Disciplina de Projetos e Análise de Algoritmos

Tamanho: px
Começar a partir da página:

Download "Disciplina de Projetos e Análise de Algoritmos"

Transcrição

1 Aula 6 - A Maior Subsequência Comum Possível (Programação Dinâmica Parte IV)

2 Aplicações na Biologia Um problema bastante em voga na Biologia é a análise do DNA de dois ou mais organismos distintos. Um DNA é composto por uma sequência de moléculas, chamadas de bases, A Adenina T Timina C Citosina G Guanina Computacionalmente, um DNA pode ser visto como uma fita dupla de Strings, com o alfabeto {A,T,G,C}

3 Aplicações na Biologia

4 Aplicações na Biologia Dado os DNA s de dois organismos: S 1 = ACCGTGGAAAAGGTTAAGGCCAGGATTTAACCGCGGGC S 2 = ACCGCGGTTTAATCCGGATAGGTTGAAATGGTTGAAAC É possível indagar: Quão semelhantes são estes dois organismos? Estes organismos são da mesma espécie? Um destes organismos é ancestral do outro organismo? Observe que a resposta destas questões dependerão de quão semelhantes eles são.

5 Similaridade É possível medir similaridade de várias formas diferentes! É possível definir que duas fitas de DNA são similares se uma é uma substring da outra. Também é possível definir similaridade pelo número de transformações necessária para transforma uma fita de DNA na outra. Aqui, quanto menor o número de transformações maior a similaridade. Uma terceira forma é definir uma outra fita S 3 de tal forma que esta seja formada pelas bases que coincidentes nas fitas S 1 e S 2. Quanto maior for S 3 mais semelhantes serão S 1 e S 2. S 3 é a maior subsequência comum possível entre S 1 e S 2.

6 Subsequência Introdução Uma Subsequência Uma Subsequência Comum A subsequência comum mais longa Dada uma sequência X = x 1,x 2,...,x m e outra sequência Z = z 1,z 2,...,z k. A sequência Z será subsequência de X se existir uma sequência estritamente crescente i 1,i 2,...,i k de índices de X tal que para todo j = 1,2,...,k implique em x ij = z j. Por exemplo, dado X = A,B,C,B,D,A,B e Z = B,C,D,B. Z é uma subsequência de X com a sequência de índices correspondendo a 2,3,5,7

7 Subsequência Comum Uma Subsequência Uma Subsequência Comum A subsequência comum mais longa Agora são dadas duas sequências, X e Y. É dito que Z é uma subsequência comum de X e Y se Z é uma subsequência de X e de Y ao mesmo tempo. Por exemplo, e X = A,B,C,B,D,A,B Y = B,D,C,A,B,A note que a subsequência B,C,A, embora não seja a subsequência mais longa. A subsequência mais longa (LCS) terá comprimento 4: B,C,B,A ou B,D,A,B.

8 Definindo o Problema Uma Subsequência Uma Subsequência Comum A subsequência comum mais longa Problema da Subsequência Comum Mais Longa (LCS) Dadas duas sequências X = x 1,x 2,...,x m e Y = y 1,y 2,...,y n é desejado encontrar a maior subsequência de maior comprimento possível comum às sequências X e Y. Este problema pode ser abordado via programação dinâmica.

9 Passo 1: Caracterizando a Maior Subsequência Comum Por força bruta: Enumera-se todas as possíveis subsequências de X. Checa-se se cada uma destas subsequências também é subsequências de Y, guardando a de maior comprimento. Cada subsequência pode ser representada por por um subconjunto de índices na forma {1,2,...,m}. Observe que X terá 2 m subsequências, o que acarreta em um custo exponencial, sendo inviável na prática!

10 Passo 1: Caracterizando a Maior Subsequência Comum O problema LCS apresenta uma subestrutura ótima! Como será visto, a classe natural de subproblemas são os pares dos prefixos de duas sequências de entrada. Dada uma sequência X = x 1,x 2,...,x m Definie-se o i-ésimo prefixo de X, para i = 0,1,2,...,m como Por exemplo, dada a sequência X i = x 1,x 2,...,x i X = A,B,C,B,D,A,B então e X 0 = (sequência vazia) X 4 = A,B,C,B

11 Passo 1: Caracterizando a Maior Subsequência Comum Teorema Ótima para o Problema LCS Faça X = x 1,x 2,...,x m e Y = y 1,y 2,...,y n serem sequências, e faça Z = z 1,z 2,...,z k ser uma LCS de X e Y. 1 Se x m = y n, então z k = x m = y n e Z k 1 é uma LCS de X m 1 e Y n 1. 2 Se x m y n, então z k x m implicando que Z é uma LCS de X m 1 e de Y. 3 Se x m y n, então z k y n implicando que Z é uma LCS de X e de Y n 1.

12 Passo 1: Caracterizando a Maior Subsequência Comum Prova do Teorema Se z k x m e fixarmos x m = y n para obtermos Z com uma LCS de X e Y de comprimento k +1, estaremos contrariando o fato de Z ser uma LCS de X e Y. Assim, temos que ter z k = x m = y n. Observe então que o prefixo Z k 1 de comprimento k 1 é uma sequência comum de X m 1 e Y n 1. Pergunta-se Z k 1 é uma LCS? Suponha que existe uma sequência comum W de X m 1 e Y n 1 com comprimento maior que k 1. Logo fazendo x m = y n implicaria que W teria um comprimento maior que k, o que seria uma contradição.

13 Passo 1: Caracterizando a Maior Subsequência Comum Prova do Teorema Se z k x m então Z é uma sequência comum entre X m 1 e Y. Se existisse uma sequência comum W de X m 1 e Y com comprimento maior que k, então W também poderia ser uma sequência comum de X m e Y, contrariando a suposição de que Z é uma LCS de X e Y. 3 Uma prova simétrica ao item 2.

14 Passo 2: Uma Solução Recursiva O Teorema 5.1 afirma que deve-se observar 1 ou 2 subproblemas para se encontrar uma LCS de X = x 1,x 2,...,x m e Y = y 1,y 2,...,y n, Se x m = y n deve-se procurar a LCS de X m 1 e Y n 1 e depois acrescentar x m = y n. Se x m y n, então deve-se resolver 2 subproblemas: Encontrar uma LCS de X m 1 e Y; e Encontrar uma LCS de X e Y n 1 Sendo a LCS mais longa destas duas a LCS de X e Y. Desta forma a sobreposição nas soluções dos subproblemas é clara! Para resolver a LCS de X e Y é necessário resolver a LCS de X m 1 e Y, e X e Y n 1.

15 Passo 2: Uma Solução Recursiva Defina c[i,j] ser o comprimento de uma LCS das sequências X i e Y j. Se i = 0 ou j = 0, uma das sequências tem comprimento zero, implicando que a LCS tem comprimento zero. ótima do problema da LCS e a forma recursiva: 0, sei = 0 ou j = 0 c[i,j] = c[i 1,j 1]+1, sei,j > 0 e x i = y j max(c[i,j 1],c[i 1,j]), sei,j > 0 e x i y j (1)

16 Passo 3: Computando o comprimento de uma LCS Um algoritmo natural para resolver a Equação 1 teria custo exponencial! Contudo este problema tem apenas Θ(nm) subproblemas distintos. Algoritmo com programação dinâmica: Considere duas sequências como entrada, X = x 1,x 2,...,x m e Y = y 1,y 2,...,y n Os valore c[i, j] são armazenados em uma tabela c[0..m, 0..n], onde os valores são computados linha a linha, esquerda para direita Também há uma tabela b[1..m, 1..n] tal que são armazenados as entradas para a escolha da solução ótima dos subproblemas quando está se computando c[i, j]. Saídas: b e c, onde c[m,n] contem o comprimento de uma LCS de X e Y.

17 Passo 3: Computando o comprimento de uma LCS LCS-LENGTH(X,Y) 1 m = X.length 2 n = Y.length 3 let b[1..n,1..n] e c[0..m,0..n] be new tables 4 for i = 1 to m 5 c[i,0] = 0 6 for i = 1 to n 7 c[0,j] = 0 8 for i = 1 to m 9 for j = i to n 10 if x i == y j 11 c[i,j] = c[i 1,j 1]+1 12 b[i,j] = տ 13 elseif c[i 1,j] c[i,j 1] 14 c[i,j] = c[i 1,j] 15 b[i,j] = 16 else c[i,j] = c[i,j 1] 15 b[i,j] = 17 return c and b

18 Passo 3: Computando o comprimento de uma LCS Exemplo: Dadas as sequências X = A,B,C,D,A,B e Y = B,D,C,A,B,A. Observe que o custo será Θ(nm) visto que a referência a cada entrada de uma tabela tem custo de Θ(1).

19 Passo 4: Construindo uma LCS Observando a tabela b gerada pelo LCS-LENGTH rapidamente é possível se construir uma LCS das sequências X e Y. Começa-se na entrada b[n, m], e segue-se as setas. Quando encontra-se a seta տ em b[i,j] significa que x i = y j, logo este é um elemento da LCS. Assim, é possível se computar os elementos de uma LCS em ordem reversa.

20 Passo 4: Construindo uma LCS Para se imprimir a LCS na ordem correta, PRINT-LCS(b,X,i,j) 1 if i == 0 or j == 0 2 return // LCS is empty 3 if b[i,j] == տ 4 PRINT-LCS(b,X,i 1,j 1) 5 print x i 6 elseif b[i,j] == 7 PRINT-LCS(b,X,i 1,j) 8 else PRINT-LCS(b,X,i,j 1) Sendo a chamada inicial PRINT-LCS(b, X, X.length, Y.length).

21 Passo 4: Construindo uma LCS Para a tabela b gerada no nosso último exemplo, PRINT-LCS iria gerar a sequência, BCBA O custo para este procedimento será de O(m+n) Visto que este decrementa no mínimo uma unidade de i e/ou j para cada chamada recursiva.

22 Melhorando o Código! Observe que este código LENGTH-LCS pode ser melhorado em desempenho tanto no tempo como no espaço. Como? Exercício para reflexão! Será que a tabela b é realmente necessária? Será que a tabela c necessita ser totalmente armazenada?

23 Sugestão de Leitura Capítulo 15, seção 15.4 do ĺıvro do Cormen; Weiss, Mark Allen. Data Structures and Algorithms Analysis in C. Second Edition. (1997) - Capítulo 8

Subsequência comum mais longa Em inglês, Longest Common Subsequence (LCS)

Subsequência comum mais longa Em inglês, Longest Common Subsequence (LCS) Programação Dinâmica Subsequência comum mais longa Em inglês, Longest Common Subsequence (LCS) Fernando Lobo Algoritmos e Estrutura de Dados II 1 / 23 Longest Common Subsequence (LCS) Dadas duas sequências,

Leia mais

Programação Dinâmica. Programa do PA. Técnicas Avançadas de Projeto. Aulas Anteriores. Introdução. Plano de Aula. Técnicas de Projeto de Algoritmos

Programação Dinâmica. Programa do PA. Técnicas Avançadas de Projeto. Aulas Anteriores. Introdução. Plano de Aula. Técnicas de Projeto de Algoritmos Programação Dinâmica Técnicas de Projeto de Algoritmos Aula 13 Alessandro L. Koerich Pontifícia Universidade Católica do Paraná (PUCPR) Ciência da Computação 7 o Período Engenharia de Computação 5 o Período

Leia mais

O Problema do Troco Principio da Casa dos Pombos. > Princípios de Contagem e Enumeração Computacional 0/48

O Problema do Troco Principio da Casa dos Pombos. > Princípios de Contagem e Enumeração Computacional 0/48 Conteúdo 1 Princípios de Contagem e Enumeração Computacional Permutações com Repetições Combinações com Repetições O Problema do Troco Principio da Casa dos Pombos > Princípios de Contagem e Enumeração

Leia mais

Lista n 0 1 de Exercícios de Teoria da Computação

Lista n 0 1 de Exercícios de Teoria da Computação Lista n 0 1 de Exercícios de Teoria da Computação UFU-Curso de Bacharelado em Ciência da Computação - 7 0 período Profa. Sandra de Amo Exercícios de Revisão : Autômatos e Gramáticas 1. Mostre que a linguagem

Leia mais

Complexidade de Algoritmos. Edson Prestes

Complexidade de Algoritmos. Edson Prestes Edson Prestes Caminhos de custo mínimo em grafo orientado Este problema consiste em determinar um caminho de custo mínimo a partir de um vértice fonte a cada vértice do grafo. Considere um grafo orientado

Leia mais

MC102 Algoritmos e Programação de Computadores

MC102 Algoritmos e Programação de Computadores MC102 Algoritmos e Programação de Computadores Instituto de Computação UNICAMP Primeiro Semestre de 2015 Roteiro 1 Fundamentos de análise de algoritmos 2 Cálculo da função de custo 3 Exercícios Instituto

Leia mais

Métodos Computacionais. Árvores

Métodos Computacionais. Árvores Métodos Computacionais Árvores Árvores Vetores e Listas são ótimos para representar estrutura de dados lineares, mas não para modelar dados hierárquicos Exemplos de dados hierárquicos: sistema de arquivos

Leia mais

Contagem. George Darmiton da Cunha Cavalcanti CIn - UFPE

Contagem. George Darmiton da Cunha Cavalcanti CIn - UFPE Contagem George Darmiton da Cunha Cavalcanti CIn - UFPE Sumário Princípios Básicos de Contagem A Regra do Produto A Regra da Soma O número de subconjuntos de um conjunto finito Princípio da Inclusão-Exclusão

Leia mais

EAD Árvore árvore binária

EAD Árvore árvore binária EAD Árvore árvore binária - Uma árvore binária é um conjunto finito de elementos (nodos) que pode ser vazio ou particionado em três subconjuntos: - raiz da árvore (elemento inicial, que é único); - subárvore

Leia mais

Computabilidade 2012/2013. Sabine Broda Departamento de Ciência de Computadores Faculdade de Ciências da Universidade do Porto

Computabilidade 2012/2013. Sabine Broda Departamento de Ciência de Computadores Faculdade de Ciências da Universidade do Porto Computabilidade 2012/2013 Sabine Broda Departamento de Ciência de Computadores Faculdade de Ciências da Universidade do Porto Capítulo 1 Computabilidade 1.1 A noção de computabilidade Um processo de computação

Leia mais

Estruturas de Dados Aula 15: Árvores 17/05/2011

Estruturas de Dados Aula 15: Árvores 17/05/2011 Estruturas de Dados Aula 15: Árvores 17/05/2011 Fontes Bibliográficas Livros: Introdução a Estruturas de Dados (Celes, Cerqueira e Rangel): Capítulo 13; Projeto de Algoritmos (Nivio Ziviani): Capítulo

Leia mais

Linguagem C: Árvores Binarias

Linguagem C: Árvores Binarias Instituto de C Linguagem C: Árvores Binarias Luis Martí Instituto de Computação Universidade Federal Fluminense lmarti@ic.uff.br - http://lmarti.com Tópicos Principais Introdução Árvores binárias Implementação

Leia mais

Casamento de Cadeias. Introdução. Introdução. Estrutura de Dados. Cadeia de caracteres: sequência de elementos denominados caracteres.

Casamento de Cadeias. Introdução. Introdução. Estrutura de Dados. Cadeia de caracteres: sequência de elementos denominados caracteres. Introdução de Cadeias Estrutura de Dados II Prof. Guilherme Tavares de Assis Universidade Federal de Ouro Preto UFOP Instituto de Ciências Exatas e Biológicas ICEB Departamento de Computação DECOM 1 Cadeia

Leia mais

Núcleo e Divisões Celulares

Núcleo e Divisões Celulares UNIDADE 2 ORIGEM DA VIDA E BIOLOGIA CELULAR CAPÍTULO 10 Aula 1 Núcleo: estrutura e composição Cromossomos, genes e DNA 1. NÚCLEO: NÚMERO E FORMA Células eucarióticas Cromossomos DNA + proteínas (histonas)

Leia mais

1 se n = 0 n (n 1)! se n 1

1 se n = 0 n (n 1)! se n 1 Recursão versus Iteração Problema: Cálculo de n! = n (n 1)... 1 int facti(int n) { int fac=n; while(n>0){ fac=fac*n; n--; } return fac; } [epd94, Cap. 5.13-15] Definição recursiva: n! = { 1 se n = 0 n

Leia mais

INF1007: Programação 2 10 Árvores Binárias. (c) Dept. Informática - PUC-Rio 1

INF1007: Programação 2 10 Árvores Binárias. (c) Dept. Informática - PUC-Rio 1 INF1007: Programação 2 10 Árvores Binárias (c) Dept. Informática - PUC-Rio 1 Tópicos Principais Introdução Árvores binárias Representação em C Ordens de percurso em árvores binárias Altura de uma árvore

Leia mais

Figura 13.1: Um exemplo de árvore de diretório.

Figura 13.1: Um exemplo de árvore de diretório. 13. Árvores W. Celes e J. L. Rangel Nos capítulos anteriores examinamos as estruturas de dados que podem ser chamadas de unidimensionais ou lineares, como vetores e listas. A importância dessas estruturas

Leia mais

1 Tipos de dados em Análise de Clusters

1 Tipos de dados em Análise de Clusters Curso de Data Mining Sandra de Amo Aula 13 - Análise de Clusters - Introdução Análise de Clusters é o processo de agrupar um conjunto de objetos físicos ou abstratos em classes de objetos similares Um

Leia mais

BCC202 - Estrutura de Dados I

BCC202 - Estrutura de Dados I BCC202 - Estrutura de Dados I Aula 04: Análise de Algoritmos (Parte 1) Reinaldo Fortes Universidade Federal de Ouro Preto, UFOP Departamento de Ciência da Computação, DECOM Website: www.decom.ufop.br/reifortes

Leia mais

BCC242. Alfabeto, Strings, Linguagens. Registro aqui o agradecimento à Profa. Lucília por ceder slides que fazem parte deste material.

BCC242. Alfabeto, Strings, Linguagens. Registro aqui o agradecimento à Profa. Lucília por ceder slides que fazem parte deste material. BCC242 Alfabeto, Strings, Linguagens Registro aqui o agradecimento à Profa. Lucília por ceder slides que fazem parte deste material. Exemplo: Máquina de Venda A máquina de venda retorna uma cocacola por

Leia mais

Faculdade de Computação

Faculdade de Computação UNIVERSIDADE FEDERAL DE UBERLÂNDIA Faculdade de Computação Disciplina : Teoria da Computação Professora : Sandra Aparecida de Amo Lista de Exercícios n o 2 Exercícios sobre Modelos de Máquinas de Turing

Leia mais

ESTRUTURAS DE DADOS I. Notas de Aula. Prof. Dr. Gilberto Nakamiti

ESTRUTURAS DE DADOS I. Notas de Aula. Prof. Dr. Gilberto Nakamiti ESTRUTURAS DE DADOS I Notas de Aula 1 SUMÁRIO 1. INTRODUÇÃO... 2 1.1 Array (vetores)... 2 2. BUSCA DE ELEMENTOS... 3 2.1 Busca Seqüencial... 3 2.2 Busca Binária... 3 2.3 Busca Indexada... 3 2.4 Busca Hash...

Leia mais

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

Bioinformática Histórico e conceitos básicos

Bioinformática Histórico e conceitos básicos Bioinformática Histórico e conceitos básicos Raimundo Lima da S. Júnior M.Sc. Departamento de Biologia Núcleo de Pesquisas Replicon PUC-GO Silva Jr., RL Casamento entre a ciência da computação e a biologia

Leia mais

Árvores Binárias de Busca

Árvores Binárias de Busca Árvores Binárias de Busca Uma Árvore Binária de Busca T (ABB) ou Árvore Binária de Pesquisa é tal que ou T = 0 e a árvore é dita vazia ou seu nó contém uma chave e: 1. Todas as chaves da sub-árvore esquerda

Leia mais

Bioinformática. Alinhamento de Sequências. Prof. Msc. Rommel Ramos

Bioinformática. Alinhamento de Sequências. Prof. Msc. Rommel Ramos Bioinformática Alinhamento de Sequências Prof. Msc. Rommel Ramos 2013 Sumário 1. Comparação de Sequências 2. O que é alinhamento? 3. Tipos de Alinhamento 4. Algoritmos 5. Métodos de Alinhamento Comparação

Leia mais

Curso de Iniciação ao Access Basic (I) CONTEÚDOS

Curso de Iniciação ao Access Basic (I) CONTEÚDOS Curso de Iniciação ao Access Basic (I) CONTEÚDOS 1. A Linguagem Access Basic. 2. Módulos e Procedimentos. 3. Usar o Access: 3.1. Criar uma Base de Dados: 3.1.1. Criar uma nova Base de Dados. 3.1.2. Criar

Leia mais

Pointer Jumping. odg(v) e idg(v): graus de saída e entrada do vértice v V. um vértice r tal que. O vértice r é dita raíz de T

Pointer Jumping. odg(v) e idg(v): graus de saída e entrada do vértice v V. um vértice r tal que. O vértice r é dita raíz de T Pointer Jumping T = (V,E) : árvore direcionada odg(v) e idg(v): graus de saída e entrada do vértice v V um vértice r tal que v V-{r}, odg(v) = 1, odg(r)=0 v V-{r}, um caminho de v a r O vértice r é dita

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

1. Introdução... 1 1.1. Definição... 1 1.2. Conceitos relacionados... 2

1. Introdução... 1 1.1. Definição... 1 1.2. Conceitos relacionados... 2 Índice i Índice Capítulo 4 Estrutura de Dados não sequencial com armazenamento não sequencial ( Árvore ) 1. Introdução... 1 1.1. Definição... 1 1.2. Conceitos relacionados... 2 2. Árvores binárias... 2

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

Estruturas de Dados. Prof. Gustavo Willam Pereira Créditos: Profa. Juliana Pinheiro Campos

Estruturas de Dados. Prof. Gustavo Willam Pereira Créditos: Profa. Juliana Pinheiro Campos Estruturas de Dados Prof. Gustavo Willam Pereira Créditos: Profa. Juliana Pinheiro Campos Árvores Conceitos Árvores binárias Árvores binárias de pesquisa Árvores binárias balanceadas Árvores ESTRUTURAS

Leia mais

x0 = 1 x n = 3x n 1 x k x k 1 Quantas são as sequências com n letras, cada uma igual a a, b ou c, de modo que não há duas letras a seguidas?

x0 = 1 x n = 3x n 1 x k x k 1 Quantas são as sequências com n letras, cada uma igual a a, b ou c, de modo que não há duas letras a seguidas? Recorrências Muitas vezes não é possível resolver problemas de contagem diretamente combinando os princípios aditivo e multiplicativo. Para resolver esses problemas recorremos a outros recursos: as recursões

Leia mais

Complexidade de Algoritmos

Complexidade de Algoritmos Complexidade de Algoritmos Complexidade de Algoritmos Envolvendo Estruturas de Dados Elementares Prof. Osvaldo Luiz de Oliveira Estas anotações devem ser complementadas por apontamentos em aula. Vetor

Leia mais

Busca. Pesquisa sequencial

Busca. Pesquisa sequencial Busca Banco de dados existem para que, de tempos em tempos, um usuário possa localizar o dado de um registro, simplesmente digitando sua chave. Uma tabela ou um arquivo é um grupo de elementos, cada um

Leia mais

MARCO TÚLIO NOGUEIRA SILVA

MARCO TÚLIO NOGUEIRA SILVA MARCO TÚLIO NOGUEIRA SILVA ALINHAMENTO MÚLTIPLO GLOBAL DE SEQÜÊNCIAS PELA REPRESENTAÇÃO DE PROFILE E CLUSTERIZAÇÃO: COMPARAÇÃO COM OS RESULTADOS DO CLUSTALW (EMBL-EBI) Monografia de graduação apresentada

Leia mais

Capítulo 2: Transformação de Matrizes e Resolução de Sistemas

Capítulo 2: Transformação de Matrizes e Resolução de Sistemas 2 Livro: Introdução à Álgebra Linear Autores: Abramo Hefez Cecília de Souza Fernandez Capítulo 2: Transformação de Matrizes e Resolução de Sistemas Sumário 1 Transformação de Matrizes.............. 3 1.1

Leia mais

Algoritmos em Javascript

Algoritmos em Javascript Algoritmos em Javascript Sumário Algoritmos 1 O que é um programa? 1 Entrada e Saída de Dados 3 Programando 4 O que é necessário para programar 4 em JavaScript? Variáveis 5 Tipos de Variáveis 6 Arrays

Leia mais

Árvores e Árvores Binárias

Árvores e Árvores Binárias MAC 5710 - Estruturas de Dados - 2008 Referência bibliográfica Os slides sobre este assunto são parcialmente baseados nas seções sobre árvores do capítulo 4 do livro N. Wirth. Algorithms + Data Structures

Leia mais

Primitivas Gráficas. Prof. Márcio Bueno {cgtarde,cgnoite}@marciobueno.com. Fonte: Material do Prof. Robson Pequeno de Sousa e do Prof.

Primitivas Gráficas. Prof. Márcio Bueno {cgtarde,cgnoite}@marciobueno.com. Fonte: Material do Prof. Robson Pequeno de Sousa e do Prof. Primitivas Gráficas Prof. Márcio Bueno {cgtarde,cgnoite}@marciobueno.com Fonte: Material do Prof. Robson Pequeno de Sousa e do Prof. Robson Lins Traçado de Primitivas em Dispositivos Matriciais Conversão

Leia mais

Gabarito 1ª Fase. Versão em pseudo código. 1 de 12 13/08/2008 22:23. FAETEC de Quintino ganha a 1ª OAH. Clique aqui para acessar o site da OAH 2008

Gabarito 1ª Fase. Versão em pseudo código. 1 de 12 13/08/2008 22:23. FAETEC de Quintino ganha a 1ª OAH. Clique aqui para acessar o site da OAH 2008 1 de 12 13/08/2008 22:23 FAETEC de Quintino ganha a 1ª OAH. Clique aqui para acessar o site da OAH 2008 Gabarito 1ª Fase Versão em pseudo código { Questão 1 FUNÇÃO PreencherTabuleiro : matriz VAR Tab[1..8][1..8]

Leia mais

PROBLEMA DE TRANSPORTE: MODELO E MÉTODO DE SOLUÇÃO

PROBLEMA DE TRANSPORTE: MODELO E MÉTODO DE SOLUÇÃO PROBLEMA DE TRANSPORTE: MODELO E MÉTODO DE SOLUÇÃO Luciano Pereira Magalhães - 8º - noite lpmag@hotmail.com Orientador: Prof Gustavo Campos Menezes Banca Examinadora: Prof Reinaldo Sá Fortes, Prof Eduardo

Leia mais

O ESPAÇO NULO DE A: RESOLVENDO AX = 0 3.2

O ESPAÇO NULO DE A: RESOLVENDO AX = 0 3.2 3.2 O Espaço Nulo de A: Resolvendo Ax = 0 11 O ESPAÇO NULO DE A: RESOLVENDO AX = 0 3.2 Esta seção trata do espaço de soluções para Ax = 0. A matriz A pode ser quadrada ou retangular. Uma solução imediata

Leia mais

INF 1007 Programação II

INF 1007 Programação II INF 1007 Programação II Aula 14 Árvores Binárias Edirlei Soares de Lima Árvores Uma estrutura de dados do tipo árvore permite que dados sejam organizados de maneira hierárquica.

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!!

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!! Miguel Rocha Dep. Informática - Universidade do Minho BIOINFORMÁTICA: passado, presente e futuro!! Bragança, 11 de Maio de 2006 Porquê a Bioinformática?! Novas tecnologias experimentais da Biologia Molecular

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

Projetos. Universidade Federal do Espírito Santo - UFES. Mestrado em Informática 2004/1. O Projeto. 1. Introdução. 2.

Projetos. Universidade Federal do Espírito Santo - UFES. Mestrado em Informática 2004/1. O Projeto. 1. Introdução. 2. Pg. 1 Universidade Federal do Espírito Santo - UFES Mestrado em Informática 2004/1 Projetos O Projeto O projeto tem um peso maior na sua nota final pois exigirá de você a utilização de diversas informações

Leia mais

Orientação a Objetos. Conceitos Iniciais Introdução a Linguagem Java. Gil Eduardo de Andrade

Orientação a Objetos. Conceitos Iniciais Introdução a Linguagem Java. Gil Eduardo de Andrade Orientação a Objetos Conceitos Iniciais Introdução a Linguagem Java Gil Eduardo de Andrade Conceitos: Orientação a Objeto Introdução Abordagem típica no desenvolvimento de sistemas complexos; Consiste

Leia mais

3. INTRODUÇÃO À LINGUAGEM C 3.1. CONCEITOS BÁSICOS. Lógica de Programação

3. INTRODUÇÃO À LINGUAGEM C 3.1. CONCEITOS BÁSICOS. Lógica de Programação Lógica de Programação 3. INTRODUÇÃO À LINGUAGEM C Caro Aluno Vamos iniciar o terceiro capítulo da nossa disciplina. Agora vamos começar a aplicar os conceitos vistos nos capítulos anteriores em uma linguagem

Leia mais

Teoria da Complexidade

Teoria da Complexidade handout.pdf June 5, 0 Teoria da Complexidade Cid C. de Souza / IC UNICAMP Universidade Estadual de Campinas Instituto de Computação o semestre de 0 Revisado por Zanoni Dias Autor Prof. Cid Carvalho de

Leia mais

Cadeias de Markov. Geovany A. Borges gaborges@ene.unb.br

Cadeias de Markov. Geovany A. Borges gaborges@ene.unb.br 36341 - Introdução aos Processos Estocásticos Curso de Pós-Graduação em Engenharia Elétrica Departamento de Engenharia Elétrica Universidade de Brasília Cadeias de Markov Geovany A. Borges gaborges@ene.unb.br

Leia mais

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE DEFINIÇÃO Palavra de origem grega gennos (fazer nascer- geração). Estudo dos mecanismos de transmissão de características de uma espécie,

Leia mais

Estruturas de Dados Pilhas, Filas e Deques

Estruturas de Dados Pilhas, Filas e Deques Estruturas de Dados Pilhas, Filas e Deques Prof. Eduardo Alchieri Estruturas de Dados Pilhas Pilhas Lista LIFO (Last In, First Out) Os elementos são colocados na estrutura (pilha) e retirados em ordem

Leia mais

1 Propriedades das Funções Contínuas 2

1 Propriedades das Funções Contínuas 2 Propriedades das Funções Contínuas Prof. Doherty Andrade 2005 Sumário 1 Propriedades das Funções Contínuas 2 2 Continuidade 2 3 Propriedades 3 4 Continuidade Uniforme 9 5 Exercício 10 1 1 PROPRIEDADES

Leia mais

Programação Dinâmica

Programação Dinâmica fib(5) fib(4) fib(3) fib(3) fib(2) fib(2) fib(1) fib(2) fib(1) fib(1) fib(0) fib(1) fib(0) fib(1) fib(0) Uma metodologia de resolução de problemas Center for Research in Advanced Computing Systems (CRACS

Leia mais

Python Funções. Introdução à Programação SI1

Python Funções. Introdução à Programação SI1 Python Funções Introdução à Programação SI1 Conteúdo Funções Conceitos Objetivos Modularização Exemplos Exercícios 2 Funções O que são? Qual a função de uma função? 3 Imagine o código 4 Imagine o código

Leia mais

Árvores AVL. Prof. Othon M. N. Batista Estrutura de Dados

Árvores AVL. Prof. Othon M. N. Batista Estrutura de Dados Árvores AVL Prof. Othon M. N. Batista Estrutura de Dados Roteiro (/2) Árvore Binária de Pesquisa - Pior Tempo ABP Balanceada e Não Balanceada Balanceamento de Árvores Balanceamento de ABP Balanceamento

Leia mais

Estrutura de Dados Básica

Estrutura de Dados Básica Estrutura de Dados Básica Professor: Osvaldo Kotaro Takai. Aula 7: Recursividade O objetivo desta aula é apresentar o conceito de recursão para solução de problemas. A recursão é uma técnica de programação

Leia mais

Python: Comandos Básicos. Claudio Esperança

Python: Comandos Básicos. Claudio Esperança Python: Comandos Básicos Claudio Esperança Primeiros passos em programação Até agora só vimos como computar algumas expressões simples Expressões são escritas e computadas imediatamente Variáveis podem

Leia mais

Listas Duplamente Encadeadas

Listas Duplamente Encadeadas Listas Duplamente Encadeadas! quando for preciso seguir a seqüência de elementos em ambos os sentidos! cada nó possui dois ponteiros: ant e prox ant prox a b c d Início Fim 1 Listas Duplamente Encadeadas

Leia mais

LÓGICA DE PROGRAMAÇÃO. Professor Celso Masotti http://ead.celsomasotti.com.br

LÓGICA DE PROGRAMAÇÃO. Professor Celso Masotti http://ead.celsomasotti.com.br LÓGICA DE PROGRAMAÇÃO Professor Celso Masotti http://ead.celsomasotti.com.br Ano: 2015 1 HTML & PHP em Ambiente Web PARTE II Sumário I Decisão... 4 Operadores de Comparação... 6 II IF ELSEIF ELSE... 7

Leia mais

Projeto e Análise de Algoritmos Projeto de Algoritmos Introdução. Prof. Humberto Brandão humberto@dcc.ufmg.br

Projeto e Análise de Algoritmos Projeto de Algoritmos Introdução. Prof. Humberto Brandão humberto@dcc.ufmg.br Projeto e Análise de Algoritmos Projeto de Algoritmos Introdução Prof. Humberto Brandão humberto@dcc.ufmg.br aula disponível no site: http://www.bcc.unifal-mg.edu.br/~humberto/ Universidade Federal de

Leia mais

MD Teoria dos Conjuntos 1

MD Teoria dos Conjuntos 1 Teoria dos Conjuntos Renato Martins Assunção assuncao@dcc.ufmg.br Antonio Alfredo Ferreira Loureiro loureiro@dcc.ufmg.br MD Teoria dos Conjuntos 1 Introdução O que os seguintes objetos têm em comum? um

Leia mais

Instruções de controle: Parte 1. 2005 by Pearson Education do Brasil

Instruções de controle: Parte 1. 2005 by Pearson Education do Brasil 1 4 Instruções de controle: Parte 1 2 4.2 Algoritmos Algoritmos: As ações a executar. A ordem em que essas ações executam. Controle do programa: Especifica a ordem em que as ações são executadas em um

Leia mais

Árvores. Seqüência de arcos, com origem na raiz e final em um determinado nó. Quantos caminhos existem para se atingir um determinado nó?

Árvores. Seqüência de arcos, com origem na raiz e final em um determinado nó. Quantos caminhos existem para se atingir um determinado nó? 39 Árvores Conceitue caminho. Seqüência de arcos, com origem na raiz e final em um determinado nó. Quantos caminhos existem para se atingir um determinado nó? Apenas um. O que determina o tamanho de um

Leia mais

EFICIÊNCIA DE ALGORITMOS E

EFICIÊNCIA DE ALGORITMOS E AULA 2 EFICIÊNCIA DE ALGORITMOS E PROGRAMAS Medir a eficiência de um algoritmo ou programa significa tentar predizer os recursos necessários para seu funcionamento. O recurso que temos mais interesse neste

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Os objetivos indicados aplicam-se a duas linguagens de programação: C e PHP

Os objetivos indicados aplicam-se a duas linguagens de programação: C e PHP AGRUPAMENTO DE ESCOLAS DE SANTA COMBA DÃO CURSO PROFISSIONAL DE TÉCNICO DE GESTÃO E PROGRAMAÇÃO DE SISTEMAS INFORMÁTICOS 2012-2015 PROGRAMAÇÃO E SISTEMAS DE INFORMAÇÃO MÓDULO 2 Mecanismos de Controlo de

Leia mais

Estruturas de Dados Árvores

Estruturas de Dados Árvores Estruturas de Dados Árvores Prof. Eduardo Alchieri Árvores (introdução) Importância de estruturas unidimensionais ou lineares (vetores e listas) é inegável Porém, estas estruturas não são adequadas para

Leia mais

3 ALGORITMOS GENÉTICOS : CONCEITOS BÁSICOS E EXTENSÕES VINCULADAS AO PROBLEMA DE MINIMIZAÇÃO DE PERDAS

3 ALGORITMOS GENÉTICOS : CONCEITOS BÁSICOS E EXTENSÕES VINCULADAS AO PROBLEMA DE MINIMIZAÇÃO DE PERDAS 3 ALGORITMOS GENÉTICOS : CONCEITOS BÁSICOS E EXTENSÕES VINCULADAS AO PROBLEMA DE MINIMIZAÇÃO DE PERDAS 3.1 - Conceitos Básicos Entendemos como algoritmo um conjunto predeterminado e bem definido de regras

Leia mais

Lógica Computacional 117366. 2 Descrição do Projeto

Lógica Computacional 117366. 2 Descrição do Projeto Lógica Computacional 117366 Descrição do Projeto Formalização de Algoritmos para Ordenação com Heaps 24 de setembro de 2015 Prof. Mauricio Ayala-Rincón Prof. Flávio L. C. de Moura A estagiária de docência

Leia mais

Lema do Bombeamento Linguagens Livres de Contexto

Lema do Bombeamento Linguagens Livres de Contexto Lema do Bombeamento Linguagens Livres de Contexto Bombeando FA s 0 0 x y z 1 1 1 0 Strings de comprimento 3 ou mais no DFA acima podem ser bombeados, pois tais strings correspondem a caminhos de comprimento

Leia mais

A pirâmide de Pascal

A pirâmide de Pascal A pirâmide de Pascal Luzitelma Maria Barbosa de Castro Tarcisio Praciano-Pereira Departamento de Matemática Universidade Estadual Vale do Acaraú Março de 2003 luzitl@hotmail.com pré-prints do Curso de

Leia mais

O trabalho pioneiro nesta área remonta a Ulam, que o teria inventado em 1946 ao estudar as possibilidades de ganhar no jogo de cartas Solitário.

O trabalho pioneiro nesta área remonta a Ulam, que o teria inventado em 1946 ao estudar as possibilidades de ganhar no jogo de cartas Solitário. Prof. Lorí Viali, Dr. viali@mat.ufrgs.br http://www.ufrgs.br/~viali/ Números aleatórios (NA) são elementos básicos necessários na simulação de quase todos os sistemas discretos. Eles podem ser utilizados

Leia mais

Máquinas de Turing 1

Máquinas de Turing 1 Máquinas de Turing 1 Agenda Máquinas de Turing (TM) Alan Turing Motivação Tese de Church-Turing Definições Computação Configuração de TM Reconhecedores vs. Decisores 2 Alan Turing Alan Turing é um dos

Leia mais

Índice. Capítulo 2 Estrutura de Dados sequencial com armazenamento sequencial

Índice. Capítulo 2 Estrutura de Dados sequencial com armazenamento sequencial Índice i Índice Capítulo 2 Estrutura de Dados sequencial com armazenamento sequencial 1. A Estrutura Abstrata de Dados Lista... 1 1.1. Definição... 1 1.2. Implementação de Listas utilizando armazenamento

Leia mais

Instituto de Computação

Instituto de Computação Instituto de Computação Universidade Estadual de Campinas MO824 - Programação Inteira e Combinatória Geração de Colunas para o Problema de Corte e Empacotamento Bidimensional em Faixas Fabricio Olivetti

Leia mais

Exemplos. char c; int i=67;... c= A ; c=c+1; if (c== B )... c=i; i=c; i++; if (i>= C )...

Exemplos. char c; int i=67;... c= A ; c=c+1; if (c== B )... c=i; i=c; i++; if (i>= C )... Caracteres Conceitos Tipo de dados simples (char), cujo valor é a codificação numérica de um caracter; Caracteres literais são representados por aspas simples, como em A e a ; Variáveis do tipo char podem

Leia mais

ESTRUTURAS DE DADOS II MSc. Daniele Carvalho Oliveira

ESTRUTURAS DE DADOS II MSc. Daniele Carvalho Oliveira ESTRUTURAS DE DADOS II MSc. Daniele Carvalho Oliveira ÁRVORES ED2: MSc. Daniele Oliveira 2 Introdução Filas, pilhas» Estruturas Lineares Um dos exemplos mais significativos de estruturas não-lineares são

Leia mais

CIÊNCIA DA COMPUTAÇÃO E SISTEMAS DA INFORMAÇÃO

CIÊNCIA DA COMPUTAÇÃO E SISTEMAS DA INFORMAÇÃO CIÊNCIA DA COMPUTAÇÃO E SISTEMAS DA INFORMAÇÃO MATERIAL INSTRUCIONAL ESPECÍFICO Tomo V 1 Questão 1 Questão 1. 1 O problema P versus NP é um problema ainda não resolvido e um dos mais estudados em Computação.

Leia mais

TIPOS ABSTRATOS DE DADOS DEFINIÇÃO E EXEMPLOS. Bruno Maffeo Departamento de Informática PUC-Rio

TIPOS ABSTRATOS DE DADOS DEFINIÇÃO E EXEMPLOS. Bruno Maffeo Departamento de Informática PUC-Rio TIPOS ABSTRATOS DE DADOS DEFINIÇÃO E EXEMPLOS Bruno Maffeo Departamento de Informática PUC-Rio TERMINOLOGIA BÁSICA ALGORITMO Um algoritmo pode ser visto como uma seqüência de ações expressas em termos

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

Listas (Parte 2) Túlio Toffolo tulio@toffolo.com.br www.toffolo.com.br. BCC202 Aula 10 Algoritmos e Estruturas de Dados I

Listas (Parte 2) Túlio Toffolo tulio@toffolo.com.br www.toffolo.com.br. BCC202 Aula 10 Algoritmos e Estruturas de Dados I Listas (Parte 2) Túlio Toffolo tulio@toffolo.com.br www.toffolo.com.br BCC202 Aula 10 Algoritmos e Estruturas de Dados I Listas Encadeadas Características: Tamanho da lista não é pré-definido Cada elemento

Leia mais

Um Exemplo de Refatoração. Prof. Alberto Costa Neto DComp/UFS alberto@ufs.br

Um Exemplo de Refatoração. Prof. Alberto Costa Neto DComp/UFS alberto@ufs.br Um Exemplo de Refatoração Prof. Alberto Costa Neto DComp/UFS alberto@ufs.br Exemplo Programa para calcular e imprimir o valor devido por um cliente de uma vídeo locadora Filme códigopreço:int 1 * * 1 Locação

Leia mais

Estruturas de Dados I

Estruturas de Dados I UFES - Curso de verão 2011 Estruturas de Dados I Profa. Juliana Pinheiro Campos jupcampos@gmail.com Árvores binárias de busca (ou São árvores projetadas para dar suporte a operações de busca de forma eficiente.

Leia mais

e à Linguagem de Programação Python

e à Linguagem de Programação Python Introdução a Algoritmos, Computação Algébrica e à Linguagem de Programação Python Curso de Números Inteiros e Criptografia Prof. Luis Menasché Schechter Departamento de Ciência da Computação UFRJ Agosto

Leia mais

Algoritmos e Estruturas de Dados: Árvore Binária de Busca

Algoritmos e Estruturas de Dados: Árvore Binária de Busca Busca pelo nodo 72 Árvore Binária de Busca Introdução 2/21 Algoritmos e Estruturas de Dados: Árvore Binária de Busca 44 Raiz Rômulo Silva de Oliveira Departamento de Automação e Sistemas DAS UFSC romulo@das.ufsc.br

Leia mais

ALGORITMOS E ESTRUTURAS DE DADOS CES-11 CES-11 CES-11

ALGORITMOS E ESTRUTURAS DE DADOS CES-11 CES-11 CES-11 ALGORITMOS E ESTRUTURAS DE DADOS Prof. Paulo André Castro pauloac@ita.br Sala 110 Prédio da Computação www.comp.ita.br/~pauloac IECE - ITA Uma árvore binária é: uma árvore vazia; ou uma árvore onde qualquer

Leia mais

Linguagens Formais e Autômatos. Alfabetos, Palavras, Linguagens e Gramáticas

Linguagens Formais e Autômatos. Alfabetos, Palavras, Linguagens e Gramáticas Linguagens Formais e Autômatos Alfabetos, Palavras, Linguagens e Gramáticas Cristiano Lehrer, M.Sc. Introdução (1/3) A Teoria das Linguagens Formais foi originariamente desenvolvida na década de 1950 com

Leia mais

INF 1005 Programação I

INF 1005 Programação I INF 1005 Programação I Aula 12 Cadeia de Caracteres (Strings) Edirlei Soares de Lima Caracteres Até o momento nós somente utilizamos variáveis que armazenam números (int, float ou

Leia mais

6.3 Equivalência entre Autômatos com Pilha Não-Determinísticos e Gramáticas Livre do Contexto

6.3 Equivalência entre Autômatos com Pilha Não-Determinísticos e Gramáticas Livre do Contexto Capítulo 6. Autômatos com Pilha 6.3 Equivalência entre Autômatos com Pilha Não-Determinísticos e Gramáticas Livre do Contexto Nos exemplos da seção anterior, vimos que os autômatos com pilha existem para

Leia mais

Complexidade de Algoritmos

Complexidade de Algoritmos Complexidade de Algoritmos Classes de Complexidades de Problemas Prof. Osvaldo Luiz de Oliveira Estas anotações devem ser complementadas por apontamentos em aula. Tempo polinomial Um algoritmo A, com entrada

Leia mais

Introdução à Programação Aula 11 Mais sobre ciclos e iteração

Introdução à Programação Aula 11 Mais sobre ciclos e iteração Introdução à Programação Aula 11 Mais sobre ciclos e iteração Pedro Vasconcelos DCC/FCUP 2014 Pedro Vasconcelos (DCC/FCUP) Introdução à Programação Aula 11 Mais sobre ciclos e iteração 2014 1 / 26 Nesta

Leia mais

Computers do not solve problems, People do! E.R.Davidson

Computers do not solve problems, People do! E.R.Davidson 3. O Problema do Par Mais Próximo (closest pair problem) António Leslie Bajuelos Departamento de Matemática Universidade de Aveiro Mestrado em Matemática e Aplicações Computers do not solve problems, People

Leia mais

INF 1007 Programação II

INF 1007 Programação II INF 1007 Programação II Aula 05 Cadeias de Caracteres Edirlei Soares de Lima Caracteres Caracteres são representados através de códigos numéricos. Tabela de códigos: Define correspondência

Leia mais

Aluísio Eustáquio da Silva

Aluísio Eustáquio da Silva 1 Aluísio Eustáquio da Silva SciLab Programável Material didático usado em aulas de Programação de Computadores, Algoritmos e Lógica de Programação Betim Maio de 2012 2 PROGRAMAÇÃO O SciLab permite que

Leia mais

Introdução ao Scilab

Introdução ao Scilab Programação de Computadores 1 Capítulo 1 Introdução ao Scilab José Romildo Malaquias Departamento de Computação Universidade Federal de Ouro Preto 2014.2 1/35 1 MATLAB e Scilab 2 O ambiente Scilab 2/35

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Pilhas. Profa Morganna Diniz

Pilhas. Profa Morganna Diniz Pilhas Profa Morganna Diniz Pilhas Geralmente pilhas são úteis em situações em que dados devem ser recuperados em ordem inversa a do armazenamento É uma estrutura de dados linear que permite acesso por

Leia mais