Genómica e Análise Comparativa de Genomas

Save this PDF as:

Tamanho: px
Começar a partir da página:

Download "Genómica e Análise Comparativa de Genomas"


1 Genómica e Análise Comparativa de Genomas

2 Genómica Genómica é o estudo do genoma, genes e das suas funções. Permite o conhecimento dos mecanismos moleculares da expressão génica incluindo as relações genes/ambiente.

3 Tamanho de Genomas A quantidade de DNA de um genoma haploide designa-se tamanho do genoma ou Valor C. O valor C é constante dentro de uma espécie mas variável entre espécies 1 kb = 1,000 bp; 1 Mb (or Mbp) = 1,000,000 bp

4 Tamanho de Genomas (haploides) e número de genes Genoma Pares de bases Genes Notas Phi-X virus of E. coli Epstein-Barr (EBV) Causa mononucleose Nanoarchaeum equitans Archaea parasita organismo com o menor genoma Mycoplasma genitalium Procariota com um pequeno genomas E. coli ,290 destes genes codificam proteinas e o resto RNAs Agrobact. tumefaciens Vector para produzir plantas transgénicas Sinorhizobium meliloti O simbionte da alfalfa. Possui 1 cromossoma e 2 grandes plasmídeos

5 Relação entre o nº de genes e o tamanho do genoma Procariota Nº de Genes/Tamanho Genoma Nº de Genes Tamanho Genoma (pb x100) Genes

6 Genomas Procariotas Possuem a informação genética numa só molécula; Têm poucos genes (E.coli tem ~4400); Têm um genoma compacto com poucos ou nenhuns espaços entre os genes; Não têm genes descontínuos, não possuem intrões Têm poucas ou nenhumas sequências repetitivas.

7 Tamanho de Genomas (haploides) de organismos modelo Genoma Pares de bases Genes Notas E. coli ,290 destes genes codificam proteinas e o resto RNAs Sacchromyces cerevisiae Levedura Neurospora crassa Ainda mais 498 genes de RNA C. elegans Nemátodo 1º eucariota multicelular com o genoma completamente sequenciado D. melanogaster Mosca da fruta. Modelo dos trabalhos de Morgan Anopheles gambiae Mosquito Vector da malária Arabidopsis thaliana ~ Angiospérmica- Ddicotiledónea Oryza sativa Arroz

8 Relação entre o nº de genes e o tamanho do genoma Nº de Genes/Tamanho Genoma (Mpb) Nº de Genes x Tamanho do Genoma (Mpb)

9 Tamanho de Genomas (haploides) Genoma Homem Cromossoma 1 Cromossoma Y Rato Lagosta Quercus suber Triticum aestivum Fritilaria Mbp ~ Notas O maior cromossoma humano O menor cromossoma humano Trigo mole Monocotiledónea

10 Genomas Eucariotas Possuem a informação genética em várias moléculas; Tamanhos de genomas muito diferentes (não se relacionam com o número de genes); Muitas sequências repetitivas não codificantes; Genes com muitos intrões.

11 Paradoxo do valor C Não há relação entre a complexidade do organismo e a sua quantidade de DNA. Não há relação entre a quantidade de DNA e o número de genes presentes nesse organismo

12 Porque é que os genomas variam tantas ordens de grandeza em diferentes organismos? Sequências não codificantes. Muitas vezes repetitivas A quantidade de DNA não génico varia muito de espécie para espécie As regiões não codificantes do genoma têm alguma função a nível da espécie? Diferentes níveis de organização da cromatina Controlo da expressão génica

13 Mecanismos de aumento do tamanho do Genoma Duplicação Genómica poliploidia Duplicação Cromossómica Repetição de sequências (tandem ou dispersas) Sequências palindrómicas Sequências muito repetidas pequenas com mais de cópias Sequências repetidas Sequências em cópia única

14 Poliploidização do trigo mole AA T. monococcum X Wild wheat BB species T. searsii? Emmer wheat AB AABB Double genome X ABD DD T. turgidum T. tauschii Double genome AABBDD T. aestivum Modern bread wheat (allohexaploid)

15 DNA muito repetido : DNA satélite (repetições em tandem) DNA satélite clássico minisatélites microsatélites telómeros O DNA satélite clássico foi descoberto em 1970 por estudos de cinética de re-associação. É heterocromatina constitutiva, está condensado ao longo do ciclo celular. É rico em AT e mais leve que o conjunto dos outros fragmentos. Aparece em todos os cromossomas humanos nas regiões pericentroméricas e todo o braço longo do cromossomay. Contribui com 8% do Genoma Humano. É 6x mais abundante que a fracção genómica que codifica proteínas Qual a sua função?

16 DNA muito repetido repetições em tandem minisatélites microsatélites telómeros DNA satélite clássico Minisatélites = Nº variável de repetições em tandem entre bp. Grupos de ,000 bp, tendem a aparecer perto dos telómeros. Diferentes pessoa possuem diferentes números. Tendem a ser muito heterozigóticos fingerprinting. um locus heterozigótico

17 DNA muito repetido repetições em tandem microsatélites telómeros DNA satélite clássico minisatélites Os microsatélites são muito pequenos não tendo mais de 2-4 bases Estão espalhados por todo o genoma em tandem. São raros em regiões codificantes e nos telómeros. O microsatélites mais comum no genoma humano é o dinucleótido repetido (CA)n CACACACACACACACACACACA GTGTGTGTGTGTGTGTGTGTGT..CACACACACACACA..GTGTGTGTGTGTGT um locus heterozigótico

18 DNA repetido repetições em tandem telómeros classic satellite DNA minisatellites microsatellites Os telómeros selam as extremidades dos cromossomas. Longas cadeias em tandem da sequência TTAGGG. Nas células somáticas há cerca de repetições desta sequência na extremidade de cada cromossoma. Esta sequência encontra-se em mais de 100 espécies de vertebrados (mamíferos, pássaros, réteis e peixes). TTAGGGTTAGGGTTAGGGTTAGGG AATCCCAATCCCAATCCCAATCCC Os telómeros têm uma função O número de repetições pode variar

19 Enzimas para manipulação de DNA Nucleases Degradam moléculas de DNA quebrando as ligações fofodiéster que ligam um nucleótido ao seguinte. Podem ser endonucleases ou exonucleases Enzimas de restrição cortam as moléculas de DNA em posições específicas

20 Enzyme Recognition sequence Type of ends End sequences AluI 5 -AGCT-3 Blunt 5 -AG CT-3' 3' -TCGA-5 3' -TC GA-5 Sau3AI 5 -GATC-3' Sticky, 5 overhang 5' - GATC-3' 3' -CTAG-5' 3' -CTAG -5' HinfI 5' -GANTC-3' Sticky, 5' overhang 5' -G ANTC-3' 3' -CTNAG-5' 3' -CTNA G-5' BamHI 5' -GGATCC-3' Sticky, 5' overhang 5' -G GATCC-3' 3' -CCTAGG-5' 3' -CCTAG G-5' BsrBI 5' -CCGCTC-3' Blunt 5' - NNNCCGCTC-3' 3' -GGCGAG-5' 3' - NNNGGCGAG-5' EcoRI 5' -GAATTC-3' Sticky, 5' overhang 5' -G AATTC-3' 3' -CTTAAG-5' 3' -CTTAA G-5' PstI 5' -CTGCAG-3' Sticky, 3' overhang 5' -CTGCA G-3' 3' -GACGTC-5' 3' -G ACGTC-5' NotI 5' -GCGGCCGC-3' Sticky, 5' overhang 5' -GC GGCCGC-3' 3' -CGCCGGCG-5' 3' -CGCCGG CG-5' BglI 5' -GCCNNNNNGGC-3' Sticky, 3' overhang 5' -GCCNNNN NGGC-3' 3' -CGGNNNNNCCG-5' 3' -CGGN NNNNCCG-5' N = any nucleotide. Note that most, but not all, recognition sequences have inverted symmetry: when read in the 5' 3 direction, the sequence is the same in both strands.

21 Mapas de restrição

22 Mapas de restrição

23 Enzimas para manipulação de DNA DNA polimerases enzimas que sintetizam novos polinucleótidos complementares a uma cadeia molde de DNA ou de RNA

24 Enzimas para manipulação de DNA Ligases enzimas que ligam moléculas de DNA sintetizando ligações fosfodiéster entre nucleótidos das duas extremidades de um única molécula

25 Caracterização Genómica Bibliotecas Genómicas Biblotecas de C-DNA

26 Bibliotecas Genómica Extracção Quebra mecânica ou digestão enzimática Linkers + DNA ligase Tecido DNA Genómico Fragmentos de DNA Vectores Transformação com vectores recombinantes

27 Clones de DNA Genómico Estes clones possuem fragmentos de DNA genómico. Obter a estrutura dos genes Identidficar regiões envolvidas na regulação génica Mapear e analisar alterações no genoma. Sequenciar o genoma

28 Bibliotecas de cdna Extracção Transcriptase reversa + primer + dntps RNase H + DNA polimerase + dntps Linkers + DNA ligase Tecido mrna Híbrido cdna-rna cdna dupla hélice Vector Transformação com vector recombinante

29 Transcrição e Processamento

30 Análise de fragmentos de DNA - PCR As análises moleculares de DNA necessitam de grandes quantidades de moléculas a analisar A técnica de PCR permite ter grandes quantidades de um determinado fragmento. O seu inventor foi galardoado com o prémio Nobel da Química de É um método rápido e relativamente económico de amplificar pequenos segmentos de DNA.

31 PCR - Polymerase Chain Reaction Requer o conhecimento da sequência de DNA numa região de interesse À medida que vai havendo mais informação, a técnica de PCR vai sendo cada vez mais utilizada Com primers apropriados podemos amplificar as regiões desejadas a partir de uma quantidade ínfima de DNA Não está dependente da distribuição dos locais de restricção

32 Replicação do DNA

33 PCR, Ciclo - 1 Template Cycle 1 1. Denature Primer 1 Primer 2 2. Anneal primers 3. Synthesize new DNA with polymerase

34 PCR, Ciclo - 2 Cycle 2 1. Denature 2. Anneal primers 3. Synthesize new DNA with polymerase

35 PCR, Ciclo - 3 Cycle 3 (focus on DNA segments bounded by primers) 1. Denature 2. Anneal primers 3. Synthesize new DNA with polymerase 2 moléculas duplas do produto que se prentende

36 PCR, Ciclo - 4: aumento exponencial do produto Cycle 4: Denature, anneal primers, and synthesize new DNA: 6 moléculas duplas do produto que se prentende

37 PCR, Ciclo - 5: aumento exponencial do produto Cycle 5: Denature, anneal primers, and synthesize new DNA: 14 moléculas duplas do produto que se prentende

38 PCR: Produz grandes quantidades das moléculas pretendidas O número de moléculas do fragmento de DNA que se encontra entre os primers aumenta 2 vezes em cada ciclo Se n= nº de ciclos, a amplificação é de cerca de [2 (n-1) ]-2 Depois de 21 ciclos temos o nosso fragmento amplificado cerca de 1 milhão de vezes Uma amostra com 0.1 pg do fragmento de interesse, pode ser amplificado até 0.1 µg

39 PCR - Polymerase Chain Reaction

40 Estabilidade da molécula de DNA Na molécula de DNA, a temperatura necessária à desnaturação da molécula aumenta com o tamanho da molécula e com o seu conteúdo em C+G. Fórmula simples para calcular a temperatura de desnaturação Tm Tm = 4(G + C) + 2(A + T) ºC.

41 Temperatura de emparelhamento e desenho do primer A temperatura de emparelhamento (Ta = Temperatura de annealing) depende directamente do tamanho e da composição dos primers. Deve ser cerca de 5ºC inferior à temperatura de desnaturação. Ta muito baixos em relação ao ideal para o par de primers usado, levará a emparelhamentos em zonas de menor homologia com a consequente amplificação de zonas não específicas e baixa do rendimento

42 Temperatura de emparelhamento e desenho do primer (Cont.) Ta muito altos em relação ao ideal para o par de primers usado produzirá pouco produto Pares de primers com Ta muito diferentes poderão nunca dar bons rendimentos e poderão levar à amplificação de uma só cadeia A fase de emparelhamento não deverá durar muito tempo. A maioria dos primers emparelha completamente em 30s. Excepto se Ta for muito perto de Tm ou se os primers forem muito longos.

43 Temperatura de emparelhamento Amplificação do vírus do papiloma Humano. A amostra de DNA foi retirada de uma biópsia e foi amplificado com primers específicos para este vírus e com diferentes temperaturas de emparelhamento. Especificidade a 50ºC

44 Tamanho do primer Os primers devem ter uma sequência complexa de modo que a probabilidade de emparelharem com outras sequências para além da escolhida seja bastante baixa. Probabilidade de encontrar uma das 4 bases no DNA - ¼ Probabilidade de encontrar um dinucleótido qualquer - 1/16 Probabilidade de encontrar uma qualquer sequência de 4 bases - 1/256 Probabilidade de encontrar uma qualquer sequência de 16 bases 1/ Um oligonucleótido maior que 17 pares de bases é extremamente específico.

45 Temperatura de polimerização (extenção) e sua duração Normalmente 70 72ºC durante 30s 3min Paradoxo: como é que a extenção (actividade da polimnerase) se dá a temperaturas superiores à do emparelhamento??? A polimerização ocorre desde o início do emparelhamento dos primers A actividade da polimerase é optima a 70ºC e a polimerização ocorre até 100 bases/sec. Cerca de 1 min para sequências de 2Kb

46 Regras simples para desenho de primers Deverão ter entre bases de tamanho A composição deverá ter entre 50-60% de G+C Os primers deverão terminar na posiçãp 3' num G ou C, ou CG ou GC: aumenta a estabilidade do emparelhamento Tms deverão ser entre 55-80ºC As extremidades 3 dos primers não devem ser complementares de modo a não formarem preferencialmente dímeros de primers Não deve haver complementaridade (possibilidade de se formarem estruturas tipo gancho de cabelo.

47 cdna PCR Estratégia utilizada para ampliar fragmentos de c- DNA: Mistura de fragmentos 21-meros com 20 resíduos de Timina + sequência aleatória de bases (por ex. A, G ou C na posição 3 ) 5'-TTTTTTTTTTTTTTTTTTTTTTTTT(A,G,C)-3'

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais


ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO ORGANIZAÇÃO DO MATERIAL GENÉTICO CELULAR Massa compacta, ocupando um volume limitado As suas variadas actividades, tal como replicação e transcrição, têm

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais


MAPA DO CROMOSSOMA DE E.coli REPLICAÇÃO DE DNA MAPA DO CROMOSSOMA DE E.coli TERMINOLOGIA Regras básicas para a designação de genes e proteínas: Genes bacterianos 3 letras minúsculas em itálico que reflectem a sua função aparente Ex:

Leia mais


ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais


ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

O que é a Reacção em Cadeia da Polimerase (PCR)?

O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? 3 5 F R 3 5 Um processo para multiplicar selectivamente um determinado segmento de DNA Esse segmento pode

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Bases Moleculares da Hereditariedade


Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

h>p:// Genômica Evolu/va Prof. Yuri Leite Evolução UFES

h>p:// Genômica Evolu/va Prof. Yuri Leite Evolução UFES h>p:// Genômica Evolu/va Prof. Yuri Leite Evolução UFES Genômica Genômica: estudo de genomas completos (cromossomos, organelas, plasmídeos) Seqüências

Leia mais


ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais


Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Ficha de Apoio Teórico: Replicação do DNA

Ficha de Apoio Teórico: Replicação do DNA Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Apoio Teórico: Replicação do DNA Introdução Uma das características mais pertinentes de todos

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais


ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

V e t e r i n a r i a n D o c s Genética

V e t e r i n a r i a n D o c s Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais


PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Gene é um segmento de DNA que contém informações para codificar uma ou mais funções

Gene é um segmento de DNA que contém informações para codificar uma ou mais funções Gene é um segmento de DNA que contém informações para codificar uma ou mais funções Espécie Espécie = mesma carga genética Biodiversidade 10.000.000 espécies Ecossistema várias espécies vivendo em um mesmo

Leia mais



Leia mais


DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Transgênicos - 3º. Colegial Professor Fernando

Transgênicos - 3º. Colegial Professor Fernando Transgênicos - 3º. Colegial Professor Fernando 1. (Ufsm) Bioma é uma região com o mesmo tipo de clima, possui plantas e animais característicos [Planeta Terra: Ecossistemas, 2008]. Mas, como a interferência

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais



Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais


MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Danos ao DNA (tipos, locais e frequência) Dano ao DNA -> mutação -> doença Mutação em regiões controladoras e codificantes Mecanismos de Reparo Fita simples

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa SUMÁRIO ENÉI MOLEULR Daniel Macedo de Melo Jorge História da enética Molecular; Organização e estrutura dos genomas; DN e RN Dogma entral Replicação ranscrição radução enes

Leia mais



Leia mais

As enzimas de restrição

As enzimas de restrição As enzimas de restrição A Engenharia Genética é possível graças a um grupo especial de enzimas que cortam o DNA. Estas enzimas são chamadas de enzimas de restrição ou endonucleases de restrição. As enzimas

Leia mais


ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Fenótipo: Factores ambientais

Fenótipo: Factores ambientais MUTAÇÕES Fenótipo: Factores ambientais Genoma Mutações: são alterações ou modificações súbitas em genes ou cromossomas, podendo provocar uma variação hereditária ou uma mudança no fenótipo. Pode produzir

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais


DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA E GEOLOGIA 11.º Avisos 1.EstedocumentoapenasservecomoapoioparcialàsaulasdeBiologiaeGeologia11.ºano Unidade5 lecionadas na Escola Secundária Morgado Mateus(Vila Real)

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais


SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo.

Dra. Kátia R. P. de Araújo Sgrillo. Dra. Kátia R. P. de Araújo Sgrillo São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

Genomas procariótico e eucariótico

Genomas procariótico e eucariótico GENOMA I Genomas procariótico e eucariótico Organização do DNA nos cromossomas Organização dos genes nos cromosssomas Estrutura dos genes e ainda: DNA repetitivo DNA extracromossómico Eucariotas Procariotas

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction)

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) - Realiza a replicação selectiva e rápida de uma sequência específica de nucleotídeos a partir de uma mistura complexa de DNAs amplificação

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015.

Criado e Desenvolvido por: Todos os direitos são reservados 2015. Criado e Desenvolvido por: Todos os direitos são reservados 2015. O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais


CONCEITOS DE BIOLOGIA MOLECULAR. Jorge Mondego CONCEITOS DE BIOLOGIA MOLECULAR Jorge Mondego Biologia Molecular Genome Transcriptome The OME -Era Proteome Metabolome - Entendimento da fisiologia e reprodução de microorganismos - Entendimento dos mecanismos

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF PCR Desenvolvida

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA REPLICAÇÃO DO Plano de Aula -Composição e estrutura do - e Hereditariedade -Processo de replicação REPLICAÇÃO DO Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DIVISÃO CELULAR E REPLICAÇÃO Bibliografia

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Genética Molecular Técnicas aplicadas a produção animal


Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais


WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ Diagnóstico molecular para Campylobacter spp.

Leia mais


BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais


ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA GENÉTICA BACTERIANA INTRODUÇÃO O DNA existe como uma hélice de fita dupla, mantidas pelo pareamento de bases nitrogenadas específicas (AT; CG). - A seqüência de bases codifica a informação genética; -

Leia mais