça intestinal em uma das extremidades, formando um saco; - virar o saco, expondo a mucosa para o lado externo; - colocar solução salina no interior do saco; - mergulhá-lo, parcialmente, numa solução salina idêntica, porém acrescida de glicose; - medir, em função do tempo, a variação da concentração da glicose na solução externa, mantendo as condições adequadas; - adicionar, em um determinado momento T, à solução externa, cianeto de sódio, um forte inibidor da cadeia respiratória mitocondrial. O resultado deste experimento está representado por uma das curvas do gráfico a seguir.

37 A curva que representa as variações da concentração de glicose na solução em que o saco foi mergulhado é a de número: a) 1 b) 2 c) 3 d) (UERJ) OBESIDADE Proteína facilita a absorção de gorduras. A proteína FATP4, que tem um papel importante na absorção da gordura pelo organismo, se presente em nível elevado nas células que revestem pequenas saliências vasculares do intestino delgado e responsáveis pelo transporte dos ácidos graxos dentro do corpo, leva à obesidade, um problema de saúde... (Jornal do Brasil, 24/09/99) As pequenas saliências vasculares no intestino delgado mencionadas acima consistem na seguinte estrutura e respectiva constituição: a) glândulas - epitélio e membrana basal b) vilosidades - epitélio e tecido conjuntivo c) evaginações - paredes de vasos sangüíneos e linfáticos d) microvilosidades - membrana plasmática e microtúbulos 24. A membrana plasmática pode apresentar modificações ligadas ao aumento da adesão celular. Assinale a alternativa que apresente exemplos destas modificações nas células epiteliais animais. a) glicocálix e plasmodesmos b) glicocálix e interdigitações c) plasmodesmos e microvilos d) desmossomos e vilosidades e) zônula de oclusão e trama terminal 25. Para exercerem suas funções de reabsorção, as células epiteliais dos túbulos renais apresentam a) vilosidades e muitas mitocôndrias. b) superfície lisa e muitas mitocôndrias. c) vilosidades e poucas mitocôndrias. d) superfície lisa e poucas mitocôndrias. e) grandes vacúolos. 26. (UERJ) Como consequência dos mecanismos que regulam a pressão osmótica dos peixes marinhos, os peixes ósseos precisam beber água do mar, enquanto os cartilaginosos não. O gráfico abaixo mostra a osmolaridade do plasma sanguíneo de peixes marinhos, em relação à da água do mar. A coluna do gráfico que representa a osmolaridade do plasma dos elasmobrânquios e a substância orgânica importante para a manutenção da pressão osmótica nesses animais estão indicadas em: a) 1 - ácido úrico b) 2 - glicina c) 3 glicose d) 4 uréia 27. (UERJ) No fígado, o transporte de glicose é realizado por difusão passiva mediada por proteínas transportadoras da membrana plasmática. Em um experimento, cuja base consistiu em cultivar células hepáticas em um meio adequado, foram seguidos os seguintes passos: - adicionar ao meio de cultivo uma concentração de glicose suficiente para manter, já no primeiro minuto, seu transportador saturado;

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

ÁCIDOS NUCLÉICOS. Prof. Sharline F. M. Santos UFPB CT DEQ

ÁCIDOS NUCLÉICOS. Prof. Sharline F. M. Santos UFPB CT DEQ ÁCIDOS NUCLÉICOS Prof. Sharline F. M. Santos UFPB CT DEQ ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucleicos: DNA ou ácido desoxiribonucleico e RNA ou ácido ribonucleico. Ácidos Nucléicos Os

Leia mais

A base molecular da vida Constituintes da matéria-viva

A base molecular da vida Constituintes da matéria-viva A base molecular da vida Constituintes da matéria-viva Principais elementos químicos dos seres vivos Quando se analisa a matéria-viva que constitui os seres vivos, encontram-se principalmente os seguintes

Leia mais

O QUE SÃO SUBSTÂNCIAS INORGÂNICAS? QUAL A FUNÇÃO BIOLÓGICA DE CADA UMA?

O QUE SÃO SUBSTÂNCIAS INORGÂNICAS? QUAL A FUNÇÃO BIOLÓGICA DE CADA UMA? O QUE SÃO SUBSTÂNCIAS ORGÂNICAS? O QUE SÃO SUBSTÂNCIAS INORGÂNICAS? QUAL A FUNÇÃO BIOLÓGICA DE CADA UMA? SUBSTÂNCIAS ORGÂNICAS: CARBONO, HIDROGÊNIO, OXIGÊNIO E NITROGÊNIO FORMAM CADEIAS LONGAS E COMPLEXAS

Leia mais

23/03/2015. Moléculas orgânicas - Carboidratos

23/03/2015. Moléculas orgânicas - Carboidratos Moléculas orgânicas - Carboidratos São formados por C, H, O. São Conhecidos como: Hidratos de Carbono Glucídios Glicídios Açúcares Sacarídeos Funções: Energética (glicose); Glicogênio : reserva energética

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira ENEM. Citologia

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira ENEM. Citologia ENEM Citologia 1. (Enem 2014) Segundo a teoria evolutiva mais aceita hoje, as mitocôndrias, organelas celulares responsáveis pela produção de ATP em células eucariotas, assim como os cloroplastos, teriam

Leia mais

COMPOSIÇÃO QUÍMICA CELULAR COMPOSTOS INORGÂNICOS: ÁGUA- SAIS MINERAIS COMPOSTOS ORGÂNICOS: CARBOIDRATOS

COMPOSIÇÃO QUÍMICA CELULAR COMPOSTOS INORGÂNICOS: ÁGUA- SAIS MINERAIS COMPOSTOS ORGÂNICOS: CARBOIDRATOS COMPOSIÇÃO QUÍMICA CELULAR COMPOSTOS INORGÂNICOS: ÁGUA- SAIS MINERAIS COMPOSTOS ORGÂNICOS: CARBOIDRATOS COMPOSTOS INORGÂNICOS Não apresentam Carbono em sua estrutura DOIS TIPOS: Água e Sais Minerais ÁGUA:

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

47 Por que preciso de insulina?

47 Por que preciso de insulina? A U A UL LA Por que preciso de insulina? A Medicina e a Biologia conseguiram decifrar muitos dos processos químicos dos seres vivos. As descobertas que se referem ao corpo humano chamam mais a atenção

Leia mais

BIOLOGIA - AULA 04: NOÇÕES DE QUÍMICA CELULAR; MEMBRANA PLASMÁTICA E TRANSPORTES.

BIOLOGIA - AULA 04: NOÇÕES DE QUÍMICA CELULAR; MEMBRANA PLASMÁTICA E TRANSPORTES. BIOLOGIA - AULA 04: NOÇÕES DE QUÍMICA CELULAR; MEMBRANA PLASMÁTICA E TRANSPORTES. I. NOÇÕES DE QUÍMICA CELULAR 1. A composição química da célula Certas substâncias são essenciais para a manutenção da vida

Leia mais

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I

INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA. Aluno: Módulo I INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CAMPUS LAGES CURSO TÉCNICO EM BIOTECNOLOGIA Aluno: Módulo I Professor: Leandro Parussolo Unidade Curricular: Biologia Celular ATIVIDADE

Leia mais

Trabalho Online. 3ª SÉRIE TURMA: 3101 2º Bimestre Nota: DATA: / /

Trabalho Online. 3ª SÉRIE TURMA: 3101 2º Bimestre Nota: DATA: / / Trabalho Online NOME: Nº.: DISCIPLINA: BIOLOGIA I PROFESSOR(A): LEANDRO 3ª SÉRIE TURMA: 3101 2º Bimestre Nota: DATA: / / 1. A seguir estão representados três modelos de biomembranas: a) A que constituintes

Leia mais

Vitaminas Função: reguladora Atuação: ativando enzimas fundamentais nos processos metabólicos dos seres vivos. BIOLOGIA 3ª série Profª Reisila Mendes

Vitaminas Função: reguladora Atuação: ativando enzimas fundamentais nos processos metabólicos dos seres vivos. BIOLOGIA 3ª série Profª Reisila Mendes Vitaminas Função: reguladora Atuação: ativando enzimas fundamentais nos processos metabólicos dos seres vivos. BIOLOGIA 3ª série Profª Reisila Mendes Classificação Lipossolúveis (A, D E e K) Não possuem

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Importante reserva energética; são as gorduras.

Importante reserva energética; são as gorduras. Importante reserva energética; são as gorduras. 1g de lipídio libera 9kcal contra 4kcal por 1g de carboidrato. Podem ser armazenados de forma mais concentrada que os carboidratos. O excesso do consumo

Leia mais

ALUNO(a): Observe o esquema a seguir, no qual I e II representam diferentes estruturas citoplasmáticas.

ALUNO(a): Observe o esquema a seguir, no qual I e II representam diferentes estruturas citoplasmáticas. GOIÂNIA, / / 2015 PROFESSOR: DISCIPLINA: SÉRIE: 3º ano ALUNO(a): Lista de Exercícios NOTA: No Anhanguera você é + Enem Questão 01) Observe o esquema a seguir, no qual I e II representam diferentes estruturas

Leia mais

Função orgânica nossa de cada dia. Profa. Kátia Aquino

Função orgânica nossa de cada dia. Profa. Kátia Aquino Função orgânica nossa de cada dia Profa. Kátia Aquino Vamos analisar! Funções Carboidratros (ou Glicídios) Energética: eles são os maiores fornecedores de energia para os seres vivos, principalmente a

Leia mais

Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano

Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano Escola Secundária do Monte de Caparica Disciplina de Biologia 10 º Ano Teste de avaliação Nome ----------------------------------------------------------------------- Numero -------------------------------

Leia mais

QUÍMICA CELULAR NUTRIÇÃO TIPOS DE NUTRIENTES NUTRIENTES ENERGÉTICOS 4/3/2011 FUNDAMENTOS QUÍMICOS DA VIDA

QUÍMICA CELULAR NUTRIÇÃO TIPOS DE NUTRIENTES NUTRIENTES ENERGÉTICOS 4/3/2011 FUNDAMENTOS QUÍMICOS DA VIDA NUTRIÇÃO QUÍMICA CELULAR PROFESSOR CLERSON CLERSONC@HOTMAIL.COM CIESC MADRE CLÉLIA CONCEITO CONJUNTO DE PROCESSOS INGESTÃO, DIGESTÃO E ABSORÇÃO SUBSTÂNCIAS ÚTEIS AO ORGANISMO ESPÉCIE HUMANA: DIGESTÃO ONÍVORA

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

(04) I - C (08) IV - C

(04) I - C (08) IV - C COLÉGIO CEC CENTRO EDUCACIONAL CIANORTE ED. INFANTIL, ENS. FUNDAMENTAL E MÉDIO - SISTEMA ANGLO DE ENSINO. COMPOSIÇÃO QUÍMICA (INORGÂNICA E ORGÂNICA) TERCEIRÃO 2012 (NANNI) 01) Sobre as substâncias que

Leia mais

Exercícios complementares. Biologia I. Capítulo I. Geovane souza

Exercícios complementares. Biologia I. Capítulo I. Geovane souza Exercícios complementares Biologia I Capítulo I Geovane souza QUESTÃO 1 Os adubos inorgânicos industrializados, conhecidos pela sigla NPK, contêm sais de três elementos químicos: nitrogênio, fósforo e

Leia mais

08/10/2012. Citologia. Equipe de Biologia. De que são formados os seres vivos? Substâncias inorgânicas. Água Sais minerais. Substâncias orgânicas

08/10/2012. Citologia. Equipe de Biologia. De que são formados os seres vivos? Substâncias inorgânicas. Água Sais minerais. Substâncias orgânicas Citologia Equipe de Biologia De que são formados os seres vivos? Substâncias inorgânicas Água Sais minerais Substâncias orgânicas Carboidratos Lipídios Proteínas Vitaminas Ácidos nucleicos .

Leia mais

CITOLOGIA NO ENEM (2014-2005) (C) presença de membranas envolvendo e separando a matriz mitocondrial do citoplasma.

CITOLOGIA NO ENEM (2014-2005) (C) presença de membranas envolvendo e separando a matriz mitocondrial do citoplasma. CTOLOGA NO ENEM (2014-2005) (Questão 1 - ENEM 2014) Segundo a teoria evolutiva mais aceita hoje, as mitocôndrias, organelas responsáveis pela produção de ATP em células eucarióticas, assim como os cloroplastos,

Leia mais

NUTRIÇÃO. Prof. Marta E. Malavassi

NUTRIÇÃO. Prof. Marta E. Malavassi Prof. Marta E. Malavassi Conceito: processo orgânico que envolve ingestão, digestão, absorção, transporte e eliminação das substâncias alimentares para a manutenção de funções, a formação e regeneração

Leia mais

Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia celular e molecular Cursos: Ciências Biológicas, Enfermagem, Nutrição e TO.

Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia celular e molecular Cursos: Ciências Biológicas, Enfermagem, Nutrição e TO. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia celular e molecular Cursos: Ciências Biológicas, Enfermagem, Nutrição e TO. Bases Macromoleculares das Células Composição química das células

Leia mais

Biomassa de Banana Verde Integral- BBVI

Biomassa de Banana Verde Integral- BBVI Biomassa de Banana Verde Integral- BBVI INFORMAÇÕES NUTRICIONAIS Porção de 100g (1/2 copo) Quantidade por porção g %VD(*) Valor Energético (kcal) 64 3,20 Carboidratos 14,20 4,73 Proteínas 1,30 1,73 Gorduras

Leia mais

PROFESSOR GUILHERME BIOLOGIA

PROFESSOR GUILHERME BIOLOGIA Laranjeiras do Sul: Av. 7 de Setembro, 1930. Fone: (42) 3635 5413 Quedas do Iguaçu: Pça. Pedro Alzide Giraldi, 925. Fone: (46) 3532 3265 www.genevestibulares.com.br / contato@genevestibulares.com.br PROFESSOR

Leia mais

BIOLOGIA AULA 03. c) diabetes tipo II. d) hipertensão arterial.

BIOLOGIA AULA 03. c) diabetes tipo II. d) hipertensão arterial. BIOLOGIA Prof. Hélder Telles AULA 03 1. (Fgv 2015) O pâncreas é uma glândula anfícrina, ou seja, com dupla função, desempenhando um papel junto ao sistema digestório na produção de enzimas, tais como amilases

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Bioenergética. Profa. Kalyne de Menezes Bezerra Cavalcanti

Bioenergética. Profa. Kalyne de Menezes Bezerra Cavalcanti Bioenergética Profa. Kalyne de Menezes Bezerra Cavalcanti Natal/RN Fevereiro de 2011 Substratos para o exercício O corpo utiliza nutrientes carboidratos, gorduras e proteínas consumidos diariamente para

Leia mais

Nestas últimas aulas irei abordar acerca das vitaminas. Acompanhe!

Nestas últimas aulas irei abordar acerca das vitaminas. Acompanhe! Aula: 31 Temática: Vitaminas parte I Nestas últimas aulas irei abordar acerca das vitaminas. Acompanhe! Introdução O termo vitamina refere-se a um fator dietético essencial requerido por um organismo em

Leia mais

M E T B O L I S M O CATABOLISMO ANABOLISMO

M E T B O L I S M O CATABOLISMO ANABOLISMO METABOLISMO É o conjunto das reações químicas que ocorrem num organismo vivo com o fim de promover a satisfação de necessidades estruturais e energéticas. ...metabolismo Do ponto de vista físico-químico,

Leia mais

Atividade Física e Alimentação Protéica

Atividade Física e Alimentação Protéica Atividade Física e Alimentação Protéica Para obter um bom desempenho o atleta não necessita somente de um bom treinamento, precisa de uma dieta balanceada que contenha quantidades adequadas de proteína,

Leia mais

Os lipídios são substâncias com estrutura variada sendo muito abundantes em animais e vegetais;

Os lipídios são substâncias com estrutura variada sendo muito abundantes em animais e vegetais; Lipídios Os lipídios são substâncias com estrutura variada sendo muito abundantes em animais e vegetais; Eles compartilham a característica de apresentarem baixa solubilidade em água sendo solúveis em

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

VALOR NUTRITIVO DA CARNE

VALOR NUTRITIVO DA CARNE VALOR NUTRITIVO DA CARNE Os alimentos são consumidos não só por saciarem a fome e proporcionarem momentos agradáveis à mesa de refeição mas, sobretudo, por fornecerem os nutrientes necessários à manutenção

Leia mais

QUESTÃO 40 PROVA DE BIOLOGIA II. A charge abaixo se refere às conseqüências ou características da inflamação. A esse respeito, é INCORRETO afirmar:

QUESTÃO 40 PROVA DE BIOLOGIA II. A charge abaixo se refere às conseqüências ou características da inflamação. A esse respeito, é INCORRETO afirmar: 22 PROVA DE BIOLOGIA II QUESTÃO 40 A charge abaixo se refere às conseqüências ou características da inflamação. A esse respeito, é INCORRETO afirmar: a) Se não existisse o processo inflamatório, os microorganismos

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Células procarióticas

Células procarióticas Pró Madá 1º ano Células procarióticas Citosol - composto por 80% de água e milhares de tipos de proteínas, glicídios, lipídios, aminoácidos, bases nitrogenadas, vitaminas, íons. Moléculas de DNA e ribossomos

Leia mais

Biologia Celular - Prof. Douglas

Biologia Celular - Prof. Douglas LISTA DE EXERCÍCIOS - BIOLOGIA [Supletivo São Benedito] Biologia Celular - Prof. Douglas Q1 - (CEFET-MG/2012-1) Associou-se corretamente as estruturas existentes nas células aos tipos celulares exemplificados,

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais

Oficina CN/EM 2012. Alimentos e nutrientes (web aula) H34 Reconhecer os principais tipos de nutrientes e seu papel no metabolismo humano.

Oficina CN/EM 2012. Alimentos e nutrientes (web aula) H34 Reconhecer os principais tipos de nutrientes e seu papel no metabolismo humano. Oficina CN/EM 2012 Alimentos e nutrientes (web aula) Caro Monitor, Ao final da oficina, o aluno terá desenvolvido as habilidade: H34 Reconhecer os principais tipos de nutrientes e seu papel no metabolismo

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== 01- Os seres vivos apresentam

Leia mais

27/08/2014. Carboidratos. Monossacarídeos. Introdução. Classificação (quanto ao número de monômeros) Carboidratos

27/08/2014. Carboidratos. Monossacarídeos. Introdução. Classificação (quanto ao número de monômeros) Carboidratos Introdução CARBOIDRATOS Outras denominações: - Hidratos de carbono - Glicídios, glícides ou glucídios - Açúcares. Ocorrência e funções gerais: São amplamente distribuídos nas plantas e nos animais, onde

Leia mais

Lista de exercícios: Carboidratos, Proteína e Ácidos Nucleicos 1ºano/ Prof. Karina-BIO/ CFNP

Lista de exercícios: Carboidratos, Proteína e Ácidos Nucleicos 1ºano/ Prof. Karina-BIO/ CFNP 1. (Fuvest 2014) Observe a figura abaixo, que representa o emparelhamento de duas bases nitrogenadas. 3. (Unesp 2013) Em 2012, assim como em anos anteriores, o Ministério da Saúde promoveu a campanha para

Leia mais

COMPOSIÇÃO QUÍMICA DA CARNE. Profª Sandra Carvalho

COMPOSIÇÃO QUÍMICA DA CARNE. Profª Sandra Carvalho COMPOSIÇÃO QUÍMICA DA CARNE Profª Sandra Carvalho A carne magra: 75% de água 21 a 22% de proteína 1 a 2% de gordura 1% de minerais menos de 1% de carboidratos A carne magra dos diferentes animais de abate

Leia mais

( ) Falta de vitamina D. Dificuldades em absorver o cálcio, provocando problemas para a calcificação dos ossos.

( ) Falta de vitamina D. Dificuldades em absorver o cálcio, provocando problemas para a calcificação dos ossos. NOME: ANO: 8º ENSINO: FUNDAMENTAL I TURMA: DATA: / / PROF(ª).:Sandra Medeiros ATIVIDADE DIAGNÓSTICA DE CIÊNCIAS 1. Questão Estabeleça relação entre as colunas. (a) Beribéri ( ) Falta de vitamina D. Dificuldades

Leia mais

Aula 9 Sistema digestório

Aula 9 Sistema digestório Aula 9 Sistema digestório Os alimentos fornecem nutrientes para construção de estruturas celulares e, ainda, liberação de energia para as atividades celulares. A função da digestão é converter os alimentos

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Na aula de hoje continuaremos a estudar as vitaminas. Acompanhe!

Na aula de hoje continuaremos a estudar as vitaminas. Acompanhe! Aula: 32 Temática: Vitaminas parte II Na aula de hoje continuaremos a estudar as vitaminas. Acompanhe! Vitaminas lipossolúveis As vitaminas solúveis em gorduras são absorvidas no intestino humano com a

Leia mais

LISTA DE RECUPERAÇÃO PARALELA UNIDADE I

LISTA DE RECUPERAÇÃO PARALELA UNIDADE I Aluno(a) Turma N o Série 1 a Ensino Médio Data / / 06 Matéria Biologia Professora Luisa LISTA DE RECUPERAÇÃO PARALELA UNIDADE I Conteúdos: Sais Minerais, Lipídios, Proteínas/Enzimas 01. (FFFCMPA 2006)

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

Professor Carlos - Proteinas

Professor Carlos - Proteinas 14085. (Fuvest 2001) Os três compostos abaixo têm uso farmacológico Considere as afirmações: I Nas moléculas dos três compostos, há ligações peptídicas. II A porcentagem em massa de oxigênio na dropropizina

Leia mais

ALIMENTOS, NUTRIENTES E SAÚDE. Profª MSc Monyke Lucena

ALIMENTOS, NUTRIENTES E SAÚDE. Profª MSc Monyke Lucena ALIMENTOS, NUTRIENTES E SAÚDE Profª MSc Monyke Lucena Para podermos praticar esportes, estudar ou realizar qualquer outra atividade, devemos ter energia no nosso organismo; Essa energia é fornecida pelos

Leia mais

Valores diários recomendados de nutrientes, vitaminas e minerais.

Valores diários recomendados de nutrientes, vitaminas e minerais. Conteúdo Valores diários recomendados de nutrientes, vitaminas e minerais.... 2 Como ler os rótulos dos alimentos... 5 Dose de produto... 7 Calorias... 7 Quantidade de nutrientes... 8 Explicação da quantificação

Leia mais

Centríolos. Ribossomos

Centríolos. Ribossomos Ribossomos Os ribossomos são encontrados em todas as células (tanto eucariontes como procariontes) e não possuem membrana lipoprotéica (assim como os centríolos). São estruturas citoplasmáticas responsáveis

Leia mais

d) 23, 46, 26. 23 d) DNA nucleotídeos desoxirribose uracila desoxirribose timina e) DNA ácidos desoxirribonucléicos

d) 23, 46, 26. 23 d) DNA nucleotídeos desoxirribose uracila desoxirribose timina e) DNA ácidos desoxirribonucléicos 01 - (IBMEC RJ) O núcleo celular foi descoberto pelo pesquisador escocês Robert Brown, que o reconheceu como componente fundamental das células. O nome escolhido para essa organela expressa bem essa ideia:

Leia mais

www.aliancaprevestibular.com

www.aliancaprevestibular.com Professor Juliana Villa-Verde Disciplina Bio I Lista nº Assuntos Texto I Intodução à Citologia CITOLOGIA É o ramo da biologia que estuda a célula, unidade básica dos seres vivos. Hans e Zacarias Jensen

Leia mais

Sais minerais. Capítulo 5

Sais minerais. Capítulo 5 Sais minerais Os sais minerais são elementos químicos presentes na natureza, embora nós não sejamos capazes de sintetizá-los ou produzi-los em nosso corpo. Portanto, precisamos ingeri-los para que o corpo

Leia mais

95% de água, 3% de substâncias orgânicas e 2% de sais minerais. uma secreção serosa outra secreção mucosa

95% de água, 3% de substâncias orgânicas e 2% de sais minerais. uma secreção serosa outra secreção mucosa SISTEMA DIGESTÓRIO SALIVA A saliva é um líquido claro, viscoso, alcalino (ph entre 6 e 7), que contém em sua composição: 95% de água, 3% de substâncias orgânicas e 2% de sais minerais. Além disso, também

Leia mais

Nome Número Turma Gabarito. ( C ) composto orgânico monossacarídeo ( IV ) lipídeo ( D ) composto inorgânico ( V ) enzima ( E ) tipo de carboidrato

Nome Número Turma Gabarito. ( C ) composto orgânico monossacarídeo ( IV ) lipídeo ( D ) composto inorgânico ( V ) enzima ( E ) tipo de carboidrato Prova de Matéria Nome Número Turma Gabarito Questão 1 - Considere os compostos, apresentados na coluna da esquerda, e as características, apresentadas na coluna da direita e, após, assinale a(s) proposição(ões)

Leia mais

A descoberta da célula

A descoberta da célula A descoberta da célula O que são células? As células são a unidade fundamental da vida CITOLOGIA A área da Biologia que estuda a célula, no que diz respeito à sua estrutura e funcionamento. Kytos (célula)

Leia mais

Manual de Rotulagem de Alimentos

Manual de Rotulagem de Alimentos Manual de Rotulagem de Alimentos Agosto 2013 Programa Mesa Brasil Sesc O Mesa Brasil Sesc é um programa de segurança alimentar e nutricional sustentável, que redistribui alimentos excedentes próprios para

Leia mais

N1101 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia.

N1101 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. N1101 ATENÇÃO, ALUNO! Agora, você vai responder a questões de Biologia. Questão 01 B110006RJ Os seres vivos obtêm energia a partir da matéria orgânica que se encontra no organismo, comumente, na forma

Leia mais

FISIOLOGIA DIGESTIVA

FISIOLOGIA DIGESTIVA EXERCÍCIOS DE APRENDIZAGEM FISIOLOGIA DIGESTIVA 01. Na digestão, a redução dos alimentos a partículas através de processos mecânicos tem por finalidade: a) facilitar a eliminação de substâncias inúteis

Leia mais

Unidade: GUIA ALIMENTAR PARA A POPULAÇÃO

Unidade: GUIA ALIMENTAR PARA A POPULAÇÃO Unidade: GUIA ALIMENTAR PARA A POPULAÇÃO Unidade I: BRASILEIRA 0 Unidade: GUIA ALIMENTAR PARA A POPULAÇÃO BRASILEIRA O Guia Alimentar é um instrumento que define as diretrizes alimentares a serem utilizadas

Leia mais

EXERCÍCIOS ON LINE 1ª SÉRIE TURMA: 1101 DATA: NOME: Nº

EXERCÍCIOS ON LINE 1ª SÉRIE TURMA: 1101 DATA: NOME: Nº EXERCÍCIOS ON LINE 3º Bimestre DISCIPLINA: BIOLOGIA PROFESSOR(A): LEANDRO 1ª SÉRIE TURMA: 1101 DATA: NOME: Nº 1. Qual a composição química da membrana plasmática? 2. A célula apresenta membrana plasmática

Leia mais

CONCEITOS FUNDAMENTAIS DE QUÍMICA

CONCEITOS FUNDAMENTAIS DE QUÍMICA Aulão: 16/05/2015 Conteúdo: Bioquímica Celular Básica Profº Davi Vergara Profº Roberto Fonseca Os avanços da Química, nos séculos XIX e XX, foram fundamentais para o desenvolvimento atual da Biologia.

Leia mais

CITOPLASMA. Características gerais 21/03/2015. Algumas considerações importantes: 1. O CITOPLASMA DAS CÉLULAS PROCARIÓTICAS

CITOPLASMA. Características gerais 21/03/2015. Algumas considerações importantes: 1. O CITOPLASMA DAS CÉLULAS PROCARIÓTICAS CITOPLASMA Algumas considerações importantes: Apesar da diversidade, algumas células compartilham ao menos três características: Biologia e Histologia São dotadas de membrana plasmática; Contêm citoplasma

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 17 MITOCÔNDRIAS E RESPIRAÇÃO CELULAR

BIOLOGIA - 1 o ANO MÓDULO 17 MITOCÔNDRIAS E RESPIRAÇÃO CELULAR BIOLOGIA - 1 o ANO MÓDULO 17 MITOCÔNDRIAS E RESPIRAÇÃO CELULAR Retículo endoplasmático Invólucro nuclear Núcleo Mitocôndria Procarionte fotossintético Cloroplasto Procarionte ancestral Eucariote ancestral

Leia mais

Fonte: Disponível em: http://veja.abril.com.br. Acesso em: 25 set. 2014.

Fonte: Disponível em: http://veja.abril.com.br. Acesso em: 25 set. 2014. 1. (Ufsm 2015) O consumo exagerado de sódio está associado a uma serie de doenças crônicas não transmissíveis (DCNT), como as cardiovasculares. Essas moléculas são responsáveis por 72% das mortes no Brasil,

Leia mais

Formas do fósforo: -Ortofosfatos: PO 4 3-, HPO 4 2-, H 2 PO 4 -, H 3 PO 4

Formas do fósforo: -Ortofosfatos: PO 4 3-, HPO 4 2-, H 2 PO 4 -, H 3 PO 4 CICLO DO FÓSFORO O fósforo é um não-metal multivalente pertencente à série química do nitrogênio (grupo 15 ou 5 A) que se encontra na natureza combinado, formando fosfatos inorgânicos, inclusive nos seres

Leia mais

Composição química Lista de exercícios. Natália A. Paludetto

Composição química Lista de exercícios. Natália A. Paludetto Composição química Lista de exercícios Natália A. Paludetto 1) (PUC-RS 2006) As substâncias indicadas no gráfico acima constituem os componentes não-minerais dos tecidos vivos. A maioria dos tecidos vivos

Leia mais

BIOLOGIA. Questões de 01 a 06. 01. As figuras abaixo representam organelas e estruturas citoplasmáticas.

BIOLOGIA. Questões de 01 a 06. 01. As figuras abaixo representam organelas e estruturas citoplasmáticas. GRUPO 2 BIO. 1 BIOLOGIA Questões de 01 a 06 01. As figuras abaixo representam organelas e estruturas citoplasmáticas. (Adaptado de CÉSAR & SEZAR, Biologia. São Paulo: Saraiva, vol 1, 1995.) Com base nas

Leia mais

Questões complementares

Questões complementares Questões complementares 1. Definir célula e os tipos celulares existentes. Caracterizar as diferenças existentes entre os tipos celulares. 2. Existe diferença na quantidade de organelas membranares entre

Leia mais

Atividade de Biologia 1 série

Atividade de Biologia 1 série Atividade de Biologia 1 série Nome: 1. (Fuvest 2013) Louis Pasteur realizou experimentos pioneiros em Microbiologia. Para tornar estéril um meio de cultura, o qual poderia estar contaminado com agentes

Leia mais

PROGRAMA DE EDUCAÇÃO AMBIENTAL

PROGRAMA DE EDUCAÇÃO AMBIENTAL PROGRAMA DE EDUCAÇÃO AMBIENTAL Último Encontro: Vila Velha 1 Escolha dos temas a serem trabalhados. Tema de hoje: Oficina sobre alimentação saudável 1) Alimentos Alimentos construtores: fornecem proteínas

Leia mais

TEXTO PARA A PRÓXIMA QUESTÃO (Ufc) Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos.

TEXTO PARA A PRÓXIMA QUESTÃO (Ufc) Na(s) questão(ões) a seguir escreva no espaço apropriado a soma dos itens corretos. Respiração e Fermentação 1. (Fuvest) O fungo 'Saccharomyces cerevisiae' (fermento de padaria) é um anaeróbico facultativo. Quando cresce na ausência de oxigênio, consome muito mais glicose do que quando

Leia mais

1. (MOJI-SP) A membrana plasmática, apesar de invisível ao microscópio óptico, está presente:

1. (MOJI-SP) A membrana plasmática, apesar de invisível ao microscópio óptico, está presente: Exercícios de aprofundamento Biologia Aula 1 1. (MOJI-SP A membrana plasmática, apesar de invisível ao microscópio óptico, está presente: a em todas as células, seja ela procariótica ou eucariótica. b

Leia mais

VITAMINAS. Plantão Biologia Curso do Edilson. www.cursodoedilson.com.br. delas são lipossolúveis e somente são absorvidas se dissolvidas em lipídios.

VITAMINAS. Plantão Biologia Curso do Edilson. www.cursodoedilson.com.br. delas são lipossolúveis e somente são absorvidas se dissolvidas em lipídios. VITAMINAS delas são lipossolúveis e somente são absorvidas se dissolvidas em lipídios. 1. (Uel 2011) Nos supermercados, encontramos diversos alimentos, enriquecidos com vitaminas e sais minerais. Esses

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009)

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) INSTITUTO POLITÉCNICO DE BEJA EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) Nome do Candidato Classificação Leia as seguintes informações com atenção. 1. O exame é constituído

Leia mais

Tipo de itens. O sangue é o principal fluído que circula no organismo humano.

Tipo de itens. O sangue é o principal fluído que circula no organismo humano. Tipo de itens O sangue é o principal fluído que circula no organismo humano. 1. Quais são as suas principais funções? Transporte de nutrientes, defesa, regulação térmica e controlo 2. Quais os seus constituintes?

Leia mais

BIOLOGIA. (A) a transmissão se dá pela ingestão de alimentos contaminados. (B) o mosquito transmissor da doença se reproduz em locais com água parada.

BIOLOGIA. (A) a transmissão se dá pela ingestão de alimentos contaminados. (B) o mosquito transmissor da doença se reproduz em locais com água parada. BIOLOGIA 21ª QUESTÃO A dengue é uma doença infecciosa aguda causada por vírus. Seus principais sintomas são febre súbita, fortes dores musculares, moleza, dor de cabeça, manchas vermelhas no corpo e dores

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

15/08/2013. Acelerado crescimento e desenvolvimento: IMPORTÂNCIA DA ALIMENTAÇÃO SAUDÁVEL NESSA FASE. Atinge 25% da sua altura final

15/08/2013. Acelerado crescimento e desenvolvimento: IMPORTÂNCIA DA ALIMENTAÇÃO SAUDÁVEL NESSA FASE. Atinge 25% da sua altura final Laís Cruz Nutricionista CRN 3 18128 2013 Período de transição entre infância e vida adulta (dos 10 aos 19 anos de idade) Muitas transformações físicas, psicológicas e sociais Acelerado crescimento e desenvolvimento:

Leia mais

9º ANO Ensino Fundamental

9º ANO Ensino Fundamental E n s in o F o r t e e d e R e s u l t a do s Estudante: Centro Educacio nal Juscelino K ub itschek G uar á / Valp ar a íso Exercícios Rec. Semestral 2º Bimestre B I O L O G I A 9º ANO Ensino Fundamental

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Recuperação. Células tecidos órgãos sistemas. - As células são as menores unidades vivas e são formadas por três regiões:

Recuperação. Células tecidos órgãos sistemas. - As células são as menores unidades vivas e são formadas por três regiões: Recuperação Capítulo 01 - Níveis de organização Células tecidos órgãos sistemas - As células são as menores unidades vivas e são formadas por três regiões: A- Membrana Plasmática - Revestimento da célula;

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

CADERNO DE EXERCÍCIOS 1E

CADERNO DE EXERCÍCIOS 1E CADERNO DE EXERCÍCIOS 1E Ensino Médio Ciências da Natureza II Questão Conteúdo Habilidade da Matriz da EJA/FB 1. Misturas e processos de separação H4, H5 2. Misturas e processos de separação H4, H5 e H6

Leia mais

SABOR. NUMEROSem. Fonte: Tabela Brasileira de Composição de Alimentos do Ministério da Saúde.

SABOR. NUMEROSem. Fonte: Tabela Brasileira de Composição de Alimentos do Ministério da Saúde. SABOR Fonte: Tabela Brasileira de Composição de Alimentos do Ministério da Saúde. Conteúdo produzido pela equipe de Comunicação e Marketing do Portal Unimed e aprovado pelo coordenador técnico-científico:

Leia mais

Ficha de Exercícios A Célula (VERSÃO CORRIGIDA) Ano lectivo: 10º ano Turma: Data:

Ficha de Exercícios A Célula (VERSÃO CORRIGIDA) Ano lectivo: 10º ano Turma: Data: Ficha de Exercícios A Célula (VERSÃO CORRIGIDA) Ano lectivo: 10º ano Turma: Data: 1- A célula é uma importante estrutura do mundo vivo. Todos os seres vivos começam por existir sob a forma de célula. Alguns

Leia mais

Funções dos lípidos:

Funções dos lípidos: Gorduras ou Lípidos Os lípidos são componentes essenciais de todos os organismos podendo ser obtidos a partir da alimentação ou ser sintetizados pelo nosso organismo. Constituem um grupo heterogéneo de

Leia mais

REGISTRO: Isento de Registro no M.S. conforme Resolução RDC n 27/10. CÓDIGO DE BARRAS N : 7898171287947(Frutas vermelhas) 7898171287954(Abacaxi)

REGISTRO: Isento de Registro no M.S. conforme Resolução RDC n 27/10. CÓDIGO DE BARRAS N : 7898171287947(Frutas vermelhas) 7898171287954(Abacaxi) Ficha técnica CHÁ VERDE COM CÓLAGENO, VITAMINA C E POLIDEXTROSE Pó para Preparo de Bebida a Base de Chá Verde, com Colágeno hidrolisado, vitamina C e polidextrose Sabor Abacaxi e frutas vermelhas REGISTRO:

Leia mais

95% de água, 3% de substâncias orgânicas e 2% de sais minerais. uma secreção serosa outra secreção mucosa

95% de água, 3% de substâncias orgânicas e 2% de sais minerais. uma secreção serosa outra secreção mucosa SISTEMA DIGESTÓRIO SALIVA A saliva é um líquido claro, viscoso, alcalino (ph entre 6 e 7), que contém em sua composição: 95% de água, 3% de substâncias orgânicas e 2% de sais minerais. Além disso, também

Leia mais