BacBio. Crescimento, Renovação Celular e Reprodução: da teoria à prática. Coimbra, 2012/2013. Sandra Gamboa Andreia Quaresma Fernando Delgado

Tamanho: px
Começar a partir da página:

Download "BacBio. Crescimento, Renovação Celular e Reprodução: da teoria à prática. Coimbra, 2012/2013. Sandra Gamboa Andreia Quaresma Fernando Delgado"

Transcrição

1 BacBio Crescimento, Renovação Celular e Reprodução: da teoria à prática Coimbra, 2012/2013 Sandra Gamboa Andreia Quaresma Fernando Delgado Escolher Ciência PEC282 ESCOLA SUPERIOR AGRÁRIA DE COIMBRA

2 BacBio Introdução Nesta actividade laboratorial realizar-se-á uma transformação genética, isto é, uma mudança causada por genes, envolvendo a inserção de um gene num organismo de forma a modificar uma característica desse organismo. A transformação genética é usada em inúmeras áreas da biotecnologia: na agricultura, os genes que codificam características como, resistência à geada, peste ou deterioração podem ser geneticamente transformados nas plantas; na bioremediação as bactérias podem ser transformadas com genes que permitem a digestão de derrames de petróleo; na medicina, doenças causadas por mutações genéticas estão a começar a ser tratadas através da terapia génica, transformando geneticamente as células de uma pessoa doente com cópias saudáveis desse gene. Nesta actividade, será usado um gene que codifica a proteína de fluorescência verde (GFP Green Fluorescent Protein) para transformar bactérias E. coli. Este gene é proveniente da medusa bioluminescente Aequorea victoria que confere fluorescência verde a este organismo. O gene para a GFP será inserido no genoma bacteriano e a bactéria irá expressar o seu mais recente gene e produzir a proteína fluorescente que originará bactérias brilhantes, de cor verde, quando colocadas sob a luz ultravioleta. Para a inserção do gene em questão no genoma da bactéria vamos utilizar um plasmídeo. Um plasmídeo é um segmento circular de DNA, mais pequeno que o cromossoma bacteriano, que se encontra nas bactérias. Um plasmídeo contém genes para uma ou mais características que podem beneficiar a sobrevivência das bactérias. Como exemplo temos os genes que conferem resistência aos antibióticos. As bactérias podem transferir os plasmídeos entre si de forma a partilhar esses genes. Este mecanismo permite-lhes adaptarem-se a novos ambientes, sendo que a existência de bactérias resistentes a antibióticos é um exemplo de transmissão de plasmídeos. Esta actividade permite, assim, estudar o processo de movimento de genes de um organismo para outro através de um plasmídeo. A empresa Bio-Rad construiu o plasmídeo pglo que codifica o gene para a GFP e outro para a resistência ao antibiótico ampicilina. O plasmídeo incorpora, ainda, um sistema de regulação de genes que pode ser usado para controlar a expressão da proteína de fluorescência nas células transformadas. Este sistema de regulação funciona como um interruptor que é acionado pelo açúcar arabinose. Sendo assim, o gene GFP pode ser ligado adicionando ao meio de nutrição das bactérias o açúcar arabionose. A selecção das células transformadas pelo pglo é concluída com o seu crescimento nas placas que contêm o antibiótico. As células transformadas aparecerão brancas nas placas que não contêm arabinose e fluorescentes nas que incluem este açúcar.

3 BacBio Protocolo 1ª Aula: Preparação das placas de Petri iniciais 1. Inserir uma ansa de inoculação estéril na cultura bacteriana rehidratada. Com a ansa plaquear as placas de Petri (1/grupo). O plaqueamento é feito em quatro quadrantes (ver figura abaixo) Ao finalizar, tapar rapidamente a placa para evitar contaminações. 2. Colocar as placas, com a tampa para baixo, a incubar durante a noite, a 37ºC durante 2-3 dias. 2ª Aula: Transformação 1- Etiquetar um eppendorff com +pglo e outro com pglo e também com o nome/número do grupo;

4 BacBio 2- Com uma micropipeta transferir 250 µl da solução de transformação (CaCl 2 ) para cada tubo; Solução de transformação 3- Colocar os tubos em gelo; Gelo 4- Com uma ansa de inoculação, pegar numa única colónia de bactérias provenientes da placa inicial e colocá-la no tubo +pglo; agitar até que toda a colónia fique dispersa na solução de transformação. Colocar, novamente, o tubo no gelo e repetir o processo para o tubo pglo.

5 BacBio 5- Mergulhar uma ansa de inoculação esterilizada no tubo com o plasmídeo pglo. Misturar o plasmídeo da ansa na suspensão de células do tubo +pglo. Fechar o tubo e voltar a colocá-lo no gelo. (Não adicionar o plasmídeo no tubo pglo) Plasmideo pglo 6- Incubar os tubos no gelo durante 10 minutos. Gelo 7- Enquanto os tubos estão no gelo, marca as placas de Petri com agar (marcar as placas por baixo) da seguinte forma: a. Placa 1: (+pglo) LB/amp b. Placa 2: (+pglo) LB/amp/ara c. Placa 3: (-pglo) LB/amp d. Placa 4: (-pglo) LB

6 BacBio 8- Choque térmico. Usando um suporte de espuma, transferir os tubos +pglo e pglo para um banho-maria a 42ºC, durante 50 segundos exactos. Passados os 50 segundos volta a colocar os tubos no gelo. Incubar os tubos no gelo durante 2 minutos. (Para que os resultados da transformação sejam bons a transferência do gelo para os 42ºC e novamente para o gelo deve ser rápida.) Banho-Maria Gelo 42ºC, 50 segundos Gelo 9- Remover o suporte com os tubos do gelo e coloca-los na bancada. Usando uma pipeta esterilizada, adiciona 250 µl do caldo de nutrientes LB. Repetir o mesmo para o outro tubo com uma nova pipeta. Incubar os tubos durante 10 minutos à temperatura ambiente. Nutrientes LB

7 BacBio 10- Dar pancadinhas no tubo com os dedos para misturar a solução. Usando uma pipeta esterilizada, colocar 100 µl das suspensões de transformação e controlo nas placas apropriadas. Placas transformadas Placas controlo 11- Espalhar as suspensões pela superfície do meio, usando uma ansa de inoculação esterilizada para cada placa. (não fazer muito pressão para não furar o meio) 12- Colocar as placas numa estufa a 37ºC.

8 BacBio 3ª Aula: Recolha e análise de dados Observar os resultados obtidos da transformação laboratorial sob luz normal. A seguir, desligar as luzes e segurar uma luz ultravioleta por baixo das placas. +pglo LB/amp 1. Observar e desenhar o que se vê em cada placa. Colocar os desenhos na coluna da direita da tabela de dados. Registar os dados para permitir a comparação entre as observações feitas às células +pglo e às células não transformadas (- pglo). 2. Qual o crescimento bacteriano observado em cada placa? 3. Qual a cor das bactérias? 4. Quantas colónias bacterianas existem em cada placa. Observações +pglo LB/amp/ara -pglo LB/amp Observações -pglo LB Bibliografia Biotechnology Explorer, pglo Bacterial Transformation Kit, Catalog Number EDU, Bio-Rad laboratories Inc., explorer.bio-rad.com

Escola Secundária Francisco Simões Ano lectivo 2009/2010 Professora: Ana Paula Reis 12º Ano. Desafio Bactéria. Realizado por: Biomaníacas

Escola Secundária Francisco Simões Ano lectivo 2009/2010 Professora: Ana Paula Reis 12º Ano. Desafio Bactéria. Realizado por: Biomaníacas Escola Secundária Francisco Simões Ano lectivo 2009/2010 Professora: Ana Paula Reis 12º Ano Desafio Bactéria Realizado por: Biomaníacas Introdução Teórica Este trabalho encontra-se inserido num projecto,

Leia mais

Para 1L de meio triptona ou peptona 16g (1,6%) extrato de levedura 10g (1%) NaCl 5g (0,5%)

Para 1L de meio triptona ou peptona 16g (1,6%) extrato de levedura 10g (1%) NaCl 5g (0,5%) Preparação de meio líquido - triptona ou peptona - extrato de levedura 1º Dissolver a triptona e o extrato; 2º Acrescentar o cloreto de sódio e acertar o volume; 3º Após tudo dissolvido e com volume correto,

Leia mais

Microrganismos do solo

Microrganismos do solo O que é o solo? Tem vida? Microrganismos do solo Anos a que se destina, preferencialmente: Ciências Físicas e Naturais 3º ciclo: Tema : terra no espaço biodiversidade e unidade; Tema : sustentabilidade

Leia mais

Olá! Vamos aprender um pouco sobre Biotecnologia? A Biotecnologia é uma ciência que abrange todos estes campos do conhecimento:

Olá! Vamos aprender um pouco sobre Biotecnologia? A Biotecnologia é uma ciência que abrange todos estes campos do conhecimento: Biotecnologia Olá! Vamos aprender um pouco sobre Biotecnologia? A Biotecnologia é uma ciência que abrange todos estes campos do conhecimento: É definida como uma técnica que usa organismo vivo ou parte

Leia mais

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial.

15/10/2009 GENÉTICA BACTERIANA. Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello. Informação genética essencial. GENÉTICA BACTERIANA GENOMA BACTERIANO Cromossoma (nucleóide) Informação genética essencial. Ácido desoxirribonucléico (DNA). Disciplina: Microbiologia Geral Curso: Nutrição Prof. Renata Fernandes Rabello

Leia mais

MEIOS DE CULTURA PARA LEVEDURAS

MEIOS DE CULTURA PARA LEVEDURAS MONITORAMENTO TEÓRICO E PRÁTICO DA FERMENTAÇÃO ETANÓLICA MEIOS DE CULTURA PARA LEVEDURAS COORDENADORES: Profa. Dra. Dejanira Franceschi de Angelis Prof. Dr. Octávio Antonio Valsechi RIO CLARO 2006 MEIOS

Leia mais

Bactérias Vírus Fungos Protozoários O QUE SÃO

Bactérias Vírus Fungos Protozoários O QUE SÃO Bactérias Vírus Fungos Protozoários RESUMO DOS PRINCIPAIS MICRORGANISMOS, O QUE SÃO MEIOS DE PROLIFERAÇÃO... Diferença entre as células Bactérias São seres muito simples, unicelulares e com célula procariótica

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia. Célula Procariótica. Prof. Macks Wendhell Gonçalves, Msc.

Pontifícia Universidade Católica de Goiás Departamento de Biologia. Célula Procariótica. Prof. Macks Wendhell Gonçalves, Msc. Pontifícia Universidade Católica de Goiás Departamento de Biologia Célula Procariótica Prof. Macks Wendhell Gonçalves, Msc mackswendhell@gmail.com Roteiro Células procarióticas não possuem envoltório nuclear

Leia mais

Curso Técnico em Análises Químicas Disciplina: Microbiologia. Aula 3.1 Bactérias

Curso Técnico em Análises Químicas Disciplina: Microbiologia. Aula 3.1 Bactérias Curso Técnico em Análises Químicas Disciplina: Microbiologia Aula 3.1 Bactérias CLASSIFICAÇÃO: Bactérias Quanto a respiração: Aeróbicas: crescem apenas na presença de O 2. Anaeróbicas: crescem em ausência

Leia mais

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR

Universidade Federal do Espírito Santo Centro de Ciências Agrárias. Disciplina BIOLOGIA MOLECULAR Universidade Federal do Espírito Santo Centro de Ciências Agrárias Disciplina BIOLOGIA MOLECULAR DBI05366 CAMPUS: Centro de Ciências Agrárias CURSO: Ciências Biológicas HABILITAÇÃO: Bacharelado em Ciências

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Aplicação em escala laboratorial

Aplicação em escala laboratorial Aplicação em escala laboratorial Índice Velcorin Aplicação em escala laboratorial Página 3 5 Introdução Página 3 Medidas de Segurança Página 3 Metodologia (preparo) Página 4 Metodologia Microbiológica

Leia mais

Extracção de ADN de mancha de sangue por Chelex 100. Protocolo experimental:

Extracção de ADN de mancha de sangue por Chelex 100. Protocolo experimental: Extracção de ADN de mancha de sangue por Chelex 100 1. Num tubo eppendorf misturar 1ml de água desionizada estéril com uma mancha de sangue com aproximadamente 3mm²; 2. Incubar à temperatura ambiente no

Leia mais

REVOLUÇÃO DA GENÉTICA. Ana Paula N. Guimarães

REVOLUÇÃO DA GENÉTICA. Ana Paula N. Guimarães REVOLUÇÃO DA GENÉTICA Ana Paula N. Guimarães apng89@gmail.com Tópicos Questionamentos: Revolução da Genética? Voltando um pouco no tempo: 1990 Promessas do Projeto Genoma O que aconteceria na prática Por

Leia mais

IDENTIFICAÇÃO DE SUBSTÂNCIAS E AVALIAÇÃO DA SUA PUREZA

IDENTIFICAÇÃO DE SUBSTÂNCIAS E AVALIAÇÃO DA SUA PUREZA IDENTIFICAÇÃO DE SUBSTÂNCIAS E AVALIAÇÃO DA SUA PUREZA O que se pretende Utilizar técnicas experimentais de determinação de propriedades físicas características das substâncias como métodos de identificação

Leia mais

Colorações de Bactérias: Coloração Simples e Coloração Diferencial(Coloração de Gram)

Colorações de Bactérias: Coloração Simples e Coloração Diferencial(Coloração de Gram) Escola Secundária com 3º Ciclo D.Manuel I Beja Acção de Formação ORGANIZAÇÃO E GESTÃO DOS LABORATÓRIOS ESCOLARES Guião de actividade laboratorial versão aluno Colorações de Bactérias: Coloração Simples

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Material genético Material genético Genes e cromossomas As informações hereditárias transmitidas ao longo das gerações, segundo

Leia mais

Kits Didáticos. Laboratórios Portáteis

Kits Didáticos. Laboratórios Portáteis Kits Didáticos Laboratórios Portáteis Kit pedagógico de genética A Procura do Suspeito (Papiloscopia - Jogo) Kit na forma de jogo para o ensino fundamental e médio para ensino de genética de herança mendeliana

Leia mais

Unidade 5 Cresc. e renovação celular VIII CRESCIMENTO E RENOVAÇÃO DE TECIDOS

Unidade 5 Cresc. e renovação celular VIII CRESCIMENTO E RENOVAÇÃO DE TECIDOS 1 Unidade 5 Cresc. e renovação celular VIII CRESCIMENTO E RENOVAÇÃO DE TECIDOS A mitose garante que 2 a partir de uma única célula, se formem duas células geneticamente idênticas todos os fenómenos de:

Leia mais

Biologia. Questão 1. Questão 2. Avaliação: Aluno: Data: Ano: Turma: Professor:

Biologia. Questão 1. Questão 2. Avaliação: Aluno: Data: Ano: Turma: Professor: Avaliação: Aluno: Data: Ano: Turma: Professor: Biologia Questão 1 (Fuvest 2002) Os vírus A. ( ) possuem genes para os três tipos de RNA (ribossômico, mensageiro e transportador), pois utilizam apenas aminoácidos

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

ENEM PROVA AZUL RESUMO

ENEM PROVA AZUL RESUMO ENEM 2009 - PROVA AZUL RESUMO 2009 (19 questões) 1 Ecologia - Desequilíbrio Ambiental Bioquímica 1 2 Fisiologia Humana - Interpretação gráfica Biotecnologia 1 3 Doenças virais e Bioquímica - Soro x Vacina

Leia mais

Pareceres dos Projetos de Biologia Molecular

Pareceres dos Projetos de Biologia Molecular Pareceres dos Projetos de Biologia Molecular Grupo 1: A técnica pro-drug combinando o adhsvtk e a droga gcv como uma estratégia de terapia gênica Através das técnicas Pro-Drug e Suicide Gene therapy, o

Leia mais

Prof. Msc. Cleysyvan Macedo

Prof. Msc. Cleysyvan Macedo Prof. Msc. Cleysyvan Macedo PRINCIPAIS CARACTERÍSTICAS DOS VÍRUS: Não possui estruturas celulares (membrana plasmática, citoplasma, etc.). São formado basicamente por uma cápsula protéica denominada capsômero

Leia mais

Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos

Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos INSTITUTO SUPERIOR POLITÉCNICO DE COIMBRA / ESCOLA SUPERIOR AGRÁRIA Exame de Biologia para Avaliação da Capacidade para Acesso ao Ensino Superior dos maiores de 23 anos Data: 02 Maio 2012 Duração: 2 horas

Leia mais

Alimentos transgênicos. Aluna: Maria Eugênia Araújo

Alimentos transgênicos. Aluna: Maria Eugênia Araújo Alimentos transgênicos Aluna: Maria Eugênia Araújo Sumário O que é um transgênico? Métodos de transgenia Aplicações da transgenia Pontos positivos Pontos negativos Rotulagem dos transgênicos Considerações

Leia mais

MORFOLOGIA E ESTRUTURA DA CÉLULA BACTERIANA

MORFOLOGIA E ESTRUTURA DA CÉLULA BACTERIANA MORFOLOGIA E ESTRUTURA DA CÉLULA BACTERIANA MICROBIOLOGIA I AULA 2 Profa Cristina Lacerda S Petraro Silva 1- FORMA E ARRANJO A forma: - diz respeito ao formato individual da célula bacteriana -determinada

Leia mais

EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS. Professor Fláudio

EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS. Professor Fláudio EVOLUÇÃO: IDÉIAS E EVIDÊNCIAS Professor Fláudio EVIDÊNCIAS DE EVOLUÇÃO EVOLUÇÃO conjunto de processos que levam a modificações nos seres vivos ao longo do tempo, podendo dar origem a novas espécies Entender

Leia mais

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS

PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS ESCOLA SUPERIOR AGRÁRIA Instituto Politécnico de Coimbra 2015 PROVA ESCRITA DESTINADA A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS DATA 27/04/2015 HORA 10.00H - 12.00H

Leia mais

Escola Secundária de Casquilhos Disciplina: Biologia Docente: Isabel Lopes Trabalho realizado por: Inês da Mata nº 13 Turma: 12ºA

Escola Secundária de Casquilhos Disciplina: Biologia Docente: Isabel Lopes Trabalho realizado por: Inês da Mata nº 13 Turma: 12ºA Escola Secundária de Casquilhos Disciplina: Biologia Docente: Isabel Lopes Trabalho realizado por: Inês da Mata nº 13 Turma: 12ºA Barreiro, 2009 Há grandeza neste modo de ver a vida, com as suas potencialidades,

Leia mais

Extensão da herança a Mendeliana

Extensão da herança a Mendeliana Extensão da herança a Mendeliana Genética Básica Licenciatura em Biologia Victor Martin Quintana Flores Diferentes padrões de herança a Mendeliana Tipo Descrição Mendeliana simples Ligado ao X Alelos letais

Leia mais

Protocolo experimental

Protocolo experimental Protocolo experimental E se a salinidade se alterar? Enquadramento Teórico Todos os animais necessitam de condições ambientais favoráveis à sua sobrevivência e manutenção. Parâmetros como por exemplo a

Leia mais

Determinação de lipídios em leite e produtos lácteos pelo método butirométrico

Determinação de lipídios em leite e produtos lácteos pelo método butirométrico Página 1 de 10 1 Escopo Este método tem como objetivo determinar a porcentagem de lipídios em leite e produtos lácteos pelo método butirométrico (Gerber). 2 Fundamentos Baseia-se na separação e quantificação

Leia mais

PROTOCOLO DE UTILIZAÇAO

PROTOCOLO DE UTILIZAÇAO PROTOCOLO DE UTILIZAÇAO Hibridação para cortes de tecidos preservados em parafina Materiais fornecidos: DNA marcado com moléculas fluorescentes (sonda). Buffer(tampão) de Hibridação Reativos para preparar

Leia mais

Para mudar de modo, pressionar o nariz da bola só depois da música/ sons pararem!

Para mudar de modo, pressionar o nariz da bola só depois da música/ sons pararem! Para mudar de modo, pressionar o nariz da bola só depois da música/ sons pararem! Guardar estas instruções para referência futura pois contêm informação importante. Funciona com 3 pilhas AA (incluídas).

Leia mais

Terra um planeta com Vida

Terra um planeta com Vida Condições que permitiram o aparecimento da Vida na Terra O aparecimento da Vida resultou das características particulares da Terra. Formação da Terra há cerca de 4600 M.a. Formação de uma atmosfera primitiva.

Leia mais

OUTUBRO - INTERVENÇÃO EXTRAÇÃO DE DNA VEGETAL PLANO DA INTERVENÇÃO

OUTUBRO - INTERVENÇÃO EXTRAÇÃO DE DNA VEGETAL PLANO DA INTERVENÇÃO OUTUBRO - INTERVENÇÃO EXTRAÇÃO DE DNA VEGETAL Autor: Cláudia Lucher de Freitas PLANO DA INTERVENÇÃO CONTEXTUALIZAÇÃO DNA é a sigla dada para o ácido desoxirribonucléico, que é um complexo de moléculas

Leia mais

CATÁLOGO DE MATERIAL LABORATORIAL

CATÁLOGO DE MATERIAL LABORATORIAL UNIVERSIDADE FEDERAL DE OURO PRETO PRÓ-REITORIA DE PLANEJAMENTO E DESENVOLVIMENTO DIRETORIA DE ORÇAMENTOS E FINANÇAS COORDENADORIA DE SUPRIMENTOS CATÁLOGO DE MATERIAL LABORATORIAL OURO PRETO MARÇO / 2016

Leia mais

Análise de Variância (ANOVA)

Análise de Variância (ANOVA) Análise de Variância (ANOVA) Prof. Dr. Vinicius Campos Disciplina de Bioestatística e Delineamento Experimental Graduação em Biotecnologia - UFPel Abordagens da aula... 1. Bases da ANOVA 2. Tipos de ANOVA

Leia mais

Organização do Genoma

Organização do Genoma Organização do Genoma Bibliografia: The Cell A Molecular Approach (Fourth Edition) Geoffrey M. Cooper & Robert E. Hausman. ASM Press & Sinauer Associates, Inc. 2007. (Disponível para ser requisitado na

Leia mais

Produtos para Cultivo Celular

Produtos para Cultivo Celular Produtos para Cultivo Celular CULTIVO CELULAR Através da técnica de cultivo celular, células animais ou vegetais são mantidas vivas em crescimento fora do seu tecido original, em condições controladas.

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra MICROBIOLOGIA António Veríssimo Paula Morais Medição do crescimento de E. coli Fundamento A verificação do desenvolvimento das populações de E. coli

Leia mais

CADERNO DE LABORATÓRIO

CADERNO DE LABORATÓRIO CADERNO DE LABORATÓRIO 1º Ciclo - 4º ano VOU PREVER VOU EXPERIMENTAR VOU CONCLUIR VOU AVALIAR O QUE APRENDI Personaliza o teu caderno fazendo um desenho Nome: Turma: Ano: O caderno de laboratório contém

Leia mais

Bases ecológicas da resistência bacteriana às drogas

Bases ecológicas da resistência bacteriana às drogas Bases ecológicas da resistência bacteriana às drogas Drogas antimicrobianas: mecanismo de ação Um aspecto do controle do crescimento dos microrganismos envolve a utilização de fármacos no tratamento de

Leia mais

Técnicas de Trabalho com Material Volumétrico

Técnicas de Trabalho com Material Volumétrico Universidade Federal de Goiás Instituto de Química Curso Experimental de Transformações Químicas 2010 Prof. Dr. Anselmo (adaptado, Agustina) Técnicas de Trabalho com Material Volumétrico 1 Objetivo Nesta

Leia mais

Guia de leitura. Método de disco-difusão para teste de sensibilidade aos antimicrobianos do EUCAST. Versão 4.0 Junho 2014

Guia de leitura. Método de disco-difusão para teste de sensibilidade aos antimicrobianos do EUCAST. Versão 4.0 Junho 2014 Guia de leitura 1 Método de disco-difusão para teste de sensibilidade aos antimicrobianos do EUCAST Versão 4.0 Junho 2014 Versão para Português válida a partir de 01/03/2016 Alterações na apresentação

Leia mais

EXAMES TOXICOLÓGICOS PARA DETECÇÃO DE DROGAS DE ABUSO APLICAÇÃO DO TESTE PELO MÉTODO MERGULHO E CONTA-GOTAS

EXAMES TOXICOLÓGICOS PARA DETECÇÃO DE DROGAS DE ABUSO APLICAÇÃO DO TESTE PELO MÉTODO MERGULHO E CONTA-GOTAS EXAMES TOXICOLÓGICOS PARA DETECÇÃO DE DROGAS DE ABUSO APLICAÇÃO DO TESTE PELO MÉTODO MERGULHO E CONTA-GOTAS LEMBRAR SEMPRE O teste acima de 5 drogas, tem o painel dupla face. FRENTE VERSO CONTEÚDO DO KIT

Leia mais

Introdução a Biologia Molecular: DNA Nutrição

Introdução a Biologia Molecular: DNA Nutrição Introdução a Biologia Molecular: DNA Nutrição Prof. João Ronaldo Tavares de Vasconcellos Neto ABR/2011 HISTÓRICO Organização Células DNA + Proteínas Informação das proteínas e RNAs que serão sintetizadas

Leia mais

Determinação da densidade relativa das soluções de sacarose e dos açucares a estudar

Determinação da densidade relativa das soluções de sacarose e dos açucares a estudar Determinação da densidade relativa das soluções de sacarose e dos açucares a estudar 1. Densidade relativa A densidade relativa é uma propriedade física característica de cada substância e a sua determinação

Leia mais

INSTITUTO POLITÉCNICO DE SANTARÉM ESCOLA SUPERIOR AGRÁRIA DE SANTARÉM

INSTITUTO POLITÉCNICO DE SANTARÉM ESCOLA SUPERIOR AGRÁRIA DE SANTARÉM INSTITUTO POLITÉCNICO DE SANTARÉM ESCOLA SUPERIOR AGRÁRIA DE SANTARÉM PROVAS ESPECIALMENTE ADEQUADAS A AVALIAR A CAPACIDADE PARA A FREQUÊNCIA DOS CURSOS DE LICENCIATURA DA ESCOLA SUPERIOR AGRÁRIA DE SANTARÉM,

Leia mais

Engenharia Genética e Biotecnologia

Engenharia Genética e Biotecnologia Engenharia Genética e Biotecnologia 1. (PUC - SP-2005) Encontram-se a seguir um esquema do embrião humano com aproximadamente 5 dias e um trecho sobre clonagem: Na clonagem terapêutica são utilizadas células-tronco,

Leia mais

AGRUPAMENTO DE ESCOLAS D. JOÃO V ESCOLA SECUNDÁRIA c/ 2º e 3º CICLOS D. JOÃO V

AGRUPAMENTO DE ESCOLAS D. JOÃO V ESCOLA SECUNDÁRIA c/ 2º e 3º CICLOS D. JOÃO V Informações aos Encarregados de Educação do trabalho a realizar no: 5º Ano Ciências Naturais Ano Letivo 2015/2016 1. Aulas previstas: Aulas (*) 5º1ª 5º2ª 5º3ª 5º4ª 1º Período: 21 de Setembro - 17 de Dezembro

Leia mais

BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA

BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA COMENTÁRIO DA PROVA DE BIOLOGIA A prova de Biologia apresentou uma boa abrangência em relação aos conteúdos programáticos solicitados. Envolveu conceitos fundamentais da Biologia, não descuidando de assuntos

Leia mais

APLICAÇÕES GOLD ANALISA PARA O QUICK LAB

APLICAÇÕES GOLD ANALISA PARA O QUICK LAB ÁCIDO ÚRICO - PP - Cat. 451 200 Determinações - Volume: 200 ml Técnica de Análise: Seguir as Instruções de Uso do produto. Calibração Para a calibração, usar o (1) do kit ou o Calibrador Gold Analisa Cat.

Leia mais

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS

CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS CAPÍTULO 6: COMPOSTOS ORGÂNICOS PROTEÍNAS CAP. 7: COMPOSTOS ORGÂNICOS ÁCIDOS NUCLEICOS E VITAMINAS 1. Dentre os diferentes compostos orgânicos das células temos as proteínas. Sobre estas responda: a) Cite

Leia mais

Determinação do poder rotatório específico das soluções

Determinação do poder rotatório específico das soluções Determinação do poder rotatório específico das soluções O poder rotatório específico vai ser determinado utilizando o polarímetro. É necessário proceder-se à calibração deste aparelho. Constituição e características

Leia mais

Sessão 2 quarta-feira 14h30 Sessão 3 sexta-feira 9h30 Sessão 4 sexta-feira 14h30. Edifício de Engenharia Biológica, Campus de Gualtar

Sessão 2 quarta-feira 14h30 Sessão 3 sexta-feira 9h30 Sessão 4 sexta-feira 14h30. Edifício de Engenharia Biológica, Campus de Gualtar Workshops de Biotecnologia para alunos do 3º ciclo e Secundário Datas Sessão 1 quarta-feira 9h30 Sessão 2 quarta-feira 14h30 Sessão 3 sexta-feira 9h30 Sessão 4 sexta-feira 14h30 Duração 2h30 Local Edifício

Leia mais

Teoria cromossômica da herança e genes ligados ao sexo. Herança a ligada ao sexo. Prof. Victor Martin Quintana Flores

Teoria cromossômica da herança e genes ligados ao sexo. Herança a ligada ao sexo. Prof. Victor Martin Quintana Flores Teoria cromossômica da herança e genes ligados ao sexo Herança a ligada ao sexo Genética BásicaB Prof. Victor Martin Quintana Flores 1 Nesta aula veremos como a transmissão de cromossomos está relacionada

Leia mais

CIÊNCIAS EJA 5ª FASE PROF.ª SARAH DOS SANTOS PROF. SILONE GUIMARÃES

CIÊNCIAS EJA 5ª FASE PROF.ª SARAH DOS SANTOS PROF. SILONE GUIMARÃES CIÊNCIAS EJA 5ª FASE PROF.ª SARAH DOS SANTOS PROF. SILONE GUIMARÃES REVISÃO DOS CONTEÚDOS Unidade II Ser Humano e Saúde 2 REVISÃO DOS CONTEÚDOS Aula 13 Revisão e Avaliação 3 REVISÃO 1 O sistema reprodutor

Leia mais

Curso Vocacional 2º ciclo Planificação Anual

Curso Vocacional 2º ciclo Planificação Anual Agrupamento de Escolas General Humberto Delgado Sede na Escola Secundária/3 José Cardoso Pires Santo António dos Cavaleiros Curso Vocacional 2º ciclo Planificação Anual 2015-2016 CIÊNCIAS NATURAIS METAS

Leia mais

CIÊNCIAS. Prof. Diângelo

CIÊNCIAS. Prof. Diângelo CIÊNCIAS Prof. Diângelo TABELA PERÍODICA Aula 18 Respiração Celular Respiração celular é o processo de conversão das ligações químicas de moléculas ricas em energia que poderão ser usadas nos processos

Leia mais

IMPRESSA F50 / F5 / F505 Resumo das instruções

IMPRESSA F50 / F5 / F505 Resumo das instruções IMPRESSA F50 / F5 / F505 Resumo das instruções Primeira colocação em funcionamento Ligar (I) interruptor principal (no lado posterior) Encher grãos Carregar no botão de operação Texto no display: SPRACHE

Leia mais

Estudo Dirigido Sequenciamento de DNA

Estudo Dirigido Sequenciamento de DNA Estudo Dirigido Sequenciamento de DNA Professores Dra. Daniela Alves Silvestre OBJETIVOS Compreender a partir do estudo da técnica de sequenciamento do DNA através da utilização de didesoxinucleotídeos,

Leia mais

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA

PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA PRINCÍPIOS GERAIS DA RECOMBINAÇÃO DO DNA ÍNDICE Introdução Evolução: mutação e recombinação do DNA Erros de Recombinação: Câncer? Engenharia Genética e Transgênicos Recombinação homóloga - Modelo Holliday

Leia mais

Domínio 1: PROCESSOS VITAIS COMUNS AOS SERES VIVOS Subdomínio 1: Trocas nutricionais entre o organismo e o meio: nos animais

Domínio 1: PROCESSOS VITAIS COMUNS AOS SERES VIVOS Subdomínio 1: Trocas nutricionais entre o organismo e o meio: nos animais A G R U P A M E N T O D E E S C O L A S D R. V I E I R A D E C A R V A L H O D E P A R T A M E N T O D E M A T E M Á T I C A E C I Ê N C I A S E X P E R I M E N T A I S P L A N I F I C A Ç Ã O A N U A

Leia mais

Exercícios em biotecnologia

Exercícios em biotecnologia I N PI DA PROPRIEDADE Exercícios em biotecnologia Karla Kovary Examinadora de Patentes Divisão de Biotecnologia INPI - DIRPA Oficina de Redação de Patentes 25 a 28/08/2008 Questões para determinar se uma

Leia mais

PLANO CURRICULAR DISCIPLINAR. Ciências Naturais 9º Ano

PLANO CURRICULAR DISCIPLINAR. Ciências Naturais 9º Ano PLANO CURRICULAR DISCIPLINAR Ciências Naturais 9º Ano COMPETÊNCIAS TEMAS/UNIDADES CONTEÚDOS 1º Período Aulas Previstas 28 Definir saúde segundo a O.M.S. Identificar medidas individuais promotoras de saúde.

Leia mais

Dica de Manejo - Coleta de Sangue

Dica de Manejo - Coleta de Sangue Dica de Manejo - Coleta de Sangue Introdução A coleta de sangue deve ser uma prática conhecida pelos encarregados das granjas. A partir do sangue coletado, uma grande quantidade de testes pode ser realizada,

Leia mais

Conteúdo Descritivo. Saúde e qualidade de vida da população

Conteúdo Descritivo. Saúde e qualidade de vida da população Departamento de Matemática e Ciências Experimentais Disciplina: Ciências Naturais PLANIFICAÇÃO ANUAL DO 9º ANO Conteúdo Descritivo Nº de aulas previstas [5'] 1º PERÍODO 36 Apresentação/ acolhimento / considerações

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Departamento de Biologia da Universidade do Minho Mestrado em Genética Molecular Guião das aulas práticas Ana Preto Andreia Gomes Cristina Aguiar Rui Oliveira MÉTODOS DE ANÁLISE E DETECÇÃO DE PROTEÌNAS

Leia mais

Conceituar e discutir os benefícios e os prejuízos da utilização de transgênicos na

Conceituar e discutir os benefícios e os prejuízos da utilização de transgênicos na Transgênicos Objetivo da Aula agricultura. Conceituar e discutir os benefícios e os prejuízos da utilização de transgênicos na Organismos transgênicos ou Organismos Geneticamente Modificados (OGM) são

Leia mais

R E L A T Ó R I O D A A C T I V I D A D E L A B O R A T O R I A L

R E L A T Ó R I O D A A C T I V I D A D E L A B O R A T O R I A L 1 R E L A T Ó R I O D A A C T I V I D A D E L A B O R A T O R I A L ACTIVIDADE LABORATORIAL 1.3 Efeitos da temperatura e da concentração na progressão global de uma reacção de equilíbrio com iões de cobalto

Leia mais

PROCEDIMENTO DE OPERAÇÃO PADRÃO - POP

PROCEDIMENTO DE OPERAÇÃO PADRÃO - POP PÁG.: 1/8 1. OBJETIVO Definir um procedimento para preparação dos meios de cultura pelo. 2. ALCANCE Este procedimento se aplica a todos os lotes de meios de cultura preparados pelo Controle Microbiológico,

Leia mais

Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2009/2010. Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano

Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2009/2010. Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano Faculdade de Medicina da Universidade de Coimbra Ano Lectivo 2009/2010 Unidade Curricular de BIOQUÍMICA II Mestrado Integrado em MEDICINA 1º Ano ENSINO PRÁTICO E TEORICO-PRÁTICO 7ª AULA PRÁTICA Determinação

Leia mais

Células. Capitulo 1: Fundamentos da Biologia Celular- Alberts- 2ª edição

Células. Capitulo 1: Fundamentos da Biologia Celular- Alberts- 2ª edição Células Capitulo 1: Fundamentos da Biologia Celular- Alberts- 2ª edição O que é uma célula? Pequenas unidades envolvidas por membranas e preenchidas por uma solução aquosa contendo agentes químicos, dotadas

Leia mais

Unidade 2. jcmorais 09

Unidade 2. jcmorais 09 Unidade 2 jcmorais 09 Situação Problemática Que desafios se colocam à genética no melhoramento da qualidade de vida? Cap. 1.1. Transmissão das características Como são transmitidas as características dos

Leia mais

- CAPÍTULO 1 - INTRODUÇÃO À BIOLOGIA

- CAPÍTULO 1 - INTRODUÇÃO À BIOLOGIA - CAPÍTULO 1 - INTRODUÇÃO À BIOLOGIA 1. Quais são os elementos encontrados, geralmente, em maior quantidade no corpo dos seres vivos? 2. Todos os seres vivos, com exceção dos vírus, são compostos por células.

Leia mais

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T?

Exemplos de Aplicações da Teoria das Probabilidades em Biologia. Qual a probabilidade de que o próximo nucleotídeo na seqüência seja A, C, G ou T? Exemplos de Aplicações da Teoria das Probabilidades em Biologia Exemplo 1. Suponha que se conheça a seguinte seqüência de nucleotídeos em uma molécula de DNA: AGCTTCCGATCCGCTATAATCGTTAGTTGTTACACCTCTG Qual

Leia mais

Prever qual é a altura máxima atingida após o ressalto de uma bola que é deixada cair de uma determinada altura.

Prever qual é a altura máxima atingida após o ressalto de uma bola que é deixada cair de uma determinada altura. ACTIVIDADE LABORATORIAL FÍSICA 0.º ANO ALF 2.2 BOLA SALTITONA O que se pretende Prever qual é a altura máxima atingida após o ressalto de uma bola que é deixada cair de uma determinada altura. Para tal

Leia mais

CITOPLASMA E ORGANELAS CITOPLASMÁTICAS. Instituto Federal de Santa Catarina Curso de Biotecnologia Prof. Paulo Calixto

CITOPLASMA E ORGANELAS CITOPLASMÁTICAS. Instituto Federal de Santa Catarina Curso de Biotecnologia Prof. Paulo Calixto CITOPLASMA E ORGANELAS CITOPLASMÁTICAS Instituto Federal de Santa Catarina Curso de Biotecnologia Prof. Paulo Calixto 1943 1944 1953 1956 1961-66 1973 1975 1982 1988 1990 1996 2000-03 Biotecnologia Algumas

Leia mais

Biologia Luiz Segundo

Biologia Luiz Segundo Biologia Luiz Segundo TEXTO PARA A PRÓXIMA QUESTÃO: Desde que médicos começaram a solicitar regularmente exames de tomografia computadorizada, cientistas se preocupam que o procedimento de imageamento

Leia mais

Síntese do acetato de n-butilo ou etanoato de n-butilo

Síntese do acetato de n-butilo ou etanoato de n-butilo Projeto Ciência Viva INTRODUÇÃO À QUÍMICA VERDE, COMO SUPORTE DA SUSTENTABILIDADE, NO ENSINO SECUNDÁRIO PL 3.4 Identificação e síntese de substâncias com aromas e sabores especiais Síntese do acetato de

Leia mais

Ano lectivo 2010 / 2011 Conteúdos programáticos essenciais

Ano lectivo 2010 / 2011 Conteúdos programáticos essenciais Ano de escolaridade: 7º ano Área curricular disciplinar de Ciências Naturais A Terra no Espaço Terra - Um Planeta com Vida. - Condições que permitem a existência de vida. - A Terra como um Sistema. Ciência,

Leia mais

3 Bonecos de sal E3-1

3 Bonecos de sal E3-1 3 Bonecos de sal E3-1 o que necessitas INGREDIENTES BÁSICOS uma medida de farinha uma medida de sal fino meia medida de água da torneira MATERIAL recipientes para os ingredientes chávenas para servirem

Leia mais

ROTEIRO DE AULAS PRÁTICAS DA DISCIPLINA FISIOLOGIA VEGETAL PROFª CYNTHIA CAVALCANTI DE ALBUQUERQUE

ROTEIRO DE AULAS PRÁTICAS DA DISCIPLINA FISIOLOGIA VEGETAL PROFª CYNTHIA CAVALCANTI DE ALBUQUERQUE GOVERNO DO ESTADO DO RIO GRANDE DO NORTE Secretaria do Estado da Educação, da Cultura e dos Desportos - SECD UNIVERSIDADE DO ESTADO DO RIO GRANDE DO NORTE - UERN FACULDADE DE CIÊNCIAS EXATAS E NATURAIS

Leia mais

CULTIVO IN VITRO DE SEGMENTOS NODAIS DE HORTELÃ

CULTIVO IN VITRO DE SEGMENTOS NODAIS DE HORTELÃ MICROPROPAGAÇÃO CULTIVO IN VITRO DE SEGMENTOS NODAIS DE HORTELÃ As mentas ou hortelãs são plantas perenes, raramente anuais, que se expandem mediante estolões. O fenômeno de hibridização interespecífica,

Leia mais

Extensões da Análise Mendeliana. Explicações moleculares

Extensões da Análise Mendeliana. Explicações moleculares Extensões da Análise Mendeliana Explicações moleculares Tipos de interações Tipo Descrição 1. Herança Mendeliana Simples Termo reservado para descrever situações em que os alelos seguem estritamente os

Leia mais

Assinale abaixo quais os processos que resultam na expressão das características individuais:

Assinale abaixo quais os processos que resultam na expressão das características individuais: Atividade extra Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais os processos que resultam na expressão

Leia mais

4 O anticoagulante mais utilizado na coleta de sangue para a extração de DNA é:

4 O anticoagulante mais utilizado na coleta de sangue para a extração de DNA é: CONCURSO PARA VAGA DE TÉCNICO DE LABORATÓRIO PROVA ESPECÍFICA 1ª FASE NOME: RG: DATA: 1 A extração de DNA é possível na seguinte condição: 2 - Um rastro fragmentado de DNA em gel de agarose indica: 3 A

Leia mais

GENÉTICA CLÍNICO-LABORATORIAL

GENÉTICA CLÍNICO-LABORATORIAL GENÉTICA CLÍNICO-LABORATORIAL Aula 3 Licenciatura em Ciências Biomédicas Laboratoriais 2016/17 1º Semestre Sumário Análise de pedigrees 1. Herança monogénica recessiva 2. Herança monogénica dominante 3.

Leia mais

Escola Secundária do Padrão da Légua (402412) Disciplina de Biologia do 12º ano de escolaridade

Escola Secundária do Padrão da Légua (402412) Disciplina de Biologia do 12º ano de escolaridade ÁREA DISCIPLINAR DE CTV Disciplina de Biologia do 12º ano de escolaridade Unidade 1 Reprodução Humana e Manipulação da Fertilidade Unidade 2 Património Genético Autoavaliação Unidade 2 Património Genético

Leia mais

Fatores que podem influenciar o tempo de Dissolução de um material

Fatores que podem influenciar o tempo de Dissolução de um material Fatores que podem influenciar o tempo de Dissolução de um material Questão I O Tamanho do Rebuçado Questão II O Tipo de Rebuçado Questão III O Estado de Divisão do rebuçado Questão IV A Quantidade de Líquido

Leia mais

Procedimento Operacional Padrão - POP

Procedimento Operacional Padrão - POP Página 1 de 12 Biobanco Procedimento Operacional Padrão para: Processamento de Sangue POP: V. 1.0 Nome: Extração de DNA em sangue total Efetiva: dezembro, 22 autora: Erika Regina Manuli Aprovação Profa.

Leia mais

Protocolos de experiências realizadas

Protocolos de experiências realizadas Protocolos de experiências realizadas 1. Experiências nº 1, 2, 3 : Os materiais e as suas propriedades solubilidade 2. Experiência nº 4, 5, 6 : "Os materiais e as suas propriedades - dureza" 3. Experiência

Leia mais

Preparação do gel de poliacrilamida

Preparação do gel de poliacrilamida Preparação do gel de poliacrilamida Materiais: - álcool 70% (limpeza) - SDS 10% - água Milli-Q - APS 10% - acrilamida/ bisacrilamida 40% - TEMED - tampão Tris-HCl, ph 8,8 e 6,8 - vidros 1º Limpar os vidros

Leia mais

Célula bacteriana. Membrana plasmática Parede celular Cápsula. DNA associado ao mesossomo. Mesossomo

Célula bacteriana. Membrana plasmática Parede celular Cápsula. DNA associado ao mesossomo. Mesossomo Reino Monera Célula bacteriana Mesossomo DNA associado ao mesossomo Membrana plasmática Parede celular Cápsula Enzimas relacionadas com a respiração, ligadas à face interna da membrana plasmática Flagelo

Leia mais

Colégio dos Santos Anjos Avenida Iraí, 1330 Planalto Paulista A Serviço da Vida por Amor

Colégio dos Santos Anjos Avenida Iraí, 1330 Planalto Paulista  A Serviço da Vida por Amor Colégio dos Santos Anjos Avenida Iraí, 1330 Planalto Paulista www.colegiosantosanjos.g12.br A Serviço da Vida por Amor Curso: Fundamental I Ano: 4º ano Componente Curricular: Ciências Professor (a): Adionísia

Leia mais

LÂMPADA LED SMART A67 10W BIVOLT MANUAL DE INSTRUÇÃO DE USO

LÂMPADA LED SMART A67 10W BIVOLT MANUAL DE INSTRUÇÃO DE USO LÂMPADA LED SMART A67 10W BIVOLT MANUAL DE INSTRUÇÃO DE USO www.flc.com.br I. Visão Geral Este é um produto ecológico, econômico e eficaz, economiza até 90% de energia e dura até 10 vezes mais em relação

Leia mais

Biologia. ( ) centríolo (A) 2, 1, 3, 5, 6, 4. ( ) retículo endoplasmático (B) 2, 1, 3, 5, 4, 6. ( ) complexo de Golgi (C) 1, 6, 5, 3, 2, 4

Biologia. ( ) centríolo (A) 2, 1, 3, 5, 6, 4. ( ) retículo endoplasmático (B) 2, 1, 3, 5, 4, 6. ( ) complexo de Golgi (C) 1, 6, 5, 3, 2, 4 Biologia 21. Associe os números das estruturas celulares assinaladas no desenho com os respectivos nomes da coluna abaixo do desenho. A seguir, assinale a opção em que a seqüência coincida com o que foi

Leia mais