BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "BIOQUÍMICA GERAL. Prof. Dr. Franciscleudo B. Costa UATA/CCTA/UFCG. Aula 7 Ácidos Nucleicos. Definição NUCLEOTÍDEO (RNA)"

Transcrição

1 Universidade Federal de Campina Grande Centro de Ciências e Tecnologia Agroalimentar Unidade Acadêmica de Tecnologia de Alimentos BIOQUÍMICA GERAL Definição Importância e aplicações Estrutura Geral Função dos Nucleotídeos Estrutura Tridimensional do DNA Código Genético Aula 7 Ácidos Nucleicos Campus Pombal Pombal - PB Definição Ácidos nucleicos (DNA e RNA) uma molécula constituída por uma cadeia de nucleotídeos unidos por ligação fosfodiéster. São encontrados em todas as células, atribuindo-se aos mesmos as importantes funções de armazenar, transmitir e traduzir as informações genéticas de um determinado organismo. Classificação e Constituição: Existem 2 tipos básicos: O ácido desoxirribonucléico (DNA ou ADN); O ácido ribonucléico (RNA ou ARN); Os ácidos são moléculas gigantes, constituídas por Nucleotídeos. Nucleotídeo de DNA Nucleotídeo de RNA NUCLEOTÍDEO (RNA) OBS.: A molécula sem o grupo fosfato é chamada nucleosídeo. 1

2 OBS: No Nucleosídeo só existe base nitrogenada e pentose. As bases nitrogenadas podem dividir-se em: Púricas Adenina (A) e guanina (G); Pirimídicas Citosina, Timina (T) e Uracila (U). Uracila COMPONENTES DOS NUCLEOTÍDEOS: BASE NITROGENADA Timina Ribose PENTOSE FOSFATO Citosina 2 desoxirribose No DNA a pentose é sempre a desoxirribose e as bases encontradas são: Adenina, Guanina, Citosina e Timina. No RNA a pentose é sempre a ribose e as bases encontradas são: Adenina, Guanina, Citosina e Uracila. Adenina Guanina Ácido fosfórico As pentoses As Pentoses: A adição de uma pentose a uma base nitrogenada produz um nucleosídeo. Os nucleosídeos de A, C, G, T e U são denominados, respectivamente, Adenosina, Citosina, Guanosina, Timidina e Uridina. Se o açúcar em questão é a RIBOSE, temos um ribonucleosídeo, característico do RNA Se o açúcar é a desoxirribose - 1 hidroxila a menos em C2 - temos um desoxirribonucleosídeo, característico do DNA. A ligação com a base nitrogenada ocorre sempre através da hidroxila do carbono anomérico da pentose. Bases Nitrogenadas: Compostos heterocíclicos de carbono e nitrogênio: Pirimidinas (bases pirimídicas): anel heterocíclico único: citosina (C) e timina (T) no DNA; citosina (C) e uracila (U) no RNA. Purinas (bases púricas): dois anéis heterocíclicos: guanina (G) e adenina (A): presentes tanto no DNA quanto no RNA. O Fosfato: A adição de um ou mais radicais fosfato à pentose, através de ligação tipo éster com a hidroxila do carbono 5 da mesma, dá origem aos Nucleotídeos. Os grupos fosfato são responsáveis pelas cargas negativas dos nucleotídeos e dos ácidos nucléicos. A adição do segundo ou terceiro grupo fosfato ocorre em seqüência, dando origem aos nucleotídeos di e trifosfatados. 2

3 Ligação Glicosídica: Ligação covalente estabelecida entre o carbono 1 da pentose e o N1 das pirimidinas ou o N9 das purinas. Pentose + base nitrogenada = nucleosídeo. Figura representativa de nucleosídeos de DNA DESOXIRRIBONUCLEOTÍDEOS (DNA) RIBONUCLEOTÍDEOS (RNA) Funções dos NUCLEOTÍDEOS: Os nucleotídeos trifosfato (NTP) possuem funções importantes. O ATP é o transportador de grupos fosfato e pirofosfato em reações enzimáticas envolvidas na transferência de energia química; Os NTP e NDP são transportadores energizados, semelhantes a coenzimas, de tipos específicos de moléculas. Assim, o UDP é um transportador específico de uridina-difosfato-glicose na biossíntese enzimática do glicogênio. Os NTP servem como precursores ricos em energia de unidades mononucleotídicas (ribonucleotídeo e desoxirribonucleotídeo) durante a síntese enzimática do RNA e DNA. 3

4 DNA (FITA SIMPLES) RNA LIGAÇÃO FOSFODIESTER ataque nucleofílico do 3 OH da cadeia crescente no fosfato do carbono 5 do ribonucleosídeo trifosfato NOTAÇÃO PARA ESTRUTURA DE UMA FITA SIMPLES DE ÁCIDO NUCLÉICO ESTRUTURA MOLECULAR DO DNA DNA DUPLA HÉLICE OU DNA DE WATSON E CRICK 1950 FRANKLIN E WILKINS DIFRAÇÃO DE RAIOS X NA ANÁLISE DE FIBRAS DE DNA Padrão de raios X indica que o DNA tem estrutura helicoidal 4

5 Ácido Desoxirribonucléico (DNA): A molécula de DNA é constituída por dois filamentos enrolados, um ao redor do outro, na forma de dupla-hélice. Os filamentos estão unidos por Pontes de Hidrogênio. As bases púricas sempre se ligam as bases pirimídicas: Exemplo: Adenina Timina (A T) 2 pontes de hidrogênio Guanina Citosina (G C) 3 pontes de hidrogênio DNA Presente no núcleo das células eucarióticas, mitocôndrias e cloroplastos; Presentes no citoplasma das células procarióticas; Nas células germinativas e no ovo fertilizado: dirige todo o desenvolvimento do organismo, a partir da informação contida em sua estrutura; É duplicado cada vez que a célula somática se divide DNA Molécula Duas cadeias (fitas) helicoidais polinucleotídicas, enroladas ao longo de um mesmo eixo, formando uma dupla hélice de sentido rotacional à direita: dextrógera: Na dupla hélice as duas fitas de DNA são complementares (A = T e G = C) e apresentam polaridades opostas: antiparalelas: polaridade 5 3 em uma fita e 3 5 na outra. Grupo fosfato e desoxirribose (parte hidrofílica): parte externa da molécula. Bases nitrogenadas (parte hidrofóbica): dentro da dupla. 5

6 COMPLEMENTAÇÃO DE BASES DO DNA ADENINA GUANINA Importância do DNA Molécula da vida contém código para construção das proteínas em todos os seres vivos; Se liga a Timina por duas pontes de hidrogênio. Se liga a citosina por três pontes de hidrogênio. Eucariontes animal: encontrado núcleo celular formando cromossomos e mitocôndrias; Gene - segmento de DNA que contém informações para síntese de uma ou mais proteínas. TIMINA CITOSINA A = T G C GENE (DNA) transcrição tradução RNA PROTEÍNA O Dogma Central da Biologia Molecular: O Código Genético Tríplice: As quatro letras do alfabeto da vida: A, G, C, T, são agrupadas de 3 a 3, formando uma trinca que codifica a posição de um determinado tipo de aminoácido. Cada trinca recebe o nome de Códon (tanto no DNA como no RNA). A cada trinca formamos um aminoácido. Dogma Central da Biologia Molecular Foi estabelecido em 1956 por Francis Crick. Postulava que o sentido da construção das moléculas é sempre de DNA à Proteína fluxo unidirecional da informação. O DNA é o molde para formar DNA (replicação) e RNA (transcrição). Este por sua vez é o molde para formação das proteínas (tradução). Hoje se sabe que, em alguns vírus, o RNA pode replicar-se e, em outros, o RNA pode produzir DNA (transcrição reversa) utilizando o maquinário genético da célula-hospedeira. Porém, não é possível se sintetizar ácidos nucléicos a partir de proteínas. Os novos conhecimentos permitiram que se ampliasse o dogma central sem perder a unidirecionalidade, ou seja, de ácido nucléico à proteína. 6

7 Replicação do DNA Capaz auto-duplicar e conservar informação genética; Final duas moléculas-filhas que conservam a metade da moléculamãe ; Necessidade de fita molde; Ocorre na fase S da interfase; DNA polimerase: adição de nucleotídeos no sentido 5.3 : necessidade de extremidade 3 -OH livre para que ocorra a ligação fosfodiéster. Necessidade de um iniciador ou primer : oligonucleotídeo de RNA, complementar ao DNA fita-molde. Duplicação semiconservativa; Replicação do DNA Replicação do DNA Revisão de leitura e correção: DNA polimerase : correção de leitura no sentido contrário ao de polimerização Após adição de um nucleotídeo, a DNA polimerase se dissocia ou se move ao longo do molde para adicionar um outro nucleotídeo; DNA ligase: no final da síntese, a polimerase remove os iniciadores e os substitui por nucleotídeos de DNA Æ cortes selados pela DNA ligase. Sistema de reparo: pareamentos errados são instáveis e provocam dobras na molécula (alteração espacial): percebidos e corrigidos. TRANSCRIÇÃO RNA: o controle da síntese de proteínas O RNAm é uma molécula relativamente pequena que pode sair ao citoplasma e participar da síntese de proteínas; A informação para a síntese de proteínas é mantida porque o molde pertence ao DNA; Interpreta e executa a informação do DNA. É formada por um único filamento de polinucleotídeos. Pentose é sempre a ribose. Bases nitrogenadas: adenina, guanina, citosina e uracila. É fabricado no núcleo e migra para o citoplasma. 7

8 Tipos de RNA mrna formado no núcleo contém mensagem - código transcrito a partir do DNA - para síntese proteínas. Conjunto de 3 nucleotídeos chamado CÓDON; trna presente no citoplasma transporta AA até ribossomos para síntese protéica; rrna faz parte da estrutura dos ribossomos participa do processo de tradução dos códons para construção das proteínas. Estruturas fundamentais que intervêm na tradução RNA de transferência e ribossomas trna é responsável pela formação de um complexo activado com cada aminoácido e pelo seu transporte até ao tripleto que lhe corresponde na cadeia de Mrna Ribossomas estruturas celulares que servem de posto de transferência ; têm 60 a 65% de rrna (RNA ribosómico) e 35% a 40% de proteína Onde deve começar a tradução Emparelhamento correto entre codons e anticodons Formação da ligações peptídicas Etapas da síntese protéica Transcrição Síntese do RNA-m pelo DNA Tradução Organização dos aminoácidos soltos no citoplasma pelo RNA de modo a formar uma proteína característica. DNA (ácido desoxirribonucléico) localizado no núcleo e mitocôndrias DNA e RNA RNA (ácido ribonucléico) localizado no núcleo e citoplasma Do RNA à proteína Na tradução, as bases no RNA passam para uma sequência de AAs. Cada grupo de 3 bases consecutivas códon, corresponde a um aminoácido. dupla hélice com duas fitas formado com pentose desoxirribose e fosfato bases nitrogenadas: A, T, C e G uma fita formado com pentose ribose e fosfato bases nitrogenadas: A, U, C e G Desse modo, são formados os aminoácidos. Os códons UAG, UAA e UGA são códons finalizadores. O aminoácido metionina é o sinalizador do início do aminoácido. 8

9 Código Genético Do RNA à proteína Os códons só realizam o trabalho de identificação dos aminoácidos com o auxílio do RNA-t, que é capaz de se ligar a unidades de aminoácidos dissolvidos no citoplasma e transportálos até o RNA-m. Cada RNA-t tem um anticódon específico. O anticódon CGA vai se ligar exclusivamente ao códon do aminoácido alanina. Este processo é feito nos ribossomos. À medida que os ribossomos deslizam pelo RNA-m, os aminoácidos se unem, formando uma proteína. RNA-r Os mecanismos da tradução são controlados por enzimas e pelo RNA-r, também uma enzima. O RNA-r da subunidade ribossomal maior catalisa a formação das ligações peptídicas e o RNA da subunidade menor reconhece os pontos do RNA-m pelos quais a síntese deve começar ou terminar. 9

10 Pensando... Qual proteína irá formar o DNA: ACGGAACTA? R: RNA-m: UGCCUUGAU Anticódon do RNA-t: ACGGAACUA Proteína: Cys-Leu-Val 10

Duplicação do DNA e Síntese de PROTEÍNAS

Duplicação do DNA e Síntese de PROTEÍNAS Duplicação do DNA e Síntese de PROTEÍNAS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose (ribose RNA e desoxirribose DNA) e uma base nitrogenada

Leia mais

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena

DNA: Replicação e Transcrição. Professora: MSc Monyke Lucena EXTRA, EXTRA Se a mãe for (DD) e o pai (D), nenhum dos descendentes será daltónico nem portador. Se a mãe (DD) e o pai for (d), nenhum dos descendentes será daltônico, porém as filhas serão portadoras

Leia mais

Figura 1. Exemplo da estrutura de um nucleotídeo

Figura 1. Exemplo da estrutura de um nucleotídeo 2 - ÁCIDOS NUCLÉICOS Na natureza há dois tipos de ácidos nucléicos: DNA ou ácido desoxirribonucléico e RNA ou ácido ribonucléico. Analogamente a um sistema de comunicação, essas informações são mantidas

Leia mais

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet

Duplicação do DNA e Síntese de PROTEÍNAS. Telmo Giani Fonte: Internet Duplicação do DNA e Síntese de PROTEÍNAS Telmo Giani Fonte: Internet OS ÁCIDOS NUCLEICOS DNA Ácido fosfórico Desoxirribose Bases Púricas: A e G Bases Pirimídicas: C e T Dupla fita RNA Ácido fosfórico Ribose

Leia mais

Duplicação do DNA & Síntese de proteínas

Duplicação do DNA & Síntese de proteínas Duplicação do DNA & Síntese de proteínas Aula de Biologia Tema: Duplicação do DNA & Síntese Protéica Daniel Biólogo Planetabiologia.com ÁCIDOS NUCLÉICOS 1) Conceito: Os Ácidos Nucléicos são macromoléculas,

Leia mais

MÓDULO 3 BIOLOGIA MOLECULAR

MÓDULO 3 BIOLOGIA MOLECULAR MÓDULO 3 BIOLOGIA MOLECULAR Aula 1 - Estrutura e Propriedades dos Ácidos Nucleicos Evidências de que o DNA constitui o material genético Experimento de Frederick Griffith (1928) Pneumococcus pneumoniae

Leia mais

REVISÃO: Terceira Unidade Nutrição

REVISÃO: Terceira Unidade Nutrição REVISÃO: Terceira Unidade Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto JUL/2011 HISTÓRICO 1957 CRICK e GAMOV Dogma Central da Biologia Molecular A Célula DIFERENCIAÇÃO Núcleo: DNA CRESCIMENTO

Leia mais

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto

Organização estrutural e funcional do núcleo. Professor Otaviano Ottoni Netto Organização estrutural e funcional do núcleo Professor Otaviano Ottoni Netto Núcleo Celular Estrutura do Núcleo Alberts et al., 1994 - págs 335 e 345 _Tráfego de proteínas entre núcleo e citoplasma_

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos

Nucleotídeos e Ácidos Nucleicos. Maiara Paparele dos Santos Nucleotídeos e Ácidos Nucleicos Maiara Paparele dos Santos Conceito Ácidos nucleicos sequência de nucleotídeos o moedas energéticas; o Componentes de cofatores enzimáticos o DNA (ácido desoxirribonucleico)

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem.

genética molecular genética clássica DNA RNA polipeptídio GENÉTICA Exercícios 1. Julgue os itens que se seguem. GENÉTICA clássica molecular DNA RNA polipeptídio Exercícios 1. Julgue os itens que se seguem. 01. As cadeias de RNA mensageiros são formadas por enzimas que complementam a sequência de bases de um segmento

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Aula 2 - Revisão DNA RNA - PROTEÍNAS

Aula 2 - Revisão DNA RNA - PROTEÍNAS Aula 2 - Revisão DNA RNA - PROTEÍNAS Estudo Dirigido Aula 2 - Revisão 1. Características comuns a todos os organismos vivos; 2. Domínios da Vida e tipos celulares, principais diferenças dos tipos celulares;

Leia mais

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ).

03/02/2010. Estrutura de Ácidos. Nucléicos e. Organização do. Genoma Humano. DNA por Watson & Crick, (Nature 171: ). DNA por Watson & Crick, 1953 Estrutura de Ácidos Nucléicos e Organização do Genoma Humano (Nature 171: 737-738). Modelo de estrutura tridimensional do DNA, baseado principalmente nos estudos de difração

Leia mais

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book.

Livro Interactivo 3D Permite Fazer Anotações e Imprimir. Dúvidas Mais Comuns BIO 11. Flipping Book. Livro Interactivo 3D Permite Fazer Anotações e Imprimir Dúvidas Mais Comuns BIO 11 Flipping Book http://netxplica.com DÚVIDAS MAIS COMUNS :: BIOLOGIA E GEOLOGIA 11 http://netxplica.com 1. Crescimento e

Leia mais

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7

Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Universidade Estadual do Rio Grande do Sul Bacharelado em Gestão Ambiental Biologia Aplicada Aula 7 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4. Assunto: (i) Síntese

Leia mais

Ácidos Nucleicos e suas propriedades

Ácidos Nucleicos e suas propriedades UNIVERSIDADE FEDERAL DO PARANÁ SETOR DE CIÊNCIAS AGRÁRIAS DEPARTAMENTO DE FITOTECNIA E FITOSSANITARISMO AF 060- Biotecnologia Vegetal Ácidos Nucleicos e suas propriedades Prof a. Renata FaierCalegario

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS

ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS ESTRUTURAS E FUNÇÕES BIOLÓGICAS DOS NUCLEOTÍDEOS: OS ÁCIDOS NUCLÉICOS META Introduzir o estudo das funções biológicas, propriedades químicas e estruturas dos nucleotídeos. OBJETIVOS Ao final desta aula,

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica

A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica BG 11 EPM 14/15 A síntese proteica envolve várias fases, que culminam na síntese de proteínas nos ribossomas, tendo como base a informação genética do DNA. Classifica como Verdadeira (V) ou Falsa (F) cada

Leia mais

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS

COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS COMPOSIÇÃO QUÍMICA DOS ÁCIDOS NUCLEICOS Unidade básica dos Ácidos Nucleicos Existem apenas 4 bases em cada um dos ácidos nucleicos DNA DNA e RNA RNA Ácido fosfórico Ácido fosfórico Pentose Desoxirribose

Leia mais

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Tradução. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Tradução Biologia Molecular Prof. Silmar Primieri Relação DNA RNA Proteína Estrutura das proteínas Gene - Proteína Hipótese Gene - Proteina Os genes são responsáveis pelo funcionamento

Leia mais

Síntese de RNA e Proteínas

Síntese de RNA e Proteínas Síntese de RNA e Proteínas BCM I T.04 Transcrição e tradução são os meios da célula expressar as instruções génicas o fluxo de informação genética é do DNA para o RNA para as Proteínas Os genes podem ser

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

GENÉTICA: DE MENDEL AO DNA

GENÉTICA: DE MENDEL AO DNA GENÉTICA: DE MENDEL AO DNA Como os genes influenciam as características? O que faz com que um alelo seja dominante ou recessivo? Por que alguns genes provocam doenças? PROBLEMATIZAÇÃO Quais são os ácidos

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Dra. Maria Izabel Gallão. Síntese de proteínas

Dra. Maria Izabel Gallão. Síntese de proteínas Síntese de proteínas DNA RNAm proteína - citoplasma 20 aa formar uma pt RNAt específico subunidades do ribossomos precarregada com fatores protéicos auxiliares. a síntese protéica começa quando todos estes

Leia mais

Água. A água é uma estrutura dipolar formada por dois átomos de hidrogênio ligados a um átomo de oxigênio.

Água. A água é uma estrutura dipolar formada por dois átomos de hidrogênio ligados a um átomo de oxigênio. Química da Vida Água A água compõe a maior parte da massa corporal do ser humano e de todos os seres vivos, logo na composição química celular prevalece à presença de água. Sendo 70% do peso da célula

Leia mais

BASES MOLECULARES DA HERANÇA

BASES MOLECULARES DA HERANÇA BASES MOLECULARES DA HERANÇA INDÚSTRIA DE INFORMAÇÃO A Fábrica A Célula O Manual de Instruções DNA O Dogma Central DNA-RNA-Proteínas Os Operários Proteínas Erros de Programação Doenças MOLÉCULAS NAS CÉLULAS

Leia mais

ÁCIDOS NUCLÉICOS Alfredinho Alves

ÁCIDOS NUCLÉICOS Alfredinho Alves ÁCIDOS NUCLÉICOS Alfredinho Alves 1 1. Histórico Frederish Miescher, médico alemão, aos 20 anos de idade, observou a presença do DNA em células do pus, embora não pudesse detalhar a estrutura molecular

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera

Lista de Exercícios. Aluno(a): Nº. Professor: Mário Neto 3 Ano Disciplina: Ciências da Natureza - Biologia. Pré Universitário Uni-Anhanguera Lista de Exercícios Aluno(a): Nº. Professor: Mário Neto Série: 3 Ano Disciplina: Ciências da Natureza - Biologia Pré Universitário Uni-Anhanguera 1 1) (UFES-ES) O modelo abaixo representa a configuração

Leia mais

Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS. Paulo Dutra

Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS. Paulo Dutra Ácidos Nucléicos Duplicação do DNA e Síntese de PROTEÍNAS Paulo Dutra ÁCIDOS NUCLEICOS Nucleotídeos É a unidade formadora dos ácidos nucléicos: DNA e RNA. É composto por um radical fosfato, uma pentose

Leia mais

Princípios de Sistemática Molecular

Princípios de Sistemática Molecular ! Ciências teóricas e sistemática biológica "! DNA, genes, código genético e mutação! Alinhamento de seqüências! Mudanças evolutivas em seqüências de nucleotídeos! Otimização em espaços contínuos e discretos!

Leia mais

Descoberta da Estrutura do DNA

Descoberta da Estrutura do DNA DNA Estrutura Descoberta da Estrutura do DNA James Watson (geneticista americano) Francis Crick (físico inglês) Esclareceram a estrutura do DNA em 1953 O que se sabia sobre os genes Fatores hereditários

Leia mais

Prof. João Carlos Setubal

Prof. João Carlos Setubal Prof. João Carlos Setubal QBQ 102 Aula 3 (biomol) Transcrição e tradução Replicação Dogma Central da Biologia Molecular Transcrição RNA mensageiro Usa Uracila ao invés de Timina Tradução de mrnas Ocorre

Leia mais

Interbits SuperPro Web

Interbits SuperPro Web 1. (em 2004) Sobre a atividade e a expressão dos genes, assinale o que for correto. 01) Durante a transcrição de um gene normal e funcional, as fitas opostas servem de molde para a síntese de RN mensageiros

Leia mais

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI

COLÉGIO PEDRO II CAMPUS TIJUCA II. DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE / ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED & PEDRO

Leia mais

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri

IFSC Campus Lages. Transcrição. Biologia Molecular Prof. Silmar Primieri IFSC Campus Lages Transcrição Biologia Molecular Prof. Silmar Primieri RNA - estrutura Semelhante ao DNA, com ribose como glicídio e uracila como base nitrogenada, no lugar da timina do DNA. RNA é unifilamentar

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Composição química celular

Composição química celular Natália Paludetto Composição química celular Proteínas Enzimas Ácidos nucléicos Proteínas Substâncias sólidas; Componente orgânico mais abundante da célula. Podem fornecer energia quando oxidadas, mas

Leia mais

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade.

1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. 1. (Acafe 2016) Cientistas identificam nova mutação genética relacionada à obesidade. Um estudo realizado por pesquisadores do departamento de medicina da Imperial College London, na Inglaterra, revelou

Leia mais

A função da água e sais minerais dentro da célula

A função da água e sais minerais dentro da célula A QUÍMICA DA VIDA A função da água e sais minerais dentro da célula Eles tem a ver com o metabolismo das mitocôndrias na qual a principal função seria de não parar a que sustenta, vejamos isso entre água

Leia mais

Seminário Bioquímica II

Seminário Bioquímica II Seminário Bioquímica II RNA transportador estrutura e função Professor: Júlio Borges Grupo: Ana Paula Faria: 8624640 Rafael Godoy: 6784142 Vitória Grando: 8523471 Sumário Introdução Estrutura primária

Leia mais

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M.

Transcrição em Eucariotos. Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Transcrição em Eucariotos Prof. Doutor Júlio César Borges Disciplina: Bioquímica II Lenita P. Altoé Paula B. Perroni Rhaissa M. Bontempi _sumário _sumário Transcrição Dogma central Considerações iniciais

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas

Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas FICHA (IN)FORMATIVA Nº 1 Biologia e Geologia Módulo 4 Modelo da dupla hélice, replicação do DNA e síntese de proteínas Ácidos nucleicos Os ácidos nucleicos armazenam e transmitem a informação hereditária.

Leia mais

CONTROLE DO METABOLISMO GENES

CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Nucleotídeos e Ácidos Nucléicos

Nucleotídeos e Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO Escola de Engenharia de Lorena EEL Programa de Aperfeiçoamento de Ensino - PAE Nucleotídeos e Ácidos Nucléicos Angela da Silva Machado Súmula da aula... Estrutura e função dos

Leia mais

GOIÂNIA, / / PROFESSOR: Fred. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

GOIÂNIA, / / PROFESSOR: Fred. Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2016 PROFESSOR: Fred DISCIPLINA: Biologia SÉRIE: 1º ALUNO(a): No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: - É fundamental

Leia mais

PROF: L. CLAUDIO BIOLOGIA

PROF: L. CLAUDIO BIOLOGIA NOME: 1ºANO- EXERCICIOS DE RECUPERAÇÃO PROF: L. CLAUDIO BIOLOGIA 1. (G2) Quais são as duas propriedades fundamentais do DNA que permitem a essa substância desempenhar o papel de material genético? 2. (G2)

Leia mais

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA

BIOVESTIBA.NET BIOLOGIA VIRTUAL Profº Fernando Teixeira UFRGS BIOQUÍMICA BIOVESTIBA.NET VIRTUAL UFRGS BIOQUÍMICA 1. (Ufrgs 2015) Observe a tira abaixo. Se o filho do Radicci tornar-se vegetariano do tipo que não utiliza produtos derivados de animais, ficará impossibilitado

Leia mais

Enunciado de Prova Escrita de Avaliação Sumativa

Enunciado de Prova Escrita de Avaliação Sumativa Enunciado de Prova Escrita de Avaliação Sumativa Ano Lectivo: 2007/200 Disciplina: Biologia e Geologia (ano 2) Ano: 11º Turma: CT Curso: C.H. - C.T. Duração: 0 min. Data: 31 / /2007 Docente: Catarina Reis

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Dos genes às proteínas

Dos genes às proteínas Dos genes às proteínas - Estrutura e função Bioinformática aula 1 INTRODUÇÃO O Dogma Central O fluxo de informação nos organismos segue uma direção única: do DNA para o RNA, e do RNA para a proteína DNA

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br

Dra. Kátia R. P. de Araújo Sgrillo. Sgrillo.ita@ftc.br Dra. Kátia R. P. de Araújo Sgrillo Sgrillo.ita@ftc.br São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR

DEFINIÇÕES EM EPIDEMIOLOGIA MOLECULAR E CONCEITOS BÁSICOS EM BIOLOGIA MOLECULAR DEFINIÇÕES EM E DEFINIÇÕES EM E CONCEITOS BÁSICOS EM BIOLOGIA PARA QUE SERVE ESTA AULA 1. DEFINIÇÕES EM CONCEITUAÇÃO DE DIFERENCIAÇÃO ENTRE, TAXONOMIA E FILOGENIA 2. CONCEITOS EM BIOLOGIA APRESENTAR (REVER)

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

CÓDIGO GENÉTICO E SÍNTESE PROTEICA

CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética

ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA. Aula teórica 4. Maria Carolina Quecine Departamento de Genética ESTRUTURA DOS ÁCIDOS NUCLEICOS E REPLICAÇÃO DO DNA Aula teórica 4 LGN0114 Biologia Celular Maria Carolina Quecine Departamento de Genética mquecine@usp.br FUNÇÃO DO MATERIAL GENÉTICO 1. Função genotípica:

Leia mais

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA

Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: COLÉGIO DIOCESANO SERIDOENSE CURSINHO PRÉ-ENEM PROFESSORA: MSc MONYKE LUCENA Noções de Genética: Genética: É o estudo da hereditariedade. Hereditariedade: fenômeno que explica as semelhanças

Leia mais

A Química da Vida. Gabriela Eckel

A Química da Vida. Gabriela Eckel A Química da Vida Gabriela Eckel Água A água é um composto químico formado por dois átomos de hidrogênio e um de oxigênio. Sua fórmula química é H2O. Porém, um conjunto de outras substâncias como, por

Leia mais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais

Substâncias. Orgânicas. Inorgânicas. - Formadas por átomos de carbono e hidrogênio. - Água e sais minerais Substâncias Orgânicas - Formadas por átomos de carbono e hidrogênio Inorgânicas - Água e sais minerais - Carboidratos, lipídios, proteínas, ácidos nucleicos e vitaminas QUÍMICA CELULAR Água Funções: Solvente

Leia mais

1. CITOQUÍMICA QUESTÕES DE 01-10

1. CITOQUÍMICA QUESTÕES DE 01-10 1. CITOQUÍMICA QUESTÕES DE 01-10 QUESTÃO - 01 01- Proteínas são moléculas essenciais à vida, atuando como enzimas, hormônios, anticorpos, antibióticos e agentes anti-tumorais, além de estar presentes nos

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

DNA e Cromossomos. Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição

DNA e Cromossomos. Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição DNA e Cromossomos Capitulo 5 - Fundamentos da Biologia Celular- Alberts- 2ª edição Ácidos nucléicos Formado por nucleotídeos: uma base nitrogenada ligada a uma ribose ou desoxirribose e um ou mais grupos

Leia mais

Núcleo celular: O centro de comando. Unidade 4 Pág 34

Núcleo celular: O centro de comando. Unidade 4 Pág 34 Núcleo celular: O centro de comando. Unidade 4 Pág 34 NÚCLEO O núcleo é o centro de coordenação das atividades da célula. Em geral há um núcleo por célula; células sem núcleo são apenas uma fase da vida;

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Química da Vida. Prof. João Ronaldo Tavares de Vasconcellos Neto

Química da Vida. Prof. João Ronaldo Tavares de Vasconcellos Neto Química da Vida Prof. João Ronaldo Tavares de Vasconcellos Neto Propriedades Atômicas Elementos e Compostos químicos; Alguns símbolos são derivados do latim Por Exemplo: o símbolo do sódio é Na, da palavra

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula.

Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula. Aula 01 Composição química de uma célula O que é uma célula? Vamos iniciar o estudo da unidade fundamental que constitui todos os organismos vivos: a célula. Toda célula possui a capacidade de crescer,

Leia mais

ADN. Ana Martins STC-7 Saberes fundamentais

ADN. Ana Martins STC-7 Saberes fundamentais 2010 ADN Ana Martins STC-7 Saberes fundamentais 20-07-2010 Em 1869, o Médico Suíço Friedrich Miescher retirou de uma ligadura alguns glóbulos brancos e fez uma grande descoberta. Descobriu que o núcleo

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DO ESTADO DE SANTA CATARINA CENTRO DE CIÊNCIAS TECNOLÓGICAS DEPARTAMENTO DE QUÍMICA DQMC BIOQUÍMICA BIO0001 Estrutura e Função de Ácidos Nucléicos Prof Karine P. Naidek Novembro/2016 Os Ácidos

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

Aula 5: O código genético

Aula 5: O código genético Aula 5: O código genético O dogma central da biologia: Decifrando códigos:.............................................. A professora é legal ACUCAUGAAACCGAGGCUUGUCACGAACGUAUUAGCGGAAGAGAAGCAACG Thr-His-Glu-Thr-Glu-Ala-Cys-His-Glu-Arg-Ile-Ser-Gly-Arg-Glu-Ala-Thr

Leia mais

ESCOLA ESTADUAL DR JOSÉ MARQUES DE OLIVEIRA AVALIAÇÃO ESTUDOS INDEPENDENTES DE RECUPERAÇÃO RESOLUÇÃO SEE Nº 2.197, DE 26 DE OUTUBRO DE 2012

ESCOLA ESTADUAL DR JOSÉ MARQUES DE OLIVEIRA AVALIAÇÃO ESTUDOS INDEPENDENTES DE RECUPERAÇÃO RESOLUÇÃO SEE Nº 2.197, DE 26 DE OUTUBRO DE 2012 ESCOLA ESTADUAL DR JOSÉ MARQUES DE OLIVEIRA AVALIAÇÃO ESTUDOS INDEPENDENTES DE RECUPERAÇÃO RESOLUÇÃO SEE Nº 2.197, DE 26 DE OUTUBRO DE 2012 Aluno: Ano:2016 Série: 1ºAno Data : Matéria: Biologia Turno:

Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao:

Tradução. 3 tipos de RNA estao envolvidos no processo da traducao: Tradução Tradução: refere-se a todo o processo pelo qual a sequência de bases de um mrna é usada como molde para unir aminoácidos para a formação de uma proteína. O DNA guarda as informações para a síntese

Leia mais

Professora Leonilda Brandão da Silva

Professora Leonilda Brandão da Silva COLÉGIO ESTADUAL HELENA KOLODY E.M.P. TERRA BOA - PARANÁ Professora Leonilda Brandão da Silva E-mail: leonildabrandaosilva@gmail.com http://professoraleonilda.wordpress.com/ ACIDOS NUCLEICOS Capítulo 13

Leia mais

ÁCIDOS NUCLEICOS, NUCLÉOLO E SÍNTESE PROTEICA

ÁCIDOS NUCLEICOS, NUCLÉOLO E SÍNTESE PROTEICA ÁCIDOS NUCLEICOS, NUCLÉOLO E SÍNTESE PROTEICA Aula 6 VERA LÚCIA CORRÊA FEITOSA META Apresentar os conceitos e funções dos Ácidos nucleicos e Nucléolo, além de fundamentar a Síntese Proteica. OBJETIVOS

Leia mais

Geralmente é arredondado e único por célula, mas existem núcleos com outras formas e células com mais de um núcleo

Geralmente é arredondado e único por célula, mas existem núcleos com outras formas e células com mais de um núcleo Núcleo Celular Geralmente é arredondado e único por célula, mas existem núcleos com outras formas e células com mais de um núcleo Núcleo Celular Algumas células não têm núcleo (são anucleadas), como as

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Prof. Juliana -

Prof. Juliana - Mitose e Meiose CICLO CELULAR Célula encaminhada à progressão no ciclo por mecanismos de regulação relacionados a crescimento multiplicação diferenciação celular condição de latência. Falhas nos mecanismos

Leia mais

Célula animal Célula vegetal

Célula animal Célula vegetal PROF. TOSCANO Célula animal Célula vegetal O que há de comum nas células? No inicio do século XIX, a Química Inorgânica (que estuda as substâncias que compõem objetos não-vivos), já analisava diversas

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

A Molécula da Vida. A HISTORIA DA GENETICA... 2 Modelo de dupla hélice... 6

A Molécula da Vida. A HISTORIA DA GENETICA... 2 Modelo de dupla hélice... 6 CONTEÚDO A HISTORIA DA GENETICA... 2 Modelo de dupla hélice... 6 A descoberta de Chargaff... 6 Análises por difração de raios X... 8 A descoberta de Watson e Crick... 9 Evidencias da replicação semiconservativa...

Leia mais

ÁGUA A queda do teor de água, nas células e no organismo, abaixo de certo limite, gera uma situação de desequilíbrio hidrossalino, com repercussões

ÁGUA A queda do teor de água, nas células e no organismo, abaixo de certo limite, gera uma situação de desequilíbrio hidrossalino, com repercussões A Química da vida ÁGUA A queda do teor de água, nas células e no organismo, abaixo de certo limite, gera uma situação de desequilíbrio hidrossalino, com repercussões nos mecanismos osmóticos e na estabilidade

Leia mais

Bioquímica Celular. LIVRO CITOLOGIA Capítulo 02 Itens 1 a 3 págs. 19 a 30. 3ª Série Profª Priscila F Binatto Fev/2013

Bioquímica Celular. LIVRO CITOLOGIA Capítulo 02 Itens 1 a 3 págs. 19 a 30. 3ª Série Profª Priscila F Binatto Fev/2013 Bioquímica Celular LIVRO CITOLOGIA Capítulo 02 Itens 1 a 3 págs. 19 a 30 3ª Série Profª Priscila F Binatto Fev/2013 Constituintes Bioquímicos da Célula Água e Minerais Carboidratos Lipídios Proteínas Ácidos

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais