Sequenciamento de genomas: princípios e métodos clássicos

Tamanho: px
Começar a partir da página:

Download "Sequenciamento de genomas: princípios e métodos clássicos"

Transcrição

1 Sequenciamento de genomas: princípios e métodos clássicos Cesar Martins Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP Sequenciamento de DNA e de genomas: Determinar a sequência de nucleotídeos ao longo da cadeia de DNA...AGCAATTGTGAGTCCCTGACTTTTTGCTTA 1

2 Aplicações Estudo de genes Diagnóstico forense e clínico Identificação de indivíduos Estudos comparativos Evolução, Fisiologia, Ecologia,... Conhecimento do genoma Genomas sequenciados Primeiro genoma sequenciado: Fago X174, pb (9 genes) Sanger et al. 1977, Nature 265: Primeiro eucarionte sequenciado: Saccharomyces cerevisae, 13 milhões pb Goffeau et al. 1996, Science 274: 546, Primeiro animal sequenciado: Caenorhabditis elegans, 100 milhões pb C elegans Sequencing Consortium 1998, Science 282: Primeira planta sequenciada: Arabidopsis thaliana, 157 milhões pb Arabidopsis Genome Initiative 2000, Nature 408: Genoma humano: 3 bilhões pb International Human Genome Sequencing Consortium 2001, Nature: 409: ; Venter et al. 2001, Science 291:

3 Genomas sequenciados 1000 genomes available Source: NCBI, May 07/2013 Princípios e Métodos Clássicos Método químico Maxam & Gilbert 1977 Método dideoxi ou de terminalização Sanger et al

4 Método químico Método químico Walter Gilbert Prêmio Nobel em Bioquímica (1980) 4

5 Arranjo dos nucleotídeos na molécula de ácido nucléico fosfato Base Nucleotídeo açúcar Ligação fosfodiéster Nucleotídeo Ligação fosfodiéster Nucleotídeo Arranjo dos nucleotídeos na molécula de ácido nucléico 5

6 Clivagem preferencial do DNA em nucleotídeos específicos Clivagem preferencial do DNA em nucleotídeos específicos Dimetilfulfato Piperidina 6

7 Marcar os finais da dupla fita de DNA com 32 P Desnaturar o DNA para separar as fitas 7

8 Método químico Método químico 8

9 Método químico Método químico 9

10 eletroforese Método químico A>G G>A C C+T Método químico 10

11 Método químico Método dideoxi ou de terminalização 11

12 Método dideoxi ou de terminalização *Método dideoxi de sequenciamento *Sequenciamento Shotgun Frederick Sanger Dois prêmios Nobel em Bioquímica Sanger Institute, Cambridge, England Arranjo dos nucleotídeos na molécula de ácido nucléico fosfato base açúcar Nucleotídeo Ligação fosfodiéster Nucleotídeo Ligação fosfodiéster Nucleotídeo 12

13 Duplicação do DNA Fita contínua Fita descontínua Primers Duplicação do DNA DNA polimerase requer adicionar próximo nucleotídeo 13

14 Método dideoxi ou de terminalização Nucleotídeo normal Deoxinucleotídeo Nucleotídeo sem grupo OH no carbono 3 do açucar Dideoxinucleotídeo Método dideoxi ou de terminalização T G C A Deoxinucleotídeos normais T G C A Dideoxinucleotídeos (nucleotídeos alterados) 14

15 Método dideoxi ou de terminalização Seqüenciamento manual ** IMPORTANTE!! primer ou um dos nucleotídeos marcados radioativamente! Método dideoxi ou de terminalização Seqüenciamento manual 15

16 Método dideoxi ou de terminalização Seqüenciamento manual by C Martins (1999) Gilbert X Sanger Gilbert Requer grande quantidade de DNA purificado e muitos passos de purificação; Digestões enzimáticas; Produz curtas leituras; Encontrou aplicação em footprinting Não requer clonagem; Automatização não disponível. Sanger Requer clonagem do fragmento de interesse; Requer muito pouco DNA; Não necessita de digestões; Desenvolvimento de automação. 16

17 Método dideoxi ou de terminalização Desenvolvimento de sequenciamento automatizado 1986: Leroy E. Hood's laboratory at the California Institute of Technology announce the first semi-automated DNA sequencing machine. 1987: Applied Biosystems markets first automated sequencing machine, the model ABI 370. Seqüenciamento automático versão I A AGCTTA AGCTTACGA AGCTTACGAA AGCTTACGAATGCGTCCA AGCTTACGAATGCGTCCACA AGCTTACGAATGCGTCCACAA AGCTTACGAATGCGTCCACAACGCTA AGCTTACGAATGCGTCCACAACGCTACA AG AGCTTACG AGCTTACGAATG AGCTTACGAATGCG AGCTTACGAATGCGTCCACAACG AGCTTACGAATGCGTCCACAACGCTACAG AGCTTACGAATGCGTCCACAACGCTACAGG AGCTTACGAATGCGTCCACAACGCTACAGGTG AGC AGCTTAC AGCTTACGAATGC AGCTTACGAATGCGTC AGCTTACGAATGCGTCC AGCTTACGAATGCGTCCAC AGCTTACGAATGCGTCCACAAC AGCTTACGAATGCGTCCACAACGC AGCTTACGAATGCGTCCACAACGCTAC AGCT AGCTT AGCTTACGAAT AGCTTACGAATGCGT AGCTTACGAATGCGTCCACAACGCT AGCTTACGAATGCGTCCACAACGCTACAGGT A G C T T G C A A G C T T G C A 17

18 Fluorescence detection in automated DNA sequence analysis 18/ 03/ 12 08:17 nature.com about npg naturejobs natureevents help site index SEARCH JOURNAL Journal Home Current Issue AOP Archive Sequenciamento automático my account e-alerts subscribe register Go Sunday 18 March 2012 Nature 321, (12 June 1986); doi: /321674a0 THIS ARTICLE Download PDF References Export citation Export references Send to a friend More articles like this Table of Contents < Previous Next > Fluorescence detection in automated DNA sequence analysis LLOYD M. SMITH, JANE Z. SANDERS, ROBERT J. KAISER, PETER HUGHES, CHRIS DODD, CHARLES R. CONNELL *, CHERYL HEINER *, STEPHEN B. H. KENT & LEROY E. HOOD Division of Biology, California Institute of Technology, Pasadena, California 91125, USA * Applied Biosystems, Inc., Foster City, California 94404, USA We have developed a method for the partial automation of DNA sequence analysis. Fluorescence detection of the DNA fragments is accomplished by means of a fluorophore covalently attached to the oligonucleotide primer used in enzymatic DNA sequence analysis. A different coloured fluorophore is used for each of the reactions specific for the bases A, C, G and T. The reaction mixtures are combined and co-electrophoresed down a single polyacrylamide gel tube, the separated fluorescent bands of DNA are detected near the bottom of the tube, and the sequence information is acquired directly by computer. References Leroy Hood 1. Sanger, F., Nicklen, S. & Coulson, A. R. Proc. natn. Acad. Sci. U.S.A. 74, (1977). ChemPort 2. Smith, A. J. H. Meth. Enzym. 65, (1980). Article PubMed ChemPort 3. Maxam, A. M. & Gilbert, W. Meth. Enzym. 65, (1980). Article PubMed ChemPort 4. Smith, L. M., Fung, S., Hunkapiller, M. W., Hunkapiller, T. J. & Hood, L. E. Nucleic Acids Res. 13, (1985). PubMed ISI ChemPort 5. Smith, L. M., Kaiser, R. J., Sanders, J. Z. & Hood, L. E. Meth. Enzym. (in the press). 6. Atkinson, T. & Smith, M. Oligonucleotide Synthesis: A Practical Approach (ed. Gait, M. J.) (IRL, Oxford, 1984). 7. Forster, A. C., McInnes, J. L., Skingle, D. C. & Symons, R. H. Nucleic Acids Res. 13, (1985). PubMed ISI ChemPort 8. Chuvpilo, S. A. & Kravchenko, V. V. Sov. J. bioorg. Chem. 9, (1983). 9. Rosenthal, A., Schwertner, S., Hahn, V. & Hunger, H. Nucleic Acids Res. 13, (1985). PubMed ISI ChemPort 1986 Nature Publishing Group Privacy Policy Seqüenciamento automático versão II DNA Primer Nucleotídeos normais (A, C, G, T) Dideoxinucleotídeo DNA polimerase tampão A C G T T G C A / nature/ journal/ v321/ n6071/ abs/ a0.html gina 1 de 1 A C G T : dideoxi nucleotídeos marcados com compostos fluorescentes 18

19 Seqüenciamento automático versão II Seqüenciamento automático versão II 19

20 Seqüenciamento automático versão II Seqüenciamento automático versão II Cromatograma 20

21 Seqüenciamento automático versão II Seqüenciamento automático versão III (capilar) 21

22 Seqüenciamento automático versão III (capilar) Seqüenciamento automático versão III (capilar) 22

23 Seqüenciamento automático versão III (capilar) Seq capilar por Sanger 23

24 Seqüenciamento automático Plasmidio AMOSTRAS PARA SEQUENCIAMENTO PCR Seqüenciamento automático Plasmidio AMOSTRAS PARA SEQUENCIAMENTO 24

25 Hierarchical shotgun sequencing Sequenciamento de genomas inteiros Sequenciamento total de genomas Whole genome shotgun sequencing 25

26 Desvendando a complexidade dos genomas Mapa físico da seqüência nucleotídica HGP Celera Sequenciamento clássico por -Vantagens -Limitações 26

27 Curso de Férias de Julho de 2013 Instituto de Biociências, UNESP, Botucatu, SP 27

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

The next generation sequencing

The next generation sequencing The next generation sequencing Cesar Martins (cmartins@ibb.unesp.br) Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP 1 Métodos Atuais Sequenciamento

Leia mais

Análise genômica 2013

Análise genômica 2013 Curso de Férias Análise genômica 2013 08 a 11 de julho de 2013 Dr. Marcos Correa Dias (dias@ibb.unesp.br) Instituto de Biociências, UNESP, Botucatu, SP Qual a diferença? homem bactéria 1 COMPLEXIDADE MECÂNICA

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

O surgimento da Bioinformática Banco de Dados Biológicos

O surgimento da Bioinformática Banco de Dados Biológicos Rede de Biodiversidade e Biotecnologia da Amazônia Legal Programa de Pós-Graduação da Bionorte FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA NÚCLEO DE SAÚDE DEPARTAMENTO DE MEDICINA PROGRAMA DE PÓS-GRADUAÇÃO

Leia mais

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR Noções Básicas de Seqüenciamento Genético Maria do Carmo Debur LACEN/PR Determinar a seqüência de nucleo3deos do DNA Métodos Clássicos 1976 Allan Maxam e Walter Gilbert (EUA) Método da Degradação Química

Leia mais

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14 4/11/14 Aula 2 Sequenciamento de genomas procariotos utilizando tecnologia de nova geração Introdução ao sequenciamento de nova geração Ana Marcia de Sá Guimarães, Méd Vet, MSc, PhD Aula 2 Tópicos 1. Sequenciamento

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Novas Tecnologias de Sequenciamento

Novas Tecnologias de Sequenciamento Novas Tecnologias de Sequenciamento Tecnologias de sequenciamento Sanger (Capilaridade) Uma das inovações tecnológicas de maior influência na pesquisa biológica, desde que foi lançada em 1977 Abordagem

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

h>p://www.biology.gatech.edu/professors/labsites/goodisman Genômica Evolu/va Prof. Yuri Leite Evolução UFES

h>p://www.biology.gatech.edu/professors/labsites/goodisman Genômica Evolu/va Prof. Yuri Leite Evolução UFES h>p://www.biology.gatech.edu/professors/labsites/goodisman Genômica Evolu/va Prof. Yuri Leite Evolução UFES Genômica Genômica: estudo de genomas completos (cromossomos, organelas, plasmídeos) Seqüências

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Sistema Web para Projeto de PCR

Sistema Web para Projeto de PCR Sistema Web para Projeto de PCR Abstract. This paper describes a web system that help the work of molecular biologists, automatizating the steps necessary for preparing a PCR experiment. This system will

Leia mais

Seqüenciamento (continuação )

Seqüenciamento (continuação ) Seqüenciamento (continuação ) Embrapa Recursos Genéticos e Biotecnologia Novas metodologias promissoras (2001) Seqüenciamento por hibridização Khrapko et al. (1989). FEBS Lett. 256: 118-122 http://dx.doi.org/10.1016/0014-5793(89)81730-2

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

Bases da biologia molecular: de genes a genomas

Bases da biologia molecular: de genes a genomas Bases da biologia molecular: de genes a genomas Cesar Martins (cmartins@ibb.unesp.br) Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP Macromoléculas

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Desenvolvimento de uma Ferramenta. Cromatogramas

Desenvolvimento de uma Ferramenta. Cromatogramas Desenvolvimento de uma Ferramenta Web para análise automática tica de Cromatogramas Faculdade de Filosofia Ciências e Letras de Ribeirão Preto - USP Faculdade de Medicina de Ribeirão Preto USP Lariza Laura

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

1838: lê Ensaio sobre o princípio da população, de Thomas Malthus (1798)

1838: lê Ensaio sobre o princípio da população, de Thomas Malthus (1798) Ácidos Nucleicos MO640A - Biologia Computacional Felipe Rodrigues da Silva Embrapa Recursos Genéticos e Biotecnologia Grandes Eventos da Genética 1865 Genes são elementos particulados 1871 Descoberta dos

Leia mais

CURSO SOBRE ACESSO ÀS BIBLIOTECAS ON-LINE DA MEDLINE/PubMed

CURSO SOBRE ACESSO ÀS BIBLIOTECAS ON-LINE DA MEDLINE/PubMed TUTORIAL PARA ACESSO BIBLIOTECA ON-LINE da MEDLINE/PUBMED CURSO SOBRE ACESSO ÀS BIBLIOTECAS ON-LINE DA MEDLINE/PubMed Este tutorial faz parte do curso de extensão da UNIFESP sobre acesso on-line às publicações

Leia mais

UM NOVO TESTE PARA TUBERCULOSE

UM NOVO TESTE PARA TUBERCULOSE UM NOVO TESTE PARA TUBERCULOSE Rio de Janeiro e Manaus testam para o Ministério da Saúde uma nova tecnologia para o diagnóstico da tuberculose pulmonar Que novo teste é este? O Xpert MTB/RIF é um método

Leia mais

As enzimas de restrição

As enzimas de restrição As enzimas de restrição A Engenharia Genética é possível graças a um grupo especial de enzimas que cortam o DNA. Estas enzimas são chamadas de enzimas de restrição ou endonucleases de restrição. As enzimas

Leia mais

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal Fepagro em foco Samuel Mazzinghy Alvarenga Histórico recente da Agropecuária Era científica: a partir de ~ 1.700 Rotação de culturas e métodos de cultivo intensivo Drenagem Utilização de arado, máquinas

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

Disciplina Genética Mendeliana

Disciplina Genética Mendeliana Disciplina Genética Mendeliana Semestre 2008.1 Coordenação: Prof a Neide Santos e-mail: santos_neide@yahoo.com.br Prof a Dr a Ana Maria Benko- Iseppon Laboratório de Genética e Biotecnologia Vegetal Universidade

Leia mais

Fontes de Informação Bibliométricas para a gestão de revistas Científicas

Fontes de Informação Bibliométricas para a gestão de revistas Científicas Fontes de Informação Bibliométricas para a gestão de revistas Científicas Jose Cláudio Santos Gerente Regional para América do Sul Jose.santos@thomsonreuters.com URL: www.thomsonreuters.com Agenda: 3.

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO

GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa SUMÁRIO ENÉI MOLEULR Daniel Macedo de Melo Jorge danielmacedo.jorge@gmail.com História da enética Molecular; Organização e estrutura dos genomas; DN e RN Dogma entral Replicação ranscrição radução enes

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO

Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Universidade Federal de Pelotas Faculdade de Agronomia Eliseu Maciel Programa de Pós-Graduação em Agronomia CENTRO DE GENOMICA E FITOMELHORAMENTO Introdução à Bioinformática Professores: Luciano Maia Antonio

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais

Anotação de Genomas. Fabiana G. S. Pinto

Anotação de Genomas. Fabiana G. S. Pinto Anotação de Genomas Fabiana G. S. Pinto Obtenção de Seqüências geradas pelo MegaBace 1000 Dados brutos (medidas analógicas) de saída do seqüênciamento Base calling BIOINFORMÁTICA * PHRED: - Transforma

Leia mais

Conceitos Básicos de Técnicas em Biologia Molecular

Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 1 2 Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 3 ISSN 0103-0205 Setembro, 2008 Empresa Brasileira

Leia mais

Técnicas de análise de DNA e RNA

Técnicas de análise de DNA e RNA Técnicas de análise de DNA e RNA Fundamento e aplicação das técnicas de análise de DNA Extracção, purificação, quantificação e detecção de ácidos nucleicos Electroforese convencional em gel de agarose

Leia mais

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Genômica. O que chamou mais atenção no filme?

Genômica. O que chamou mais atenção no filme? Genômica O que chamou mais atenção no filme? Tempo para sequenciamento do genoma Predição do fenótipo com base no genótipo Como este conhecimento pode ser usado para gerar novas tecnologias? Sequenciamento

Leia mais

Roteiro. Cienciometria. Indicadores cienciométricos. Estudos cienciométricos Considerações finais. Histórico da cienciometria

Roteiro. Cienciometria. Indicadores cienciométricos. Estudos cienciométricos Considerações finais. Histórico da cienciometria João Carlos Nabout Roteiro Cienciometria Histórico da cienciometria Coletando dados para cienciometria Banco de dados Web of Science Usando o Web of Science Indicadores cienciométricos Fator de impacto,

Leia mais

NPG Site Licenses: nature.com: a melhor ciência do mundo no seu desktop

NPG Site Licenses: nature.com: a melhor ciência do mundo no seu desktop NPG Site Licenses: nature.com: a melhor ciência do mundo no seu desktop David Paredes Junho 2005 Índice: O Catálogo da NPG Nature e as suas revistas associadas: Research journals SérieNature Reviews SérieNature

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

2005 2011 O caminho da GMB para aprovação técnica no PMC passou pelo projeto GMB2NLM

2005 2011 O caminho da GMB para aprovação técnica no PMC passou pelo projeto GMB2NLM 2005 2011 O caminho da GMB para aprovação técnica no PMC passou pelo projeto GMB2NLM Klaus Hartfelder Editor Assistente da GMB editor@gmb.org.br ou klaus@fmrp.usp.br Passo 1: submissão dos dados da revista

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

Bioinformática Histórico e conceitos básicos

Bioinformática Histórico e conceitos básicos Bioinformática Histórico e conceitos básicos Raimundo Lima da S. Júnior M.Sc. Departamento de Biologia Núcleo de Pesquisas Replicon PUC-GO Silva Jr., RL Casamento entre a ciência da computação e a biologia

Leia mais

Análise Genética da Cannabis sativa

Análise Genética da Cannabis sativa Análise Genética da Cannabis sativa Rodrigo Soares de Moura-Neto Professor Associado Instituto de Biologia/UFRJ 02/09/2014 rodrigomouraneto@ufrj.br Perspectiva Histórica da Tipagem por DNA SNPs 2014 STR

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

Fabiana G. S. Pinto SEQÜENCIAMENTO. ENCIAMENTO GENÔMICO Técnicas e Aplicações

Fabiana G. S. Pinto SEQÜENCIAMENTO. ENCIAMENTO GENÔMICO Técnicas e Aplicações SEQÜENCIAMENTO ENCIAMENTO GENÔMICO Técnicas e Aplicações Ácidos Nucléicos Fabiana G. S. Pinto * 2 tipos de ácidos nucléicos: DNA -Ácido desoxirribonucléico RNA- Ácido ribonucléico * Constituição dos Nucleotideos:

Leia mais

Manual EndNote. Professores: Prof. Msc. Menandes A. de S. Neto Prof. Esp. Walter Júnior Jovêncio de Faria

Manual EndNote. Professores: Prof. Msc. Menandes A. de S. Neto Prof. Esp. Walter Júnior Jovêncio de Faria Manual EndNote Professores: Prof. Msc. Menandes A. de S. Neto Prof. Esp. Walter Júnior Jovêncio de Faria 1) Configurando o EndNote para normas ABNT 1. 1 - Abra o Microsoft Word e clique na Aba EndNote

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

SciVerse ScienceDirect. Guia do Usuário. SciVerse ScienceDirect. Acelere suas pesquisas

SciVerse ScienceDirect. Guia do Usuário. SciVerse ScienceDirect. Acelere suas pesquisas SciVerse ScienceDirect Guia do Usuário SciVerse ScienceDirect Acelere suas pesquisas Bem-vindo ao SciVerse ScienceDirect: como obter o máximo de sua assinatura O SciVerse ScienceDirect é o componente de

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction)

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) - Realiza a replicação selectiva e rápida de uma sequência específica de nucleotídeos a partir de uma mistura complexa de DNAs amplificação

Leia mais

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento

Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Empresa Brasileira de Pesquisa Agropecuária Embrapa Amazônia Oriental Ministério da Agricultura, Pecuária e Abastecimento Embrapa Amazônia Oriental Belém, PA 2015 DIVERGÊNCIA GENÉTICA ENTRE MATRIZES DE

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

ESTRUTURA DO DNA E ORGANIZAÇAO DA ATIVIDADE BIOLÓGICA

ESTRUTURA DO DNA E ORGANIZAÇAO DA ATIVIDADE BIOLÓGICA ESTRUTURA DO DNA E ORGANIZAÇAO DA CROMATINA ATIVIDADE BIOLÓGICA 1 Qual é a natureza química da molécula responsável por estocar a informação genética??? CARACTERÍSTICAS 1. Estocar a informação e transmitir

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

RELATÓRIO TÉCNICO - CIENTÍFICO

RELATÓRIO TÉCNICO - CIENTÍFICO UNIVERSIDADE FEDERAL DO PARÁ PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO DIRETORIA DE PESQUISA PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA PIBIC : CNPq, CNPq/AF, UFPA, UFPA/AF, PIBIC/INTERIOR,

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais