BacBio. Crescimento, Renovação Celular e Reprodução: da teoria à prática. Coimbra, 2012/2013. Sandra Gamboa Andreia Quaresma Fernando Delgado

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "BacBio. Crescimento, Renovação Celular e Reprodução: da teoria à prática. Coimbra, 2012/2013. Sandra Gamboa Andreia Quaresma Fernando Delgado"

Transcrição

1 BacBio Crescimento, Renovação Celular e Reprodução: da teoria à prática Coimbra, 2012/2013 Sandra Gamboa Andreia Quaresma Fernando Delgado Escolher Ciência PEC282 ESCOLA SUPERIOR AGRÁRIA DE COIMBRA

2 BacBio Introdução Nesta actividade laboratorial realizar-se-á uma transformação genética, isto é, uma mudança causada por genes, envolvendo a inserção de um gene num organismo de forma a modificar uma característica desse organismo. A transformação genética é usada em inúmeras áreas da biotecnologia: na agricultura, os genes que codificam características como, resistência à geada, peste ou deterioração podem ser geneticamente transformados nas plantas; na bioremediação as bactérias podem ser transformadas com genes que permitem a digestão de derrames de petróleo; na medicina, doenças causadas por mutações genéticas estão a começar a ser tratadas através da terapia génica, transformando geneticamente as células de uma pessoa doente com cópias saudáveis desse gene. Nesta actividade, será usado um gene que codifica a proteína de fluorescência verde (GFP Green Fluorescent Protein) para transformar bactérias E. coli. Este gene é proveniente da medusa bioluminescente Aequorea victoria que confere fluorescência verde a este organismo. O gene para a GFP será inserido no genoma bacteriano e a bactéria irá expressar o seu mais recente gene e produzir a proteína fluorescente que originará bactérias brilhantes, de cor verde, quando colocadas sob a luz ultravioleta. Para a inserção do gene em questão no genoma da bactéria vamos utilizar um plasmídeo. Um plasmídeo é um segmento circular de DNA, mais pequeno que o cromossoma bacteriano, que se encontra nas bactérias. Um plasmídeo contém genes para uma ou mais características que podem beneficiar a sobrevivência das bactérias. Como exemplo temos os genes que conferem resistência aos antibióticos. As bactérias podem transferir os plasmídeos entre si de forma a partilhar esses genes. Este mecanismo permite-lhes adaptarem-se a novos ambientes, sendo que a existência de bactérias resistentes a antibióticos é um exemplo de transmissão de plasmídeos. Esta actividade permite, assim, estudar o processo de movimento de genes de um organismo para outro através de um plasmídeo. A empresa Bio-Rad construiu o plasmídeo pglo que codifica o gene para a GFP e outro para a resistência ao antibiótico ampicilina. O plasmídeo incorpora, ainda, um sistema de regulação de genes que pode ser usado para controlar a expressão da proteína de fluorescência nas células transformadas. Este sistema de regulação funciona como um interruptor que é acionado pelo açúcar arabinose. Sendo assim, o gene GFP pode ser ligado adicionando ao meio de nutrição das bactérias o açúcar arabionose. A selecção das células transformadas pelo pglo é concluída com o seu crescimento nas placas que contêm o antibiótico. As células transformadas aparecerão brancas nas placas que não contêm arabinose e fluorescentes nas que incluem este açúcar.

3 BacBio Protocolo 1ª Aula: Preparação das placas de Petri iniciais 1. Inserir uma ansa de inoculação estéril na cultura bacteriana rehidratada. Com a ansa plaquear as placas de Petri (1/grupo). O plaqueamento é feito em quatro quadrantes (ver figura abaixo) Ao finalizar, tapar rapidamente a placa para evitar contaminações. 2. Colocar as placas, com a tampa para baixo, a incubar durante a noite, a 37ºC durante 2-3 dias. 2ª Aula: Transformação 1- Etiquetar um eppendorff com +pglo e outro com pglo e também com o nome/número do grupo;

4 BacBio 2- Com uma micropipeta transferir 250 µl da solução de transformação (CaCl 2 ) para cada tubo; Solução de transformação 3- Colocar os tubos em gelo; Gelo 4- Com uma ansa de inoculação, pegar numa única colónia de bactérias provenientes da placa inicial e colocá-la no tubo +pglo; agitar até que toda a colónia fique dispersa na solução de transformação. Colocar, novamente, o tubo no gelo e repetir o processo para o tubo pglo.

5 BacBio 5- Mergulhar uma ansa de inoculação esterilizada no tubo com o plasmídeo pglo. Misturar o plasmídeo da ansa na suspensão de células do tubo +pglo. Fechar o tubo e voltar a colocá-lo no gelo. (Não adicionar o plasmídeo no tubo pglo) Plasmideo pglo 6- Incubar os tubos no gelo durante 10 minutos. Gelo 7- Enquanto os tubos estão no gelo, marca as placas de Petri com agar (marcar as placas por baixo) da seguinte forma: a. Placa 1: (+pglo) LB/amp b. Placa 2: (+pglo) LB/amp/ara c. Placa 3: (-pglo) LB/amp d. Placa 4: (-pglo) LB

6 BacBio 8- Choque térmico. Usando um suporte de espuma, transferir os tubos +pglo e pglo para um banho-maria a 42ºC, durante 50 segundos exactos. Passados os 50 segundos volta a colocar os tubos no gelo. Incubar os tubos no gelo durante 2 minutos. (Para que os resultados da transformação sejam bons a transferência do gelo para os 42ºC e novamente para o gelo deve ser rápida.) Banho-Maria Gelo 42ºC, 50 segundos Gelo 9- Remover o suporte com os tubos do gelo e coloca-los na bancada. Usando uma pipeta esterilizada, adiciona 250 µl do caldo de nutrientes LB. Repetir o mesmo para o outro tubo com uma nova pipeta. Incubar os tubos durante 10 minutos à temperatura ambiente. Nutrientes LB

7 BacBio 10- Dar pancadinhas no tubo com os dedos para misturar a solução. Usando uma pipeta esterilizada, colocar 100 µl das suspensões de transformação e controlo nas placas apropriadas. Placas transformadas Placas controlo 11- Espalhar as suspensões pela superfície do meio, usando uma ansa de inoculação esterilizada para cada placa. (não fazer muito pressão para não furar o meio) 12- Colocar as placas numa estufa a 37ºC.

8 BacBio 3ª Aula: Recolha e análise de dados Observar os resultados obtidos da transformação laboratorial sob luz normal. A seguir, desligar as luzes e segurar uma luz ultravioleta por baixo das placas. +pglo LB/amp 1. Observar e desenhar o que se vê em cada placa. Colocar os desenhos na coluna da direita da tabela de dados. Registar os dados para permitir a comparação entre as observações feitas às células +pglo e às células não transformadas (- pglo). 2. Qual o crescimento bacteriano observado em cada placa? 3. Qual a cor das bactérias? 4. Quantas colónias bacterianas existem em cada placa. Observações +pglo LB/amp/ara -pglo LB/amp Observações -pglo LB Bibliografia Biotechnology Explorer, pglo Bacterial Transformation Kit, Catalog Number EDU, Bio-Rad laboratories Inc., explorer.bio-rad.com

Escola Secundária Francisco Simões Ano lectivo 2009/2010 Professora: Ana Paula Reis 12º Ano. Desafio Bactéria. Realizado por: Biomaníacas

Escola Secundária Francisco Simões Ano lectivo 2009/2010 Professora: Ana Paula Reis 12º Ano. Desafio Bactéria. Realizado por: Biomaníacas Escola Secundária Francisco Simões Ano lectivo 2009/2010 Professora: Ana Paula Reis 12º Ano Desafio Bactéria Realizado por: Biomaníacas Introdução Teórica Este trabalho encontra-se inserido num projecto,

Leia mais

Para 1L de meio triptona ou peptona 16g (1,6%) extrato de levedura 10g (1%) NaCl 5g (0,5%)

Para 1L de meio triptona ou peptona 16g (1,6%) extrato de levedura 10g (1%) NaCl 5g (0,5%) Preparação de meio líquido - triptona ou peptona - extrato de levedura 1º Dissolver a triptona e o extrato; 2º Acrescentar o cloreto de sódio e acertar o volume; 3º Após tudo dissolvido e com volume correto,

Leia mais

CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA. Atualmente é muito comum ouvirmos falar de clonagem em meios de

CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA. Atualmente é muito comum ouvirmos falar de clonagem em meios de CLONAGEM MOLECULAR E TRANSFORMAÇÃO BACTERIANA I - INTRODUÇÃO Atualmente é muito comum ouvirmos falar de clonagem em meios de comunicação que atingem o grande público. É também bastante comum assistirmos

Leia mais

Microrganismos do solo

Microrganismos do solo O que é o solo? Tem vida? Microrganismos do solo Anos a que se destina, preferencialmente: Ciências Físicas e Naturais 3º ciclo: Tema : terra no espaço biodiversidade e unidade; Tema : sustentabilidade

Leia mais

5 Aula Prática Exame do Microcultivo de levedura. Plaqueameno de Açúcar. Ensaio de Óxido-Redução com Resazurina

5 Aula Prática Exame do Microcultivo de levedura. Plaqueameno de Açúcar. Ensaio de Óxido-Redução com Resazurina IB UNESP - Rio Claro CCA - UFSCar Araras II CURSO DE MONITORAMENTO DA FERMENTAÇÃO ETANÓLICA PERÍODO: 11 a 15 DE FEVEREIRO DE 2008 ATIVIDADES PRÁTICAS 5 Aula Prática Exame do Microcultivo de levedura. Plaqueameno

Leia mais

Actividade prática: Constrói os teus Kits de Genética!

Actividade prática: Constrói os teus Kits de Genética! Actividade prática: Constrói os teus Kits de Genética! Mais uma vez vais vestir a tua bata de cientista e investigador e preparar o teu dia a dia no laboratório. Hoje é um dia especial, vais receber a

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Biologia de Microrganismos Professora: Alessandra Machado Genética Bacteriana

Leia mais

MALAJOVICH M.A. Atividades práticas Trabalhar em segurança. Guia n 0 67,

MALAJOVICH M.A. Atividades práticas Trabalhar em segurança. Guia n 0 67, OS DESODORANTES POR QUE PRECISAMOS DE DESODORANTES? Vários tipos de microrganismos se desenvolvem na pele, especialmente nas dobras e partes mais úmidas associadas às glândulas sudoríparas. Sua atividade

Leia mais

Detecção de IL-1 por ELISA sanduíche. Andréa Calado

Detecção de IL-1 por ELISA sanduíche. Andréa Calado Detecção de IL-1 por ELISA sanduíche Andréa Calado andreabelfort@hotmail.com ELISA O teste identifica e quantifica Ag ou Ac, utilizando um dos dois conjugados com enzimas; PRINCIPAIS TIPOS: INDIRETO:

Leia mais

MEIOS DE CULTURA PARA LEVEDURAS

MEIOS DE CULTURA PARA LEVEDURAS MONITORAMENTO TEÓRICO E PRÁTICO DA FERMENTAÇÃO ETANÓLICA MEIOS DE CULTURA PARA LEVEDURAS COORDENADORES: Profa. Dra. Dejanira Franceschi de Angelis Prof. Dr. Octávio Antonio Valsechi RIO CLARO 2006 MEIOS

Leia mais

Olá! Vamos aprender um pouco sobre Biotecnologia? A Biotecnologia é uma ciência que abrange todos estes campos do conhecimento:

Olá! Vamos aprender um pouco sobre Biotecnologia? A Biotecnologia é uma ciência que abrange todos estes campos do conhecimento: Biotecnologia Olá! Vamos aprender um pouco sobre Biotecnologia? A Biotecnologia é uma ciência que abrange todos estes campos do conhecimento: É definida como uma técnica que usa organismo vivo ou parte

Leia mais

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial.

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial. GENÉTICA BACTERIANA GENOMA BACTERIANO Cromossoma (nucleóide) Informação genética essencial. Ácido desoxirribonucléico (DNA). Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello

Leia mais

Genética de Bactérias

Genética de Bactérias Genética de Bactérias Descrição de mutantes Mecanismos de recombinação Mapeamento de genes Considerações iniciais Microrganismos no contexto da Genética 1940 com Beadle & Tatum mutantes auxotróficos em

Leia mais

Relembrando: Material genético

Relembrando: Material genético REGULAÇÃO GÉNICA Relembrando: Material genético O MATERIAL GENÉTICO é o suporte físico do conjunto de padrões de informações hereditárias, transmitidas ao longo das gerações. GENE é a unidade de informação

Leia mais

Bactérias Vírus Fungos Protozoários O QUE SÃO

Bactérias Vírus Fungos Protozoários O QUE SÃO Bactérias Vírus Fungos Protozoários RESUMO DOS PRINCIPAIS MICRORGANISMOS, O QUE SÃO MEIOS DE PROLIFERAÇÃO... Diferença entre as células Bactérias São seres muito simples, unicelulares e com célula procariótica

Leia mais

Curso Técnico em Análises Químicas Disciplina: Microbiologia. Aula 3.1 Bactérias

Curso Técnico em Análises Químicas Disciplina: Microbiologia. Aula 3.1 Bactérias Curso Técnico em Análises Químicas Disciplina: Microbiologia Aula 3.1 Bactérias CLASSIFICAÇÃO: Bactérias Quanto a respiração: Aeróbicas: crescem apenas na presença de O 2. Anaeróbicas: crescem em ausência

Leia mais

Síntese de Proteínas e Divisão Celular

Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular Síntese de Proteínas e Divisão Celular 1. Normalmente não se encontram neurônios no cérebro em plena divisão celular. Entretanto, no Mal de Alzheimer, grandes quantidades

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia. Célula Procariótica. Prof. Macks Wendhell Gonçalves, Msc.

Pontifícia Universidade Católica de Goiás Departamento de Biologia. Célula Procariótica. Prof. Macks Wendhell Gonçalves, Msc. Pontifícia Universidade Católica de Goiás Departamento de Biologia Célula Procariótica Prof. Macks Wendhell Gonçalves, Msc mackswendhell@gmail.com Roteiro Células procarióticas não possuem envoltório nuclear

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Extracção de ADN de mancha de sangue por Chelex 100. Protocolo experimental:

Extracção de ADN de mancha de sangue por Chelex 100. Protocolo experimental: Extracção de ADN de mancha de sangue por Chelex 100 1. Num tubo eppendorf misturar 1ml de água desionizada estéril com uma mancha de sangue com aproximadamente 3mm²; 2. Incubar à temperatura ambiente no

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

Determinação de sensibilidade bacteriana aos antimicrobianos

Determinação de sensibilidade bacteriana aos antimicrobianos Determinação de sensibilidade bacteriana aos antimicrobianos Prof. Adj. Ary Fernandes Junior Departamento de Microbiologia e Imunologia Instituto de Biociências UNESP Tel. 14 3880.0412/0413 ary@ibb.unesp.br

Leia mais

Aplicação em escala laboratorial

Aplicação em escala laboratorial Aplicação em escala laboratorial Índice Velcorin Aplicação em escala laboratorial Página 3 5 Introdução Página 3 Medidas de Segurança Página 3 Metodologia (preparo) Página 4 Metodologia Microbiológica

Leia mais

Vírus - Caracterização Geral

Vírus - Caracterização Geral Noções de Vírus By Profª. Cynthia Vírus - Caracterização Geral Vírus = veneno ou fluído venenoso (Latim) Acelulares/ Partículas Infecciosas Composição química de nucleoproteínas (DNA ou RNA+Proteínas)

Leia mais

REVOLUÇÃO DA GENÉTICA. Ana Paula N. Guimarães

REVOLUÇÃO DA GENÉTICA. Ana Paula N. Guimarães REVOLUÇÃO DA GENÉTICA Ana Paula N. Guimarães apng89@gmail.com Tópicos Questionamentos: Revolução da Genética? Voltando um pouco no tempo: 1990 Promessas do Projeto Genoma O que aconteceria na prática Por

Leia mais

Kits Didáticos. Laboratórios Portáteis

Kits Didáticos. Laboratórios Portáteis Kits Didáticos Laboratórios Portáteis Kit pedagógico de genética A Procura do Suspeito (Papiloscopia - Jogo) Kit na forma de jogo para o ensino fundamental e médio para ensino de genética de herança mendeliana

Leia mais

IDENTIFICAÇÃO DE SUBSTÂNCIAS E AVALIAÇÃO DA SUA PUREZA

IDENTIFICAÇÃO DE SUBSTÂNCIAS E AVALIAÇÃO DA SUA PUREZA IDENTIFICAÇÃO DE SUBSTÂNCIAS E AVALIAÇÃO DA SUA PUREZA O que se pretende Utilizar técnicas experimentais de determinação de propriedades físicas características das substâncias como métodos de identificação

Leia mais

Colorações de Bactérias: Coloração Simples e Coloração Diferencial(Coloração de Gram)

Colorações de Bactérias: Coloração Simples e Coloração Diferencial(Coloração de Gram) Escola Secundária com 3º Ciclo D.Manuel I Beja Acção de Formação ORGANIZAÇÃO E GESTÃO DOS LABORATÓRIOS ESCOLARES Guião de actividade laboratorial versão aluno Colorações de Bactérias: Coloração Simples

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Material genético Material genético Genes e cromossomas As informações hereditárias transmitidas ao longo das gerações, segundo

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Hospedeiros e vetores de clonagem

Hospedeiros e vetores de clonagem UNIVERSIDADE FEDERAL DO RIO DE JANEIRO PÓLO AVANÇADO DE XERÉM GRADUAÇÃO EM BIOTECNOLOGIA CURSO MELH. GEN. E OGMs (XBT353) TURMA 2015/2 Hospedeiros e vetores de clonagem Prof. Dr. Silas Pessini Rodrigues

Leia mais

Unidade 5 Cresc. e renovação celular VIII CRESCIMENTO E RENOVAÇÃO DE TECIDOS

Unidade 5 Cresc. e renovação celular VIII CRESCIMENTO E RENOVAÇÃO DE TECIDOS 1 Unidade 5 Cresc. e renovação celular VIII CRESCIMENTO E RENOVAÇÃO DE TECIDOS A mitose garante que 2 a partir de uma única célula, se formem duas células geneticamente idênticas todos os fenómenos de:

Leia mais

Biologia. Questão 1. Questão 2. Avaliação: Aluno: Data: Ano: Turma: Professor:

Biologia. Questão 1. Questão 2. Avaliação: Aluno: Data: Ano: Turma: Professor: Avaliação: Aluno: Data: Ano: Turma: Professor: Biologia Questão 1 (Fuvest 2002) Os vírus A. ( ) possuem genes para os três tipos de RNA (ribossômico, mensageiro e transportador), pois utilizam apenas aminoácidos

Leia mais

Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos

Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos INSTITUTO SUPERIOR POLITÉCNICO DE COIMBRA / ESCOLA SUPERIOR AGRÁRIA Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos Data: 02 Maio 2012 Duração: 2 horas

Leia mais

Escola Secundária de Casquilhos Disciplina: Biologia Docente: Isabel Lopes Trabalho realizado por: Inês da Mata nº 13 Turma: 12ºA

Escola Secundária de Casquilhos Disciplina: Biologia Docente: Isabel Lopes Trabalho realizado por: Inês da Mata nº 13 Turma: 12ºA Escola Secundária de Casquilhos Disciplina: Biologia Docente: Isabel Lopes Trabalho realizado por: Inês da Mata nº 13 Turma: 12ºA Barreiro, 2009 Há grandeza neste modo de ver a vida, com as suas potencialidades,

Leia mais

Conjunto de slides educacionais

Conjunto de slides educacionais Conjunto de slides educacionais Objectivos de aprendizagem e conteúdo Objectivos de aprendizagem: Familiarização com as principais diferenças de NovoSeven estável à temperatura ambiente, Compreensão dos

Leia mais

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS ESCOLA SUPERIOR AGRÁRIA Instituto Politécnico de Coimbra 2015 PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS DATA 27/04/2015 HORA 10.00H - 12.00H

Leia mais

Pareceres dos Projetos de Biologia Molecular

Pareceres dos Projetos de Biologia Molecular Pareceres dos Projetos de Biologia Molecular Grupo 1: A técnica pro-drug combinando o adhsvtk e a droga gcv como uma estratégia de terapia gênica Através das técnicas Pro-Drug e Suicide Gene therapy, o

Leia mais

CATÁLOGO DE MATERIAL LABORATORIAL

CATÁLOGO DE MATERIAL LABORATORIAL UNIVERSIDADE FEDERAL DE OURO PRETO PRÓ-REITORIA DE PLANEJAMENTO E DESENVOLVIMENTO DIRETORIA DE ORÇAMENTOS E FINANÇAS COORDENADORIA DE SUPRIMENTOS CATÁLOGO DE MATERIAL LABORATORIAL OURO PRETO MARÇO / 2016

Leia mais

ENEM PROVA AZUL RESUMO

ENEM PROVA AZUL RESUMO ENEM 2009 - PROVA AZUL RESUMO 2009 (19 questões) 1 Ecologia - Desequilíbrio Ambiental Bioquímica 1 2 Fisiologia Humana - Interpretação gráfica Biotecnologia 1 3 Doenças virais e Bioquímica - Soro x Vacina

Leia mais

Protocolo experimental

Protocolo experimental Protocolo experimental E se a salinidade se alterar? Enquadramento Teórico Todos os animais necessitam de condições ambientais favoráveis à sua sobrevivência e manutenção. Parâmetros como por exemplo a

Leia mais

Prof. Msc. Cleysyvan Macedo

Prof. Msc. Cleysyvan Macedo Prof. Msc. Cleysyvan Macedo PRINCIPAIS CARACTERÍSTICAS DOS VÍRUS: Não possui estruturas celulares (membrana plasmática, citoplasma, etc.). São formado basicamente por uma cápsula protéica denominada capsômero

Leia mais

Genética IV: Genética Bioquímica

Genética IV: Genética Bioquímica Genética IV: Genética Bioquímica 1. Genética da População Este campo alcançou seus avanços pelas leis propostas por duas pessoas, Hardy e Weinberg (1908). Vamos supor que em uma população haja dois alelos

Leia mais

Perfil dos participantes do PEP em Microbiologia da RMRS. & Técnicas/ metodologias do ensaio de BACTÉRIAS HETEROTRÓFICAS

Perfil dos participantes do PEP em Microbiologia da RMRS. & Técnicas/ metodologias do ensaio de BACTÉRIAS HETEROTRÓFICAS Perfil dos participantes do PEP em Microbiologia da RMRS & Técnicas/ metodologias do ensaio de BACTÉRIAS HETEROTRÓFICAS O perfil do grupo foi baseado em questionário organizado pela Rede Metrológica e

Leia mais

MORFOLOGIA E ESTRUTURA DA CÉLULA BACTERIANA

MORFOLOGIA E ESTRUTURA DA CÉLULA BACTERIANA MORFOLOGIA E ESTRUTURA DA CÉLULA BACTERIANA MICROBIOLOGIA I AULA 2 Profa Cristina Lacerda S Petraro Silva 1- FORMA E ARRANJO A forma: - diz respeito ao formato individual da célula bacteriana -determinada

Leia mais

Determinação de lipídios em leite e produtos lácteos pelo método butirométrico

Determinação de lipídios em leite e produtos lácteos pelo método butirométrico Página 1 de 10 1 Escopo Este método tem como objetivo determinar a porcentagem de lipídios em leite e produtos lácteos pelo método butirométrico (Gerber). 2 Fundamentos Baseia-se na separação e quantificação

Leia mais

OUTUBRO - INTERVENÇÃO EXTRAÇÃO DE DNA VEGETAL PLANO DA INTERVENÇÃO

OUTUBRO - INTERVENÇÃO EXTRAÇÃO DE DNA VEGETAL PLANO DA INTERVENÇÃO OUTUBRO - INTERVENÇÃO EXTRAÇÃO DE DNA VEGETAL Autor: Cláudia Lucher de Freitas PLANO DA INTERVENÇÃO CONTEXTUALIZAÇÃO DNA é a sigla dada para o ácido desoxirribonucléico, que é um complexo de moléculas

Leia mais

PROTOCOLO DE UTILIZAÇAO

PROTOCOLO DE UTILIZAÇAO PROTOCOLO DE UTILIZAÇAO Hibridação para cortes de tecidos preservados em parafina Materiais fornecidos: DNA marcado com moléculas fluorescentes (sonda). Buffer(tampão) de Hibridação Reativos para preparar

Leia mais

Alimentos transgênicos. Aluna: Maria Eugênia Araújo

Alimentos transgênicos. Aluna: Maria Eugênia Araújo Alimentos transgênicos Aluna: Maria Eugênia Araújo Sumário O que é um transgênico? Métodos de transgenia Aplicações da transgenia Pontos positivos Pontos negativos Rotulagem dos transgênicos Considerações

Leia mais

Para mudar de modo, pressionar o nariz da bola só depois da música/ sons pararem!

Para mudar de modo, pressionar o nariz da bola só depois da música/ sons pararem! Para mudar de modo, pressionar o nariz da bola só depois da música/ sons pararem! Guardar estas instruções para referência futura pois contêm informação importante. Funciona com 3 pilhas AA (incluídas).

Leia mais

EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS. Professor Fláudio

EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS. Professor Fláudio EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS Professor Fláudio EVIDÊNCIAS DE EVOLUÇÃO EVOLUÇÃO conjunto de processos que levam a modificações nos seres vivos ao longo do tempo, podendo dar origem a novas espécies Entender

Leia mais

Análise de Variância (ANOVA)

Análise de Variância (ANOVA) Análise de Variância (ANOVA) Prof. Dr. Vinicius Campos Disciplina de Bioestatística e Delineamento Experimental Graduação em Biotecnologia - UFPel Abordagens da aula... 1. Bases da ANOVA 2. Tipos de ANOVA

Leia mais

Produtos para Cultivo Celular

Produtos para Cultivo Celular Produtos para Cultivo Celular CULTIVO CELULAR Através da técnica de cultivo celular, células animais ou vegetais são mantidas vivas em crescimento fora do seu tecido original, em condições controladas.

Leia mais

Organização do Genoma

Organização do Genoma Organização do Genoma Bibliografia: The Cell A Molecular Approach (Fourth Edition) Geoffrey M. Cooper & Robert E. Hausman. ASM Press & Sinauer Associates, Inc. 2007. (Disponível para ser requisitado na

Leia mais

Extensão da herança a Mendeliana

Extensão da herança a Mendeliana Extensão da herança a Mendeliana Genética Básica Licenciatura em Biologia Victor Martin Quintana Flores Diferentes padrões de herança a Mendeliana Tipo Descrição Mendeliana simples Ligado ao X Alelos letais

Leia mais

Crescimento e regeneração de tecidos

Crescimento e regeneração de tecidos Crescimento e regeneração de tecidos Crescimento Renovação celular Regeneração celular A mitose é um processo de divisão nuclear segundo o qual uma célula origina duas células geneticamente idênticas.

Leia mais

EXAMES TOXICOLÓGICOS PARA DETECÇÃO DE DROGAS DE ABUSO APLICAÇÃO DO TESTE PELO MÉTODO MERGULHO E CONTA-GOTAS

EXAMES TOXICOLÓGICOS PARA DETECÇÃO DE DROGAS DE ABUSO APLICAÇÃO DO TESTE PELO MÉTODO MERGULHO E CONTA-GOTAS EXAMES TOXICOLÓGICOS PARA DETECÇÃO DE DROGAS DE ABUSO APLICAÇÃO DO TESTE PELO MÉTODO MERGULHO E CONTA-GOTAS LEMBRAR SEMPRE O teste acima de 5 drogas, tem o painel dupla face. FRENTE VERSO CONTEÚDO DO KIT

Leia mais

Bases ecológicas da resistência bacteriana às drogas

Bases ecológicas da resistência bacteriana às drogas Bases ecológicas da resistência bacteriana às drogas Drogas antimicrobianas: mecanismo de ação Um aspecto do controle do crescimento dos microrganismos envolve a utilização de fármacos no tratamento de

Leia mais

Clonagem Molecular. Fragmentos de DNA de interesse. Fagos Cosmídeos BACs/ YACs

Clonagem Molecular. Fragmentos de DNA de interesse. Fagos Cosmídeos BACs/ YACs Clonagem Molecular Fragmentos de DNA de interesse Vetores: Plasmídeos Fagos Cosmídeos BACs/ YACs Hospedeiros: E.coli Levedura Células vegetais Células animais Enzimas: Enzimas de restrição DNA polimerases

Leia mais

Guia de leitura. Método de disco-difusão para teste de sensibilidade aos antimicrobianos do EUCAST. Versão 4.0 Junho 2014

Guia de leitura. Método de disco-difusão para teste de sensibilidade aos antimicrobianos do EUCAST. Versão 4.0 Junho 2014 Guia de leitura 1 Método de disco-difusão para teste de sensibilidade aos antimicrobianos do EUCAST Versão 4.0 Junho 2014 Versão para Português válida a partir de 01/03/2016 Alterações na apresentação

Leia mais

De acordo com suas necessidades, o cirurgião poderá selecionar o cimento pela viscosidade que melhor se adapte dentro das especificações:

De acordo com suas necessidades, o cirurgião poderá selecionar o cimento pela viscosidade que melhor se adapte dentro das especificações: Cimento Cimento Introdução O cimento Ortopédico Lepine é um cimento acrílico, radiopaco e estéril, fabricado em conformidade com a ISSO 5833: 1992, Lyon França. Devido às suas características, permite

Leia mais

Estudo Dirigido Sequenciamento de DNA

Estudo Dirigido Sequenciamento de DNA Estudo Dirigido Sequenciamento de DNA Professores Dra. Daniela Alves Silvestre OBJETIVOS Compreender a partir do estudo da técnica de sequenciamento do DNA através da utilização de didesoxinucleotídeos,

Leia mais

Terra um planeta com Vida

Terra um planeta com Vida Condições que permitiram o aparecimento da Vida na Terra O aparecimento da Vida resultou das características particulares da Terra. Formação da Terra há cerca de 4600 M.a. Formação de uma atmosfera primitiva.

Leia mais

As Teorias Evolutivas. Princípios da Teoria de Lamarck. Fundamentos da Evolução Biológica. Ideias Evolucionistas - Lamarckismo

As Teorias Evolutivas. Princípios da Teoria de Lamarck. Fundamentos da Evolução Biológica. Ideias Evolucionistas - Lamarckismo Fundamentos da Evolução Biológica As Teorias Evolutivas Várias teorias evolutivas surgiram, mas destacam-se se as teorias de Lamarck e de Darwin. O EVOLUCIONISMO, OU TEORIA DA EVOLUÇÃO, É A EXPLICAÇÃO

Leia mais

Estabelecimento de culturas de linhas celulares estáveis que expressem proteínas fluorescentes. Cristina Duque Luís Flores

Estabelecimento de culturas de linhas celulares estáveis que expressem proteínas fluorescentes. Cristina Duque Luís Flores Estabelecimento de culturas de linhas celulares estáveis que expressem proteínas fluorescentes Cristina Duque Luís Flores Introdução No centro da divisão celular está o fuso mitótico, cuja função é segregar

Leia mais

AGRUPAMENTO DE ESCOLAS D. JOÃO V ESCOLA SECUNDÁRIA c/ 2º e 3º CICLOS D. JOÃO V

AGRUPAMENTO DE ESCOLAS D. JOÃO V ESCOLA SECUNDÁRIA c/ 2º e 3º CICLOS D. JOÃO V Informações aos Encarregados de Educação do trabalho a realizar no: 5º Ano Ciências Naturais Ano Letivo 2015/2016 1. Aulas previstas: Aulas (*) 5º1ª 5º2ª 5º3ª 5º4ª 1º Período: 21 de Setembro - 17 de Dezembro

Leia mais

Engenharia Genética e Biotecnologia

Engenharia Genética e Biotecnologia Engenharia Genética e Biotecnologia 1. (PUC - SP-2005) Encontram-se a seguir um esquema do embrião humano com aproximadamente 5 dias e um trecho sobre clonagem: Na clonagem terapêutica são utilizadas células-tronco,

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra MICROBIOLOGIA António Veríssimo Paula Morais Medição do crescimento de E. coli Fundamento A verificação do desenvolvimento das populações de E. coli

Leia mais

BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA

BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA A prova de Biologia apresentou uma boa abrangência em relação aos conteúdos programáticos solicitados. Envolveu conceitos fundamentais da Biologia, não descuidando de assuntos

Leia mais

APLICAÇÕES GOLD ANALISA PARA O QUICK LAB

APLICAÇÕES GOLD ANALISA PARA O QUICK LAB ÁCIDO ÚRICO - PP - Cat. 451 200 Determinações - Volume: 200 ml Técnica de Análise: Seguir as Instruções de Uso do produto. Calibração Para a calibração, usar o (1) do kit ou o Calibrador Gold Analisa Cat.

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética.

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética. UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Cap.2.1. Alterações do Material Genético Engenharia genética Biologia 12º ano UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação

Leia mais

Estratégias biotecnológicas para o combate do NMP

Estratégias biotecnológicas para o combate do NMP Estratégias biotecnológicas para o combate do NMP Marta Vasconcelos Escola Superior de Biotecnologia Universidade Católica do Porto 19 de Junho de 2009 O problema: O nemátode da madeira do pinheiro (NMP)

Leia mais

PLANO DE CURSO DISCIPLINA: Ciências ÁREA DE ENSINO: FUNDAMENTAL I SÉRIE\ ANO: 4º ANO DESCRITORES CONTEÚDOS SUGESTÕES DE PROCEDIMENTOS METODOLÓGICOS

PLANO DE CURSO DISCIPLINA: Ciências ÁREA DE ENSINO: FUNDAMENTAL I SÉRIE\ ANO: 4º ANO DESCRITORES CONTEÚDOS SUGESTÕES DE PROCEDIMENTOS METODOLÓGICOS UNIDADE 1 A VIDA SOB MICROSCÓPIO *Conhecer a história do microscópio *Conhecer doenças causadas por microrganismos *conhecer que os seres vivos são formados por células *Conhecendo microscópio e sua utilidade.

Leia mais

CADERNO DE LABORATÓRIO

CADERNO DE LABORATÓRIO CADERNO DE LABORATÓRIO 1º Ciclo - 4º ano VOU PREVER VOU EXPERIMENTAR VOU CONCLUIR VOU AVALIAR O QUE APRENDI Personaliza o teu caderno fazendo um desenho Nome: Turma: Ano: O caderno de laboratório contém

Leia mais

Teoria cromossômica da herança e genes ligados ao sexo. Herança a ligada ao sexo. Prof. Victor Martin Quintana Flores

Teoria cromossômica da herança e genes ligados ao sexo. Herança a ligada ao sexo. Prof. Victor Martin Quintana Flores Teoria cromossômica da herança e genes ligados ao sexo Herança a ligada ao sexo Genética BásicaB Prof. Victor Martin Quintana Flores 1 Nesta aula veremos como a transmissão de cromossomos está relacionada

Leia mais

CIÊNCIAS. Prof. Diângelo

CIÊNCIAS. Prof. Diângelo CIÊNCIAS Prof. Diângelo TABELA PERÍODICA Aula 18 Respiração Celular Respiração celular é o processo de conversão das ligações químicas de moléculas ricas em energia que poderão ser usadas nos processos

Leia mais

Técnicas de Trabalho com Material Volumétrico

Técnicas de Trabalho com Material Volumétrico Universidade Federal de Goiás Instituto de Química Curso Experimental de Transformações Químicas 2010 Prof. Dr. Anselmo (adaptado, Agustina) Técnicas de Trabalho com Material Volumétrico 1 Objetivo Nesta

Leia mais

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA ÍNDICE Introdução Evolução: mutação e recombinação do DNA Erros de Recombinação: Câncer? Engenharia Genética e Transgênicos Recombinação homóloga - Modelo Holliday

Leia mais

IMPRESSA F50 / F5 / F505 Resumo das instruções

IMPRESSA F50 / F5 / F505 Resumo das instruções IMPRESSA F50 / F5 / F505 Resumo das instruções Primeira colocação em funcionamento Ligar (I) interruptor principal (no lado posterior) Encher grãos Carregar no botão de operação Texto no display: SPRACHE

Leia mais

Domínio 1: PROCESSOS VITAIS COMUNS AOS SERES VIVOS Subdomínio 1: Trocas nutricionais entre o organismo e o meio: nos animais

Domínio 1: PROCESSOS VITAIS COMUNS AOS SERES VIVOS Subdomínio 1: Trocas nutricionais entre o organismo e o meio: nos animais A G R U P A M E N T O D E E S C O L A S D R. V I E I R A D E C A R V A L H O D E P A R T A M E N T O D E M A T E M Á T I C A E C I Ê N C I A S E X P E R I M E N T A I S P L A N I F I C A Ç Ã O A N U A

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

INSTITUTO POLITÉCNICO DE SANTARÉM ESCOLA SUPERIOR AGRÁRIA DE SANTARÉM

INSTITUTO POLITÉCNICO DE SANTARÉM ESCOLA SUPERIOR AGRÁRIA DE SANTARÉM INSTITUTO POLITÉCNICO DE SANTARÉM ESCOLA SUPERIOR AGRÁRIA DE SANTARÉM PROVAS ESPECIALMENTE ADEQUADAS A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DOS CURSOS DE LICENCIATURA DA ESCOLA SUPERIOR AGRÁRIA DE SANTARÉM,

Leia mais

Resultados Figura 14. Seqüenciamento do gene da condroitinase AC clonado no vetor pcdna3.1(+).

Resultados Figura 14. Seqüenciamento do gene da condroitinase AC clonado no vetor pcdna3.1(+). 49 Figura 14. Seqüenciamento do gene da condroitinase AC clonado no vetor pcdna3.1(+). Para confirmar a correta inserção do gene da condroitinase AC no plasmídeo pcdna3.1(+) o gene foi dividido em 5 partes

Leia mais

Dica de Manejo - Coleta de Sangue

Dica de Manejo - Coleta de Sangue Dica de Manejo - Coleta de Sangue Introdução A coleta de sangue deve ser uma prática conhecida pelos encarregados das granjas. A partir do sangue coletado, uma grande quantidade de testes pode ser realizada,

Leia mais

Conteúdo Descritivo. Saúde e qualidade de vida da população

Conteúdo Descritivo. Saúde e qualidade de vida da população Departamento de Matemática e Ciências Experimentais Disciplina: Ciências Naturais PLANIFICAÇÃO ANUAL DO 9º ANO Conteúdo Descritivo Nº de aulas previstas [5'] 1º PERÍODO 36 Apresentação/ acolhimento / considerações

Leia mais

Todos tem uma grande importância para o organismo.

Todos tem uma grande importância para o organismo. A Química da Vida ÁGUA A água é um composto químico formado por dois átomos de hidrogênio e um de oxigênio. Sua fórmula química é H2O. A água pura não possui cheiro nem cor. Ela pode ser transformada em

Leia mais

PROCEDIMENTO DE OPERAÇÃO PADRÃO - POP

PROCEDIMENTO DE OPERAÇÃO PADRÃO - POP PÁG.: 1/8 1. OBJETIVO Definir um procedimento para preparação dos meios de cultura pelo. 2. ALCANCE Este procedimento se aplica a todos os lotes de meios de cultura preparados pelo Controle Microbiológico,

Leia mais

Determinação da densidade relativa das soluções de sacarose e dos açucares a estudar

Determinação da densidade relativa das soluções de sacarose e dos açucares a estudar Determinação da densidade relativa das soluções de sacarose e dos açucares a estudar 1. Densidade relativa A densidade relativa é uma propriedade física característica de cada substância e a sua determinação

Leia mais

Escola Secundária do Padrão da Légua (402412) Disciplina de Biologia do 12º ano de escolaridade

Escola Secundária do Padrão da Légua (402412) Disciplina de Biologia do 12º ano de escolaridade ÁREA DISCIPLINAR DE CTV Disciplina de Biologia do 12º ano de escolaridade Unidade 1 Reprodução Humana e Manipulação da Fertilidade Unidade 2 Património Genético Autoavaliação Unidade 2 Património Genético

Leia mais

Conceituar e discutir os benefícios e os prejuízos da utilização de transgênicos na

Conceituar e discutir os benefícios e os prejuízos da utilização de transgênicos na Transgênicos Objetivo da Aula agricultura. Conceituar e discutir os benefícios e os prejuízos da utilização de transgênicos na Organismos transgênicos ou Organismos Geneticamente Modificados (OGM) são

Leia mais

RELATÓRIO DE AULA PRÁTICA EM LABORATÓRIO: CONTAGEM DE BACTÉRIAS TOTAIS E PESQUISA DE COLIFORMES, COLIFORMES FECAIS E ESCHERICHIA COLI EM ALIMENTOS

RELATÓRIO DE AULA PRÁTICA EM LABORATÓRIO: CONTAGEM DE BACTÉRIAS TOTAIS E PESQUISA DE COLIFORMES, COLIFORMES FECAIS E ESCHERICHIA COLI EM ALIMENTOS 3cm INSTITUTO FEDERAL DE EDUCAÇÃO, CIÊNCIA E TECNOLOGIA DE SANTA CATARINA CURSO TÉNICO EM... Fonte Arial ou Times 12, maiúscula sem negrito BELTRANO DE TAL FULANO DE TAL Fonte 12, semnegrito 3cm 2cm RELATÓRIO

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Departamento de Biologia da Universidade do Minho Mestrado em Genética Molecular Guião das aulas práticas Ana Preto Andreia Gomes Cristina Aguiar Rui Oliveira MÉTODOS DE ANÁLISE E DETECÇÃO DE PROTEÌNAS

Leia mais

R E L A T Ó R I O D A A C T I V I D A D E L A B O R A T O R I A L

R E L A T Ó R I O D A A C T I V I D A D E L A B O R A T O R I A L 1 R E L A T Ó R I O D A A C T I V I D A D E L A B O R A T O R I A L ACTIVIDADE LABORATORIAL 1.3 Efeitos da temperatura e da concentração na progressão global de uma reacção de equilíbrio com iões de cobalto

Leia mais

Prever qual é a altura máxima atingida após o ressalto de uma bola que é deixada cair de uma determinada altura.

Prever qual é a altura máxima atingida após o ressalto de uma bola que é deixada cair de uma determinada altura. ACTIVIDADE LABORATORIAL FÍSICA 0.º ANO ALF 2.2 BOLA SALTITONA O que se pretende Prever qual é a altura máxima atingida após o ressalto de uma bola que é deixada cair de uma determinada altura. Para tal

Leia mais

c u r s o Biotecnologia Aplicada à Agropecuária 20 a 31 de julho de 2009

c u r s o Biotecnologia Aplicada à Agropecuária 20 a 31 de julho de 2009 c u r s o Biotecnologia Aplicada à Agropecuária 20 a 31 de julho de 2009 Introdução A Biotecnologia, conceitualmente, é a união de biologia com tecnologia, é um conjunto de técnicas que utilizam os seres

Leia mais

Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2009/2010. Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano

Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2009/2010. Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2009/2010 Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano ENSINO PRÁTICO E TEORICO-PRÁTICO 7ª AULA PRÁTICA Determinação

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

Biologia. ( ) centríolo (A) 2, 1, 3, 5, 6, 4. ( ) retículo endoplasmático (B) 2, 1, 3, 5, 4, 6. ( ) complexo de Golgi (C) 1, 6, 5, 3, 2, 4

Biologia. ( ) centríolo (A) 2, 1, 3, 5, 6, 4. ( ) retículo endoplasmático (B) 2, 1, 3, 5, 4, 6. ( ) complexo de Golgi (C) 1, 6, 5, 3, 2, 4 Biologia 21. Associe os números das estruturas celulares assinaladas no desenho com os respectivos nomes da coluna abaixo do desenho. A seguir, assinale a opção em que a seqüência coincida com o que foi

Leia mais

Instituto Superior Técnico. Engenharia Genética

Instituto Superior Técnico. Engenharia Genética Instituto Superior Técnico Engenharia Genética Lisboa, 12 de outubro de 2015 Índice Resumo... 3 Resultados... 6 Tratamento de Resultados... 10 Discussão de Resultados... 14 Bibliografia... 17 2 Resumo

Leia mais

Boletim de Instruções EMENDAS DE FIBRAS ÓPTICAS FIBRLOK II UNIVERSAL 2529

Boletim de Instruções EMENDAS DE FIBRAS ÓPTICAS FIBRLOK II UNIVERSAL 2529 Fol.067-Rev.02 - Pg.1/5 Boletim de Instruções EMENDAS DE FIBRAS ÓPTICAS FIBRLOK II UNIVERSAL 2529 1.0 GERAL 1.01 A Emenda de Fibra Óptica Fibrlok II Universal 2529 proporciona emendas mecânicas permanentes

Leia mais