As enzimas de restrição

Tamanho: px
Começar a partir da página:

Download "As enzimas de restrição"

Transcrição

1 As enzimas de restrição A Engenharia Genética é possível graças a um grupo especial de enzimas que cortam o DNA. Estas enzimas são chamadas de enzimas de restrição ou endonucleases de restrição. As enzimas de restrição são proteínas produzidas por bactérias para prevenir ou restringir a introdução de DNA exógeno. Elas atuam como tesouras de DNA cortando-o e inativando-o. As enzimas de restrição reconhecem e cortam sítios específicos ao longo da molécula de DNA, chamados sítios de restrição. Cada enzima de restrição (e existem centenas, produzidas por muitas bactérias diferentes) tem o seu próprio sítio de ação. Em geral, um sítio de restrição é uma seqüência palindrômica de 4 ou 6 pares de base. Um DNA palindrômico é uma seqüência na qual a fita lida no sentido 5 a 3 é a mesma da fita lida no sentido 5 a 3. Por exemplo: 5 GAATTC 3 3 CTTAAG 5 é uma seqüência de DNA palindrômica. Para verificar isto, leia as seqüências das fitas superior e inferior do final 5 para o final 3. Esta seqüência é também um sítio de restrição para a enzima chamada EcoRI. O nome EcoRI vem de uma bactéria na qual ela foi descoberta, Escherichia coli RY 13 (EcoR), e I porque esta foi a primeira enzima de restrição encontrada neste organismo. 1

2 A EcoRI corta entre a G e a A em cada fita de DNA (veja abaixo). Assim que os cortes são feitos, o DNA é mantido unido pelas pontes de hidrogênio entre as quatro bases do meio. As pontes de hidrogênio são frágeis, e então o DNA se separa. Sítios de restrição: 5 GAATTC 3 3 CTTAAG 5 DNA cortado: 5 G AATTC 3 3 CTTAA G 5 A EcoRI não corta diretamente a molécula de DNA. Quando a EcoRI corta uma molécula de DNA, há a formação de fitas simples como caudas nos finais novos. Este tipo de final é chamado de finais coesivos (sticky end) porque podem se unir facilmente a outras fitas com finais complementares. Nem todas as enzimas de restrição formam finais coesivos; algumas cortam as duas fitas de DNA diretamente, produzindo um final abrupto (blunt end). Quando os cientistas estudam uma molécula de DNA, uma das primeiras coisas a fazer é solucionar onde estão os sítios de restrição. Então, eles criam um mapa de restrição, mostrando a localização dos sítios de clivagem para muitas enzimas diferentes. Estes mapas são utilizados como mapas rodoviários para a molécula de DNA. A figura 1 mostra um mapa de restrição de um plasmídio. 2

3 EcoRI (1/5541) HindIII (32) PvuI (4916) EagI (942) PvuII (3247) ApaI (2035) SmaI (2540) Figura 1. Mapa de restrição do plasmídio YIP5 (5541 pares de base). O número após cada nome de enzima de restrição indica em qual par de base o DNA é cortado pela enzima. Abaixo estão demonstrados alguns sítios de restrição de diferentes enzimas de restrição. EcoRI: 5 GAATTC 3 HindIII: 5 AAGCTT 3 3 CTTAAG 5 3 TTCGAA 5 BamHI: 5 GGATCC 3 AluI: 5 AGCT 3 3 CCTAGG 5 3 TCGA 5 SmaI: 5 CCCGGG 3 HbaI: 5 GCGC 3 3 GGGCCC 5 3 CGCG 5 3

4 Quais destas enzimas formariam finais abruptos? Quais delas formariam finais coesivos? Exercício 1 Corte a faixa de papel com a seqüência de DNA ao longo de suas bordas. Esta faixa representa uma molécula de DNA de fita dupla. Cada seqüência de letras representa a cadeia fosfodiéster, e as linhas verticais entre os pares de base representam as pontes de hidrogênio entre as bases. 1. Você vai simular a atividade da EcoRI. Verifique ao longo da seqüência do DNA 1 até você encontrar o sítio da EcoRI (utilize a lista de enzimas dada como referência). Faça cortes através da cadeia fosfo-diéster justamente entre a G e a A do sítio de restrição em ambas as fitas. Não corte através de toda a faixa. Lembre-se que a EcoRI corta a cadeia de cada fita de DNA separadamente. 2. Agora separe as pontes de hidrogênio entre os sítios de corte, cortando através das linhas verticais. Separe os dois pedaços de DNA. Analise os finais produzidos pela EcoRI. Eles são abruptos ou coesivos? Escreva EcoRI nos finais cortados. Mantenha os fragmentos cortados em sua mesa. 3. Repita o procedimento com a faixa 2, desta vez simulando a atividade da SmaI. Encontre o sítio da SmaI e corte através do esqueleto fosfodiéster nos sítios indicados acima. Há alguma ponte de hidrogênio entre os sítios de restrição? Os finais novos são coesivos ou abruptos? Marque os novos finais com SmaI e mantenha os fragmentos de DNA em sua mesa. 4. Simule a atividade da HindIII com a faixa 3. Estes finais são coesivos ou abruptos? Marque os novos finais com HindIII e mantenha os fragmentos. 5. Repita o procedimento com a faixa 4, simulando a EcoRI novamente. 6. Pegue o fragmento de DNA inicial da faixa 4 (um fragmento) EcoRI e o fragmento final da HindIII da faixa 3. Ambos os fragmentos têm caudas em fita simples de 4 bases. Escreva as seqüências de bases das duas caudas e 4

5 identifique-as EcoRI e HindIII. Marque os finais 5 e 3. As seqüências de bases dos finais produzidos pela EcoRI e HindIII são complementares? 7. Tire o fragmento da HindIII e pegue o fragmento final da faixa 1 (cortado com EcoRI). Compare os finais de fita simples do fragmento produzido pela EcoRI na faixa 1 com o fragmento produzido pela EcoRI na faixa 4. Escreva as seqüências de bases das caudas de fita simples e marque os finais 5 e 3. Eles são complementares? 8. Imagine que você cortou um fragmento de DNA completamente desconhecido com EcoRI. Você acha que os finais de fita simples destes fragmentos serão complementares àqueles produzidos nas faixas 1 e 4? 9. Uma enzima chamada DNA ligase refaz as pontes fosfodiéster entre nucleotídeos. Para a DNA ligase trabalhar, dois nucleotídeos devem se aproximar com a orientação apropriada para a ponte (o final 5 de um deve estar próximo ao final 3 do outro). Você acha que seria mais fácil para a DNA ligase reconectar dois fragmentos cortados pela EcoRI ou um fragmento cortado pela EcoRI com outro cortado pela HindIII? Qual é a sua explicação? Exercício 2 A figura 1 é um mapa de restrição do plasmídio circular YIP5. Este plasmídio contém 5541 pares de bases. Há um sítio de restrição da EcoRI no par de base 1. As posições dos outros sítios de restrição estão demonstradas no mapa. Os números após o nome das enzimas mostram em qual par de base a enzima cliva o DNA. Se você digerir o YIP5 com EcoRI, você vai obter um pedaço de DNA com 5541 pares de bases. 10. Quais seriam os produtos de digestão com as enzimas EcoRI e EagI? 11. Quais seriam of produtos de digestão com as enzimas HindIII e ApaI? 12. Quais seriam of produtos de digestão com as enzimas HindIII, ApaI e PvuI? 13. Se você pegar os produtos de digestão da questão 10 e digeri-los com PvuI, quais seriam os produtos? 5

6 TAGACTGAATTCAAGTCA ATCTGACTTAAGTTCAGT ATACGCCCGGGTTCTAAA TATGCGGGCCCAAGATTT CAGGATCGAAGCTTATGC GTCCTAGCTTCGAATACG AATAGAATTCCGATCCGA TTATCTTAAGGCTAGGCT - 5 6

7 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir muitos fragmentos de DNA. Para realizar a digestão com enzimas de restrição, basta acrescentar ao DNA a enzima desejada e deixa-la agir num tempo e temperatura apropriados. Antes de a reação começar, a mistura no tubo parece um fluido claro. Ao término da reação, a mistura continua clara! Olhando apenas para o tubo, como você pode dizer que aconteceu alguma coisa? Para verificar o produto de uma reação de digestão com enzimas de restrição, você deve ser capaz de visualizar os diferentes fragmentos produzidos. Existem corantes químicos que coram o DNA, mas obviamente não é bom adicionar estes corantes à mistura no tubo. No laboratório, os cientistas utilizam um processo chamado eletroforese em gel para separar os fragmentos de DNA de modo que eles podem visualizar o resultado de uma digestão (além de outros procedimentos). A eletroforese em gel utiliza a natureza química do DNA para separar os fragmentos. Sob circunstâncias normais, os grupos fosfato na cadeia do DNA são carregados negativamente. Então, as moléculas de DNA são muito mais atraídas pelo que é carregado positivamente. No gel de eletroforese, as moléculas de DNA são colocadas em um campo elétrico (o qual tem um pólo positivo e um pólo negativo) e vão migrar para o pólo positivo. O campo elétrico faz com que as moléculas de DNA se movam, mas para que elas se separem e sejam distinguidas umas das outras, todo o processo ocorre em um gel (daí vem o nome eletroforese em gel). Para separar o DNA, são utilizados diferentes tipos de gel. O gel mais freqüentemente utilizado na eletroforese de DNA é chamado de agarose e se comporta como uma gelatina comestível, porém sem açúcar e sem cor. Para fazer um gel para DNA (ou para moldar um gel), você deve dissolver a agarose em pó em um tampão fervente, colocar em um recipiente apropriado e deixar resfriar. Enquanto isto esfria, solidifica. 7

8 Para aplicar o DNA no gel de agarose, utiliza-se um pente apropriado na agarose ainda líquida e já disposta no recipiente. Quando a agarose se solidifica e o pente é retirado, permanece uma fila de pequenos orifícios no gel. As amostras de DNA são colocadas nos poços antes do início da eletroforese. Para a eletroforese, todo o gel é colocado em uma cuba de eletroforese com um tampão (água + sal). É aplicada uma corrente elétrica, a qual vai fluir através do tampão e do gel. Quando a corrente é aplicada, as moléculas de DNA começam a migrar para o pólo positivo do campo elétrico (Figura 2). Fonte de energia DNA + Cuba de eletroforese com solução salina Figura 2. Na eletroforese, o gel é colocado em uma cuba com solução salina e é aplicada uma corrente elétrica. O DNA carregado negativamente migra para o pólo positivo. Todo o DNA migra para o pólo positivo, mas o material do gel torna a migração mais difícil para as moléculas de DNA maiores do que para as menores. Então, em um mesmo período de tempo, um fragmento pequeno de DNA pode migrar muito mais longe do que um fragmento grande. Você pode pensar no gel de eletroforese como uma pista de corrida onde os corredores (as moléculas a serem separadas) se separam como 8

9 atletas em uma corrida real (Figura 3). As moléculas menores correm mais rápidas. Duas moléculas do mesmo tamanho vão correr exatamente juntas Figura 3. Na eletroforese, os DNAs pequenos sempre ganham. Após algum tempo, a corrente elétrica é cortada e o gel é colocado em uma solução corante. Após a coloração, o DNA pode ser visualizado. O método mais utilizado pelos pesquisadores é a coloração com brometo de etídio. Quando o brometo de etídio se liga ao DNA, este fluoresce sob luz ultravioleta (UV). (Obs: O brometo de etídio é mutagênico e requer extrema cautela durante a sua utilização e recipientes adequados para descarte). O padrão observado é uma série de riscos (bandas) no gel; cada banda é composta por moléculas de DNA de um tamanho. Na verdade, existem milhões de moléculas de DNA em uma mesma banda, mas elas são do mesmo tamanho (ou de tamanhos muito próximos). Após a digestão com enzimas de restrição, o gel deve apresentar uma banda para cada fragmento de tamanho diferente produzido na digestão. O fragmento menor 9

10 será aquele que migrou mais longe do poço onde foi colocado a amostra e o fragmento maior será aquele que migrou menos (Figura 4). A B Amostras (Não há amostras no restante do gel) 1. Digestão com enzima de restrição 2. Eletroforese 3. Visualização e análise do gel Figura 4. Uma das finalidades da eletroforese em gel é separar produtos de digestão com enzimas de restrição. (A) Mapa de restrição com o tamanho dos fragmentos em pares de base. (B) Esquema de um gel após a eletroforese. 10

11 Atividade Nas próximas páginas, você tem três representações de uma molécula de DNA (Apêndice 1) e o esquema de um gel de eletroforese (Apêndice 2). No Apêndice 1 estão representados os sítios de três enzimas de restrição diferentes na mesma molécula de DNA. Você vai simular a digestão deste DNA com cada uma das três enzimas e então vai simular a eletroforese dos fragmentos de restrição em um gel de agarose. 1. Corte as três figuras da molécula de DNA. 2. Simule a atividade da enzima de restrição EcoRI na molécula de DNA que mostra os sítios da EcoRI, cortando a faixa nas linhas verticais que representam os sítios da EcoRI. Após ter digerido a molécula com a EcoRI mantenha os seus fragmentos de restrição. 3. Agora você vai digerir a segunda molécula de DNA com a BamHI. Preserve os fragmentos de restrição obtidos. 4. Faça o mesmo com a última molécula de DNA, utilizando a enzima HindIII. 5. Em seu gel de eletroforese imaginário, você vai separar os fragmentos da EcoRI, BamHI e HindIII como se você tivesse aplicado estas amostras em poços diferentes e adjacentes no gel. Arrume os seus fragmentos como se eles estivessem sido separados através de eletroforese em gel de agarose. (Os fragmentos maiores devem ficar mais próximos dos poços onde as amostras foram aplicadas). 6. Agora, separe os fragmentos BamHI e coloque-os adjacente aos fragmentos EcoRI. Certifique-se de ter ordenado cada fragmento EcoRI corretamente pelo tamanho com relação aos fragmentos BamHI que você já havia disposto. 7. Repita o mesmo procedimento para os fragmentos HindIII. Agora você deve ter três grupos de fragmentos dispostos na sua frente. 8. Agora olhe para o esquema de um gel de eletroforese dado no Apêndice 2. Note que ele tem uma escala de tamanho dado em pares de bases disposta à esquerda dos 11

12 poços do gel. Utilizando esta escala como um guia, desenhe o padrão obtido com a digestão que você realizou. Utilize um poço para a digestão com EcoRI, outro para a digestão com BamHI e um terceiro para a digestão com HindIII. 9. Utilize as informações obtidas nas fitas de papel que você recortou para desenhar as bandas representando os fragmentos de restrição em pares de bases. Todos os fragmentos menores no gel estão na frente dos fragmentos maiores? Você notou que o tamanho da escala parece não ter intervalos regulares? Isto ocorre porque os fragmentos de tamanhos diferentes se comportam de forma diferente no gel de agarose. 12

13 Apêndice 1 Você tem a representação de três moléculas de DNA com pares de bases. Cada representação mostra a localização de diferentes sítios de restrição (linhas verticais). Os números entre os sítios de restrição mostram os tamanhos (em pares de bases) dos fragmentos que serão gerados após a digestão do DNA com as respectivas enzimas. Sítios de restrição da EcoRI Sítios de restrição da BamHI Sítios de restrição da HindIII

14 Apêndice 2 Esquema de um gel de agarose. EcoRI BamHI HindIII Escala de tamanho em pares de bases Amostras

15 Plasmídios Recombinantes Algumas das técnicas mais importantes em Biotecnologia utilizadas hoje envolvem a construção de moléculas de DNA recombinantes. O material recombinante é a reunião de fragmentos com origens diferentes. Você pode construir uma bicicleta recombinante através da união de duas bicicletas diferentes: por exemplo, você pode colocar os pneus de uma bicicleta na estrutura de outra. O seu genoma é recombinante porque uma parte veio de sua mãe e outra de seu pai. As moléculas de DNA recombinantes são pedaços de DNA de fontes diferentes que foram reunidos. Em Biotecnologia, geralmente, uma das fontes de DNA é um plasmídio. Os plasmídios são pequenas moléculas de DNA circulares. Os plasmídios são copiados pelas enzimas de duplicação de DNA da célula porque eles contêm uma seqüência especial de bases chamada de origem de duplicação. As enzimas de duplicação reconhecem esta seqüência especial e começam a sintetizar uma nova molécula de DNA. Como você deve imaginar, o cromossomo da bactéria e outros cromossomos também apresentam origem de duplicação. As origens de duplicação são essenciais para a hereditariedade; se a molécula de DNA não tivesse uma origem de duplicação, ela não poderia ser copiada pela célula e não seria transmitida às gerações futuras. Os plasmídios freqüentemente contêm genes para resistência a antibióticos. Os antibióticos são substâncias naturais produzidas pela maioria dos microrganismos para matar outros microrganismos quando em competição. A resistência a antibióticos também é um fenômeno natural; os microorganismos que produzem antibióticos devem ser resistentes pelo menos ao antibiótico que produzem! Nós vamos trabalhar com os genes para resistência aos antibióticos ampicilina e canamicina. Nesta atividade, você vai reunir plasmídios que carregam genes para resistência à ampicilina e à canamicina e então recombinar os dois plasmídios. Nós chamamos o plasmídio com resistência a ampicilina de pamp, o plasmídio com resitência à canamicina de pkan e o plasmídio recombinante de pamp/kan. Nós vamos utilizar um modelo de plasmídios de papel para mimetizar o processo realizado quando da construção de um DNA recombinante. A tesoura vai substituir as enzimas de restrição. A enzima DNA 15

16 ligase, a qual forma as pontes de fosfodiéster entre os pedaços de DNA, será representada pela fita adesiva (ou cola). Nosso resultado será uma molécula de DNA recombinante. Os cientistas colocam os plasmídios recombinantes reais em bactérias, onde eles vão se multiplicar. As bactérias também se multiplicam, fazendo milhões de cópias de moléculas de DNA recombinante e das proteínas que elas codificam. A construção dos plasmídios pamp e pkan Localize as fitas de DNA nos Apêndices Modelo de papel do plasmídio pamp e Modelo de papel do plasmídio pkan. Em cada faixa, as seqüências de letras indicam as bases e as linhas horizontais indicam a cadeia de açúcar e fosfato da molécula de DNA. As pontes de hidrogênio entre os pares de base estão localizadas no espaço em branco entre as linhas formadas pelas seqüências de letras. 1. Corte ao longo das linhas sólidas. Retire cada faixa, deixando as linhas sólidas intactas. Faça um corte vertical para unir o final aberto de cada faixa formada pelas linhas sólidas. Este corte vai remover as marcações 5 e 3 de cada fita. 2. Após ter recortado as três faixas, cole com fita adesiva o final 1 com a área cole 1, cobrindo as linhas verticais. Cole o final 2 ao cole 2 e o 3 ao cole 3 até que você complete o modelo circular do plasmídio pamp. 3. Utilizando o Apêndice Modelo de papel do plasmídio pkan faça o mesmo procedimento descrito acima, montando agora o modelo circular do plasmídio que contém o gene de resistência para a canamicina. Construindo o plamídio recombinante pamp/kan Agora você tem os plasmídios pamp e pkan preparados. Você vai usa-los agora como materiais iniciais para construir um plasmídio recombinante. Corte o pamp e o pkan com as enzimas BamHI e HindIII. Você vai unir os fragmentos de cada plasmídio, criando um plamídio pamp/kan. 16

17 1. Primeiro, simule a atividade da enzima de restrição BamHI. Lendo da posição 5 para a 3 (esquerda para a direita) ao longo da fita superior do seu plasmídio pamp, encontre a seqüência de bases GGATCC (sítio de restrição da BamHI). Note que esta é uma seqüência palindrômica. Corte através da cadeia de açúcar e fosfato entre as duas G; pare no centro da área em branco que contém as pontes de hidrogênio (não corte através de todo o papel). Faça o mesmo com a fita oposta. Agora corte através das pontes de hidrogênio entre os dois cortes anteriores e abra o plasmídio em uma tira. Cada final da tira deve ter uma pequena seqüência de fita simples 3 CTAG 5. Marque no final de cada faixa BamHI. 2. Agora, simule a atividade da enzima de restrição HindIII. Lendo da posição 5 para a 3 (esquerda para a direita) ao longo da fita superior do seu plasmídio pamp, encontre a seqüência de bases AAGCTT (sítio de restrição da HindIII). Note que esta é também uma seqüência palindrômica. Corte através da cadeia de açúcar e fosfato entre as duas A; pare no centro da área em branco que contém as pontes de hidrogênio (não corte através de todo o papel). Faça o mesmo cortando entre as duas A do sítio de restrição da fita oposta. Agora corte através das pontes de hidrogênio entre os dois cortes anteriores e abra o plasmídio em uma tira. Cada final da tira deve ter uma pequena seqüência de fita simples; uma é o final BamHI e a outra é a seqüência 3 TCGA 5. Agora você tem dois pedaços de DNA do pamp. Reserve-os. 3. Utilizando o modelo de plasmídio pkan, repita os passos 1 e 2. O plasmídio pkan deve resultar em duas partes com os finais marcados. 4. Pegue o pedaço de plasmídio que contém o gene de resistência à ampicilina e reúna ao pedaço contendo o gene de resistência à canamicina utilizando a DNA ligase (fita adesiva). Certifique-se da complementaridade de bases quando você fizer a ligação. Note que o final BamHI não vai parear com o final HindIII, mas vai parear com o outro final BamHI. Da mesma forma, o final HindIII deve parear com o outro final HindIII. 17

18 Lembre-se de que o DNA é tridimensional. Em nosso modelo, as letras representando as bases podem parecer uma em cima da outra, mas no DNA real isto não acontece. Então, nesta simulação no papel, as letras representando as bases não precisam necessariamente estar logo acima umas das outras. Certifique-se da direção 5 3 da fita e que os pares de base estejam corretos. Agora você criou um plamídio recombinante pamp/kan. Transformação É possível introduzir os plasmídios em bactérias utilizando o processo de transformação. As bactérias que podem ser transformadas (podem receber DNA exógeno) são chamadas de células competentes. Algumas bactérias são competentes naturalmente. Outras podem se tornar competentes por meio de um tratamento químico ou físico. Quando a bactéria incorpora o plasmídio, ela passa a expressar a resistência ao antibiótico que estiver "instruído" no DNA recém adquirido. As bactérias que expressam proteínas novas desta forma são chamadas de transformadas. As enzimas de duplicação de DNA da célula sintetizam cópias novas do plasmídio, que será, então, transmitido às células-filhas quando a bactéria se multiplicar. Neste processo são geradas muitas cópias idênticas de genes novos, então, dizemos que estes são genes clonados. Após a transformação por plasmídios contendo genes de resistência a antibióticos, as bactérias transformadas podem ser detectadas quando são cultivadas em placas contendo o(s) antibiótico(s). No meio de cultura contendo antibiótico, apenas as bactérias que expressarem o novo gene de resistência ao antibiótico vão formar colônias (as bactérias transformadas). Este método de selecionar transformantes (porque eles não são os únicos que podem crescem em meio de cultura) é vantajoso porque, normalmente, a transformação é um processo bastante ineficiente. Em um experimento típico, apenas 1 célula em cada será transformada. 18

19 Questões 1. Um sítio de corte feito pela BamHI vai se ligar apenas a um corte que tenha sido feito por BamHI. O mesmo é verdade para cortes feitos pela HindIII e pela maioria dos sítios de corte das enzimas de restrição. Se você usa dois fragmentos de uma vez, quais combinações diferentes poderiam ser formadas a partir dos quatro fragmentos que você obteve no exercício 3? Quais destes poderiam ser detectados em colônias de transformantes em meio de cultura contendo antibiótico? 2. Supondo que você fez a atividade com DNA real e pretende transformar bactérias com o seu plasmídio pamp/kan. Descreva um experimento para crescer as bactérias transformadas em placas e selecionar aquelas que tenham sido transformadas por pamp/kan. Inclua os controles que poderão lhe dizer quais bactérias formarão colônias e se o antibiótico está ativo. 3. Com relação à questão 2, descreva um procedimento para distinguir as bactérias que foram transformadas por outras moléculas de DNA que se formaram durante o processo de ligação (você descreveu estas moléculas na questão 1). 4. Freqüentemente, os cientistas combinam um gene de resistência a um antibiótico com seja qual for o gene que eles estão tentando clonar. Este gene é então associado a um gene de resistência a um antibiótico. Qualquer bactéria que contenha o gene de interesse será, portanto, resistente ao antibiótico. Na maioria dos casos, os cientistas não têm interesse na proteína que destrói o antibiótico. Porque então os cientistas combinam os genes desta forma? 19

20 Modelo de papel do plasmídio pamp 1 Gene de resistência à ampicilina 5' AATTCGATGAATTCXXXXXXXXXXXXXXXXXXXXXXXXXXGAATTCTGAAGGTTCGAAGCGCTAT 3' TTAAGCTACTTAAGXXXXXXXXXXXXXXXXXXXXXXXXXXCTTAAGACTTCCAAGCTTCGCGATA 2 5' GTCGGATCCAGATCCGAAGTCTCTCTAGGACCTTGCGAAGCCACGTAGTTCAGATTAATGCCTGAT 3' CAGCCTAGGTCTAGGCTTCAGAGAGATCCTGGAACGCTTCGGTGCATCAAGTCTAATTACGGACTA 3 Origem de duplicação 5' CGCTACAAGCTTATAGCGGCCXXXXXXXXXXXXXXXXXXXXAATATTGCGCAGTCTTAGCACTCC 3' GCGATGTTCGAATATCGCCGGXXXXXXXXXXXXXXXXXXXXTTATAACGCGTCAGAATCGTGAGG 19

21 Modelo de papel do plasmídio pkan 1 Origem de duplicação 5' TACTCGATGAAATCXXXXXXXXXXXXXXXXXXXXXXAGCTATGTTCTGAAGGATCCATATAGCGC 3' ATGAGCTACTTTAGXXXXXXXXXXXXXXXXXXXXXXTCGATACAAGACTTCCTAGGTATATCGCG 2 Gene de resistência à kanamicina 5' ATGACCGTCAGATCCGATGCTTCXXXXXXXXXXXXXXXXXXXXXXXXTCGAACGTACGGTCCGA 3' TACTGGCAGTCTAGGCTACGAAGXXXXXXXXXXXXXXXXXXXXXXXXAGCTTGCATGCCAGGCT 3 5' GATCACATGCTTATAAATATTGCGAAGCTTCAGTCAGCGCGTAGCACTCCTTAACGCGATGCATTAA 3' CTAGTGTACGAATATTTATAACGCTTCGAAGTCAGTCGCGCATCGTGAGGAATTGCGCTACGTAATT 20

22 21

23 Análise de Restrição A combinação da digestão com enzimas de restrição e a eletroforese em gel freqüentemente é chamada de análise de restrição, pois a informação obtida destes procedimentos pode ser utilizada para analisar a estrutura da molécula de DNA. A análise de restrição é importante especialmente para verificar a estrutura de moléculas de DNA recombinante e na análise de DNA desconhecido. Os exemplos a seguir mostram alguns problemas típicos de análise de restrição encontrados pelos pesquisadores. Desafio de análise de restrição I Você deseja inserir um fragmento de restrição EcoRI de pares de bases em um plasmídio (Figura 1). Você digere o plasmídio com EcoRI, pára a digestão, adiciona o fragmento de pares de bases e liga. Você sabe que este procedimento vai gerar uma mistura de plasmídios originais e plasmídios recombinantes. Delineie um procedimento de análise de restrição que você poderia utilizar para distinguir entre o vetor regenerado e o vetor recombinante. Estabeleça o tamanho dos fragmentos esperados. Utilize o esquema de gel fornecido para mostrar os produtos esperados na sua análise (um produto por poço). Marque cada poço com o tipo de molécula de DNA (plasmídio ou plasmídio recombinante) e os tamanhos dos fragmentos esperados. Desafio de análise de restrição II Você deseja remover o fragmento de restrição EcoRI do plasmídio e substituí-lo por um fragmento EcoRI diferente mas também de 1.500pb. Você digere o plasmídio com EcoRI, pára a digestão, adiciona o fragmento de pares de bases e liga (Figura 2). 22

24 Vetor incial Esquema do Gel A distância entre os sítios de restrição é dada em pares de bases. BamHI pb EcoRI pb Fragmento a ser inserido no vetor EcoRI pb EcoRI Figura 1. Informação e esquema do gel de eletroforese para o desafio de análise de restrição I. Vetor incial Fragmento EcoRI a ser inserido A distância entre os sítios de restrição é dada em pares de bases pb EcoRI BamHI EcoRI BamHI EcoRI 500 pb pb pb pb Origem EcoRI Figura 2. Informação e esquema do gel de eletroforese para o desafio de análise de restrição II. 23

25 Atividade A. Desenhe os produtos que você poderia gerar que apresente uma origem de duplicação e menos de 7.000pb. (Sugestão: o que são todos os fragmentos presentes na reação de ligação?). Marque os produtos A, B, etc. e indique as distancias entre os sítios de restrição. B. Descreva um procedimento de análise de restrição que levará você a identificar o maior número de produtos possível após uma única digestão. Você pode usar mais de uma enzima de restrição na digestão. Estabeleça o tamanho dos fragmentos esperados para cada um dos seus produtos de IIA. C. Use o esquema de gel de eletroforese da figura 3 para desenhar o padrão de gel esperado de sua proposta de análise para cada um dos produtos mostrados em IIA. Marque os poços do gel com o produto (A, B, etc). Marque as bandas com o tamanho dos fragmentos (com base na escala fornecida). Tamanho do Fragmento (pb) Figura 3. Esquema de um gel de eletroforese para o desafio de análise de restrição IIC. 24

26 Desafio de análise de restrição III Quando os pesquisadores estudam um fragmento de DNA desconhecido, freqüentemente, a primeira coisa a se fazer é colocar junto a um mapa de restrição. O mapa é então utilizado como um guia quando eles vão estudar os genes codificados por este segmento. Como o fragmento é colocado junto ao mapa de restrição? Deve-se digerir o DNA com enzimas únicas e com combinações de enzimas. Observando-se os tamanhos dos fragmentos produzidos, os pesquisadores determinam as localizações dos sítios de restrição que poderiam resultar no padrão de bandas obtido. Agora você vai montar um mapa de restrição (como um quebra-cabeça). Um fragmento de DNA linear é digerido com a enzima de restrição EcoRI e resulta em três segmentos: um com 3.000, outro com e outro com pb. Quando digerida com a BamHI, a molécula de DNA gera fragmentos de 4.500, e 2.500pb. Um digestão dupla com EcoRI e BamHI resulta em fragmentos de 2.500, 500, 3.600, e 400 pb. Desenhe um mapa de restrição do fragmento de DNA desconhecido, mostrando as localizações dos sítios de restrição EcoRI e BamHI. Indique as distâncias entre os sítios de restrição em pares de bases. Indique também a distância e a posição de cada um destes sítios com o respectivo nome da enzima. 25

27 Detecção de Seqüências Específicas de DNA Parte 1. Procurando um gene Imagine que você é um cientista e acabou de extrair um DNA. Você precisa saber se este DNA contém o gene para fibrose cística. Você sabe pouco sobre o gene da fibrose cística, então, como você pode dizer se o tem em sua amostra? Quando um cientista procura por um determinado segmento de DNA, ele pode utilizar um DNA especial denominado sonda (probe). Normalmente uma sonda é um fragmento de DNA de fita simples. Se um pedaço de DNA de fita simples encontra outro segmento de DNA também de fita simples e com exatamente a mesma seqüência de bases, eles vão se parear formando um DNA de dupla hélice. Os cientistas utilizam um termo especial para o pareamento de duas fitas simples de DNA para constituir uma fita dupla: hibridação (Figura 1). Sonda Complementaridade de bases Gene de interesse Figura 1. Hibridação de uma sonda com uma seqüência dentro do DNA de fita simples. Para saber se um gene está presente na amostra de DNA, os cientistas utilizam uma sonda com a mesma seqüência de uma parte do gene. Ela é adicionada à amostra de DNA para saber se vai hibridar em algum local. Como eles sabem quando a sonda hibridou? Se a sonda hibridar com a amostra, irá grudar com o DNA da amostra. Se não, a sonda pode ser retirada facilmente. Após a lavagem da amostra, os cientistas conseguem saber se a sonda hibridou com a amostra ou não. Se ocorrer a hibridação é porque a seqüência de DNA da sonda está presente na amostra. Se a sonda é um pequeno segmento do gene, então, provavelmente o gene está presente na amostra. 26

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

Exercício 2 DNA e Eletroforese

Exercício 2 DNA e Eletroforese Exercício 2 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

ELETROFORESE APLICADA À ANÁLISE DE DNA

ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA GENÉTICA BACTERIANA INTRODUÇÃO O DNA existe como uma hélice de fita dupla, mantidas pelo pareamento de bases nitrogenadas específicas (AT; CG). - A seqüência de bases codifica a informação genética; -

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

TRANSFERÊNCIA DE GENES EM BACTÉRIAS

TRANSFERÊNCIA DE GENES EM BACTÉRIAS TRANSFERÊNCIA DE GENES EM BACTÉRIAS SEXO BACTERIANO Bactérias podem trocar ou transferir DNA entre elas por três diferentes vias. Em todos os casos, as células que fornecem o DNA são chamadas de DOADORAS

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

O complexo maquinário de replicação e suas enzimas

O complexo maquinário de replicação e suas enzimas O complexo maquinário de replicação e suas enzimas AULA 10 objetivos Ao final desta aula, você deverá ser capaz de: Apresentar os diferentes componentes do maquinário de replicação. Conhecer as diferentes

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica.

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica. Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Eletroforese Introdução a Eletroforese Eletroforese migração de moléculas ionizadas,

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Conceitos Básicos de Técnicas em Biologia Molecular

Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 1 2 Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 3 ISSN 0103-0205 Setembro, 2008 Empresa Brasileira

Leia mais

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA REPLICAÇÃO DO Plano de Aula -Composição e estrutura do - e Hereditariedade -Processo de replicação REPLICAÇÃO DO Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DIVISÃO CELULAR E REPLICAÇÃO Bibliografia

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Transgênicos - 3º. Colegial Professor Fernando

Transgênicos - 3º. Colegial Professor Fernando Transgênicos - 3º. Colegial Professor Fernando 1. (Ufsm) Bioma é uma região com o mesmo tipo de clima, possui plantas e animais característicos [Planeta Terra: Ecossistemas, 2008]. Mas, como a interferência

Leia mais

Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014

Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014 Biologia Molecular Caderno de relatórios Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva Docentes: Dr. Cláudio Sunkel, Prof. Mariana Osswald 1 Extração de DNA genómico de Drosophila Melanogaster

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Ficha de Apoio Teórico: Replicação do DNA

Ficha de Apoio Teórico: Replicação do DNA Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Apoio Teórico: Replicação do DNA Introdução Uma das características mais pertinentes de todos

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

CADERNO DE EXERCÍCIOS 3F

CADERNO DE EXERCÍCIOS 3F Questão CADERNO DE EXERCÍCIOS 3F Ensino Médio Ciências da Natureza II Conteúdo 1. Ligações de hidrogênio interação intermolecular Habilidade da Matriz da EJA/FB H27 2. Ligações de hidrogênio e tensão superficial

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais

Relatórios de Biologia Molecular

Relatórios de Biologia Molecular Relatórios de Biologia Molecular 2013/2014 Professores: Dr. Claúdio Sunkel; Mariana Osswald Realizado por: Ana Isabel Sá; Ana Sofia Évora; Nuno Padrão 1 Extração de DNA genómico de Drosophila melanogaster

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

Quem é o criminoso? Apostila da Oficina Prática de Genética, Genoma e Biotecnologia

Quem é o criminoso? Apostila da Oficina Prática de Genética, Genoma e Biotecnologia Todos os direitos reservados ao O DNA vai à Escola. 2008 www.odnavaiaescola.org Conteúdo deste módulo Polimorfismo de DNA Técnica de eletroforese de DNA Teste de DNA Enzimas de restrição Apostila da Oficina

Leia mais

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi

VIROLOGIA HUMANA. Professor: Bruno Aleixo Venturi VIROLOGIA HUMANA Professor: Bruno Aleixo Venturi O que são vírus? A palavra vírus tem origem latina e significa "veneno". Provavelmente esse nome foi dado devido às viroses, que são doenças causadas por

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

DNA: Passado, Presente e Futuro

DNA: Passado, Presente e Futuro DNA: Passado, Presente e Futuro O passado O modelo do DNA que hoje nos é tão familiar foi divulgado em abril de 1953 na revista científica Nature pelos cientistas James Watson e Francis Crick. Eles afirmaram

Leia mais

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa SUMÁRIO ENÉI MOLEULR Daniel Macedo de Melo Jorge danielmacedo.jorge@gmail.com História da enética Molecular; Organização e estrutura dos genomas; DN e RN Dogma entral Replicação ranscrição radução enes

Leia mais