EXTRACÇÃO E QUANTIFICAÇÃO DE PROTEÍNAS DO GLÚTEN ASSOCIADAS À DOENÇA CELÍACA NA TRIBO TRITICEAE

Tamanho: px
Começar a partir da página:

Download "EXTRACÇÃO E QUANTIFICAÇÃO DE PROTEÍNAS DO GLÚTEN ASSOCIADAS À DOENÇA CELÍACA NA TRIBO TRITICEAE"

Transcrição

1 UNIVERSIDADE DE TRÁS-OS-MONTES E ALTO DOURO EXTRACÇÃO E QUANTIFICAÇÃO DE PROTEÍNAS DO GLÚTEN ASSOCIADAS À DOENÇA CELÍACA NA TRIBO TRITICEAE DISSERTAÇÃO DE MESTRADO EM BIOTECNOLOGIA PARA AS CIÊNCIAS DA SAÚDE LUÍS MIGUEL FERREIRA RAMOS SEABRA ORIENTADOR: PROFESSOR DOUTOR GILBERTO PAULO PEIXOTO IGREJAS VILA REAL, 2012

2 UNIVERSIDADE DE TRÁS-OS-MONTES E ALTO DOURO EXTRACÇÃO E QUANTIFICAÇÃO DE PROTEÍNAS DO GLÚTEN ASSOCIADAS À DOENÇA CELÍACA NA TRIBO TRITICEAE DISSERTAÇÃO DE MESTRADO EM BIOTECNOLOGIA PARA AS CIÊNCIAS DA SAÚDE Luís Miguel Ferreira Ramos Seabra Orientador: Professor Doutor Gilberto Paulo Peixoto Igrejas (Departamento de Genética e Biotecnologia, UTAD) Composição do Júri VILA REAL, 2012

3 AGRADECIMENTOS Com o término desta dissertação de 2º Ciclo, há a necessidade de expressar os meus mais sinceros agradecimentos a todos os que, por diversos motivos, contribuíram na realização deste trabalho. À Universidade de Trás-os-Montes e Alto Douro na pessoa do Professor Doutor Carlos Alberto Sequeira, Reitor da UTAD, pelas facilidades concedidas na realização deste trabalho. Ao Presidente da Escola de Ciências da Vida e do Ambiente da Universidade de Coimbra, na pessoa do Professor Doutor António Fontaínhas Fernandes, agradeço a disponibilização dos meios académicos para a realização desta dissertação. À Coordenação do Mestrado em Biotecnologia para as Ciências da Saúde, na pessoa do Professor Doutor Valdemar Carnide, agradeço a oportunidade que tive em frequentar este Mestrado e pelo envolvimento na aprovação do plano de trabalho. Ao Instituto de Biotecnologia e Bioengenharia, Centro de Genómica e Biotecnologia (IBB/CGB-UTAD), na pessoa do Professor Doutor Henrique Guedes- Pinto, pela disponibilização dos meios necessários à execução desta dissertação. Aos Docentes do 1.º e 2.º ciclo, que ao longo do Curso e Mestrado me transmitiram os seus conhecimentos e contribuíram assim para o enriquecimento da minha formação académica e científica e da mesma forma me ajudaram a perspectivar acerca dos meus interesses futuros. Ao Professor Doutor Gilberto Igrejas, pelo seu papel como orientador, pelos ensinamentos, pelo apoio, pela contribuição prestada e pela constante disponibilidade. Ao Professor Doutor Carlos Carvalho, ao Professor Doutor Cristóvão Lima, à Professora Doutora Ana Coimbra e ao Professor Doutor Rui Vitorino pela disponibilidade, ajuda e contributo indispensável para a realização deste trabalho. I

4 Ao Miguel, pela ajuda, pelo contributo e pelas viagens à Universidade do Minho. À Daniela, à Susana e ao Júlio pela ajuda e pela partilha de conhecimentos. Ao Alexandre, à Hajer, à Sónia, ao Luís, ao Rui e aos restantes colegas de laboratório, pela disponibilidade, pela companhia, pelo bom ambiente e por todas as vezes que vieram mais cedo e saíram mais tarde do laboratório para que pudesse realizar os trabalhos práticos. À Sofia, pela amizade, pelo apoio, pela paciência e pelo auxílio na revisão desde trabalho. Aos meus Pais e à minha irmã pelo apoio e incentivo permanentes em todos os projectos que decido realizar. A todos os outros colegas e amigos que sempre me ajudaram e apoiaram nas diversas etapas da minha vida e me ajudaram a seguir em frente. A todas as pessoas que directa ou indirectamente permitiram a realização e conclusão deste trabalho, o meu muito obrigado. II

5 RESUMO A ingestão de glúten por doentes celíacos pode provocar danos no intestino e um conjunto de variadíssimos sintomas que vão desde a alteração dos hábitos intestinais, malnutrição, diarreia, fadiga e perda de peso ao atraso do crescimento, osteoporose, infertilidade e linfoma. Actualmente esta doença afecta cerca de 1% da população mundial. Recorrendo às técnicas actuais de análise proteómica, foi objectivo deste trabalho avaliar a prevalência do péptido 33-mer em 19 variedades de trigo (Triticum spp.), uma landrace (Triticum aestivum L.), 3 variedades de centeio (Secale cereale L.), 12 populações regionais de centeio e um centeio silvestre (Secale vavilovii), cultivados em Portugal. As proteínas de reserva foram extraídas através de dois métodos distintos, as metodologias propostas por Singh e colaboradores, publicada em 1991, e a de extracção em duas etapas adaptada de van den Broeck e colaboradores, publicada em As proteínas foram separadas por electroforese em gel de poliacrilamida na presença de detergente dodecil sulfato de sódio (sodium dodecyl sulfate - polyacrylamide gel electrophoresis, SDS-PAGE), transferidas por Western-blotting, e hibridadas com o anticorpo monoclonal Anti-Gliadin 33-mer (G12). Os resultados da técnica de Western blotting foram estimados pela intensidade da marcação de cada perfil proteico, sendo que a cada variedade foi atribuído um valor entre 0 e 15, que corresponde ao somatório dos valores de intensidade obtidos com cada método de extracção e reflecte a capacidade de hibridação do anticorpo com cada variedade em estudo. Posteriormente, 21 bandas das diversas variedades que apresentavam uma elevada capacidade de hibridação com o anticorpo foram isoladas e identificadas por ionização e dessorção a laser assistida por matriz tempo de voo (matrix-assisted laser desorption/ionization time of flight, MALDI-TOF). Através dos resultados obtidos foi possível confirmar que as variedades de trigo apresentam, de uma forma geral, uma maior prevalência de 33-mer que as variedades de III

6 centeio, 7,1 face a 5,8, respectivamente. Foi possível identificar as diferenças na prevalência entre as várias variedades e foi demonstrado que existe uma maior prevalência deste péptido na fracção das gliadinas que na fracção das gluteninas. O valor mais elevado foi o da variedade de trigo Ariesol (11) e os valores mais reduzidos foram os dos centeios Alvão e Picasso (3). Ao contrário de outros trabalhos, este estudo não permite afirmar que as variedades antigas são menos tóxicas que as variedades modernas, uma vez que os trigos antigos (8) apresentaram capacidade de hibridação superior à média dos trigos (7,1). Foi ainda possível verificar que os trigos duros (tetraplóides) (8,8) apresentaram uma capacidade de hibridação superior aos trigos moles (hexaplóides) (6,5). Das 21 bandas, foi possível identificar 4 sequências proteicas através da utilização da base de dados NCBI (National Center for Biothecnology Information). À luz dos conhecimentos actuais estas sequências não se encontram descritas como associadas à doença celíaca. A metodologia de extracção em duas etapas mostrou ser mais rápida e fácil de executar na realização de SDS-PAGE que a metodologia de Singh, usada rotineiramente no laboratório. Complementarmente, o kit Ridascreen permitiu comprovar os resultados gerais obtidos, no entanto, uma vez que detecta uma sequência de aminoácidos (QQPFP) diferente da do péptido 33-mer, alguns resultados foram discordantes dos obtidos com o anticorpo Anti-Gliadin 33-mer (G12). Palavras-chave: Doença celíaca, Triticeae, Glúten, SDS-PAGE, Western blotting, MALDI-TOF. IV

7 SUMMARY The intake of gluten by celiac disease patients can cause damage in the small intestine and a set of widely varying symptoms ranging from a change in bowel habits, malnutrition, diarrhea, fatigue and weight loss to delayed growth, osteoporosis, infertility and lymphoma. Currently this disease affects about 1% of the world s population. Using the current techniques for proteomic analysis, the aim of this study was to quantify the prevalence of the 33-mer peptide in 19 wheat varieties (Triticum spp.), one landrace (Triticum aestivum L.), 3 rye varieties (Secale cereale L.), 12 local populations of rye and one wild rye (Secale vavilovii), cultivated in Portugal. Storage proteins were extracted by two different methods, the method proposed by Singh and collaborators, published in 1991, and the two-step gluten extract method adapted from van den Broeck and collaborators, published in Proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred by Western blotting, and hybridized with the monoclonal antibody "Anti- Gliadin 33-mer (G12)". The Western blotting results were estimated by the intensity of the labeling of each protein profile; each variety was given a value between 1 and 15, which correspond to the sum of the intensity values obtained with each extraction method and reflects the capacity of hybridization of the antibody with each variety being studied. Subsequently, 21 bands of different varieties that showed high hybridization with the antibody were selected, isolated and identified by matrix-assisted laser desorption/ionization (MALDI-TOF). Out of the 21 bands isolated, it was possible to identify 4 protein sequences by using the NCBI database (National Center for Biothecnology Information). In light of present knowledge, these sequences have not been described as associated with celiac disease. Through the results it was possible to confirm that wheat varieties (7.1/15) have, in general, a higher prevalence of 33-mer than rye varieties, 7.1 compared to 5.8, respectively. It was possible to identify the differences in the prevalence between the V

8 different varieties and it was shown that there is a higher prevalence of this peptide in gliadins than in glutenins. The highest value was that of the wheat variety 'Ariesol' (11) and the lowest values were those of the rye 'Alvão' and 'Picasso' (3). In contrast to other studies, this one did not show that the older varieties are less toxic than modern varieties, since the varieties of older wheat (8) displayed a higher hybridization capacity than the wheat s average (7.1). It was further verified that the durum wheat (tetraploid) (8.8) had a higher hybridization capacity than the soft wheat (hexaploid) (6.5). Out of the 21 bands isolated, it was possible to identify 4 protein sequences by using the NCBI database (National Center for Biothecnology Information). In light of present knowledge, these sequences have not been described as associated with celiac disease. The two-step gluten extract method revealed to be faster and easier to run for SDS-PAGE than the method proposed by Singh, used routinely in the laboratory. Additionally, the Ridascreen kit validated the overall results; however, since it detects an amino acid sequence (QQPFP) different from that of the 33-mer peptide, some results were conflicting with those obtained with the antibody Anti-Gliadin 33-mer (G12). Keywords: Celiac disease, Triticeae, Gluten, SDS-PAGE, Western blotting, MALDI- TOF. VI

9 ÍNDICE GERAL Agradecimentos... I Resumo... III Summary... V Índice Geral... VII Índice de Quadros... IX Índice de Figuras... IX Lista de Abreviaturas... X Capítulo I Revisão Bibliográfica Grãos de Trigo e Centeio Constituição Proteicas dos Grãos Localização dos Genes das Proteínas do Glúten O Glúten na Alimentação Doenças relacionadas com o glúten Doença Celíaca Epidemiologia da Doença Celíaca Manifestação Clínica Doenças Associadas à Doença Celíaca Factores Ambientais Alternativas aos produtos com glúten Factores Genéticos Patogénese da Doença Celíaca Contributos da Genómica e da Proteómica Objectivos e Implicações deste Estudo Capítulo II - Material e Métodos Material Vegetal Métodos Protocolo I - Extracção do glúten em duas etapas (2009) Protocolo II Metodologia proposta por Singh (1991) Protocolo de extracção das gliadinas e das gluteninas Extracção das gluteninas Extracção das gliadinas VII

10 2.3 Quantificação das Fracções Proteicas Método de Bradford Ridascreen - Gliadin Competitive (R-Biopharm) Electroforese do Tipo SDS-PAGE Coloração com Azul de Coomassie Coloração com Nitrato de Prata Western blotting Transferência Marcação com o anticorpo Optimização da metodologia de revelação Revelação/detecção por eletroquimioluminescência (ECL) Excisão e identificação das bandas proteicas Análise bioinformática e desenho de primers Capítulo III Resultados e Análise Capítulo IV - Discussão dos Resultados Capítulo V Conclusões e Perspectivas Bibliografia Anexos Anexo I Constituição das soluções para a extracção das proteínas Anexos II Método Bradford (Curva de Calibração) Anexo III Constituição das soluções para SDS-PAGE Anexo IV Constituição das soluções para Western blotting VIII

11 ÍNDICE DE QUADROS Quadro 1 - Síntese das caracteristicas das prolaminas do trigo... 3 Quadro 2 - Produtos que contêm ou podem conter glúten... 5 Quadro 3 - Prevalência da doença celíaca em alguns países de acordo com dados de rastreio Quadro 4 - Principais loci associados ao desenvolvimento da doença celíaca e o valor do seu risco relativo (odds ratio) Quadro 5 - Lista de epítopos relevantes reconhecidos pelos linfócitos T Quadro 6 - Varieades de trigo e centeio utilizadas neste trabalho Quadro 7 - Parâmetros alterados da técnica de SDS-PAGE Quadro 8 - Preparação dos géis de separação Quadro 9 - Preparação dos géis de concentração Quadro 10 - Descrição das diferenças entre os métodos de extracção apresentados na Figura Quadro 11 - Análise estatística dos resultados dos apresentados nas Figuras 7 e Quadro 12 - Resultados da identificação das bandas Quadro 13 - Lista de primers desenhados no programa PerlPrimer ÍNDICE DE FIGURAS Figura 1 - Constituição dos grãos de trigo e centeio... 1 Figura 2 - Nomenclatura proposta para classificação das doenças relacionadas com o glúten... 6 Figura 3 - Prevalência da doença celíaca na população caucasiana Figura 4 - Ciclos auto amplificantes no desenvolvimento da doença celíaca Figura 5 - Esquema representativo do Protocolo II Figura 6 - Imagem de um gel que representa parte do processo de optimização do protocolo de extracção em duas etapas Figura 7 - Exemplo dos resultados obtidos após a realização da metodologia da Western blotting com o anticorpo Anti-Gliadin 33-mer (G12) (Biomedal S. L.) Figura 8 - Valores atribuidos às diferentes variedades de trigo e centeio com base na intensidade dos perfis após a realização da metododogia de Western-blottin e hibridação com o anticorpo Anti-Gliadin 33- mer (G12) (Biomedal S. L.) Figura 9 - Valors da concentração (ng/ml) de glúten obtidos com recurso ao kit Ridascreen - Gliadin Compettitive (R-Biopharm), para as variedades de trigo Figura 10 - Exemplo da selecção dos Accession numbers para a sequência de Alvão, na base de dados NCBI Figura 11 - Selecção dos primers para a sequência para as três sequências estudadas IX

12 LISTA DE ABREVIATURAS ACN Acetonitrilo APS Persulfato de Sódio BSA Bovine Serum Albunin, albumina de soro bovino Da Dalton DC Doença celíaca DCR Doença celíaca refractária DTT Ditiotreitol ECL Eletroquimioluminescência HCl Ácido Clorídrico HLA Human leukocyte antigen, antígenos leucocitários humanos HMW High molecular weight, alto peso molecular HMW-GS High molecular weight glutenin subunits, subunidades de gluteninas de alto peso molecular Ig Imunoglobulina INF-γ Interferão-gama IPG x SDS-PAGE Immobilized ph gradient followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, electroforese bidimensional em gradiente de ph imobilizado e posterior electroforese em gel de poliacrilamida na presença detergente dodecil sulfato de sódio LMW Low molecular weight, baixo peso molecular LMW-GS Low molecular weight glutenin subunits, subunidades de gluteninas de baixo peso molecular NK Natural Killer cell, células exterminadoras naturais. ma Miliamperes MALDI-TOF Matrix-assisted laser desorption/ionization time of flight, ionização e dessorção a laser assistida por matriz tempo de voo M r Massa molecular MS/MS Tandem mass spectrometry, espectrometria de massa em tandem PBS Phosphate Buffered Saline, tampão fostato-salino PCR Polymerase chain reaction, reacção em cadeia pela acção da polimerase pi Ponto Isoeléctrico ppm Partes por milhão PVDF Fluoreto de polivinilideno rpm Rotações por minuto SDS Sodium dodecyl sulfate, detergente dodecil sulfato de sódio X

13 SDS-PAGE Sodium dodecyl sulfate - polyacrylamide gel electrophoresis, electroforese em gel de poliacrilamida na presença de detergente dodecil sulfato de sódio TCA Ácido tricloroacético TEMED Tetrametiletilenodiamina TG2 Transglutaminase 2 TPBS Tampão fosfato-salino com tween-20 Tris Hidroximetil aminometano V Volt WDEIA Wheat dependent exercise induced anaphylaxis, anafilaxia dependente do trigo induzida pelo exercício XI

14 Revisão Bibliográfica CAPÍTULO I REVISÃO BIBLIOGRÁFICA 1. GRÃOS DE TRIGO E CENTEIO O trigo é o terceiro cereal mais produzido no mundo, a seguir ao milho e ao arroz [1], tendo assim um importante peso na alimentação humana. Os cereais trigo e centeio são membros da família Poaceae e da tribo Triticeae. O amido é o maior constituinte dos grãos destes cereais e é considerado uma importante fonte de calorias na alimentação. No entanto, cerca de 8 a 15% da sua constituição são proteínas, sendo assim também uma importante fonte de proteica [2, 3]. Os grãos de trigo e centeio são, em geral, muito semelhantes, encontrando-se representada a sua constituição na Figura 1. Endosperm Pêlos Porção externa da Endosperma prega amiláceo Célula do endosperma Farelo Camada de aleurona Célula de aleurona Pericarpo Epiderme Hipoderme Células cruzadas Células tubulares Tegumento Testa Camada de hialina Embrião Gémula Escutelo Radícula Coifa Figura 1- Constituição dos grãos de trigo e centeio. Adaptado de [4]. As propriedades viscoelásticas do glúten são essenciais para a formação da massa e conferem ao pão o seu sabor e textura característicos. Devido às suas propriedades únicas, o glúten é utilizado na indústria alimentar em larga escala, não só 1

15 Revisão Bibliográfica em produtos claramente associados com cereais, como o pão, biscoitos e massas, mas também como ingrediente em molhos, sopas instantâneas e fármacos. Consequentemente, a ingestão diária de glúten na Europa Ocidental e nos Estados Unidos da América é elevada, variando entre 15 a 20g por dia [5]. 1.1 Constituição Proteicas dos Grãos Existem várias formas de caracterizar as proteínas constituintes dos grãos de trigo e centeio, sendo a mais utilizada a divisão em quatro grupos segundo a solubilidade [6], isto é: 1. Albuminas, solúveis em água. 2. Globulinas, insolúveis em água e solúveis em soluções salinas. 3. Gliadinas, insolúveis em água e soluções salinas e solúveis em soluções alcoólicas. 4. Gluteninas, insolúveis nas soluções mencionadas anteriormente e solúveis em ácidos ou bases diluídas, ou em detergentes. O glúten, é uma mistura das proteínas gliadinas e gluteninas, presente nos grãos de trigo, centeio, cevada e aveia. As gliadinas e gluteninas são por vezes designadas em conjunto como prolaminas. As prolaminas têm designações diferentes consoante o cereal em questão, gliadinas e gluteninas no trigo, secalinas no centeio, hordeínas na cevada e aveninas na aveia. Estas fracções proteicas representam pelo menos 50% do azoto total dos grãos e a sua quantidade aumenta desproporcionalmente na presença de níveis elevados de azoto no meio. Assim, os de trigo e centeio são compostos por prolaminas, que representam entre 50 a 80% das proteínas de reserva, seguido das albuminas (12 a 30%) e globulinas (5 a 10%) [4, 6, 7]. No trigo, as gliadinas formam uma família proteica vasta que pode ser subdividida em gliadinas-α/β, -γ e -ω, e as gluteninas que, por sua vez, podem ser subdivididas em subunidades de gluteninas de alto peso molecular (high molecular weight-glutenin subunits - HMW-GS) e baixo peso molecular (low molecular weightglutenin subunits - LMW-GS). Similarmente, no centeio, as secalinas dividem-se em 2

16 Revisão Bibliográfica secalinas-γ M r 40,000, secalinas-ω, secalinas-γ M r 75,000 e secalinas de alto peso molecular (HMW) [3,6,7]. Uma outra classificação agrupa as prolaminas em três grupos ou famílias: as ricas em enxofre (S-rich), pobres em enxofre (S-poor) e as prolaminas de alto peso molecular (HMW). No trigo, as prolaminas HMW estão presentes apenas no formato de polímeros de glutenina enquanto as prolaminas ricas em enxofre estão presentes como monómeros (gliadinas-α e γ) e polímeros (gluteninas), e as pobres em enxofre estão presentes, predominantemente, como monómeros (gliadinas- ω), podendo também estar presentes na forma de polímeros (gluteninas). As prolaminas HMW são caracterizadas pelo seu elevado conteúdo em glicina e menores quantidades de prolina e fenilalanina que as restantes prolaminas encontrando-se, quase exclusivamente, em agregados bissulfito [2, 8]. O Quadro 1 apresenta mais detalhadamente os tipos e as características das prolaminas. Devido à sua elevada contribuição no conteúdo proteico total, as prolaminas determinam em grande medida a qualidade proteica dos grãos na nutrição humana e animal, levando a deficiências nos aminoácidos essenciais lisina e treonina, principalmente em crianças. No entanto, o maior interesse nas prolaminas está relacionado com o seu impacto nas propriedades do processamento do grão para a produção de pão, massas, biscoitos, etc. [2, 3]. Quadro 1 Síntese das caracteristicas das prolaminas do trigo. Adaptado de [9]. Componentes Polaminas HMW Subunidades de glutenina HWM M r (% total) (6-10%) Polímeros e monómeros Polímeros Composição de aminoácidos parcial (mol%) 30-35% Gln, 10-16% Pro, 15-20% Gly, 0,5-1,5 Cys, 0,7-1,4% Lys Prolaminas S-rich Gliadinas-γ Monómeros Gliadinas-α Monómeros 30-40% Gln, 15-20% Pro, 2-3% Subunidades de Gluteninas de LMW (70-80%) Cys, <1% Lys tipos B e C a Polímeros Prolaminas S-poor Gliadinas-ω Monómeros % Gln, 30-20% Pro, 8-9% Subunidades de Gluteninas LMW (10-20%) Phe, 0-0,5% Lys, 0-0,5% Cys b tipo D a Polímeros a As subunidades de gluteninas LMW tipo C são essencialmente formas poliméricas de gliadinas-α e γ e as subunidades tipo D são formas poliméricas de gliadinas-ω. As subunidades LMW tipo B constituem um grupo discreto de prolaminas S-rich. b Cys encontra-se presente nas subunidades, LMW tipo B, mas ausente nas gliadinas-ω. 3

17 Revisão Bibliográfica 1.2 Localização dos Genes das Proteínas do Glúten Existe grande similaridade na localização dos loci multigénicos major que codificam as prolaminas no grupo de cromossomas 1. O locus major codificador de subunidades de prolaminas de alto peso molecular (gluteninas HMW-GS em trigo e secalinas HMW em centeio) é Glu-1. Os seus genes estruturais foram localizados no braço longo dos cromossomas 1A, 1B e 1D para o trigo e 1R para o centeio. O locus Glu-R1 é também designado Sec 3 no centeio. O outro locus major é o Gli-1 localizado no braço curto dos mesmos cromossomas, que codifica gliadinas-ω e gliadinas-γ em trigo e as secalinas-γ M r 40,000 e secalinas-ω em centeio. O locus Gli-R1 é também designado Sec 4 no centeio [10]. As distâncias nos mapas genéticos destes loci em trigo e centeio são comparáveis. Verifica-se 8,9% de recombinação entre o locus HMW no braço longo e o centrómero para todos os cromossomas 1A, 1B e 1D. O locus Glu-R1 foi mapeado próximo do centrómero no cromossoma 1R do centeio [10]. Enquanto no trigo os loci Glu-1 e Gli-1 estão fracamente ligados, ou de forma não significativa, nos loci Glu-R1 e Gli-R1 do centeio a recombinação entre estes dois grupos de loci pode ter valores que oscilam entre 36 e 40,8%. No locus Gli-R1 do centeio, foram descritos dois recombinantes entre secalinas-γ M r 40,000 e secalinas-ω. [10, 11]. 1.3 O Glúten na Alimentação O glúten encontra-se presente numa vasta gama de produtos alimentares consumidos diariamente pela população humana. Apresenta uma maior prevalência nas dietas ocidentais e menor nas dietas tradicionais asiáticas. No entanto, a globalização tem contribuído para uma maior introdução do glúten nas dietas orientais. No Quadro 2, encontram-se descritos alguns dos alimentos que contêm, ou podem conter, glúten na sua composição [12]. Para além do glúten ser utilizado das mais diversas formas numa vasta gama de produtos alimentares, inclusive produtos que por vezes não sugerem uma 4

18 Revisão Bibliográfica relação clara com cereais, estes por si só representam uma importante parte numa dieta equilibrada [13]. Quadro 2 - Produtos que contêm ou podem conter glúten. Adaptado de [12]. Grupo Carne, peixe, marisco, ovos Farináceos e feculentos Gorduras Legumes Frutos Lacticínios Molhos e conservantes Bebidas Outros Alimentos que podem conter glúten Enchidos, produtos pré-cozinhados Pão, tostas, bolos secos, bolachas e biscoitos, massas alimentícias, sêmolas, farinhas de trigo, cevada, centeio e aveia, flocos de aveia Algumas banhas de comércio Produtos industriais, com mistura de cereais/espessantes Compotas ou sumos industriais com espessantes Queijo creme, queijos comerciais Molho branco, molhos de comércio, sopas em cubo ou de pacote, sobremesas instantâneas, gelados comerciais Whisky Alguns fármacos 1.4 Doenças Relacionadas com o Glúten Actualmente, o número de pacientes que sofre de doenças relacionadas com o glúten tem vindo a aumentar sendo, por isso, considerado um problema de natureza global. Sapone e colaboradores (2012) sugeriram uma nomenclatura para organizar todas as doenças associadas ao glúten (Figura 2) [14]. Existe uma elevada quantidade de alergias que pode ser associada ao trigo e ao centeio, muitas destas comuns a uma grande variedade de plantas e alimentos no geral. No entanto, um número grande destas alergias está associado às proteínas constituintes do glúten, com maior importância as gliadinas e as gluteninas, que têm o potencial de desencadear reacções alérgicas mediadas por Imunoglobulinas E (IgE) [12, 15, 16]. O glúten apresenta um elevado conteúdo em aminoácidos como a glutamina (30%) e prolina (15%), e é esta elevada quantidade de prolina que torna o glúten altamente resistente à degradação por enzimas gastrointestinais, permitindo assim que os péptidos imunogénicos do glúten interajam com a superfície da mucosa intestinal [3]. 5

19 Revisão Bibliográfica As manifestações mais comuns destas alergias, provocadas pela ingestão do glúten (alergias alimentares), são a urticária generalizada, síndrome de eczema/dermatite atópica, vómito, enterocolites e anafilaxia dependente do trigo induzida pelo exercício (wheat dependent exercise induced anaphylaxis, WDEIA) [15-17]. A asma do padeiro é uma doença ocupacional, normalmente provocada pela inalação da farinha e, encontra-se associada às gliadinas α e ω [15]. Estas formas clínicas são geralmente transitórias, e são distintas da hipersensibilidade auto-imune ao glúten, como no caso da doença celíaca, uma vez que a hipersensibilidade não alérgica não é mediada por anticorpos IgE [18]. Doenças relacionadas com o glúten Patogénese Autoimune Alérgica Não autoimune e alérgica (imunidade inata?) Doença celíaca Ataxia de glúten Dermatitis herpetiformis Alergia ao trigo Sensibillidade ao glúten Simptomática Alergia respiratória Silenciosa Alergia alimentar Potencial WEIDA Urticária de contacto Figura 2 - Nomenclatura proposta para classificação das doenças relacionadas com o glúten [14]. 6

20 Revisão Bibliográfica 2. DOENÇA CELÍACA A doença celíaca é uma doença de inflamação crónica do intestino delgado provocada pela ingestão de proteínas presentes no glúten. A manifestação desta doença é desencadeada por factores genéticos, ambientais e imunológicos, apresentando uma vasta variedade de sintomas [19-21]. 2.1 Epidemiologia da Doença Celíaca Com uma prevalência de cerca de 0,3-1% em caucasianos, a doença celíaca é uma das doenças mais comuns de intolerância alimentar no mundo. Também ocorre com elevada prevalência nas populações do Norte de África e no Médio Oriente, encontrando-se no continente asiático maioritariamente confinada ao noroeste da Índia. A doença celíaca nunca foi detectada na população chinesa nem na população negra de África e apresenta incidência ligeiramente superior nas mulheres, possivelmente relacionada com a probabilidade de detecção como resultados de deficiência em ferro ou auto-imunidade associada [5, 19, 22, 23]. No entanto, apesar da elevada prevalência da doença celíaca, esta continua a ser considerada como subdiagnosticada [20, 24]. Os dados de alguns países, cuja prevalência da doença celíaca é conhecida, encontram-se descritos no Quadro 3. Em Portugal, a incidência da doença celíaca tem um valor desconhecido, no entanto, foram realizados estudos que permitiram fazer um cálculo indirecto e obter um valor estimado. A incidência calculada através dos casos diagnosticados nas unidades de gastroenterologia pediátrica em Portugal foi de 1:3648 e estudos recentes realizados numa população portuguesa determinaram uma prevalência de 1:134, com um intervalo de confiança a 95% entre 1:53-1:500. Este resultado está de acordo com a prevalência recentemente referida noutras populações europeias, pelo que há razões para deduzir que a doença celíaca é uma doença subdiagnosticada em Portugal [25]. 7

21 Revisão Bibliográfica Quadro 3 - Prevalência da doença celíaca em alguns países de acordo com dados de rastreio [26]. País Prevalência Argentina 1:167 Austrália 1:251 Brasil 1:66 a 1:119 Egipto 1:187 Espanha 1:118 Estados Unidos 1:105 Finlândia 1:99 a 1:67 Índia 1:310 Irão 1:166 a 1:104 Israel 1:157 Itália 1:106 Países Baixos 1:198 Reino Unido 1:100 Rússia 1:133 Suécia 1:77 Tunísia 1:157 Turquia 1: Manifestação Clínica Quando um doente celíaco ingere glúten, o seu sistema imunitário responde provocando danos nas vilosidades intestinais. As vilosidades intestinais são responsáveis pela absorção dos nutrientes para a corrente sanguínea, no entanto, quando as vilosidades intestinais estão danificadas, o indivíduo fica subnutrido independentemente da quantidade de alimentos que ingere. Esta resposta imunitária ocorre em indivíduos geneticamente susceptíveis, perante a exposição a certos motivos de aminoácidos nas proteínas do glúten. Actualmente, o único tratamento é a eliminação do glúten da dieta dos pacientes [19, 22]. A doença celíaca é uma doença com uma associação genética e está fortemente relacionada com a presença dos loci HLA-DQ2 ou HLA-DQ8, com a localização cromossómica 6p21, uma vez que ambos os genótipos provocam uma predisposição no indivíduo para o desenvolvimento da doença [19, 26]. Apesar de se pensar durante muitos anos que o desencadear dos primeiros sintomas desta doença ocorria durante a infância foi, recentemente, demonstrado que estes podem surgir durante a vida adulta e 8

22 Revisão Bibliográfica até mesmo na terceira idade [27]. As manifestações clínicas variam consoante a faixa etária em que se inserem, designadamente: As crianças dos 6 aos 24 meses, após a introdução dos cereais na dieta, sofrem um aumento gradual de distensão abdominal, anorexia, atrofia muscular, atraso no crescimento, hipotonia e irritabilidade. Nas crianças mais velhas e adolescentes, a doença pode manifestar-se por atraso no desenvolvimento estato-ponderal e pubertário, raquitismo, diarreia, anemia recorrente ou desempenho escolar deficiente. Os adultos que desenvolvem a doença celíaca podem manifestar diarreia, anemia, osteoporose, artrite, sintomas neurológicos, depressão ou ansiedade, convulsões, infertilidade ou abortos recorrentes e irregularidade menstrual. A intensidade dos sintomas é muito variável, sendo os sintomas intestinais os mais típicos, como a diarreia, distensão abdominal e dor. Por vezes, a doença pode ser desencadeada por certos estímulos como cirurgias, gravidez, infecções virais e stresse emocional severo [3, 5, 12]. As manifestações mais frequentemente descritas da doença celíaca, esteatorreia, meteorismo abdominal e emagrecimento, não são actualmente as principais manifestações da doença. Até 30% dos doentes celíacos apresentam aumento do índice de massa corporal no momento do diagnóstico. Nas formas mais leves da doença celíaca os sintomas gastrointestinais são muitas vezes ligeiros, inespecíficos ou ausentes. Pode ocorrer dor abdominal, por vezes prolongada, meteorismo e alterações do trânsito intestinal como obstipação isolada ou alternância com diarreia. A prevalência da doença celíaca em doentes com síndroma do intestino irritável é estimada em cerca de 4,6%. Astenia e mal-estar geral são relativamente frequentes e podem também ocorrer vómitos, náuseas e anorexia [12]. Formas extra-intestinais da doença celíaca incluem a anemia ferropénica e a patologia músculo-esquelética. A doença celíaca pode manifestar-se como uma anemia ferropénica sem explicação aparente, e pensa-se que seja responsável por 5% destes casos. A complicação mais frequente da doença celíaca é a osteopenia que se desenvolve como consequência da má-absorção de vitamina D e cálcio, e diminuição do 9

23 Revisão Bibliográfica seu aporte em situações de intolerância à lactose. Outros factores que podem estar envolvidos são o sexo do paciente, desnutrição e redução da actividade física. Manifesta-se em geral com lombalgia arrastada, e responde apenas parcialmente à dieta sem glúten, podendo evoluir para osteoporose com acréscimo do risco fracturário, embora não exista uma concordância entre os estudos existentes [12]. Uma pequena percentagem dos pacientes em que a doença se manifesta na idade adulta desenvolve uma resistência primária ou secundária a uma dieta sem glúten. Esta condição é chamada de doença celíaca refractária (DCR) e trata-se de uma enteropatia com atrofia vilositária sustentada e linfocitose intra-epitelial apesar da restrição de glúten durante mais de 12 meses, ou em que a manutenção de sintomas graves obriga a intervenção farmacológica, independentemente da duração da dieta restritiva [12]. Actualmente a DCR é subdividida em dois subtipos: DCR tipo I (DCR I) e DCR tipo II (DCR II). Ambos apresentam uma resistência clínica e histológica à dieta sem glúten, no entanto, a DCR II está associada à presença de elevado número de linfócitos intraepiteliais com anomalias genéticas, da qual se desenvolvem células de linfoma. A DCR II é assim considerada uma condição de pré-malignidade e cerca de 50% dos pacientes desenvolvem um linfoma evidente no espaço de 5 anos após o diagnóstico [5]. Em suma, a maioria dos doentes celíacos apresenta manifestações clínicas pouco complicadas que podem ser resolvidas com a realização de uma dieta sem glúten, no entanto, a DCR II e linfoma associado a DCR são difíceis de tratar, daí apresentarem taxas de sobrevivência de 5 anos de <44% e <20%, respectivamente [5]. 2.3 Doenças Associadas à Doença Celíaca A doença celíaca está fortemente associada a doença auto-imune dermatite herpetiforme, estando presente em % destes doentes. Um défice selectivo de IgA ocorre em 1,7-2,6% dos doentes celíacos, os quais não produzem anticorpos de classe IgA mas têm geralmente elevada concentração de anticorpos IgG. Existe uma elevada prevalência de doença celíaca, estimada em 6,3%, associada à Síndrome de Down, sendo também descrita uma relação com a Síndrome de Turner e com malformações 10

24 Revisão Bibliográfica cardíacas. Estima-se que a prevalência de Diabetes mellitus tipo 1 na doença celíaca seja de 5% e, inversamente, 3-8% dos diabéticos insulinodependentes apresentam intolerância ao glúten. Os doentes celíacos de ambos os sexos apresentam maior taxa de infertilidade. Existe, também, um risco acrescido de amenorreia, abortos espontâneos e prematuridade em casos de doença celíaca não tratada. Os quadros psiquiátricos mais comuns são a ansiedade, irritabilidade e depressão que respondem rapidamente à dieta restritiva. Cerca de 10% dos doentes celíacos podem apresentar simultaneamente gastrite linfocítica. Pode também existir uma associação com doença inflamatória intestinal (especialmente proctite ulcerosa) em cerca de 20% destes pacientes, sendo susceptível de melhorar com a restrição de glúten. Para além das doenças referidas anteriormente, encontra-se estabelecida a associação entre doença celíaca e a cirrose biliar primária, colangite esclerosante primária, hepatite e colangite auto-imunes, patologia auto-imune da tiróide e doença de Addison [12, 28]. 2.4 Factores Ambientais O desenvolvimento da doença celíaca é determinado tanto por factores genéticos como por factores ambientais, estando estes últimos associados à ingestão de produtos contendo glúten. A primeira publicação referente à doença celíaca foi em 1953 por Dicke e colaboradores, que descreveu que a ingestão de produtos de trigo poderia provocar sintomas de má absorção. Em 1975, Ferguson e colaboradores, relataram que as proteínas de reserva do trigo, do centeio e cevada (glúten), provocam uma resposta imunitária mediada por células no intestino delgado, em doentes susceptíveis [5]. Durante as últimas décadas, verificou-se um aumento muito acentuado na prevalência da doença celíaca que não pode ser apenas justificado com o melhoramento das técnicas de diagnóstico. Actualmente, considera-se que a principal causa deste aumento são as mudanças verificadas nas dietas da população mundial em geral nas últimas décadas e as mudanças no estilo de vida que levaram a um maior consumo de produtos contendo glúten, que incluem o seu uso crescente como aditivos em alimentos processados e medicamentos. Apesar de actualmente não existirem provas conclusivas, suspeita-se que os programas de melhoramento a que muitos cereais foram sujeitos, 11

25 Revisão Bibliográfica com maior importância o trigo, com o objectivo de aumentar o rendimento, capacidade de adaptação a diversos climas, melhores características para a produção do pão e a maior resistência a doenças e pragas, acabaram por aumentar a prevalência dos péptidos intolerados pelos doentes celíacos [3] Alternativas aos produtos com glúten Nos últimos anos, têm surgido no mercado os produtos designados sem glúten. Estes são tipos de produtos alimentares que normalmente incluiriam glúten na sua composição, no entanto, foram desenvolvidos de forma a poderem ser consumidos por indivíduos intolerantes através da redução ou eliminação deste na sua composição. Um exemplo destes produtos é o pão, que tem grande impacto na dieta ocidental. O pão sem glúten é produzido através de farinhas que inclui farinha de amêndoa, sorgo, milho e até de legumes como o feijão [29]. Para certificar um produto como sem glúten é necessária a utilização de testes com elevada sensibilidade. A União Europeia, a Organização Mundial de Saúde e o Codex Alimentarius requerem uma medição confiável das prolaminas do trigo, em vez de uma detecção de todas as proteínas do glúten, que incluí albuminas, globulinas e proteínas granulares do amido. Os limites oficiais descritos no Draft Revised Standard for Gluten-free Foods (2006) [30] são 20 ppm de conteúdo total de glúten para produtos alimentares naturalmente sem glúten, 200 ppm para produtos tornados sem glúten, produtos sólidos à base de matéria seca e produtos líquidos à base do produto original [31, 32]. O trigo diplóide Einkorn (AA, T. monococcum), cultivado em grande escala na antiguidade, encontrou recentemente um novo mercado ao nível dos alimentos considerados bons para a saúde. Ao contrário das variedades modernas, existem evidências que sugerem que as gliadinas do trigo Einkorn podem não ser tão tóxicas para os doentes celíacos. As diferenças na constituição do glúten devem-se ao facto do trigo Einkorn apenas ter 14 cromossomas, em vez dos 42 dos trigos hexaplóides. No entanto, esta variedade ainda não foi recomendada para uma dieta sem glúten [33]. 12

26 Revisão Bibliográfica Numa abordagem diferente, Spaenij-Dekking (2005) e colaboradores [34], analisaram a trigos diplóides (AA, BB e DD), tetraplóides (AABB) e hexaploides (AABBDD) para a presença de sequências que desencadeiam a resposta imunitária em doentes celíacos. Dentro trigos diplóides, o genoma DD revelou ser mais tóxico que AA e BB. Não entanto, não se verificou que a presença do genoma DD em trigos hexaplóides (trigo mole) conferisse uma toxicidade superior à dos trigos tetraplóides (trigo duro) [34]. Por outro lado, estudos realizados por outros investigadores, demonstram uma maior expressão dos genes das gliadinas em trigos hexaplóides do que nos seus homólogos em trigos tetraplóides [35]. Spaenij-Dekking (2005) e colaboradores concluíram que existe variabilidade genética suficiente em trigos com baixa toxicidade que podem vir a ser utilizados na selecção e obtenção de variedades de trigo susceptíveis de serem consumidas por doentes celíacos [34]. Actualmente existem incertezas acerca da toxicidade da aveia para os doentes celíacos. Estudos recentes demonstram que produtos que contêm aveia, vendidos comercialmente, encontram-se muitas vezes contaminados com proteínas de trigo, centeio e cevada, revelando-se tóxicos. A aveia livre de contaminações não estimula uma resposta imunitária na maioria dos doentes celíacos, no entanto uma pequena percentagem demonstrou-se, mesmo assim, sensível. Devido aos resultados publicados serem contraditórios, verifica-se a necessidade de uma abordagem mais profunda para que a aveia possa ser aconselhada a pelo menos uma parte dos doentes [36]. 2.5 Factores Genéticos Para além destes factores ambientais, o desenvolvimento da doença celíaca requer uma predisposição genética, uma vez que praticamente todos os doentes celíacos partilham os genes heterodiméricos HLA-classe 2, HLA-DQ2 e/ou HLA-DQ8. Estas moléculas de classe 2 são expressas em células apresentadoras de antigénios [5, 28]. O genótipo HLA-DQ2 está presente em cerca de 25% da população europeia, no entanto, apenas cerca de 4% dos indivíduos com este genótipo desenvolvem doença 13

27 Revisão Bibliográfica celíaca (Figura 2). Isto implica a presença de outros factores genéticos e ambientais como contribuidores para a manifestação da doença celíaca. 75% HLA-DQX 25% HLA-DQ2 96% Saudáveis 4% DC 3% DCR 97% Sem complicações Figura 3 - Prevalência da doença celíaca na população caucasiana. Adpatado de [5]. A forte influência genética da doença celíaca é bastante evidente, uma vez que 80% dos gémeos monozigóticos apresentam concordância da doença, ao contrário dos gémeos dizigóticos em que a concordância é de 11%. A principal influência genética é o HLA (human leukocyte antigen, antígenos leucocitários humanos), que foi primeiramente indicado por estudos que descreviam a predominância dos serotipos HLA-B8 e HLA-DR3 nos anos 70. No final dos anos 80 e na década de 90, estabeleceuse uma associação mais forte com HLA-DQ2 (DQA*0501, DQB*0201, que passaram a ter a terminologia de HLA-DQ2.5), que é codificado em conjunto com HLA-B8 e HLA- DR3 no haplotipo ancestral 8.1, altamente conservado. A forte associação entre a doença celíaca e HLA-DQ2.5 torna-se mais evidente quando se observa que indivíduos homozigóticos para HLA-DQ2.5 têm, cerca de cinco vezes, mais probabilidade de manifestarem a doença celíaca que os indivíduos heterozigóticos para o mesmo locus. Da mesma forma, a homozigotia de HLA-DQ2.5 está associada ao desenvolvimento da doença celíaca refractária tipo II e linfoma associado à DCR, sendo que a associação revela-se menos clara em situações de heterozigotia e do locus HLA-DQ8. Existe outra variante de HLA-DQ2, HLA-DQ2.2 (DQA*0201, DQA*0201), que é muito similar ao motivo de HLA-DQ2.5 mas não provoca uma predisposição para a doença celíaca. A diferença encontra-se nas propriedades de ligação aos péptidos nestas variantes de HLA-DQ2. O risco estimado de HLA-DQ2 e HLA-DQ8 no desenvolvimento de doença celíaca é cerca de 35% [5, 37, 38]. 14

28 Revisão Bibliográfica Nem todos os indivíduos com HLA-DQ2.5 e HLA-DQ8 desenvolvem doença celíaca, o que indica que estes genótipos HLA são necessários mas não suficientes para o desenvolvimento da doença. Estudos genéticos recentes realizados com um grande número de doentes e familiares revelaram factores adicionais de risco, a maioria dos quais está relacionada com a inflamação e a regulação dos linfócitos T. No entanto, a contribuição total combinada destes polimorfismos foi estimada em apenas 3% a 4%. Para além disso, estima-se que os genes HLA contribuam somente para 40% dos componentes hereditários da doença. Aguardam-se resultados de estudos com outros genes potencialmente candidatos, designadamente os genes reguladores dos linfócitos T (CD28, CTLA4 e ICOS). Os 13 loci identificados encontram-se sumariados no Quadro 4, onde se encontra também indicado o valor do risco relativo (odds ratio) de cada um destes loci. Quanto maior o valor do risco relativo, maior a associação ou nãoindependência entre os loci e o desenvolvimento da doença. O desenvolvimento da doença em indivíduos sem os genes HLA-DQ2 e HLA-DQ8 é extremamente raro [5, 12, 28]. 2.6 Patogénese da Doença Celíaca As moléculas HLA classe II HLA-DQ2 e HLA-DQ8 são expressas em células apresentadoras de antigénios, principalmente macrófagos, células dendríticas, e linfócitos B. Os péptidos do glúten são apresentados por estas moléculas, o que pode levar à activação de linfócitos T auxiliares específicos para o glúten na lâmina própria, as células centrais que provocam a inflamação intestinal, resultando na hiperplasia das criptas e na atrofia das vilosidades [28]. Para além dos factores referidos anteriormente sabe-se, também, que a inclusão de glúten na alimentação das crianças, infecções precoces com vírus enteropáticos e alterações na flora bacteriana, demonstram favorecer a manifestação clínica da doença celíaca na infância. Estas observações indicam que a doença celíaca resulta de uma desregulação de uma resposta dos linfócitos T auxiliares ao glúten num grupo de portadores de HLA-DQ2 e/ou HLA-DQ8. Quase todos os pacientes com doença celíaca desenvolvem autoanticorpos imunoglobulina A para a enzima transglutaminase do 15

29 Revisão Bibliográfica tecido (transglutaminase 2 [TG2]), que é expressa por muitos tipos celulares e associase com a matriz extracelular (endomísio ou fibras da reticulina). A TG2 tem como alvo certos resíduos de glutamina em algumas proteínas extracelulares e intracelulares, geralmente formando uma ligação entre estas e um resíduo de lisina numa segunda proteína, em que a TG2 serve de ponte, resultando na ligação cruzada das duas proteínas. Em alternativa, TG2 pode apenas diamidar (remover um grupo funcional amida) estas glutaminas para resíduos de ácido glutâmico com carga negativa [28, 37, 39]. Quadro 4 Principais loci associados ao desenvolvimento da doença celíaca e o valor do seu risco relativo (odds ratio). Adaptado de [5]. Locus Gene candidato Função Odds ratio 6p21 HLA Apresentação de antigénios. 6,23 (5,95 6,52) 3q25-3q26 3p21 IL12A CCR1, CCR2, CCR3 e CCR5 Subunidade de IL12, regula a diferenciação de Th1. Recrutamento de células imunitárias para o local de infecção. 1,36 (1,29 1,44) 1,30 (1,23 1,39) 3q28 LPP Possível papel na manutenção da forma celular. 1,29 (1,25 1,34) 6q23 12q24 2q11-2q12 6q25 TNFAIP3 SH2B3 IL18R1 e IL18RAP TAGAP Inibe a activação de NFκB e a apoptose mediada por TNF. Molécula adaptadora envolvida na sinalização dos linfócitos T. Respectivamente a cadeia α e β do receptor IL18, IL18 é uma citocina pró-infamatória. Papel na modulação das mudanças no citoesqueleto. 1,23 (1,17 1,28) 1,20 (1,15 1,24) 1,19 (1,14 1,25) 1,16 (1,12 1,21) 2p16 REL Componente no complexo de transcrição NFκB 1,15 (1,11 1,20) 2q33 1q31 4q27 CTLA4 Efeito inibidor na resposta dos linfócitos T. CD28 Efeito estimulador na resposta dos linfócitos T. ICOS Efeito estimulador na resposta dos linfócitos T. RGS1 Actua como uma proteína activadora de GTPases, regulando assim a sinalização celular. IL2 Estimula a proliferação dos linfócitos T. IL21 Regula a função dos linfócitos T e células NK (Natural Killer). 1,14 (1,9 1,19) 0,80 (0,76 0,84) 0,74 (0,70 0,78) Os péptidos do glúten encontram-se praticamente desprovidos de cargas negativas, importantes para que ocorra a ligação a HLA-DQ2 e HLA-DQ8, assim, a afinidade entre os péptidos de glúten e HLA-DQ2 e HLA-DQ8 é muito baixa. Uma vez que o glúten tem elevado conteúdo em glutamina (Q) e prolina (P), as sequências QP, QXP e QXXP (em que X representa qualquer aminoácido), são frequentemente 16

30 Revisão Bibliográfica encontradas nos péptidos. Assim, as proteínas do glúten, especialmente a fracção solúvel em álcool (gliadinas, secalinas, hordeínas), mas também as gluteninas são substratos preferidos pela TG2. No entanto, apenas nas sequências QXP a glutamina é convertida, o que resulta numa introdução altamente selectiva de cargas negativas nos péptidos. Quando diamidados, a maioria dos péptidos de glúten negativamente carregados têm uma maior afinidade para se ligarem a HLA-DQ2 ou HLA-DQ8, o que leva a um aumento do conjunto de péptidos que podem ser apresentados. Como resultado, o conjunto de linfócitos T auxiliares específicos para o glúten é substancialmente aumentado, o que agrava a inflamação e o desenvolvimento da doença [5, 28]. A TG2 encontra-se, maioritariamente, retida intracelularmente numa forma inactiva e é activada após a sua libertação quando ocorrem danos no tecido. Assim sendo, deve acontecer algo que provoca os danos no tecido permitindo a modificação dos péptidos do glúten. Mesmo que a resposta dos linfócitos T auxiliares contra os péptidos não modificados do glúten seja rara, poderá representar a primeira falha na tolerância ao glúten. A apresentação dos péptidos aos linfócitos T auxiliares provoca um aumento da produção de Interferão-gama (INF-γ) (Figura 3). O INF-γ irá provocar o aumento da expressão das moléculas HLA-DQ, o que por sua vez aumentará a apresentação de péptidos de glúten. Na presença de glúten, esta reacção torna-se um ciclo que poderá provocar danos nos tecidos locais. Estes danos provocam a libertação de TG2, que aumenta a afinidade dos péptidos com as moléculas HLA-DQ, o que por sua vez aumenta a resposta dos linfócitos T auxiliares, levando à indução de danos nos tecidos e ao início de um segundo ciclo. Em alternativa, infecções que ocorrem no tracto gastrointestinal poderiam gerar um meio pró-inflamatório que levaria à perda da tolerância ao glúten e, simultaneamente a danos nos tecidos, iniciando assim a diamidação pela TG2 [5, 40]. Foram identificados ou deduzidos por sequências de consenso com TG2, um número elevado (> 50) de péptidos de glúten distintos que podem desencadear esta resposta imunitária. Por norma, estes péptidos são relativamente resistentes à digestão pelas proteases gastrointestinais, o que aumenta a sua quantidade no intestino delgado. O péptido 33-mer das gliadinas-α, LQLQPFPQPQLPYPQPQLPYPQPQLPYPQPQPF, 17

31 Revisão Bibliográfica contém seis sequências parcialmente sobrepostas de aminoácidos que formam ligações com HLA-DQ2 que podem ser diamidadas pela TG2. Este péptido considerado um superantigénio celíaco é utilizado como péptido modelo em estudos pré-clínicos e é naturalmente formado pela digestão com as enzimas gástricas e pancreáticas [28, 39, 41, 42] e tem especial importância neste trabalho. O péptido 33-mer é rico em prolina e glutamina, logo, é um péptido extremamente resistente à degradação proteolítica [43]. A presença deste péptido foi confirmada não só em gliadinas mas, também, em secalinas e hordeínas. Ainda não foi demonstrada a sua presença em aveia [44]. Resposta dos Linfócitos T INFγ Danos no Tecido Resposta dos Linfócitos T TG2 Apresentação de Glúten Expressão de HLA- DQ2/8 Apresentação de HLA-DQ 2/8 Diamidação dos Péptidos do Glúten Figura 4 - Ciclos auto amplificantes no desenvolvimento da doença celíaca. Adaptado de [5]. 18

32 Revisão Bibliográfica 3. CONTRIBUTOS DA GENÓMICA E DA PROTEÓMICA O aumento da sua prevalência, as manifestações clínicas imprevisíveis e a falta uma terapia farmacológica tornam a doença celíaca uma doença complexa e altamente relevante. Além disso, a prática de uma dieta rigorosa sem glúten ao longo de toda a vida pode gerar um considerável stresse psicológico, emocional e económico. Assim, há um grande interesse por parte da comunidade científica no desenvolvimento de novas terapias [40, 45]. Um dos contributos mais evidentes da genómica e da proteómica no estudo e compreensão dos mecanismos responsáveis pela doença celíaca é a identificação dos loci associados ao desenvolvimento da doença (Quadro 4) e dos epítopos apresentados aos linfócitos T (Quadro 5) [38]. A utilização das técnicas de análise proteómica permitiu a comparação das sequências de trigo, centeio e cevada, com sequências de aveia (com toxicidade questionável na doença celíaca), milho e arroz (não tóxicos). Um exemplo de um destes estudos foi realizado por McLachlan e colaboradores em 2002, que determinaram a sequência QQQP como uma das causadoras da toxicidade em trigo. No entanto, a sequência QQQPS revelava-se não tóxica em milho e arroz. Através do estudo dos aminoácidos flanqueadores, concluiu-se a relação entre a toxicidade na doença celíaca e o motivo extenso QQQPFP presente em trigo, centeio e cevada. O motivo QQQPF foi encontrado em aveia, sequência que apresenta alguma actividade em ensaios in vitro e pode estar presente em algumas variedades [46]. No Quadro 5 estão representados alguns dos epítopos que contribuem para a toxicidade na doença celíaca e as suas sequências aminoacídicas. A sequência QQPFP tem especial importância neste trabalho, uma vez que foi utilizado o kit Ridascreen Gliadin Competitive (R-Biopharm) que detecta esta sequência em específico. A espectrometria de massa é a técnica utilizada na identificação de péptidos e proteínas. No entanto, a capacidade de determinação da toxicidade das sequências aminoacídicas, entre outras características, é obtida através do cruzamento com a informação disponível nas bases de dados. Assim sendo, a identificação destas 19

33 Revisão Bibliográfica sequências potencialmente tóxicas e a sua submissão nas bases de dados são essenciais para o progresso e para o desenvolvimento de novas técnicas e terapias [47]. Quadro 5 - Lista de epítopos relevantes reconhecidos pelos linfócitos T. Adaptado de [38]. Epítopo 1 Nomes anteriores Sequência reconhecida 2 Epítopos restritos a DQ2.5 DQ2.5-glia-α1a DQ2-α-I, α9 PFPQPELPY DQ2.5-glia-α1b DQ2-α-III PYPQPELPY DQ2.5-glia-α2 DQ2-α-II, α2 PQPELPYPQ DQ2.5-glia-α3 glia-α20 FRPEQPYPQ DQ2.5-glia-γ1 DQ2-γ-I PQQSFPEQQ DQ2.5-glia-γ2 DQ2-γ-II, γ30 IQPEQPAQL DQ2.5-glia-γ3 DQ2-γ-III QQPEQPYPQ DQ2.5-glia-γ4a DQ2-γ-IV SQPEQEFPQ DQ2.5-glia-γ4b DQ2-γ-VIIc PQPEQEFPQ DQ2.5-glia-γ4c DQ2-γ-VIIa QQPEQPFPQ DQ2.5-glia-γ4d DQ2-γ-VIIb PQPEQPFCQ DQ2.5-glia-γ5 DQ2-γ-VI QQPFPEQPQ DQ2.5-glia-ω1 DQ2-ω-I PFPQPEQPF DQ2.5-glia-ω2 DQ2-ω-II PQPEQPFPW DQ2.5-glut-L1 glutenin-17 PFSEQEQPV DQ2.5-glut-L2 glutenin-156 FSQQQESPF DQ2.5-hor-1 Hor-α9, Hα9 PFPQPEQPF DQ2.5-hor-2 Hor-α2, Hα2 PQPEQPFPQ DQ2.5-hor-3 hor-i-dq2 PIPEQPQPY DQ2.5-sec-1 Sec-α9, Sα9 PFPQPEQPF DQ2.5-sec-2 Sec-α2, Sα2 PQPEQPFPQ DQ2.5-ave-1a Av-α9A PYPEQEEPF DQ2.5-ave-1b Av-α9B, 1490 PYPEQEQPF Epítopos restritos a DQ2.2 DQ2.2-glut-L1 glutenin-17 PFSEQEQPV Epítopos restritos a DQ8 DQ8-glia-α1 DQ8-α-I EGSFQPSQE DQ8-glia-γ1a DQ8-γ-Ia EQPQQPFPQ DQ8-glia-γ1b DQ8-γ-Ib EQPQQPYPE DQ8-glut-H1 HMW-glutenin QGYYPTSPQ Epítopos restritos a DQ8.5 DQ8.5-glia-α1 DQ8-α-I EGSFQPSQE DQ8.5-glia-γ1 PQQSFPEQE DQ8.5-glut-H1 HMW-glutenin QGYYPTSPQ 1 Foram utilizados nomes encurtados: glia = gliadinas, glut = gluteninas, hor = hordeínas, sec = secalinas, ave = aveninas. 2 Os resíduos de glutamato (E) formados pela diamidação mediada pela TG2 que são locais de reconhecimento importantes encontram-se a negrito. Encontram-se sublinhados resíduos de glutamina adicionais que também são alvos da TG2. 20

34 Revisão Bibliográfica Apesar de até à data ainda não terem sido publicados novos resultados, os projectos para detectar novos marcadores serológicos da actividade da doença celíaca são bastante promissores. Estes têm por base o proteoma do soro de doentes celíacos com os sintomas em remissão, que são colocados em contacto com o glúten. Os proteomas dos soros dos pacientes, antes e após o contacto, podem ser analisados recorrendo a várias abordagens baseados na eliminação das proteínas mais abundantes, fraccionamento das mesmas, espectrometria de massa e análise bioinformática [28]. Em desenvolvimento encontram-se duas estratégias para tentar diminuir a toxicidade do glúten nos próprios alimentos. A primeira estratégia tem por base o princípio que o reconhecimento de glúten pelos linfócitos T é aumentado pela presença de prolina. A substituição da prolina em gliadinas e gluteninas por mutagénese direccionada tem como objectivo a diminuição ou supressão completa do reconhecimento motivos tóxicos por parte dos linfócitos T, impedindo assim o desencadear da resposta imunitária típica na doença celíaca. No entanto, a resposta não foi completamente abolida, sugerindo que serão necessárias mais substituições ou que esta terapia não beneficiará todos os pacientes [16]. A segunda estratégia envolve a eliminação de pontes de bissulfito em gliadinas e gluteninas. Esta abordagem poderá também ser aplicada em pacientes com alergias alimentares. As pontes de bissulfito tornam os alergénicos resistentes à digestão, permitindo a sua apresentação intacta no intestino e, consequente, a resposta imunitária. As tiorredoxinas são proteínas presentes em plantas que têm a capacidade de reduzir estas ligações. Em estudos realizados em cães, foi possível usar estas enzimas para atenuar a resposta imunitária, no entanto, em alguns grupos de pacientes as tiorredoxinas podem não conseguir anular a resposta imunitária, uma vez que péptidos importantes não têm pontes de bissulfito. São necessários mais estudos para determinar se o aumento da expressão das tiorredoxinas podem por si só minimizar sintomas alérgicos ou celíacos e determinar alergénicos importantes em subpopulações [16, 40]. 21

35 Revisão Bibliográfica 4. OBJECTIVOS E IMPLICAÇÕES DESTE ESTUDO Recorrendo às técnicas actuais de proteómica, foi objectivo deste trabalho avaliar a prevalência do péptido 33-mer em variedades da tribo Triticeae, designadamente as espécies de trigo mole (Triticum aestivum L.), trigo duro (Triticum durum Desf.) e centeio (Secale cereale L.), cultivadas em Portugal. Assim, os objectivos gerais deste trabalho foram: Desenvolver e optimizar de uma metodologia de extracção, separação e marcação das proteínas de reserva que permita obter as fracções de gliadinas e gluteninas no mesmo extracto. Analisar e comparar a prevalência do péptido 33-mer nas variedades de trigo e centeio presentes no CNV, uma landrace, variedades modernas e variedades antigas. Analisar, comparar e confirmar os resultados através da utilização do kit Ridascreen gliadin competitive (R-Biopharm). Para conseguir atingir os objectivos estabelecidos, foram definidos como objectivos específicos, nomeadamente: Comparar a prevalência do péptido 33-mer entre variedades de trigo duro (tetraplóides) e trigo mole (hexaplóides). Comparar a prevalência do péptido 33-mer entre variedades antigas e variedades modernas. Isolar e identificar proteínas marcadas pelo anticorpo 33-mer. Identificar os loci associados às sequências proteicas identificadas pela técnica MALDI-TOF. Desenhar primers que permitam a amplificação destes loci. Através da análise de um elevado número de variedades provenientes de diversas origens os objectivos deste estudo tiveram como base a identificação das variedades dos diversos cereais que sejam mais susceptíveis de serem toleradas por 22

36 Revisão Bibliográfica doentes celíacos. Desta forma, seria possível a produção de pão, massas, biscoitos e uma grande variedade de produtos que poderiam ser tolerados por pelo menos uma parte dos doentes celíacos, sem a necessidade de novas metodologias nem produtos diferentes. Assim, seria mais fácil para estes doentes a realização de uma dieta sem glúten, uma vez que poderiam consumir alimentos não muitos diferentes daqueles que consumiriam caso não fossem doentes celíacos, usufruindo que todo o valor nutricional associado aos produtos de contêm glúten. 23

37 Materiais e Métodos CAPÍTULO II - MATERIAL E MÉTODOS 1. MATERIAL VEGETAL No decorrer deste trabalho foi efectuada uma selecção de 19 variedades de trigo e uma landrace (Triticum spp.), 3 variedades de centeio (Secale cereale L.), 12 populações regionais de centeio e um centeio silvestre (Secale vavilovii), cultivadas em Portugal (Quadro 6). Foram seleccionadas variedades de trigo duro e trigo mole que já fizeram ou ainda fazem parte do Catálogo Nacional de Variedades (CNV), com a excepção da landrace Barbela. Foram consideradas como antigas todas as variedades cuja inscrição no CNV foi anterior a Os centeios foram estudados anteriormente no Laboratório de Genómica Funcional e Proteómica do IBB-CBG da UTAD [48], e Alvão é o único centeio inscrito no CNV. Quadro 6 - Varieades de trigo e centeio utilizadas neste trabalho. Grupo Trigos duros (Triticum durum Desf.) Trigos moles (Triticum aestivum L.) Nome Ano de inscrição Presente no CNV Considerado no CNV em 2012 antigo a Ariesol 1996 Atilla 2000 X Celta 1986 X X Hélvio 1988 X X Marialva 1999 X Almansor 1986 X X Alva 1993 X Ardila 2002 X Arpège 2004 X Caia 1982 X Eufrates 1996 X Jordão 1996 X Mondego 1987 X Nabão 2002 X Roxo 1995 X Sagitário 1999 Sever 1998 X Tigre 1994 X Torero 1995 X Trigo mole - landrace Barbela b Centeio Alvão c 1998 X Centeio Silvestre S. vavilovii Centeios Europeus Marder c, Picasso c Centenico, Cepeda, Edral, Gimonde, Lamas de Ôlo, Lamego, Populações regionais Malhadas, Montalegre, Morgade, Padrela, Vilar Douro, Vila Pouca a Neste trabalho, foram consideradas antigas, todas as variedades de trigo inscritas no CNV antes de b Único trigo que não sofreu melhoramento. c Centeios que sofreram melhoramento. 24

38 Materiais e Métodos 2. MÉTODOS 2.1 PROTOCOLO I - EXTRACÇÃO DO GLÚTEN EM DUAS ETAPAS (2009) De forma a obter uma extracção conjunta das proteínas do glúten dos grãos de trigo e centeio (gluteninas e gliadinas), recorreu-se à metodologia publicada por van den Broeck Two-step gluten extract, que se demonstrava ser mais e eficiente que a metodologia proposta por Singh et al., utilizada rotineiramente no Laboratório de Genómica Funcional e Proteómica [49]. 1. Colocou-se num eppendorf 50 mg de farinha de trigo. 2. Adicionou-se solução aquosa de isopropanol a 50% (v/v) (1:10, w/v) e misturouse continuamente durante 30 min a 1000 x g (MS1 Minishacker, IKA Works, Inc.), à temperatura ambiente. 3. Centrifugou-se a x g durante 10 min à temperatura ambiente, e recolheuse o sobrenadante (extracto 1). 4. Adicionou-se a solução de extracção, isopropanol a 50% (v/v), 50 mm Tris-HCl (ph 7,5), contendo DTT 1% (w/v) (1:10) durante 30 min a 60 C, e misturou-se em cada 5 a 10 min. 5. Após a adição da solução de extracção, suspendeu-se novamente o resíduo por agitação (Fastprep FP220A Instrument) durante 10s a 6,5 m/s seguindo-se sonificação durante 10 min em banho ultra-sónico (Branson 3510, Brason Ultrasonics Corporation). 6. Centrifugou-se a x g durante 10 min à temperatura ambiente, e recolheuse o sobrenadante (extracto 2). 7. Repetiu-se os passos 4, 5 e 6 (extracto 3). 8. Os três sobrenadantes obtidos foram combinados e considerados o Extracto das Proteínas do Glúten. 9. Revelou-se as proteínas em SDS-PAGE T=10,3% e C=1,3%. Esta metodologia sofreu um amplo processo de optimização e o protocolo optimizado é muito diferente do original. As principais diferenças verificam-se ao nível 25

39 Materiais e Métodos dos volumes dos vários reagentes, o prolongamento da duração do passo 2 e a eliminação do passo 7. A metodologia utilizada encontra-se descrita em seguida. 1. Colocou-se num eppendorf 50 mg de farinha de trigo. 2. Adicionou-se 1 ml solução aquosa de isopropanol a 50% (v/v) (1:10, w/v) e misturou-se continuamente durante 30 min a 1000 rpm (rotações por minuto) (Thermomixer confort, Eppendorf), à temperatura ambiente. 3. Colocou-se o eppendorf na estufa durante a noite a 65ºC para que o sobrenadante evapora-se. 4. Suspendeu-se o resíduo seco com 200 μl de Solução de extracção (Anexo I). 5. Após a adição da solução de extracção, colocou-se o resíduo em agitação (Thermomixer confort, eppendorf) durante 10s a 6,5 m/s seguindo-se sonificação durante 10 min em banho ultra-sónico (Ultrasonic bath XUB10, Grant). 6. Centrifugou-se a rpm durante 10 min à temperatura ambiente, e recolheuse o sobrenadante. 7. Adicionou-se ao sobrenadante 200 μl de Solução C (Anexo I). 8. Revelaram-se as proteínas em SDS-PAGE T=10,3% e C=1,3%. 2.2 PROTOCOLO II METODOLOGIA PROPOSTA POR SINGH (1991) A metodologia proposta por Singh et al. (1991) [50] é utilizada de forma rotineira no Laboratório de Genómica Funcional e Proteómica do IBB-CGB da UTAD. A diferença mais importante entre o protocolo I e o protocolo II é que com a metodologia proposta por Singh e colaboradores obtemos dois extractos finais (um para as gliadinas e outro para as gluteninas). Utilizaram-se também as alterações propostas por Igrejas (2000) [51]. As alterações foram feitas com o objectivo de aumentar o poder de resolução de técnica e encontram-se descritos no Quadro 7. Na Figura 4 encontra-se um esquema representativo do protocolo de extracção. 26

40 Materiais e Métodos Protocolo de extracção das gliadinas e das gluteninas 1. Adicionou-se 1 ml de Solução A (Anexo I) aos eppendorfs contendo a farinha. 2. Colocaram-se os eppendorfs na estufa durante 30 min a 60ºC. 3. Centrifugou-se durante 1 min a rpm. 4. Passaram-se os sobrenadantes para um segundo conjunto de eppendorfs e estes seguiram para o passo 15, enquanto os eppendorfs com o sedimento seguiram para o passo 5. Quadro 7 - Parâmetros alterados da técnica de SDS-PAGE [51]. Técnica de Singh et al. (1991) [50] Modificações [51] Gluteninas Gluteninas Gliadinas Concentração do gel de acrilamida Gel de gradiente 7,5-13% 12,52% 10,3% Porosidade 1,5% 0,97% 1,3% Dimensão dos géis 140 x 140 x 1,5 mm 140 x 140 x 1 mm Intensidade da corrente 40 ma/gel 30 ma/gel Tempo de migração 150 min 270 min 195 min Temperatura de migração 25ºC 14ºC Extracção das gluteninas 1. Suspendeu-se o sedimento com 1 ml de Solução A e colocou-se na estufa durante 30 min a 65ºC. 2. Centrifugou-se durante 1 min a 10000rpm e eliminou-se o sobrenadante. 3. Adicionou-se 0,1 ml da Solução B1 (Anexo I) e colocou-se na estufa durante 30 min a 65ºC. 4. Centrifugou-se durante 5 min a rpm. 5. Adicionou-se 0,1 ml da Solução B2 (Anexo I) e colocou-se na estufa durante 15 min a 65ºC. 6. Centrifugou-se durante 2 min a rpm. 7. Recuperou-se 0,1 ml do sobrenadante para um terceiro conjunto de eppendorfs. 8. Adicionou-se 0,1 ml de Solução C (Anexo I). 9. Colocou-se na estufa durante 15 min a 65ºC e centrifugou-se durante 2 min a rpm. 27

41 Materiais e Métodos 10. Revelaram-se as subunidades de gliadinas e gluteninas em SDS-PAGE T=12,52% e C=0,97% Extracção das gliadinas 1. Colocaram-se os eppendorfs do segundo conjunto na estufa durante uma noite a 65ºC para evaporação do sobrenadante. 2. Suspenderam-se os resíduos secos com 0,2 ml de solução C. 3. Colocou-se na estufa durante 15 min a 65ºC. 4. Centrifugou-se durante 5 min a rpm. 5. Revelaram-se as gliadinas-ω em SDS-PAGE T=10,3% e C=1,3%. 50 mg de farinha Extracção das gliadinas com Propanol-1 a 50% a 60ºC Eliminação do sobrenadante Recuperação do sobrenadante Extracção das Gluteninas Extracção das Gliadinas Extracção das gliadinas com Propanol-1 a 50% + Agente redutor (DTT) na estufa a 65ºC + alquilação (4-vinilpiridina) Evaporação do sobrenadante na estufa a 65ºC 100 μl do sobrenadante μl de solução C μl de solução C SDS-PAGE T=12,52% e C=0,97% SDS-PAGE T=10,3% e C=1,3% Figura 5 - Esquema representativo do Protocolo II [50]. 28

42 Materiais e Métodos 2.3 QUANTIFICAÇÃO DAS FRACÇÕES PROTEICAS Método de Bradford As amostras dos vários tipos de extracções foram quantificadas pelo método de Bradford utilizando um espectrofotómetro NanoDrop 1000 e o software NanoDrop v3.8.0 [52, 53]. O método de Bradford é usado para quantificar soluções onde se encontram proteínas diluídas. O fundamento experimental tem por base a medição da absorvância do corante Coomassie Brilliant Blue G-250 que se liga às proteínas. O Coomassie possui duas cores, vermelha e azul. A cor vermelha indica que o corante não se encontra ligado às proteínas, passando a sua cor de vermelho para azul quando este se encontra na presença das mesmas. O complexo proteína-corante tem um alto coeficiente de extinção (define o quão fortemente uma substância absorve a luz num determinado comprimento de onda por unidade de massa ou por concentração molar, respectivamente), levando assim a uma grande sensibilidade na medição da proteína. Este processo de ligação proteína-corante é muito rápido (aproximadamente 2 minutos), mantendo-se o complexo disperso por um período relativamente longo (cerca de 1 hora) [52]. A curva de calibração utilizada encontra-se no Anexo II Ridascreen - Gliadin Competitive (R-Biopharm) O kit Ridasrceen - Gliadin Competitive é um teste imunológico utilizado para a quantificação de fragmentos peptídicos de prolaminas de trigo, centeio e cevada. Utiliza um anticorpo monoclonal R5 que reconhece, entre outros, a sequência potencialmente tóxica QQPFP, que ocorre repetidamente em prolaminas. Este teste foi utilizado para comprovar os resultados obtidos através dos protocolos anteriores desenvolvidos no Laboratório de Genómica Funcional e Proteómica, sendo que a metodologia utilizada foi a indicada pelos fabricantes. Esta metodologia foi realizada em colaboração com o Departamento de Biologia e do Ambiente (DEBA) da Universidade de Trás-os-Montes e Alto Douro, sob a supervisão da Professora Doutora Ana Coimbra. 29

43 Materiais e Métodos 2.4 ELECTROFORESE DO TIPO SDS-PAGE 1. Montaram-se as placas de electroforese de acordo com as indicações do fabricante. 2. Preparou-se um gel de SDS-PAGE, T=12,52% e C=0,97%, para as subunidades gluteninas, ou um gel de SDS-PAGE T=10,3% e C=1,3% para as gliadinas (Quadro 8). Os géis tinham as dimensões de 16 cm x 18 cm e 1 mm de espessura. 3. Desgaseificou-se o gel na bomba de vácuo e adicionou-se detergente dodecil sulfato de sódio (SDS), persulfato de sódio (APS) e tetrametiletilenodiamina (TEMED). 4. Depositou-se o gel nas placas de vidro até à medida de 4 cm do topo dos vidros. 5. Adicionou-se até um máximo de 160 μl de butanol no topo do gel para remover eventuais bolhas e aguardou-se que o gel polimeriza-se. 6. Lavou-se a superfície do gel com água destilada de forma e remover o butanol. Quadro 8 - Preparação dos géis de separação (quantidades referentes a dois géis). Gluteninas Gliadinas T=12,52% C=0,97% T=10,3% C=1,3% Acrilamida 40% 15,31 ml 12,54 ml Bisacrilamida (Bis) 2% 3 ml 3,25 ml Água destilada 10,5 ml 13 ml Tampão Tris HCl ph=8,8 18,8 ml 18,8 ml Desgaseificação SDS 10% 0,5 ml 0,5 ml APS 1% 1,25 ml 1,25 ml TEMED 25 μl 25 μl 7. Secou-se o gel com o auxílio de papel de filtro. 8. Preparou-se o gel de concentração (Quadro 9). 9. Desgaseificou-se o gel na bomba de vácuo e adicionou-se os catalisadores. 10. Adicionou-se o gel nas placas de vidro até cerca de 1 cm do topo. 11. Inseriu-se o pente e eliminou-se eventuais bolhas. 30

44 Materiais e Métodos Quadro 9 - Preparação dos géis de concentração (quantidades referentes a dois géis). Acrilamida 40% Bisacrilamida (Bis) 2% Água destilada Tampão Tris HCl ph=8,8 SDS 10% APS 1% TEMED T=2,88% C=1,42% 1,68 ml 0,49 ml 17,34 ml 2,81 ml Desgaseificação 0,2 ml 1 ml 22,5 μl 12. Retiraram-se os pentes com cuidado após a polimerização e lavaram-se os poços com tampão de electroforese (Anexo III), deixando os poços cheios com esta solução. 13. Depositou-se cerca de 10 μl de amostra por poço. 14. Colocaram-se as placas na tina de electroforese e ajustou-se o volume de tampão de electroforese para os valores ideais (até à marca do fusível). 15. Iniciou-se a electroforese com o valor de amperagem de 30 ma/gel e a uma temperatura de 20ºC. 16. Parou-se a migração das gliadinas após a saída da frente de migração. A paragem da migração das gluteninas efectuou-se uma hora após a saída da frente de migração Coloração com Azul de Coomassie 17. Retirou-se o gel das placas para uma tina e adicionou-se 400 ml de Solução de coloração (Anexo III). Deixou-se em agitação durante 24 horas. 18. Descorou-se o gel em água destilada durante uma noite. 19. Colocou-se o gel em ácido tricloroacético (TCA) a 6% durante um período mínimo de 4 horas. 20. Colocou-se o gel em solução de glicerol a 5% durante um período mínimo de 2 horas. 21. Secou-se o gel entre duas folhas de papel celofane, numa placa de vidro, durante vários dias. 31

45 Materiais e Métodos Coloração com Nitrato de Prata 22. Colocou-se o gel numa tina, e adicionou-se 500 ml de solução de Fixação (Anexo III). Este permaneceu em agitação durante 3 horas, sendo que é recomendável que a solução seja substituída a cada hora. 23. Lavou-se o gel em 500 ml de 30% Etanol, durante 20 min com agitação leve, seguida de duas lavagens consecutivas (20 min cada) com 15% etanol e água desionizada, respectivamente. 24. Adicionou-se 500 ml de solução de sensibilização (Anexo III), e agitou-se levemente durante 1 min. 25. Retirou-se a solução de sensibilização e lavou-se com água desionizada três vezes durante 20s, com agitação manual. 26. Adicionaram-se 500 ml de solução de nitrato de prata (Anexo III) e agitou-se suavemente durante 30 min. Deve-se proteger a tina da luz. 27. Decantou-se a solução de nitrato de prata e lavou-se com água desionizada três vezes durante 20s, com agitação manual. 28. Adicionaram-se rapidamente 500 ml de solução de revelação. 29. Procedeu-se à revelação até os bandas estarem claramente visíveis (5-15 min). As bandas mais intensas irão revelar após 2-3 min. 30. A revelação deve ser concluída assim que for atingido o nível desejado de coloração, para evitar a formação de demasiado background. Rejeitou-se a solução de revelação, lavou-se o gel brevemente em água desionizada e imergiuse de seguida em 500 ml de solução STOP (Anexo III) durante 20 min com agitação leve. 31. Lavou-se o gel três vezes durante 10 min com água desionizada antes de qualquer procedimento seguinte. 2.5 WESTERN BLOTTING Foi utilizado o anticorpo Anti-Gliadin 33-mer (G12) (Biomedal S. L.) para detectar o péptido 33-mer das gliadinas-α, LQLQPFPQPQLPYPQPQLPYPQPQLPYP QPQPF, através da técnica de Western blotting. 32

46 Materiais e Métodos Esta técnica foi realizada em colaboração com Departamento de Biologia da Universidade do Minho, sob a supervisão do Professor Doutor Cristóvão Lima. Para a realização desta técnica os géis de SDS-PAGE não devem sofrer qualquer tipo de coloração Transferência 1. Colocou-se cada gel em 400 ml de tampão de transferência (Anexo IV), durante 20 min com agitação. 2. Incubou-se em recipientes separados por papel de blotting (Whatman 3MM) (4 ou 6 folhas por membrana) e a membrana fluoreto de polivinilideno (PVDF), durante 15 min em tampão de transferência. 3. Imergiu-se a membrana em metanol durante 10s e depois passou-se por água destilada. 4. Construiu-se a Sandwich no ECL Semi-dry Transfer Unit (Amersham), de acordo com o esquema: + Cátodo + Papel Whatman 3MM (2 ou 3 folhas) Gel Membrana PVDF Papel Whatman 3MM (2 ou 3 folhas) - Ânodo - 5. Removeu-se as bolhas de ar com um pequeno cilindro. Sobre as folhas colocaram-se algumas gotas de tampão para as manter húmidas. Secou-se excesso de líquido à volta da sandwich. 6. Colocou-se a tampa e ligou-se o aparelho, fixando a voltagem nos 12 V (ou outro valor mais indicado dependendo do tamanho da membrana), durante 1 hora. 7. No final desligou-se o aparelho, abriu-se e desmontou-se a sandwich. Desprezou-se tudo excepto as membranas PVDF. 8. Colocaram-se as membranas em tampão fosfato-salino com tween-20 (TPBS) (Anexo IV) durante 10 min. 33

47 Materiais e Métodos Marcação com o anticorpo 9. Bloqueou-se a membrana em 25 ml de tampão de bloqueio (Anexo IV) pelo menos durante 1 hora à temperatura ambiente, com agitação. 10. Retirou-se tampão de bloqueio e lavou-se 3x em TPBS, 5 min cada lavagem. 11. Num tubo de 50 ml, incubou-se a membrana com a solução do anticorpo primário Anti-Gliadin 33-mer (G12) (Biomedal S. L.) (Anexo IV), durante 1 hora à temperatura ambiente num Roller Mixer. 12. Retirou-se a membrana do tubo e colocou-se num tubo de lavagem com TPBS. 13. Lavou-se a membrana em TPBS 3x, 5min cada lavagem no Roller Mixer. 14. Incubou-se a membrana com a solução do anticorpo secundário conjugado Horseradish Peroxidase-linked (Anexo IV), durante 1h à temperatura ambiente num roller mixer (Vf=10 ml). 15. Retirou-se o anticorpo secundário e lavou-se a membrana em TPBS 3x, 5min cada lavagem Optimização da metodologia de revelação Numa fase inicial do trabalho, os resultados obtidos após a revelação não eram perceptíveis, obtendo-se perfis muito intensos para praticamente todas as amostras. Assim, foi realizado um processo de optimização com a supervisão do Professor Doutor Carlos Carvalho, devido à sua experiencia com a revelação manual por quimiluminescência, disponível na UTAD. Posteriormente, a revelação foi efectuada com uma câmara de detecção (Chemi Doc XRS, Bio-Rad Laboratories, Inc.) na Universidade do Minho, para que fosse possível a obtenção de imagens de qualidade superior Revelação/detecção por eletroquimioluminescência (ECL) 1. Preparou-se o kit Amersham ECL TM Western blotting Detection 1A:1B. 34

48 Materiais e Métodos 2. Adicionou-se 500 µl de Solução A µl de Solução B para uma membrana com 8,5 x 5,5 cm. Misturaram-se as duas soluções por inversão. 3. Retirou-se a membrana da lavagem com TPBS e colocou-se sobre uma superfície limpa. 4. Pipetou-se 1 ml da solução de revelação (A+B) sobre a membrana. 5. Deixou-se a membrana com a solução de revelação durante exactamente 1 min. 6. Escorreu-se a solução de revelação da membrana retirando o excesso da solução com o auxílio de papel absorvente. 7. Colocou-se a membrana dentro de um acetato fechado. 8. Colocou-se o acetato fechado na câmara de detecção (Chemi Doc XRS, Bio-Rad Laboratories, Inc.) e adquiriu-se a imagem. 2.7 EXCISÃO E IDENTIFICAÇÃO DAS BANDAS PROTEICAS Foram seleccionadas algumas bandas proteicas que apresentavam uma boa capacidade de hibridação com o anticorpo Anti-Gliadin 33-mer (G12) (Biomedal S. L.). Essas bandas foram excisadas e isoladas para posterior sequenciação através da técnica MALDI-TOF no Departamento de Química da Universidade de Aveiro, sob a supervisão do Professor Doutor Rui Vitorino. Seguindo trabalhos anteriores, as bandas foram removidas individualmente do gel e identificadas com auxílio de um software de imagem [54]. 1. Realizou-se um gel de SDS-PAGE em que foram incluídas as variedades das quais as bandas foram seleccionadas. 2. Digitalizou-se o gel e identificaram-se as bandas seleccionadas. 3. Colocou-se o gel sobre um transiluminador na mesma posição em que foi realizada a digitalização. Cortou-se as bandas com o auxílio de um bisturi. 4. Transferiram-se as bandas para eppendorfs individuais com uma designação específica e assinalaram-se, de seguida, as bandas no computador com o auxílio do software de imagem Image Master (GE, Amersham Biosciences). 5. Para posterior identificação através de espectrometria de massa (MALDI-TOF), lavou-se, cada banda recolhida, três vezes em 25mM de bicarbonato de amónio / 35

49 Materiais e Métodos 50% acetonitrilo (ACN), uma vez com ACN e seco num SpeedVac (Thermo Savant). 6. De seguida, adicionaram-se 25 ml de tripsina suína modificada ao nível da sequência (Promega) em 25 mm de bicarbonato de amónio a cada banda seca e posteriormente submeteu-se a incubação a 37ºC, durante a noite. 7. A extracção dos péptidos trípticos realizou-se pela adição de ácido fórmico 10%/50% ACN por três vezes, liofilização num SpeedVac (Thermo Savant) e em seguida ressuspenção em 10 ml de solução de 50% acetonitrilo/0,1% ácido fórmico. 8. Misturaram-se as amostras numa matriz 1:1 de solução saturada de ácido α- ciano-4-hidroxicinâmico preparada em 50% acetonitrilo/0,1% ácido fórmico. 9. Fizeram-se alíquotas das amostras (0,5 ml) que foram colocadas nas plataformas-alvo do espectrómetro de massa MALDI-TOF/TOF (4800 Proteomics Analyzer, Applied Biosystems, Europe). 10. Obteve-se o espectro de massa peptídico no modo de reflector de ião positivo, num intervalo de massa entre 800 e 4500 Dalton (Da) com disparos de laser ca Criou-se, para cada banda, um método de aquisição de informação independente de forma a seleccionar os seis picos mais intensos excluindo-os dos picos formados pela matriz, pela autólise da tripsina ou pela acrilamida, para subsequente aquisição da informação de espectrometria de massa em tandem (Tandem mass spectrometry, MS/MS). O espectro de massa foi internamente calibrado com picos autodigeridos de tripsina permitindo uma exactidão de massa abaixo dos 25 ppm. 12. Processaram-se e analisaram-se os resultados obtidos por MALDI-TOF através do Global Protein Server Workstation (Applied Biosystems) que utiliza um software MASCOT interno (Matrix Science, Londres, Reino-Unido) para pesquisar os fingerprints de massa peptídica e a informação MS/MS. A base de dados para sequências proteicas não-redundantes Swiss-Prot foi utilizada para todas as pesquisas sobre Triticum spp. e Secale cereale. 13. Os parâmetros de busca nas bases de dados foram os seguintes: carbamidometilação e propionamida de cisteína como uma modificação variável 36

50 Materiais e Métodos assim como a oxidação de metionina, e uma tolerância até duas clivagens trípticas falhadas. A tolerância das leituras de massa peptídica é de 25 ppm e a tolerância à massa do fragmento iónico foi de 0,3 Da. 14. Aceitaram-se as identificações positivas até 95% de nível de confiança. 2.8 ANÁLISE BIOINFORMÁTICA E DESENHO DE PRIMERS As sequências obtidas foram analisadas e identificadas na plataforma NCBI (National Center for Biothecnology Information) (http://www.ncbi.nlm.nih.gov/), usando a ferramenta de alinhamento BLAST (Basic Local Alignment Search Tool). Dentro desta ferramenta utilizou-se o tipo protein blast. A única alteração às definições predefinidas foi a selecção da base de dados, UniProtKB/Swiss-Prot (http://www.uniprot.org/). Dentro dos resultados obtidos, deu-se preferência aos que mostravam uma maior percentagem de cobertura e identidade. Recorreu-se a base de dados UniProt para obter as sequências nucleotídicas correspondentes às sequências proteicas obtidas anteriormente. As sequências nucleotídicas foram traduzidas com a ferramenta ExPASy Translate Tool (http://web.expasy.org/translate/), para confirmar que correspondiam às sequências proteicas iniciais. Todos os alinhamentos foram realizados no CLC DNA Workbench (CLC Bio). Os primers para futura amplificação das sequências nucleotídicas foram obtidos através da utilização do programa PerlPrimer v (Souceforge.net). 37

51 Sentido da corrida Resultados e Análise CAPÍTULO III RESULTADOS E ANÁLISE Com recurso às metodologias descritas anteriormente, foi possível realizar a extracção das promalinas de trigo e centeio. A metodologia de extracção em duas etapas, adaptada da publicação de van den Broeck [49], passou por um processo de optimização, de forma a poderem ser obtidos os melhores resultados possíveis. Parte deste processo passou pela realização de géis como o exemplificado na Figura 5, com diferenças entre os processos de extracção das várias amostras descritas no Quadro 10. Complementarmente foi também utilizada a coloração com nitrato de prata para uma análise mais detalhada. No final, seleccionou-se a amostra 7 como sendo a ideal, e foram utilizadas as mesmas quantidades na extracção de todas a amostras no decorrer do trabalho Gluteninas Gliadinas Figura 6 - Imagem de um gel que representa parte do processo de optimização do protocolo de extracção em duas etapas. Neste caso, foi utilizada sempre a mesma variedade de trigo e foi seleccionada a amostra 7. 38

52 Resultados e Análise Quadro 10 - Descrição das diferenças entre os métodos de extracção apresentados na Figura 5. As amostras 1 e 2 foram utilizadas como controlo. Poço Solução de Solução C Quantidade extracção (μl) (μl) depositada no gel (μl) 1 Gliadinas extraídas pela 15 2 metodologia de Singh et al. 7, , ,5 7 a , , , , a Quantidades escolhidas. Ao contrário da metodologia de van den Broeck [49] a metodologia proposta por Singh e colaboradores [50] é utilizada, rotineiramente, no Laboratório de Genómica Funcional e Proteómica, não sendo necessário um processo de optimização. Assim, para cada amostra foram utilizadas três extracções diferentes; Gliadinas Fracção das gliadinas extraídas pela metodologia de Singh. Gluteninas Fracção das gluteninas extraídas pela metodologia de Singh. Combinado Extracto obtido através da metodologia de extracção em duas etapas. As amostras foram quantificadas pelo método de Bradford [52], tendo-se obtido valores que variam entre 40 e 80 µg/μl para as três fracções proteícas. Relativamente à metodologia de Western blotting, foi necessário optimizar a metodologia de revelação. Depois de vários testes, determinou-se que os melhores resultados eram obtidos com quantidades de amostra de 5 μl depositadas no gel SDS- PAGE. Assim, tendo em consideração os valores da quantificação, foi depositado nos géis entre 200 e 400 µg de proteína. Após a hibridação com os anticorpos Anti-Gliadin 33-mer (G12) (Biomedal S. L.), procedeu-se à captação de imagem da membrana, tendo sido obtidos resultados 39

53 Resultados e Análise semelhantes aos exemplificados na Figura 6. De acordo com a metodologia utilizada, a hibridação do anticorpo com as proteínas de cada amostra é verificada pelo fenómeno de quimiluminescência nos locais onde ocorreu a esta hibridação. A cada perfil foi atribuído um valor entre 1 e 5, de acordo com a sua intensidade, sendo 5 o valor de intensidade mais elevada. Estes resultados foram organizados graficamente na Figura 7. Figura 7 Exemplo dos resultados obtidos após a realização da metodologia da Western blotting com o anticorpo Anti-Gliadin 33-mer (G12) (Biomedal S. L.). Encontram-se marcadas 4 das 21 das bandas que foram seleccionadas para posterior identificação. As restantes bandas pertencem a variedades que não estão presentes neste gel. Posteriormente realizou-se a análise estatística, sendo calculadas as médias respectivas para cada grupo de amostras (Quadro 11). Foram designadas como trigos antigos as cinco variedades de trigo duro e trigo mole, cuja inscrição no CNV foi 40

54 Resultados e Análise anterior a 1990: Celta, Hélvio, Almansor, Caia e Mondego. Os dados destas variedades foram incluídos tanto no grupo trigos antigos como nos grupos trigos duros e trigos moles, respectivamente. Trigos duros Trigos antigos Trigos moles Centeios 'Ariesol' 'Attila' 'Marialva' 'Celta' 'Hélvio' 'Almansor' 'Caia' 'Mondego' 'Alva' 'Ardila' 'Arpège' 'Eufrates' 'Jordão' 'Nabão' 'Roxo' 'Sagitário' 'Sever' 'Tigre' 'Torero' 'Barbela' 'Alvão' S. Vavilovii 'Marder' 'Picasso' 'Centenico' 'Cepeda' 'Edral' 'Gimonde' 'Lamas de Ôlo' 'Lamego' 'Malhadas' 'Montalegre' 'Morgade' 'Padrela' 'Vilar Douro' 'Vila Pouca' Gliadinas, Singh et al. Gluteninas, Singh et al. Extracção em duas etapas Figura 8 - Valores atribuidos às diferentes variedades de trigo e centeio com base na intensidade dos perfis após a realização da metododogia de Western-blottin e hibridação com o anticorpo Anti-Gliadin 33- mer (G12) (Biomedal S. L.). Os três valores correnpodem às três fracções proteicas. Através da análise dos resultados podemos verificar que, na grande maioria dos casos, o extracto das Gliadinas revelou uma maior ou igual hibridação com o 41

55 Resultados e Análise anticorpo que os outros extractos. O extracto das Gluteninas revelou, na maioria dos casos, uma maior intensidade que o extracto Combinado (obtido pela extracção em duas etapas) no caso dos Trigos Moles e dos Trigos Antigos. Relativamente aos Trigos Duros e Centeios, o extracto Combinado, revelou na maioria dos casos, uma intensidade maior ou igual ao extracto das Gluteninas. Trigos duros Trigos antigos Trigos moles Centeios 'Ariesol' 'Attila' 'Marialva' 'Celta' 'Hélvio' 'Almansor' 'Caia' 'Mondego' 'Alva' 'Ardila' 'Arpège' 'Eufrates' 'Jordão' 'Nabão' 'Roxo' 'Sagitário' 'Sever' 'Tigre' 'Torero' 'Barbela' 'Alvão' S. Vavilovii 'Marder' 'Picasso' 'Centenico' 'Cepeda' 'Edral' 'Gimonde' 'Lamas de Ôlo' 'Lamego' 'Malhadas' 'Montalegre' 'Morgade' 'Padrela' 'Vilar Douro' 'Vila Pouca' 1804, , , , , , , , , ,9 2069, , , , , , , , , ,9 2036, , , , , , , , , , , , , , , , Figura 9 - Valors da concentração (ng/ml) de glúten obtidos com recurso ao kit Ridascreen - Gliadin Compettitive (R-Biopharm), para as variedades de trigo. 42

56 Resultados e Análise Pela soma dos valores atribuídos a cada extracto e o cálculo da média, pode-se verificar que as variedades de trigo apresentam um valor superior (7,1) ao das variedades de centeio (5,8). Os valores mais elevados foram verificados nas variedades de Trigo Duro (8,8), que foram superiores aos valores das variedades de Trigos Moles (6,4) e de Trigos Antigos (8). A maioria das variedades obteve valores entre 5 e 7, sendo as excepções as variedades Ariésol, Attila (Trigos Duros), Celta, Hélvio (Trigos Duros/Antigos) e Caia (Trigo Mole/Antigo) com valores superiores a 7, e as variedades Alvão, Picasso e Centenico (Centeios) com valores inferiores a 5. Quadro 11 - Análise estatística dos resultados dos apresentados nas Figuras 7 e 8. Foram calculados os valores da média para todos os grupos de amostras e o coeficiente de correlação de Pearson (ρ2) entre a soma dos valores atribuídos a cada extracto e as concentrações obtidas com o kit Ridascreen, para cada grupo de amostras. Está também indicado os valores máximos e mínimos obtidos em cada parâmetro. Gliadinas Gluteninas Combinado Total Ridascreen (ng/ml) Correlação (ρ 2 ) Trigos (média total) 3,2 2,2 1,8 7,1 2101,58 0,0009 Trigos Duros 3,6 1,8 3,4 8,8 2128,58 0,0181 Trigos Moles 3,0 2,3 1,2 6,5 2092,58 0,0191 Trigos Antigos 3, ,10 0,9370 Centeios 2,8 0,5 2,5 5,8 2063,46 0,1717 Máximo ,31 Mínimo ,82 Média Total 3,0 1,4 2,1 6,5 2084,64 O kit Ridascreen - Gliadin Competitive (R-Biopharm) foi utilizado como forma de comparar/confirmar os resultados obtidos pelas metodologias anteriores. Alguns destes resultados são discordantes dos obtidos utilizando os anticorpos Anti-Gliadin 33- mer (G12) (Biomedal S. L.). Os resultados foram organizados graficamente na Figura 8. O valor da concentração de glúten nas variedades de trigo (2101,58 ng/ml) é superior ao obtido nas variedades de centeio (2063,46 ng/ml). O valor de concentração foi superior nos Trigos Duros (2128,58 ng/ml), seguindo-se os Trigos Antigos (2124,10 ng/ml) e o valor mais reduzido volta a ser o dos Trigos Moles (2092,58 ng/ml). As variedades Attila (Trigo Duro), Hélvio (Trigos Duros/Antigos) e Padrela (Centeio) foram as variedades que apresentaram os valores de concentração mais elevados, enquanto as variedades Jordão (Trigo Mole), Marder, Centenico e Lamas de Ôlo (Centeios) apresentaram os valores mais reduzidos, os únicos inferiores a 2000,00 ng/ml. 43

57 Resultados e Análise Foi calculado o coeficiente de correlação de Pearson (ρ2) entre a soma dos valores atribuídos a cada extracto e as concentrações obtidas com o kit Ridascreen. Este coeficiente mede o grau da correlação e a direcção dessa correlação, se positiva ou negativa, entre duas variáveis quantitativas e varia entre -1 e 1. O valor de correlação foi muito baixo para os Trigos (total) (0,0009), Trigos Duros (0,0181), Trigos Moles (0,0191) e Centeios (0,1717) (Quadro 11), no entanto, revelou-se uma forte correlação entre os valores dos Trigos Antigos (0,9370). Não considerando a significância dos resultados e a origem das variedades, obteve-se um valor de 0,9322 para o coeficiente de correlação entre as médias totais da soma dos valores atribuídos a cada extracto, de cada grupo de variedades e as respectivas médias das concentrações obtidas com o kit Ridascreen. Posteriormente foram escolhidas 21 bandas de 21 variedades diferentes, analisadas neste trabalho. Estas bandas foram seleccionadas por revelarem uma elevada intensidade após a realização da metodologia de Western blotting, por se encontrarem relativamente isoladas no gel (o que facilita a sua excisão) e de forma a incluir os vários grupos de variedades analisadas neste estudo. Estas bandas foram excisadas do gel de SDS-PAGE e identificadas, no entanto, só quatro sequências das variedades Alvão, Sagitário, Eufrates e Centenico, apresentaram homologias conhecidas (Quadro 12). Para as sequências de Alvão e Sagitário foram indicados os Accession numbers para todas as sequências com as quais foi detectada o máximo de cobertura e o máximo de identidade, todas dentro da espécie Triticum aestivum. Esta selecção encontra-se exemplificada na Figura 9. Devido à semelhança entre os aminoácidos destas duas sequências, ao valor score proteico, massa, ponto isoeléctrico (pi) e localização muito semelhante no gel de SDS-PAGE, podemos concluir que se trata da mesma sequência, contudo no caso de Alvão, a identificação foi mais incompleta. Esta sequência, P , foi identificada como parte de uma subunidade de glutenina LMW no trigo. A sequência da variedade de trigo mole Eufrates apenas demostrou o máximo de cobertura e identidade com uma sequência de reticulina oxidase em Arabidopsis 44

58 Resultados e Análise thaliana. Outras sequências com elevados valores de cobertura e identidade foram reconhecidas em Huperzia lucidula, Mus musculus, Caenorhabditis elegans. Quadro 12 - Resultados da identificação das bandas. Encontram-se indicados os parâmetros estabelecidos com o software Mascot (Matrix Science Inc.). Foram seleccionados os Accession numbers que correspondem aos valores mais elevados de cobertura e identidade. Variedade e método de extracção Score Proteico Massa Proteica (Da) pi Espécie Reconhecida Número de clivagens Perdidas Score peptídico Valor de péptidos esperado Sequência reconhecida Accession numbers Alvão (S. cereale) Combinado ,04 Triticum aestivum 0 30,28 0,099 QIPEQSRH P ; P ; P ; P ; P ; P ; P ; P ; P Sagitário (Triticum spp.) Gliadinas ,04 Triticum aestivum 1 55,36 0,00061 QIPEQSRHE SIRA P Eufrates (Triticum spp.) Gliadinas ,07 Arabidopsis thaliana 2 33,69 0,024 MLIQPVTRK KV Q9SVG4.2 Centenico (S. cereale) Combinado ,57 Triticum aestivum 1 46,02 0,0057 QLPQIPEQS RYDAIRA P ; P ; P ; P Nota: Todos os dados apresentados foram obtidos com o software Mascot (Matrix Science Inc.). No caso de Centenico, não foi detectada nenhuma sequência com o máximo de cobertura e o máximo de identidade. Assim, foram indicados os quatro resultados mais próximos, com 100% de cobertura e identidade compreendida entre 87 e 93%. Os Accession numbers P e P correspondem a subunidades de glutenina LMW, enquanto P e P correspondem a gliadinas-γ na espécie Triticum aestivum. 45

59 Resultados e Análise Devido às semelhanças entre as sequências de Alvão e Sagitário, a sequência de Alvão não foi utilizada. No caso da sequência de Centenico, apenas se encontrava disponível a sequência do mrna, pelo que os primers tiveram de ser desenhados dentro da sequência correspondente à proteína. Estes foram aproximados tanto quanto possível às extremidades da sequência. A selecção dos primers encontra-se exemplificada na Figura 10, organizada no Quadro 13. Figura 10 Exemplo da selecção dos Accession numbers para a sequência de Alvão, na base de dados NCBI. Sagitário - >ENA X07747 X Wheat gene for low molecular weight glutenin : Location: TGCTCTGTAGGCGTCAGTTCATCTTATCATCTTAGAGGAAAATACAAAGTTAGTTTTATAAAAAGCAACCGAGTCTAG AAGAACCCTCCACACGCAAGACTTCAATAATCGAGCATATCTTAACAGCCCACACACGATTGCAAACTTAGTCCTAC ACAAGCTTTGCCTTTCTTGTTTACGGCTGACAACCTATACAAGGTTCCAAACTCGGTTGCAAAAGTGATACTATCCTG ATAAGTGCGTGACATGTAAAGTTAATAAGGTGAGTCATATGTACCAAACATCGAGGTTTCTGTACTTTGTGTATGATC ATATGCACAACTAAAAAGCAACTTTGATGATGAATCCAAAAGTACGCTTTTGTAGCTAGTGCAACCCAACACAATGT ACCAAAAAAATTCATTTCAGATGCATCCAAACAGAATTATTAAAGCCGGTGCAAAGAAGGAAAAGAGGTGGTGTCC CGGCAACTATAAATAGGCATGAAGTATAAAGATCATCACAAGTACAAGCATCAAAGCCAAGCAACACTAGTTAACA CCAATCCACAATGAAGACCTTCCTCGTCTTTGCCCTCCTCGCTCTTGCGGCGGCAAGTGCCGTTGCGCAAATTTCACA GCAACAACAAGCACCGCCATTTTCGCAGCAACAACAACCACCATTTTCACAGCAACAACAACCACCATTTTCGCAGC AACAACAATCACCATTTTCGCAACAACAACAACAACCACCATTTGCGCAGCAACAACAACCACCGTTTTCACAACAA CCACCAATTTCACAGCAGCAACAACCACCATTTTCACAGCAACAACAACCACAATTTTCACAGCAACAACAACCACC ATATTCGCAGCAACAACAGCCACCATATTCGCAGCAACAACAACCACCATTTTCGCAGCAACAACAACCACCATTTT CGCAGCAACAACAACAACCACCATTTACACAGCAGCAGCAGCAGCAACAACAACAACAACCATTTACACAGCAACA GCAACCACCGTTTTCACAACAGCCACCAATTTCACAGCAGCAACAACCACCATTTTTGCAGCAACAACGACCACCAT TTTCACGGCAACAACAAATACCAGTTATTCATCCATCTGTTTTGCAACAGCTAAACCCATGCAAGGTATTCCTCCAAC AGCAGTGCATCCCTGTGGCAATGCAGCGATGTCTTGCTAGGTCACAAATGTTGCAGCAGAGCATTTGCCATGTGATGC AGCAACAATGTTGCCAGCAGTTGCGGCAAATCCCCGAGCAATCCCGCCATGAGTCAATCCGTGCTATCATCTACTCTA TCATCCTGCAGCAGCAGCAGCAGCAACAACAACAACAACAACAACAACAGGGTCAGAGTATCATCCAATATCAGCA ACAACAACCCCAACAGTTGGGCCAATGTGTCTCCCAACCCCTACAGCAGTTGCAGCAGCAACTCGGGCAACAACCTC AACAACAACAATTGGCACACCAGATAGCTCAGCTTGAGGTGATGACTTCCATTGCACTCCGTACCCTGCCAACAATG TGCAATGTCAATGTGCCGTTGTACGAAACCACCACTAGTGTGCCATTAGGCGTTGGCATCGGAGTTGGTGTCTACTGA TAAGAAAAGATCTCTAGTAATATATAGTTGGATCACCGTTGTTTAGTCGATGGATATGTCGATGTAGCGGTGACAAAT AAAGTGTCACACAACGTCATGTGTGACCCGCTCAAACTAGTTGTTTAAATTCTGAAATAAAATACAAATAAAGGTGT ATTAAGAAAATGTTCATATCGGCATTGTGTGGATGTCGATCTGATTGCCAT Eufrates - >ENA AL AL Arabidopsis thaliana DNA chromosome 4, BAC clone F21C20 [sequência incompleta] AATCTGTAATCACTAATCATATCCCTTAACTCCCTTTAATATCTTTTGTTGACCAAAACAAATATTTTTTTGTTATATGC AACGAATAAAAAAACATTGAAAGTACTTTCCAAAAACAAAACACGTCTTCTTCTCCCTGCGGTTATAAATAGACACG GATAAGTACAAAGAACAGAGGAACACGAGACCCAAGAAAAAGATCTCAAAATGCTCACGACACCTCCACGAACCTT TGTCTCTGTCCCTTTCTTCTTCTTCTTCCTCCTCTTCCTTTCTCTACCTCTCTCATCTTTCTCTCAATCGAACTCTGTATA CAACTCTTTCCTCAAGTGTTTCTCCGACAAGACGAAATCTCCACAATCCCAAATCACTGACAATGTCTTCTCTCAGAC AAACCCTGCTTTCTCCTCCGTTCTTCGTGCTTACATCCGCAATGCGAGGTTCAACACTTCCTCTACTCTTAAACCCACC 46

60 Resultados e Análise ATCATAATCACTCCTCGCTCCGAGAGCCACGTCAGCGCCGCCGTCACTTGCTCAAAAACCCTAAATTTCCTCCTCAAA ATCCGAAGCGGCGGCCATGACTACGATGGTCTCTCTTACATTTCCGACAAACCATTTTTCATCCTCGACATGTCGAAT ATCCGTGACGTCTCTGTAGATATCGCCTCGAATTCGGCATGGATCTCCGCCGGAGCGACTCTCGGAGAGGTTTATTAT CGGATTTGGGAGAAAAGCAGAGTCCATGGATTCCCCGCCGGAGTTTGTCCGACGGTTGGTGTTGGTGGGCATTTAAG CGGCGGTGGTTACGGTAACATGGTGAGGAAGTTTGGATTATCTGTGGATTACGTTGAGGATGCCAAGATCGTCGATG TAAACGGTCGGGTTTTAGATCGGAAAGCAATGGGTGAGGATCTTTTCTGGGCGATTACCGGTGGAGGAGGAGGTAGC TACGGCGTCGTTTTGGGATACAAAGTCAAGCTTGTTCCTGTGCCATCGGTCGTTACGGTGTTTAGAGTGGAGCAGTAT ATGGATTCAGGAGCTGTGGATATGGTTCACAAATGGCAATCGGTTGGTCCGAAAACTGATCCGAATCTGTTTATGAG AATGTTGATTCAACCAGTGACGAGGAAGAAGGTAAAGACTGTGAGAGCTTCTGTGGTTGCTCTGTTTTTAGGCAGAG CAGATGAAGTTGTTGCTTTGCTTAGTAAGGAGTTTCCTGAATTGGGTTTAAAGAAGGAGAATTGTTCGGAGATGACTT GGTTTCAGTCTGCTTTATGGTGGGACAATCGTCTTAATGCTACTCAGGTTGATCCTAAAGTGTTTCTTGATCGGAATCT CGATACCTCGAGTTTCGGTAAGAGGAAATCGGATTACGTCGCGACTGCGATTCCGAAGAAAGGGATTGAGTCTTTGT TCAAGAAGATGATTGAGTTAGGGAAAATCGGGCTTGTTTTCAATCCGTATGGAGGGAAAATGGCGGAGGTTGCGGTT AACGCGAAGCCGTTTCCACATCGAAACAAGCTTTTCAAGATTCAGTACTCTGTGAACTGGAAAGAAAACTCTGCAGA GATAGAGAAGGGGTACTTGAATCAGGCTAAGGTGCTTTACAGTTTCATGACCGGGTTTGTGAGCAAGAATCCTAGGA GTTCTTACTTCAATTACCGGGATGTCGATATCGGTGTGAATGATCATGGGGCGAATAGTTACAAGGAAGGAGAGGTG TATGGAAGGAAGTATTTCGGAGAGAATTTCGATCGATTAGTGAAGATTAAAACCGCGGTTGATCCCGGGAATTTCTT CAGGAATGAACAGAGTATACCTACCTTGAAAAGTAAGGCATAATTGATATATGATCATTTAATATAAAGATTGGCTT CCTATAATGTAATGTTTTAGTGAAGCACTATAGAATATATGGTTTTGGATATTGTATATTGTATAGTTTCTCTGTTCAT GGAACTCTACAACAAGCTCATTTGATTATGTGTAAGCCTATATTGGGTTTGTATGAGCGAAGTAATAAGTCAAAGTTT CTGGTGATGAAAAATCGAATTCGAAACCACTGATTGTTGAAAATAGCTACCTGCTTTTGTAATTTAAGGCGAAAATTG TGGTTTGGTTTGCAGTAGTTGACGTGATTCTTGTGACCTGCTGCAATTTTGTGTAATGAA Centenico - >ENA X51759 X Triticum durum mrna for glutenin : Location: CCCCCCCCCAAGCACAAGCATCAACACCAAGTAAAACTAGTTAGCACCAATCCATCATGAAGACCTTCCTCGTCTTTG CCCTCCTCGCCGTTGTGGCGACAAGTACCATTGCGCAGATGGAGACTAGCTGCATCCCTGGTTTGGAGAGACCATGG CAGGAGCAACCATTACCACCACAACACACATTATTTCCACAACAACAACCATTTCCACAACAACAACAACCACCATT TTCACAACAACAACCATCATTTTTGCAGCAACAACCAATTCTACCGCAGCTACCATTTTCACAGCAACAACAACCAGT TCTACCGCAACAATCACCATTTTCACAGCAACAACTAGTTTTACCTCCACAACAACAATACCAACAGGTTCTGCAACA ACAAATCCCTATTGTTCAGCCATCCGTTTTGCAGCAGCTAAACCCATGCAAGGTATTCCTCCAGCAGCAGTGCAACCC TGTGGCAATGCCACAACGTCTTGCTAGGTCGCAAATGTTGCAGCAGAGCAGTTGCCATGTGATGCAGCAACAATGTT GCCAGCAGTTGCCGCAAATCCCCGAACAATCCCGCTATGATGTAATCCGTGCCATCACCTACTCCATCATCTTACAAG AACAACAACAGGGTTTTGTCCAAGCTCAGCAGCAACAACCCCAACAGTTGGGTCAAGGTGTCTCCCAATCCCAACAA CAATCGCAGCAGCAGCTCGGACAATGTTCTTTCCAACAACCTCAGCAGCAACTGGGTCAACAGCCTCAACAACAACA GGTACTACAGGGTACCTTTTTGCAGCCACACCAGATAGCTCACCTTGAGGTGATGACTTCCATTGCACTCCGTACCCT GCCAACGATGTGCAGTGTCAATGTGCCGTTGTACAGCTCCACCACTAGTGTGCCATTCAGTGTTGGCACCGGAGTTGG TGCCTACTTATAAGAAAAGTTGTCTAGTAATATATAGTTGGACCACCGTTGTCTAGTCGATGGACATGTCGAGGAAGC GGTGACAAATAAAGTGTCACACAACGTCATGTATGACCCGCACAAAGTAGTAATTAAATTCTGGAATAAATACAAAT AAAGTGTTCTCTAGAC Figura 11 - Selecção dos primers forward e reverse para a sequência para as três sequências estudadas. Encontram-se marcados a cinzento da sequência proteica, a vermelho o primer forward e a azul o primer reverse. Quadro 13 - Lista de primers desenhados no programa PerlPrimer. Tm - Temperatura de desnaturação; CG - Percentagem de guaninas e citosinas. Variedade Primers Tm Comprimento % CG Sagitário F: TCCCGGCAACTATAAATAGG 56,94 Cº 20 pb 45 % R: GTAGCGGTGACAAATAAAGTG 57,73 Cº 21 pb 42 % Eufrates F: CTGCGGTTATAAATAGACACG 57,07 Cº 21 pb 42 % R: GGGTTTGTATGAGCGAAGTA 57,59 Cº 20 pb 45 % Centenico F: CAAGCACAAGCATCAACAC 58,26 Cº 19 pb 47 % R: GACCCGCACAAAGTAGTAA 57,54 Cº 19 pb 47 % 47

61 Discussão dos Resultados CAPÍTULO IV - DISCUSSÃO DOS RESULTADOS A marcação com recurso a anticorpos monoclonais é, actualmente, a única forma de realizar um estudo comparativo com um elevado número de variedades, como é o caso deste trabalho. É também uma importante ferramenta para quantificação de epítopos da doença celíaca em programas de melhoramento. No entanto, devido à especificidade das sequências reconhecidas, os anticorpos utilizados não revelam todos os epítopos associados à doença celíaca, enquanto noutros casos pode ocorrer a marcação de sequências que não representam os epítopos completos. Através da análise dos resultados é possível concluir que as variedades de trigo apresentam, de uma forma geral, um maior número de sequências associadas à doença celíaca que as variedades de centeio. É necessário ter em consideração que neste estudo não foi utilizado o mesmo número de variedades de trigo e centeio. Assim, não se pode considerar que a análise estatística feita para os trigos duros (5 amostras) por exemplo, tenha o mesmo significado que a análise desenvolvida para os trigos moles (15 amostras). O anticorpo Anti-Gliadin 33-mer (G12) (Biomedal S. L.) demonstrou ter uma maior ou igual capacidade de hibridação com o extracto de Gliadinas para todas as amostras analisadas, sendo que a extracção combinada e a extracção das gluteninas apresentaram, em certas variedades, resultados equivalentes. O extracto de Gluteninas apresentou uma capacidade hibridação menor que as Gliadinas na maioria das variedades estudadas, no entanto, no caso das variedades Mondego, Sagitário Tigre e Torero a resposta teve um valor equivalente. Já nos casos dos trigos Sever e Roxo, o extracto de Gluteninas apresentou uma capacidade de hibridação maior que as Gliadinas A metodologia de extracção em duas etapas utilizada neste trabalho mostrou ser mais rápida e fácil de executar do que a metodologia proposta por Singh e colaboradores [50], apresentando resultados precisos e reprodutíveis após a separação pela técnica de SDS-PAGE. No entanto, o extracto Combinado revelou resultados 48

62 Discussão dos Resultados mais complexos após a técnica de Western blotting. Esperava-se que esta nova metodologia de extracção possibilitasse a obtenção de resultados mais informativos acerca da natureza proteica total dos grãos de trigo e de centeio, uma vez que os dois tipos de prolaminas iriam ser analisados em conjunto. Como podem ser distinguidas no gel as fracções correspondentes às gluteninas (parte superior) e gliadinas (parte inferior), esperava-se que a marcação verificada nestas fracções fosse idêntica à da marcação destas fracções em separado (metodologia de Singh), o que não se verificou. No caso das variedades Alva, Arpège, Caia, Eufrates, Nabão, Roxo, Tigre e Torero a extracção Combinada apresentou uma menor hibridação com o anticorpo Anti-Gliadin 33-mer (G12) (Biomedal S. L.) que os extractos de Gliadinas e Gluteninas. No entanto, no caso dos centeios Alvão e Marder, os resultados obtidos pela extracção Combinada foram superiores aos dos extractos das Gliadinas e das Gluteninas. Nas restantes variedades a hibridação dos extractos Combinados foi igual ou superior à dos extractos das Gluteninas e igual ou inferior à dos extractos das Gliadinas. Através de uma análise mais detalhada, é possível verificar que nas amostras de trigo duro e centeio a extracção combinada apresenta resultados semelhantes, uma vez que, de uma forma geral, os resultados da extracção em duas etapas são ligeiramente inferiores aos dos extractos de Gliadinas e bastantes superiores aos de Gluteninas. Numa situação quase oposta encontram-se as variedades de trigo mole e os trigos considerados antigos (sendo que três das cinco variedades de trigos considerandos antigos neste trabalho, são variedades de trigo mole), em que os resultados da extracção em duas etapas são inferiores aos dos extractos de Gliadinas e de Gluteninas. Os resultados obtidos pela utilização do kit Ridascreen Gliadin Competitive (R-Biopharm), são por vezes discordantes dos obtidos com o anticorpo Anti-Gliadin 33- mer (G12) (Biomedal S. L.), existindo algumas diferenças na análise das diferentes variedades, quer individualmente quer em conjunto. Estes resultados podem ser justificados pelas diferenças entre as sequências detectadas pelos diferentes anticorpos, uma vez que Anti-Gliadin 33-mer (G12) (Biomedal S. L.) detecta o péptido 33-mer das gliadinas-α, LQLQPFPQPQLPYP QPQLPYPQPQLPYPQPQPF e os anticorpos do kit Ridascreen detectam a sequência QQPFP. 49

63 Discussão dos Resultados Apesar das semelhanças parciais entre as sequências não existe uma sobreposição completa da sequência QQPFP no péptido 33-mer. Apesar das duas sequências estarem associadas à toxicidade na doença celíaca, um anticorpo desenhado para detectar o péptido 33-mer não irá detectar a sequência QQPFP, e vice-versa. Assim, é possível obter resultados diferentes quando utilizados anticorpos diferentes, e ambos os resultados estarem correctos. Para se obter um resultado mais informativo acerca da toxicidade de uma variedade específica neste trabalho, seria necessária a utilização de um elevado número de anticorpos para o vasto número de sequências tóxicas ou potencialmente tóxicas já conhecidas. Segundo a bibliografia, existe uma incerteza relativamente à diferença na toxicidade para os doentes celíacos entre trigos antigos e trigos modernos [5]. Neste estudo, não se verificou que variedades de trigos que foram considerados antigos apresentavam uma menor capacidade de hibridação com os anticorpos utilizados, sendo que esta foi sempre superior à dos trigos moles. No entanto, as definições trigos antigos e trigos modernos são utilizadas muitas vezes para distinguir entre as variedades que sofreram melhoramento daquelas que não passaram por esse processo. Alguns autores argumentam que os programas de melhoramento poderão ter contribuído para um aumento da prevalência de sequências tóxicas nas variedades melhoradas. Com a excepção da landrace Barbela, todas as variedades de trigo utilizadas neste trabalho foram incluídas em programas de melhoramento. Se analisarmos esta landrace individualmente, podemos verificar que a sua capacidade de hibridação com o anticorpo Anti-Gliadin 33-mer (G12) (R-Biopharm) foi uma das mais baixas dentro das variedades de trigo (Figura 7 Total=5). No entanto, o resultado com kit Ridascreen foi um dos mais elevados (Figura ,37 ng/µl). Para se poderem obter resultados mais concretos acerca da toxicidade de Barbela é necessário procederse a uma análise de um número elevado de linhas, uma vez que cada linha apresenta um perfil proteico diferente, e verificar a predominância destes resultados. Relativamente ao centeio, as variedades Alvão, Marder e Picasso foram as únicas que sofreram melhoramento. No entanto, Alvão e Picasso revelaram a menor capacidade de hibridação com o anticorpo verificada neste trabalho (Figura 7 Total=3), contrariamente a Marder que revelou uma capacidade de hibridação 50

64 Discussão dos Resultados ligeiramente superior à média dos centeios (Figura 7 Total=7). Com o kit Ridascreen os resultados tornam-se discordantes. Alvão e Picasso apresentam concentrações de 2165,36 ng/µl e 2130,98 ng/µl respectivamente, valores muito superiores aos de concentração média para as variedades de centeio, enquanto Marder apresenta uma concentração de 1978,37 ng/µl, bastante inferior à média dos centeios. Assim, os resultados obtidos neste trabalho não permitem definir uma relação entre a inclusão em programas de melhoramento e a prevalência de epítopos associados à doença celíaca. Da mesma forma não se verificou uma menor prevalência de 33-mer em variedades de trigos duros quando comparadas com variedades de trigos moles. É sempre necessário ter em consideração que o número de variedades correspondentes a cada grupo definido neste trabalho eram desproporcionais e os resultados obtidos podem não ser os predominantes noutras variedades. Através do cálculo do coeficiente de correlação de Pearson (ρ 2 ) foi possível concluir que não se verifica uma correlação entre a soma dos valores atribuídos às várias variedades com base na intensidade das bandas e os valores de concentração obtidos com o kit Ridascreen (R-Biopharm) para os grupos de variedades Trigos (total), Trigos Duros, Trigos Moles e Centeios. Verifica-se, no entanto, uma forte correlação para o grupo designado Trigos Antigos. Estes valores não eram esperados, uma vez que o grupo Trigos Antigos e constituído por variedades muito diferentes que incluem trigos duros e trigos moles. Uma justificação para o coeficiente de correlação ser normalmente baixo deve-se às diferenças entre as sequências detectadas pelo Anti-Gliadin 33-mer (G12) e o kit Ridascreen. No entanto, verifica-se uma correlação muito forte (0,9322) quando o coeficiente de correlação é calculado utilizando os valores das médias de cada grupo de variedades e não os valores das variedades individuais. Assim, é possível concluir que apesar da correlação entre os valores obtidos com o anticorpo Anti-Gliadin 33-mer (G12) e o kit Ridascreen serem, na maioria dos casos, muito baixos quando são considerados os valores das variedades individuais, tendo em consideração o conjunto dos valores dos vários grupos de variedades (médias), verifica-se que os valores da toxicidade obtidos com os dois métodos estão fortemente correlacionados. Isto revela uma diferença clara de toxicidade entre os grupos de variedades considerados. Para 51

65 Discussão dos Resultados compreender melhor esta correlação é necessário repetir o estudo com um número superior de variedades e verificar se estes resultados são predominantes. Das 21 bandas de 21 variedades que foram excisadas e identificadas apenas quatro sequências foram caracterizadas (Quadro 12). Existem vários motivos para identificação não ter tido a eficiência desejada. O sinal insuficiente por parte dos péptidos poderá ser um destes motivos, que poderia ser corrigido através da concentração de quatro ou cinco bandas. Outro motivo poderá ser a mistura de péptidos com diferentes pi e igual ou aparente massa molecular, o que dificulta a identificação peptídica. Para separar os péptidos com diferentes pi seria necessário utilizar a técnica de electroforese bidimensional em gradiente de ph imobilizado e posterior electroforese em gel de poliacrilamida na presença de detergente dodecil sulfato de sódio (Immobilized ph gradient followed by sodium dodecyl sulfate polyacrylamide gel electrophoresis, IPG x SDS-PAGE). Por fim, a enzima tripsina que é utilizada para efectuar a digestão de proteínas, realiza a hidrólise da ligação peptídica nas posições do carboxilo da arginina ou da lisina, excepto quando o aminoácido seguinte é uma prolina. As prolaminas possuem uma baixa percentagem destes aminoácidos. Por este motivo, quando se realiza a digestão destas proteínas com tripsina formam-se péptidos, normalmente muito grandes, o que dificulta à partida a identificação das proteínas e a determinação da sequência ao realizar MS/MS. Para testar uma solução para este problema, em duas das amostras foi utilizado um cocktail enzimático em substituição da tripsina, no entanto os resultados não foram diferentes. Recorrendo à bibliografia indicada na base de dados NCBI para as sequências em causa, não foi possível identificar alguma como associada à doença celíaca [55-60]. Estes resultados eram de certa forma previsíveis uma vez que, as sequências de Alvão e Sagitário correspondem, provavelmente, à mesma sequência e a de Eufrates mostrou semelhança com sequências tanto de plantas como de animais, excluindo-se desta forma, qualquer relação com a doença celíaca. Assim, tratam-se apenas de duas sequências de 12 e 15 aminoácidos, o que torna escassa a probabilidade de se tratarem de sequências relacionadas com os objectivos deste trabalho. 52

66 Discussão dos Resultados No entanto, caso as sequências obtidas mostrassem uma relação com a doença celíaca, em especial com o péptido 33-mer, proceder-se-ia no sentido de desenhar e testar os primers para sequências nucleotídicas da mesma forma que foi demonstrado para três das sequências obtidas. O recurso à base de dados UniProt e às ferramentas ExPASy Translate Tool, CLC DNA Workbench e PerlPrimer permitiram de uma forma rápida o desenho de primers para as sequências em questão. No entanto, a eficácia destes primers teria de ser testada e optimizada em laboratório. Devido às limitações temporais do período definido para o desenvolvimento desta dissertação não foi possível realizar esta etapa, que passaria pela extracção de DNA de todas as variedades estudadas e amplificação das sequências nucleotídicas com associação à doença celíaca, com recurso aos primers desenhados para o efeito. De forma a obter sequências proteicas associadas ao péptido 33-mer, a estratégia seguinte seria a utilização da técnica IPG x SDS-PAGE. Esta técnica permite a separação proteica pelo ponto isoeléctrico e peso molecular, o que faz com que os spots proteicos obtidos sejam muito mais específicos para cada proteína do que as bandas obtidas pela técnica de SDS-PAGE. Os géis seriam utilizados na metodologia de Western blotting e os spots proteicos que mostrassem uma maior capacidade de hibridação com o péptido 33-mer seriam isolados e enviados para identificação pela técnica MALDI-TOF. Assim, esperava-se obter sequências proteicas com uma maior probabilidade de estarem associadas ao péptido 33-mer. Posteriormente, seria possível o desenho de primers mais específicos que permitiriam a amplificação das sequências nucleotídicas associadas ao péptido 33-mer presentes no genoma de cada variedade, através da técnica PCR e, desta forma, obter mais informação acerca da prevalência destas sequências no genoma de cada variedade estudada. A metodologia utilizada neste trabalho teve por base estudos realizados noutros países, em especial nos Países Baixos, onde só num estudo foi testada a prevalência de epítopos associados à doença celíaca em 36 variedades de trigos modernos e 50 landraces, com objectivos semelhantes aos deste trabalho [5, 9, 49]. No mesmo país, foi realizado um estudo que tinha como objectivo analisar a prevalência de epítopos da 53

67 Discussão dos Resultados doença celíaca nos vários genomas diferentes de trigos diplóides, tetraplóides e hexaplóides [34] e um outro que visava quantificar epítopos da doença celíaca em 26 variedades de aveia e 4 péptidos sintéticos que continham etítopos de aveninas [36]. Devido à quantidade de variedades de trigo, centeio, cevada e aveia existentes e à natureza complexa do epítopos associados à doença celíaca torna-se necessária uma integração dos resultados dos vários estudos, realizados a nível mundial, para que os objectivos deste trabalho possam ser cumpridos. 54

68 Conclusões e Perspectivas CAPÍTULO V CONCLUSÕES E PERSPECTIVAS A doença celíaca é cada vez mais um problema de saúde pública em Portugal e em todos os países com população de descendência europeia. Devido à ausência de tratamentos eficazes e à omnipresença do glúten, torna-se imperativo o desenvolvimento de variedades de trigo, centeio e cevada que permitam a confecção de alimentos com baixo teor de epítopos que desencadeiam a resposta imunitária. Este trabalho foi desenvolvido com o objectivo de avaliar e estudar a prevalência do péptido considerado superantigénico na doença celíaca, 33-mer, num conjunto de variedades de trigo e centeio cultivadas Portugal. No final deste trabalho foi possível o desenvolvimento, optimização, aplicação e domínio de várias técnicas que se tornarão rotineiras no Laboratório de Genómica Funcional e Proteómina do IBB-CGB da UTAD. Foi desenvolvida uma nova metodologia de extracção de proteínas de reserva de trigo e de centeio de forma mais rápida, que permite extrair gliadinas e gluteninas em conjunto, e optimizou-se a metodologia de Western blotting para as espécies e anticorpo utilizados neste estudo. Através da aplicação destas e outras técnicas, foram analisadas e identificadas as diferenças na prevalência de 33-mer. Tal como sugerido pela bibliografia, a prevalência deste péptido revelou-se mais elevada nas variedades de trigo do que nas variedades de centeio. Comprovou-se que a prevalência deste péptido é muito superior na fracção das gliadinas do que nas gluteninas. Não foi possível demonstrar a existência de uma maior prevalência deste péptido em variedades melhoradas quando comparadas com variedades antigas. Da mesma forma, as variedades de trigo duro (tetraplóide) não revelaram uma menor prevalência deste péptido quando comparadas com as variedades de trigo mole (hexaplóide). Apesar de algumas diferenças, estes resultados gerais foram confirmados através da utilização do kit Ridascreen gliadine competitive (R- Biopharm). Foi possível a identificação de 4 das 21 bandas de diferentes variedades que foram seleccionadas e isoladas, obtendo-se apenas 4 sequências proteicas. Através da 55

69 Conclusões e Perspectivas utilização da base de dados NCBI foi possível identificar estas sequências e verificar que estas não se encontravam descritas como associadas à doença celíaca. Este trabalho terá continuação no Laboratório de Genómica Funcional e Proteómica do IBB-CGB da UTAD. Serão introduzidas novas abordagens de forma a melhorar algumas das limitações verificadas neste trabalho, possibilitado assim, a obtenção de resultados mais conclusivos. Será introduzido um maior número de variedades e tentar-se-á que sejam incluídos nos diferentes grupos considerados (trigos duros, trigos moles, trigos antigos, variedades não melhoradas, centeios) um número semelhante de variedades. Serão também incluídas variedades de cevada, uma vez que esta espécie está fortemente associada à doença celíaca, e variedades de aveia, espécie cuja associação à doença ainda e não está esclarecida. De forma a obter mais informação sobre a prevalência total de epítopos associados à doença celíaca, será utilizado um maior número de anticorpos. As técnicas IPG x SDS-PAGE terão um papel importante tanto na separação proteica para o isolamento e posterior identificação das várias proteínas como, também, na introdução dos géis IPG x SDS-PAGE na metodologia de Western blotting. A introdução de controlos positivos e negativos será importante para a comparação dos resultados com os obtidos por outros grupos de investigação, nacionais e estrangeiros. 56

70 Bibliografia BIBLIOGRAFIA 1. FAOSTAT. Food and Agriculture Organization of the United Nations Tatham, A.R.e Shewry, P.R., The S-poor prolamins of wheat, barley and rye: Revisited. Journal of Cereal Science, : p van den Broeck, H.C., de Jong, H.C., Salentijn, E.M., Dekking, L., Bosch, D., Hamer, R.J., Gilissen, L.J., van der Meer, I.M., e Smulders, M.J., Presence of celiac disease epitopes in modern and old hexaploid wheat varieties: wheat breeding may have contributed to increased prevalence of celiac disease. Theor Appl Genet, (8): p GrainChain.com Tjon, J.M., van Bergen, J., e Koning, F., Celiac disease: how complicated can it get? Immunogenetics, (10): p Brites, C., Igrejas, G., e León, A.E., Centeno y triticale. De tales harinas, tales pones granos, harinas y productos de panificación en Iberoamérica, Capítulo IV: p Payne, P.I.e Corfield, K.G., Subunit Composition of Wheat Glutenin Proteins, Isolated by Gel Filtration in a Dissociating Medium. Planta, : p Shewry, P.R.e Bechtel, D.B., Morphology and chemistry of the rye grain. Rye. Production, chemistry and technology, 2nd ed., Capítulo V: p van den Broeck, H.C., The Quest for Celiac-Safe Wheat with good baking properties. Tese de Doutoramento, Universidade de Wageningen, Países Baixos., 2010: p Carrillo, J.M., Vazquez, J.F., e Orellana, Linkage relationships between the loci sec 1 and sec 3 in rye (Secale cereale). Heredity, : p Carrillo, J.M., Vázquez, J.F., e Orellana, J., Identification and mapping of the Gli-R3 locus on chromossome 1R of rye (Secale cereale L.). Theor Appl Genet, : p Nobre, S.R., Silva, T., e Cabral, J., Doença celíaca revisitada. J Port Gastrenterol, : p Portal_da_Saúde. enciclopedia+da+saude/ alimentacao/ DGS+ANA.htm Sapone, A., Bai, J.C., Ciacci, C., Dolinsek, J., Green, P.H., Hadjivassiliou, M., Kaukinen, K., Rostami, K., Sanders, D.S., Schumann, M., Ullrich, R., Villalta, D., Volta, U., Catassi, C., e Fasano, A., Spectrum of gluten-related disorders: consensus on new nomenclature and classification. BMC Med, : p Akagawa, M., Handoyo, T., Ishii, T., Kumazawa, S., Morita, N., e Suyama, K., Proteomic analysis of wheat flour allergens. J Agric Food Chem, (17): p

71 Bibliografia 16. Perr, H.A., Novel foods to treat food allergy and gastrointestinal infection. Curr Allergy Asthma Rep, (2): p Palosuo, K., Alenius, H., Varjonen, E., Koivuluhta, M., Mikkola, J., Keskinen, H., Kalkkinen, N., e Reunala, T., A novel wheat gliadin as a cause ofexercise-induced anaphylaxis. J Allergy Clin Immunol, 1999(103): p Mittag, D., Niggemann, B., Sander, I., Reese, I., Fiedler, E.M., Worm, M., Vieths, S., e Reese, G., Immunoglobulin E-reactivity of wheat-allergic subjects (baker's asthma, food allergy, wheatdependent, exercise-induced anaphylaxis) to wheat protein fractions with different solubility and digestibility. Mol Nutr Food Res, (5): p Presutti, R.J., Cangemi, J.R., Cassidy, H.D., e Hill, D.A., Celiac Disease. American family physitian, : p Moron, B., Bethune, M.T., Comino, I., Manyani, H., Ferragud, M., Lopez, M.C., Cebolla, A., Khosla, C., e Sousa, C., Toward the assessment of food toxicity for celiac patients: characterization of monoclonal antibodies to a main immunogenic gluten peptide. PLoS One, (5): p. e Ellis, H.J., Lozano-Sanchez, P., Bermudo Redondo, C., Suligoj, T., Biagi, F., Bianchi, P.I., Corazza, G.R., De Silvestri, A., Bravi, E., Katakis, I., O'Sullivan, C.K., e Ciclitira, P.J., Antibodies to wheat high-molecular-weight glutenin subunits in patients with celiac disease. Int Arch Allergy Immunol, (4): p Woodward, J., Coeliac disease. Medicine : p Fasano, A., Berti, I., Gerarduzzi, T., Not, T., Colletti, R.B., Drago, S., Elitsur, Y., Green, P.H., Guandalini, S., Hill, I.D., Pietzak, M., Ventura, A., Thorpe, M., Kryszak, D., Fornaroli, F., Wasserman, S.S., Murray, J.A., e Horvath, K., Prevalence of celiac disease in at-risk and not-atrisk groups in the United States: a large multicenter study. Arch Intern Med, (3): p Rubio-Tapia, A., Kyle, R.A., Kaplan, E.L., Johnson, D.R., Page, W., Erdtmann, F., Brantner, T.L., Kim, W.R., Phelps, T.K., Lahr, B.D., Zinsmeister, A.R., Melton, L.J., 3rd, e Murray, J.A., Increased prevalence and mortality in undiagnosed celiac disease. Gastroenterology, (1): p Antunes, H., Abreu, I., Nogueiras, A., Sá, C., Gonçalves, C., CLETO, P., GARCIA, F., ALVES, A., e LEMOS, D., Primeira determinação de prevalência de doença celíaca numa população portuguesa. Acta Med Port, : p Bishop, W.P.e Hoffenberg, E., Pediatric Practice Gastroenterology, Chapter 18 - Celiac disease. 2001: p Vilppula, A., Kaukinen, K., Luostarinen, L., Krekela, I., Patrikainen, H., Valve, R., Maki, M., e Collin, P., Increasing prevalence and high incidence of celiac disease in elderly people: a population-based study. BMC Gastroenterol, : p Schuppan, D., Junker, Y., e Barisani, D., Celiac disease: from pathogenesis to novel therapies. Gastroenterology, (6): p Schober, T.J.e Bean, S.R., Gluten-free baking: what is happening inside the bread? U. S. Department of Agriculture,

72 Bibliografia 30. Comission, C.A., Draft resised standard for gluten-free foods. 2006: p Redondo, M.C.B., Griffin, P.B., Ransanz, M.G., Ellis, H.J., Ciclitira, P.J., e O Sullivan, C.K., Monoclonal antibody-based competitive assay for the sensitive detection of coeliac disease toxic prolamins. Analytica Chimica Acta, : p Garcia, E., Llorente, M., Hernando, A., Kieffer, R., Wieser, H., e Mendez, E., Development of a general procedure for complete extraction of gliadins for heat processed and unheated foods. Eur J Gastroenterol Hepatol, (5): p Pizzuti, D., Buda, A., D'Odorico, A., D'Inca, R., Chiarelli, S., Curioni, A., e Martines, D., Lack of intestinal mucosal toxicity of Triticum monococcum in celiac disease patients. Scand J Gastroenterol, (11): p Spaenij-Dekking, L., Kooy-Winkelaar, Y., van Veelen, P., Drijfhout, J.W., Jonker, H., van Soest, L., Smulders, M.J., Bosch, D., Gilissen, L.J., e Koning, F., Natural variation in toxicity of wheat: potential for selection of nontoxic varieties for celiac disease patients. Gastroenterology, (3): p Salentijn, E.M., Goryunova, S.V., Bas, N., van der Meer, I.M., van den Broeck, H.C., Bastien, T., Gilissen, L.J., e Smulders, M.J., Tetraploid and hexaploid wheat varieties reveal large differences in expression of alpha-gliadins from homoeologous Gli-2 loci. BMC Genomics, : p Mujico, J.R., Mitea, C., Gilissen, L.J., de Ru, A., van Veelen, P., Smulders, M.J., e Koning, F., Natural variation in avenin epitopes among oat varieties: Implications for celiac disease. Journal of cereal science, 2010(54): p Dorum, S., Arntzen, M.O., Qiao, S.W., Holm, A., Koehler, C.J., Thiede, B., Sollid, L.M., e Fleckenstein, B., The preferred substrates for transglutaminase 2 in a complex wheat gluten digest are Peptide fragments harboring celiac disease T-cell epitopes. PLoS One, (11): p. e Sollid, L.M., Qiao, S.W., Anderson, R.P., Gianfrani, C., e Koning, F., Nomenclature and listing of celiac disease relevant gluten T-cell epitopes restricted by HLA-DQ molecules. Immunogenetics, (6): p De Re, V., Simula, M.P., Canzonieri, V., e Cannizzaro, R., Proteomic analyses lead to a better understanding of celiac disease: focus on epitope recognition and autoantibodies. Dig Dis Sci, (11): p Caputo, I., Lepretti, M., Martucciello, S., e Esposito, C., Enzymatic stractegies to detoxify gluten: implications for celiac disease. Enzyme Research, 2010(10): p Molberg, O., Uhlen, A.K., Jensen, T., Flaete, N.S., Fleckenstein, B., Arentz-Hansen, H., Raki, M., Lundin, K.E., e Sollid, L.M., Mapping of gluten T-cell epitopes in the bread wheat ancestors: implications for celiac disease. Gastroenterology, (2): p Qiao, S.W., Bergseng, E., Molberg, O., Xia, J., Fleckenstein, B., Khosla, C., e Sollid, L.M., Antigen presentation to celiac lesion-derived T cells of a 33-mer gliadin peptide naturally formed by gastrointestinal digestion. J Immunol, (3): p He, Q., Viljanen, M.K., Hinkkanen, A.E., Arvilommi, H., Mertsola, J., e Viander, M., No evidence of cross-reactivity of human antibodies to a 33-mer peptide of the alpha-gliadin component of gluten with Bordetella pertussis pertactin. Vaccine, : p

73 Bibliografia 44. Comino, I., Real, A., Lorenzo, L.d., Cornell, H., López-Casado, M.Á., Barro, F., Lorite, P., Torres, M.I., Cebolla, Á., e Sousa, C., Diversity in oat potential immunogenicity: basis for the selection of oat varieties with no toxicity in coeliac disease. Gut, ( ). 45. Pinier, M., Fuhrmann, G., Verdu, E.F., e Leroux, J.C., Prevention measures and exploratory pharmacological treatments of celiac disease. Am J Gastroenterol, (12): p ; quiz Kruzliak, P.e Bhagat, G., Celiac Disease From Pathophysiology to Advanced Therapies, 2012, InTech. p Altenbach, S.B., Vensel, W.H., e DuPont, F.M., Integration of transcriptomic and proteomic data from a single wheat cultivar provides new tools for understanding the roles of individual alpha gliadin proteins in flour quality and celiac disease. Journal of cereal science, 2010(52): p Ribeiro, M., Seabra, L., Ramos, A., Santos, S., Pinto-Carnide, O., Carvalho, C., e Igrejas, G., Polymorphism of the storage proteins in Portuguese rye (Secale cereale L.) populations. Hereditas, : p van den Broeck, H.C., America, A.H., Smulders, M.J., Bosch, D., Hamer, R.J., Gilissen, L.J., e van der Meer, I.M., A modified extraction protocol enables detection and quantification of celiac disease-related gluten proteins from wheat. J Chromatogr B Analyt Technol Biomed Life Sci, (10): p Singh, N.K., Shepherd, K.W., e Cornish, G.B., A simplified SDS-PAGE procedure for separating LMW subunits of glutenin. Journal of cereal Science, 1991: p Igrejas, G., Factores genéticos, bioquímicos e tecnológicos associados à utilização do trigo mole (Triticum aestivum L.). Tese de Doutoramento, UTAD, Vila Real., 2000: p Bradford, M.M., A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, : p Scientific T. NanoDrop 1000 Spectrophotometer V3.7. User s Manual, Görg, A., Klaus, A., Lück, C., Weiland, F., e Weiss, W., Two-Dimensional Electrophoresis with Immobilized ph Gradients for Proteome Analysis: A laboratory manual. Universidade Técnica de Munique, Zhao, X.L., Xia, X.C., He, Z.H., Lei, Z.S., Appels, R., Yang, Y., Sun, Q.X., e Ma, W., Novel DNA variations to characterize low molecular weight glutenin Glu-D3 genes and develop STS markers in common wheat. Theor Appl Genet, (3): p Okita, T.W., Cheesbrough, V., e Reeves, C.D., Evolution and heterogeneity of the alpha-/betatype and gamma-type gliadin DNA sequences. J Biol Chem, (13): p Garcia-Maroto, F., Marana, C., Garcia-Olmedo, F., e Carbonero, P., Nucleotide sequence of a cdna encoding an alpha/beta-type gliadin from hexaploid wheat (Triticum aestivum). Plant Mol Biol, (5): p Stanley Kim, H., Yu, Y., Snesrud, E.C., Moy, L.P., Linford, L.D., Haas, B.J., Nierman, W.C., e Quackenbush, J., Transcriptional divergence of the duplicated oxidative stress-responsive genes in the Arabidopsis genome. Plant J, (2): p

74 Bibliografia 59. Bayer, M.E., Bottrill, A.R., Walshaw, J., Vigouroux, M., Naldrett, M.J., Thomas, C.L., e Maule, A.J., Arabidopsis cell wall proteome defined using multidimensional protein identification technology. Proteomics, : p Bindschedler, L.V., Palmblad, M., e Cramer, R., Hydroponic isotope labelling of entire plants (HILEP) for quantitative plant proteomics; an oxidative stress case study. Phytochemistry, (10): p

75 Anexos ANEXOS proteínas. Anexo I Constituição das soluções para a extracção das Solução A (propanol a 50%): Propanol ml Água bidestilada até perfazer. 150 ml (conservação para o mesmo dia) Tampão Tris HCl 1M ph = 8,0: Tris (hidroximetil aminometano)... 6,057 g Água bidestilada até perfazer ml HCl até ph = 8,0. 3 ml Água bidestilada até perfazer ml (conservação durante 3 a 4 semanas a 4ºC) Solução B: Propanol ml Tris HCl até ph = 8, ,6 ml Água bidestilada até perfazer ml (conservação durante 1 a 2 semanas a 4ºC) Solução B1 (Solução B + 1% de ditiotrietol) Para 60 eppendorfs: Solução B... 7 ml DTT. 70 mg (conservação durante o próprio dia) Solução B2 (Solução B + 1,4% de vinilpiridina-4) Para 60 eppendorfs : Solução B... 7 ml vinilpiridina μl (conservação durante o próprio dia) Solução C: SDS.... 0,2 g Glicerol... 4 ml Azul de bromofenol... 2 mg Tris HCl até ph = 8,0.. 0,8 ml Água bidestilada até perfazer ml (conservação a 4ºC durante 2 semanas) 62

76 Anexos Solução de Extracção: Isopronanol ,5 ml Tampão Tris-HCl ph 7, ,5 ml DTT ,05 g Anexos II Método Bradford (Curva de Calibração) Anexo III Constituição das soluções para SDS-PAGE Solução de coloração (por gel): Ácido tricloroacético (TCA) 60% ml Azul de Coomassie ml Água bidestilada até perfazer ml 63

DOENÇA CELÍACA. Universidade Federal de Pernambuco UFPE Processos Patológicos Gerais - PPG Nutrição

DOENÇA CELÍACA. Universidade Federal de Pernambuco UFPE Processos Patológicos Gerais - PPG Nutrição Universidade Federal de Pernambuco UFPE Processos Patológicos Gerais - PPG Nutrição DOENÇA CELÍACA Grupo: Camila Tenório Danniely Soares Érica Ouriques Isabelle Priscila Juliana Arraes Renata Batista O

Leia mais

Doença Celíaca. Curso: Hotelaria Variante Restaurante/Bar Formador: João Ribeiro Formando: Inês Paiva Ano/Turma: 10ºD Ano Lectivo: 2011/2012

Doença Celíaca. Curso: Hotelaria Variante Restaurante/Bar Formador: João Ribeiro Formando: Inês Paiva Ano/Turma: 10ºD Ano Lectivo: 2011/2012 Doença Celíaca Curso: Hotelaria Variante Restaurante/Bar Formador: João Ribeiro Formando: Inês Paiva Ano/Turma: 10ºD Ano Lectivo: 2011/2012 ANO LECTIVO 2010-2011 PÁGINA - 2 Índice Introdução...3 O que

Leia mais

Os cereais. Trigo Arroz Centeio Milho Aveia Cevada Sorgo

Os cereais. Trigo Arroz Centeio Milho Aveia Cevada Sorgo Trigo Arroz Centeio Milho Aveia Cevada Sorgo O que são Cereais Integrais? São cereais que não foram processados. Consistem no gérmen, endosperma e casca. Endosperma: Constitui aproximadamente 83% do peso

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

Universidade Federal do Rio Grande do Sul Instituto de Ciência e Tecnologia de Alimentos Departamento de Tecnologia de Alimentos

Universidade Federal do Rio Grande do Sul Instituto de Ciência e Tecnologia de Alimentos Departamento de Tecnologia de Alimentos Universidade Federal do Rio Grande do Sul Instituto de Ciência e Tecnologia de Alimentos Departamento de Tecnologia de Alimentos Tecnologia de Produtos de Origem Vegetal Cereais & Farinhas Prof. Alex Augusto

Leia mais

DOENÇA CELÍACA E GASTRONOMIA: CONVERSAS PRELIMINARES DE UM PROJETO DE INICIAÇÃO CIENTÍFICA DA FACULDADE SENAC DE PERNANBUCO

DOENÇA CELÍACA E GASTRONOMIA: CONVERSAS PRELIMINARES DE UM PROJETO DE INICIAÇÃO CIENTÍFICA DA FACULDADE SENAC DE PERNANBUCO 1 DOENÇA CELÍACA E GASTRONOMIA: CONVERSAS PRELIMINARES DE UM PROJETO DE INICIAÇÃO CIENTÍFICA DA FACULDADE SENAC DE PERNANBUCO LUCIANA ALBUQUERQUE LYRA,SANDRA MARINHO DE OLIVEIRA E MARCOS ALEXANDRE DE MELO

Leia mais

ALIMENTAÇÃO Preventiva. Volume I

ALIMENTAÇÃO Preventiva. Volume I ALIMENTAÇÃO Preventiva Volume I By porque evoluir é preciso Que o teu alimento seja seu medicamento Hipócrates Pai da medicina moderna Não coma, nutra-se! Existem muitas informações importantes disponíveis,

Leia mais

O QUE É A DOENÇA CELÍACA?

O QUE É A DOENÇA CELÍACA? O QUE É A DOENÇA CELÍACA? Texto de apoio ao curso de Especialização Atividade física adaptada e saúde Prof. Dr. Luzimar Teixeira É uma intolerância permanente ao Glúten que acomete indivíduos com predisposição

Leia mais

Proteínas. Enzima que Colagénio Insulina degrada a insulina (hormona)

Proteínas. Enzima que Colagénio Insulina degrada a insulina (hormona) Proteínas O seu nome deriva da palavra Grega proteios, que significa de principal importância. As proteínas desempenham um papel fundamental nos sistemas biológicos, estando associadas a todas as formas

Leia mais

Distrito Federal ACELBRA-DF

Distrito Federal ACELBRA-DF CÂMARA SETORIAL DE CADEIA PRODUTIVA DA MANDIOCA E DERIVADOS DOENÇA A CELIACA Apresentação: Paulo Roberto Ferreira da Silva Presidente da Associação dos Celíacos de Brasília ACELBRA-DF Vice-Presidente da

Leia mais

Métodos para detecção de alérgenos em alimentos. Gerlinde Teixeira Departamento de Imunobiologia Universidade Federal Fluminense

Métodos para detecção de alérgenos em alimentos. Gerlinde Teixeira Departamento de Imunobiologia Universidade Federal Fluminense Métodos para detecção de alérgenos em alimentos Gerlinde Teixeira Departamento de Imunobiologia Universidade Federal Fluminense Antigenos vs Alérgenos Antigeno Imunógeno Qualquer substância capaz de estimular

Leia mais

Portuguese Summary. Resumo

Portuguese Summary. Resumo Portuguese Summary Resumo 176 Resumo Cerca de 1 em 100 indivíduos não podem comer pão, macarrão ou biscoitos, pois eles têm uma condição chamada de doença celíaca (DC). DC é causada por uma das intolerâncias

Leia mais

SÍNDROME DE HIPER-IgM

SÍNDROME DE HIPER-IgM SÍNDROME DE HIPER-IgM Esta brochura é para ser usada pelos pacientes e pelas suas famílias e não deve substituir o aconselhamento de um imunologista clínico. 1 Também disponível: AGAMAGLOBULINEMIA LIGADA

Leia mais

Doença Celíaca mitos e verdades

Doença Celíaca mitos e verdades Doença Celíaca mitos e verdades Trigo - História Existem evidências arqueológicas de um pão pesado na era Paleolítica na Europa, há 30.000 anos atrás, embora a alimentação fosse principalmente baseada

Leia mais

Alimentação Sem Glúten: Tratamento, Abordagem e Principais Dificuldades do Doente Celíaco

Alimentação Sem Glúten: Tratamento, Abordagem e Principais Dificuldades do Doente Celíaco Alimentação Sem Glúten: Tratamento, Abordagem e Principais Dificuldades do Doente Celíaco Unidade de Nutrição. Serviço de Pediatria UAG MC H S João Faculdade Ciências da Nutrição e Alimentação da Universidade

Leia mais

Complexo principal de histocompatibilidade

Complexo principal de histocompatibilidade Complexo principal de histocompatibilidade Todas as espécies possuem um conjunto de genes denominado MHC, cujos produtos são de importância para o reconhecimento intercelular e a discriminação do que é

Leia mais

IMUNODEFICIÊNCIA COMUN VARIÁVEL

IMUNODEFICIÊNCIA COMUN VARIÁVEL IMUNODEFICIÊNCIA COMUN VARIÁVEL Esta brochura é para ser usada pelos pacientes e pelas suas famílias e não deve substituir o aconselhamento de um imunologista clínico. 1 Também disponível: AGAMAGLOBULINEMIA

Leia mais

Entenda tudo sobre a Síndrome do Intestino Irritável

Entenda tudo sobre a Síndrome do Intestino Irritável Entenda tudo sobre a Síndrome do Intestino Irritável Apesar de ainda não existir cura definitiva para esse problema de saúde crônico, uma diferenciação entre essa patologia e a sensibilidade ao glúten

Leia mais

Intolerância à Lactose

Intolerância à Lactose Intolerância à Lactose A intolerância à lactose é a condição que se refere aos sintomas decorrentes da má digestão da lactose. Esta situação ocorre quando o organismo não produz lactase suficiente, uma

Leia mais

Simpósio: Sorologia na doença celíaca: o que há de novo?

Simpósio: Sorologia na doença celíaca: o que há de novo? Simpósio: Sorologia na doença celíaca: o que há de novo? Ana Renata Badan Especializanda de 1º Ano Disciplina de Gastroenterologia Departamento de Pediatria Escola Paulista de Medicina Universidade Federal

Leia mais

Intestino delgado. Intestino grosso (cólon)

Intestino delgado. Intestino grosso (cólon) As fibras alimentares estão presentes nos alimentos de origem vegetal, englobando um conjunto de compostos que não podem ser digeridos pelas enzimas do nosso sistema gastrointestinal, não sendo por isso

Leia mais

Alérgenos de origem alimentar: eles são preocupantes? Flavio Finardi Filho FCF USP ffinardi@usp.br

Alérgenos de origem alimentar: eles são preocupantes? Flavio Finardi Filho FCF USP ffinardi@usp.br Alérgenos de origem alimentar: eles são preocupantes? Flavio Finardi Filho FCF USP ffinardi@usp.br Alérgenos de origem alimentar Características gerais glicoproteínas resistência térmica resistente à proteólise

Leia mais

ANTICORPOS. CURSO: Farmácia DISCIPLINA: Microbiologia e Imunologia Clínica PROFESSORES: Guilherme Dias Patto Silvia Maria Rodrigues Querido

ANTICORPOS. CURSO: Farmácia DISCIPLINA: Microbiologia e Imunologia Clínica PROFESSORES: Guilherme Dias Patto Silvia Maria Rodrigues Querido CURSO: Farmácia DISCIPLINA: Microbiologia e Imunologia Clínica PROFESSORES: Guilherme Dias Patto Silvia Maria Rodrigues Querido ANTICORPOS Anticorpo é uma globulina sintetizada por linfócitos B e principalmente

Leia mais

Dr. José Cesar Junqueira Ph.D Universidade Federal do Estado do Rio de Janeiro

Dr. José Cesar Junqueira Ph.D Universidade Federal do Estado do Rio de Janeiro Doença a Celíaca Dr. José Cesar Junqueira Ph.D Universidade Federal do Estado do Rio de Janeiro UNI-RIO Doença a Celíaca Histórico Arateus da Capadócia - 200 AC Gee - 1888 Dicke 1950 ESPGHAN 1969 revistos

Leia mais

Estudo da Incidência de Doença Celíaca na Região Autónoma da Madeira DISSERTAÇÃO DE MESTRADO

Estudo da Incidência de Doença Celíaca na Região Autónoma da Madeira DISSERTAÇÃO DE MESTRADO DM Estudo da Incidência de Doença Celíaca na Região Autónoma da Madeira Fabiana José de Abreu Gonçalves Estudo da Incidência de Doença Celíaca na Região Autónoma da Madeira DISSERTAÇÃO DE MESTRADO Fabiana

Leia mais

COMPLICAÇÕES DIGESTIVAS DE CRIANÇAS COM CDG

COMPLICAÇÕES DIGESTIVAS DE CRIANÇAS COM CDG COMPLICAÇÕES DIGESTIVAS DE CRIANÇAS COM CDG As crianças com CDG têm frequentemente queixas digestivas e problemas nutricionais. As causas não estão bem esclarecidas, são múltiplas e em última análise,

Leia mais

RECOMENDAÇÕES ALIMENTARES PARA ALUNOS COM DIABETES, HIPERTENSÃO, DOENÇA CELÍACA, E INTOLERÂNCIA Á LACTOSE.

RECOMENDAÇÕES ALIMENTARES PARA ALUNOS COM DIABETES, HIPERTENSÃO, DOENÇA CELÍACA, E INTOLERÂNCIA Á LACTOSE. RECOMENDAÇÕES ALIMENTARES PARA ALUNOS COM DIABETES, HIPERTENSÃO, DOENÇA CELÍACA, E INTOLERÂNCIA Á LACTOSE. 1. DOENÇA CELIACA É uma doença que causa inflamações nas camadas da parede do intestino delgado,

Leia mais

MATRIZ DA PROVA DE EXAME A NÍVEL DE ESCOLA AO ABRIGO DO DECRETO-LEI Nº 357/2007 DE 29 DE OUTUBRO BIOLOGIA 12º ANO

MATRIZ DA PROVA DE EXAME A NÍVEL DE ESCOLA AO ABRIGO DO DECRETO-LEI Nº 357/2007 DE 29 DE OUTUBRO BIOLOGIA 12º ANO MATRIZ DA PROVA DE EXAME A NÍVEL DE ESCOLA AO ABRIGO DO DECRETO-LEI Nº 357/2007 DE 29 DE OUTUBRO Duração da Prova 90 minutos + 30 minutos de tolerância BIOLOGIA 12º ANO (Cursos Científico-Humanísticos

Leia mais

Tipos de Diabetes. Diabetes Gestacional

Tipos de Diabetes. Diabetes Gestacional Tipos de Diabetes Diabetes Gestacional Na gravidez, duas situações envolvendo o diabetes podem acontecer: a mulher que já tinha diabetes e engravida e o diabetes gestacional. O diabetes gestacional é a

Leia mais

E OS SEUS BENEFÍCIOS

E OS SEUS BENEFÍCIOS E OS SEUS BENEFÍCIOS A principal função do leite é nutrir (alimentar). Além disso, cumpre as funções de proteger o estômago das toxinas e inflamações e contribui para a saúde metabólica, regulando os processos

Leia mais

HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem

HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem O Vírus da Hepatite C (HCV) é considerado o principal agente etiológico responsável por 90 a 95% dos casos de hepatite pós-transfusional não A e não

Leia mais

TRATAMENTO DE ALERGIA RESPIRATÓRIA 2/3

TRATAMENTO DE ALERGIA RESPIRATÓRIA 2/3 TRATAMENTO DE ALERGIA RESPIRATÓRIA 2/3 SISTEMA IMUNE E ALERGIA Por alergia, entendem-se as repostas imunes indesejadas contra substâncias que venceram as barreiras como, os epitélios, as mucosas e as enzimas.

Leia mais

Estado do Espírito Santo CÂMARA MUNICIPAL DE VILA VELHA "Deus seja Louvado"

Estado do Espírito Santo CÂMARA MUNICIPAL DE VILA VELHA Deus seja Louvado PROJETO DE LEI Nº /2015 EMENTA: DISPÕE SOBRE CRIAÇÃO DE UM PROGRAMA DE ALIMENTAÇÃO DIFERENCIADA PARA ALUNOS ALÉRGICOS NA REDE DE ENSINO MUNICIPAL DE VILA VELHA E DÁ OUTRAS PROVIDÊNCIAS. A Câmara Municipal

Leia mais

VALOR NUTRITIVO DA CARNE

VALOR NUTRITIVO DA CARNE VALOR NUTRITIVO DA CARNE Os alimentos são consumidos não só por saciarem a fome e proporcionarem momentos agradáveis à mesa de refeição mas, sobretudo, por fornecerem os nutrientes necessários à manutenção

Leia mais

FABA ALERGIA ALIMENTAR

FABA ALERGIA ALIMENTAR FABA ALERGIA ALIMENTAR Intolerância Alimentar Aversão Alimentar Reações Imediatas e Tardias ALERGIA ALIMENTAR FABA ALERGIA ALIMENTAR - Reação adversa ao componente protéico do alimento e envolve mecanismo

Leia mais

Mestrado Integrado em Medicina Artigo de Revisão Bibliográfica 2009/2010. Doença Celíaca

Mestrado Integrado em Medicina Artigo de Revisão Bibliográfica 2009/2010. Doença Celíaca Mestrado Integrado em Medicina Artigo de Revisão Bibliográfica 2009/2010 Doença Celíaca Aluna: Cátia Andreia de Oliveira Matos Tutor: Dr.ª Marta Salgado Rodrigues Porto, Junho de 2010 Resumo Introdução:

Leia mais

Intolerâncias Alimentares Distúrbios da Deglutição

Intolerâncias Alimentares Distúrbios da Deglutição Intolerâncias Alimentares Distúrbios da Deglutição Intolerâncias Alimentares Alergias alimentares Intolerâncias metabólicas Reações farmacológicas Erros congênitos do metabolismo Alergia alimentar Mediada

Leia mais

Sumário. Data: 23/05/2013 NOTA TÉCNICA 75/2013. Medicamento/ x dieta Material Procedimento Cobertura. Solicitante. Processo Número 0024 13 023060-0

Sumário. Data: 23/05/2013 NOTA TÉCNICA 75/2013. Medicamento/ x dieta Material Procedimento Cobertura. Solicitante. Processo Número 0024 13 023060-0 NOTA TÉCNICA 75/2013 Solicitante Juiz de Direito Dr.Alexsander Antenor Penna Silva Comarca de João Monlevade Processo Número 0024 13 023060-0 Data: 23/05/2013 Medicamento/ x dieta Material Procedimento

Leia mais

Alimentos de Soja - Uma Fonte de Proteína de Alta Qualidade

Alimentos de Soja - Uma Fonte de Proteína de Alta Qualidade Alimentos de Soja - Uma Fonte de Proteína de Alta Qualidade Documento de posição do Comité Consultivo Científico da ENSA Introdução As proteínas são um importante nutriente necessário para o crescimento

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

A RODA DOS ALIMENTOS E OS NOVOS VALORES NUTRICIONAIS Mafra, 14 de Março de 2008. Ana Leonor DataPerdigão Nutricionista

A RODA DOS ALIMENTOS E OS NOVOS VALORES NUTRICIONAIS Mafra, 14 de Março de 2008. Ana Leonor DataPerdigão Nutricionista A RODA DOS ALIMENTOS E OS NOVOS VALORES NUTRICIONAIS Mafra, 14 de Março de 2008 Ana Leonor DataPerdigão Nutricionista A ALIMENTAÇÃO SAUDÁVEL É Completa Fornece energia e todos os nutrientes essenciais

Leia mais

DOENÇA CELÍACA 1. Alimentos e intolerâncias alimentares

DOENÇA CELÍACA 1. Alimentos e intolerâncias alimentares DOENÇA CELÍACA 1 Alimentos e intolerâncias alimentares Todos sabemos que os alimentos são indispensáveis à vida pois fornecem as substâncias necessárias para o normal crescimento e desenvolvimento e até

Leia mais

INFORMATIVO SCHÄR BRASIL. Líder em alimentos sem glúten UMA MARCA. Olá,

INFORMATIVO SCHÄR BRASIL. Líder em alimentos sem glúten UMA MARCA. Olá, INFORMATIVO SCHÄR BRASIL Olá, Confira a nova edição do Informativo Schär Brasil, que nesta segunda publicação foca seu conteúdo na população infantil. Apresentamos um estudo realizado pela Dr. Gemma Castillejo,

Leia mais

O QUE VOCÊ DEVE SABER SOBRE DOENÇA CELÍACA

O QUE VOCÊ DEVE SABER SOBRE DOENÇA CELÍACA O QUE VOCÊ DEVE SABER SOBRE DOENÇA CELÍACA 2 O QUE É GLÚTEN? É um conjunto de proteínas presente no Trigo, Aveia, Centeio, Cevada, e no Malte, que são cereais muito utilizados na composição de alimentos,

Leia mais

Gastronomia sem glúten e leite

Gastronomia sem glúten e leite Gastronomia sem glúten e leite Glúten Nut. Bianca Araujo de Oliveira CRN-2351 Glúten Glúten conjunto de proteínas individuais que se encontram nos cereais e se dividem em poliaminas e gluteninas. 1 Fontes

Leia mais

INULINA. Fibra alimentar. Informações Técnicas. CAS NUMBER: 9005-80-5 SIMILAR: Oligofrutose (FOS), Polifrutose

INULINA. Fibra alimentar. Informações Técnicas. CAS NUMBER: 9005-80-5 SIMILAR: Oligofrutose (FOS), Polifrutose Informações Técnicas INULINA Fibra alimentar CAS NUMBER: 9005-80-5 SIMILAR: Oligofrutose (FOS), Polifrutose INTRODUÇÃO A inulina é um nutriente funcional ou nutracêutico, composto por frutose, encontrado

Leia mais

Obesidade Infantil. O que é a obesidade

Obesidade Infantil. O que é a obesidade Obesidade Infantil O que é a obesidade A obesidade é definida pela Organização Mundial da Saúde (OMS) como uma doença em que o excesso de gordura corporal acumulada pode atingir graus capazes de afectar

Leia mais

HÁBITOS ALIMENTARES. Normalmente são alimentos saudáveis, os mais próximos do seu estado natural/integral.

HÁBITOS ALIMENTARES. Normalmente são alimentos saudáveis, os mais próximos do seu estado natural/integral. HÁBITOS ALIMENTARES O hábito alimentar saudável deve ser formado e ensinado na infância, assim fica mais fácil de ser mantido. Consuma frutas, verduras e legumes desde cedo e estimule o consumo de alimentos

Leia mais

Leguminosas e cereais

Leguminosas e cereais Leguminosas e cereais Objectivos: Descrever a estrutura de sementes de monocotiledóneas e de dicotiledóneas. Indicar os principais cereais usados como matérias primas alimentares. Descrever os processos

Leia mais

Investigador português premiado nos EUA

Investigador português premiado nos EUA Investigador português premiado nos EUA DOENÇA DE CROHN O INVESTIGADOR Henrique Veiga-Femandes, que estuda o papel de células na defesa contra infeções intestinais, recebeu o prémio Sénior Research Award,

Leia mais

Profa. Susana M.I. Saad Faculdade de Ciências Farmacêuticas Universidade de São Paulo

Profa. Susana M.I. Saad Faculdade de Ciências Farmacêuticas Universidade de São Paulo XIV Congresso Brasileiro de Nutrologia Simpósio ILSI Brasil Probióticos e Saúde Profa. Dra. Susana Marta Isay Saad Departamento de Tecnologia Bioquímico-Farmacêutica USP e-mail susaad@usp.br Alimentos

Leia mais

Glúten: dos conceitos ao trabalho do INSA. Marina Rocha Pité Seminário: Glúten e Segurança Alimentar, 2008

Glúten: dos conceitos ao trabalho do INSA. Marina Rocha Pité Seminário: Glúten e Segurança Alimentar, 2008 Glúten: dos conceitos ao trabalho do INSA Marina Rocha Pité Seminário: Glúten e Segurança Alimentar, 2008 Glúten: definição Utilização de glúten na indústria alimentar Legislação rotulagem/ limites recomendados

Leia mais

Alimentação Saudável. 2008 Teresa Bilhastre - CSCR

Alimentação Saudável. 2008 Teresa Bilhastre - CSCR Ministério da Saúde O Programa de Saúde Escolar insere-se no Plano Nacional de Saúde 2004-2010 Pretende: Reforçar as acções de promoção da saúde e prevenção da doença em ambiente escolar. Ministério da

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Cap.2.1. Alterações do Material Genético Mutações UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação Problemática

Leia mais

ENVELHECER COM SABEDORIA Alimente-se melhor para Manter a sua Saúde e Independência

ENVELHECER COM SABEDORIA Alimente-se melhor para Manter a sua Saúde e Independência ENVELHECER COM SABEDORIA Alimente-se melhor para Manter a sua Saúde e Independência 1. ALIMENTE-SE MELHOR Prevê-se que em 2025 1, só na Europa, o grupo etário mais idoso (acima dos 80 anos), passe de 21,4

Leia mais

O QUE É COLESTEROL? Sinônimos: colesterol hdl, colesterol ldl

O QUE É COLESTEROL? Sinônimos: colesterol hdl, colesterol ldl O QUE É COLESTEROL? Sinônimos: colesterol hdl, colesterol ldl O colesterol pode ser considerado um tipo de lipídio (gordura) produzido em nosso organismo. Ele está presente em alimentos de origem animal

Leia mais

DOENÇA CELÍACA NO ADULTO

DOENÇA CELÍACA NO ADULTO FACULDADE DE CIÊNCIAS DA NUTRIÇÃO E ALIMENTAÇÃO DA UNIVERSIDADE DO PORTO DOENÇA CELÍACA NO ADULTO LUÍSA MARIA ANJOS TRINDADE 2001/2002 INDICE RESUMO I. INTRODUÇÃO II. DESENVOLVIMENTO DO TEMA 1. HISTÓRIA

Leia mais

ORGANIZAÇÃO MUNDIAL DE SAÚDE (2004) 20 QUESTÕES ACERCA DE PRODUTOS ALIMENTARES GENETICAMENTE MODIFICADOS (GM)

ORGANIZAÇÃO MUNDIAL DE SAÚDE (2004) 20 QUESTÕES ACERCA DE PRODUTOS ALIMENTARES GENETICAMENTE MODIFICADOS (GM) ORGANIZAÇÃO MUNDIAL DE SAÚDE (2004) 20 QUESTÕES ACERCA DE PRODUTOS ALIMENTARES GENETICAMENTE MODIFICADOS (GM) Estas perguntas e respostas foram preparadas pela Organização Mundial de Saúde (OMS) em resposta

Leia mais

VACINE-SE A PARTIR DE 1 DE OUTUBRO CONSULTE O SEU MÉDICO

VACINE-SE A PARTIR DE 1 DE OUTUBRO CONSULTE O SEU MÉDICO VACINE-SE A PARTIR DE 1 DE OUTUBRO CONSULTE O SEU MÉDICO Perguntas frequentes sobre a gripe sazonal O que é a gripe? É uma doença infecciosa aguda das vias respiratórias, causada pelo vírus da gripe. Em

Leia mais

Curso de Patologia Digestiva

Curso de Patologia Digestiva Curso de Patologia Digestiva Neoplasias Linfóides do Tracto Gastro-Intestinal Aspectos Histológicos Sofia Loureiro dos Santos Serviço de Anatomia Patológica Hospital Fernando Fonseca, EPE SPG, Lisboa,

Leia mais

O QUE É COLESTEROL? TIPOS

O QUE É COLESTEROL? TIPOS O QUE É COLESTEROL? O colesterol pode ser considerado um tipo de lipídio (gordura) produzido em nosso organismo. Ele está presente em alimentos de origem animal (carne, leite integral, ovos etc.). Em nosso

Leia mais

Faculdade de Ciências da Nutrição e Alimentação Universidade do Porto. A Doença Celíaca de Hoje

Faculdade de Ciências da Nutrição e Alimentação Universidade do Porto. A Doença Celíaca de Hoje Faculdade de Ciências da Nutrição e Alimentação Universidade do Porto A Doença Celíaca de Hoje Monografia elaborada por: Ano Lectivo 2001 / 2002 A Doença Celíaca de Hoje... "um longo caminho a desbravar...um

Leia mais

INFECÇÃO HIV: PERSPECTIVAS ACTUAIS

INFECÇÃO HIV: PERSPECTIVAS ACTUAIS INFECÇÃO HIV: PERSPECTIVAS ACTUAIS MARIA JORGE ARROZ, MD INSA PORTUGAL CARACTERÍSTICAS IMPORTANTES DO VIH A infecção requer a proteína CD4 na superfície da célula como receptor, logo apenas pode infectar

Leia mais

Os anticorpos são proteínas específicas (imunoglobulinas) capazes de se combinarem quimicamente com os antigénios específicos.

Os anticorpos são proteínas específicas (imunoglobulinas) capazes de se combinarem quimicamente com os antigénios específicos. Os anticorpos são proteínas específicas (imunoglobulinas) capazes de se combinarem quimicamente com os antigénios específicos. Ä Os anticorpos apenas reconhecem algumas regiões da membrana do antigénio

Leia mais

Depressão. A depressão afecta pessoas de formas diferentes e pode causar vários sintomas físicos, psicológicos (mentais) e sociais.

Depressão. A depressão afecta pessoas de formas diferentes e pode causar vários sintomas físicos, psicológicos (mentais) e sociais. Depressão Introdução A depressão é uma doença séria. Se estiver deprimido, pode ter sentimentos de tristeza extrema que duram longos períodos. Esses sentimentos são muitas vezes suficientemente severos

Leia mais

Doença Celíaca Atualizada

Doença Celíaca Atualizada UNIVERSIDADE DA BEIRA INTERIOR Ciências da Saúde Doença Celíaca Atualizada Nelson Fernando Gavina Teixeira Dissertação para obtenção do Grau de Mestre em Medicina (ciclo de estudos integrado) Orientador:

Leia mais

Peço desculpa, mas perdi o documento e apenas o consegui recuperar nesta forma. Para não atrasar mais, envio-o mesmo assim.

Peço desculpa, mas perdi o documento e apenas o consegui recuperar nesta forma. Para não atrasar mais, envio-o mesmo assim. Peço desculpa, mas perdi o documento e apenas o consegui recuperar nesta forma. Para não atrasar mais, envio-o mesmo assim. Assinale com uma cruz no(s) quadrado(s) que antecede(m) a(s)resposta(s) verdadeira(s):

Leia mais

Perguntas e respostas sobre imunodeficiências primárias

Perguntas e respostas sobre imunodeficiências primárias Perguntas e respostas sobre imunodeficiências primárias Texto elaborado pelos Drs Pérsio Roxo Júnior e Tatiana Lawrence 1. O que é imunodeficiência? 2. Estas alterações do sistema imunológico são hereditárias?

Leia mais

Ensino Secundário Recorrente por Módulos Capitalizáveis Matriz da Prova do Regime de Frequência Não Presencial

Ensino Secundário Recorrente por Módulos Capitalizáveis Matriz da Prova do Regime de Frequência Não Presencial Ensino Secundário Recorrente por Módulos Capitalizáveis Matriz da Prova do Regime de Frequência Não Presencial AGRUPAMENTO DE ESCOLAS DR.ª LAURA AYRES Matriz do exame de Biologia - módulos 1,2,3 (12ºano)

Leia mais

PERFIL DOS CELÍACOS NO MUNICÍPIO DE FOZ DO IGUAÇU-PR. Curso de Enfermagem 1,2 (patrícia_depine@hotmail.com; oknihei@yahoo.com)

PERFIL DOS CELÍACOS NO MUNICÍPIO DE FOZ DO IGUAÇU-PR. Curso de Enfermagem 1,2 (patrícia_depine@hotmail.com; oknihei@yahoo.com) PERFIL DOS CELÍACOS NO MUNICÍPIO DE FOZ DO IGUAÇU-PR Patrícia Rafaela Depiné (Apresentadora), Oscar Kenji Nihei (Orientador) Curso de Enfermagem, (patrícia_depine@hotmail.com; oknihei@yahoo.com) Palavra-chave:

Leia mais

Clinicamente o autismo é considerado uma perturbação global do desenvolvimento.

Clinicamente o autismo é considerado uma perturbação global do desenvolvimento. Autismo: Definição Causas Conceitos centrais Diagnóstico O QUE É O AUTISMO? O autismo é uma disfunção no desenvolvimento cerebral que tem origem na infância e persiste ao longo de toda a vida. Pode dar

Leia mais

Guia. Nutricional. para gestantes

Guia. Nutricional. para gestantes Referências bibliográficas consultadas: 1. Committee on Nutritional Status During Pregnancy and Lactation, Institute of Medicine. Nutrition During Pregnancy: Part I: Weight Gain, Part II: Nutrient Supplements.

Leia mais

Guia. da Mulher. Um futuro sem Doença de Crohn e Colite Ulcerosa

Guia. da Mulher. Um futuro sem Doença de Crohn e Colite Ulcerosa Guia da Mulher Um futuro sem Doença de Crohn e Colite Ulcerosa A Associação Portuguesa da Doença Inflamatória do Intestino (Colite Ulcerosa e Doença de Crohn) é uma organização voluntária, sem fins lucrativos,

Leia mais

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS ! Universidade Federal de Pernambuco Centro de Ciências da Saúde Departamento de Patologia Laboratório de Imunopatologia Keizo Asami Prof. Dr. Lucas Brandão BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

Leia mais

PALAVRAS-CHAVE Panificação. Alimentos. Subprodutos. Introdução

PALAVRAS-CHAVE Panificação. Alimentos. Subprodutos. Introdução 12. CONEX Apresentação Oral Resumo Expandido 1 ÁREA TEMÁTICA: (marque uma das opções) ( ) COMUNICAÇÃO ( ) CULTURA ( ) DIREITOS HUMANOS E JUSTIÇA ( ) EDUCAÇÃO ( ) MEIO AMBIENTE ( ) SAÚDE ( ) TRABALHO (

Leia mais

Doença Celíaca e sua associação com a Diabetes Mellitus. tipo1

Doença Celíaca e sua associação com a Diabetes Mellitus. tipo1 Doença Celíaca e sua associação com a Diabetes Mellitus tipo1 Celiac Disease and its association with Type 1 Diabetes Mellitus Autora: Joana Isabel Gonçalves Alves Orientado por: Dra. Clara Matos Monografia

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

Profissional. de Saúde. Guia contendo. questões. frequentes

Profissional. de Saúde. Guia contendo. questões. frequentes Este medicamento está sujeito a monitorização adicional. Pede-se aos profi ssionais de saúde que notifi quem quaisquer suspeitas de reações adversas através do sistema nacional de notifi cação. concentrado

Leia mais

Escola Profissional Gustave Eiffel Curso Técnico de Apoio à Infância Disciplina de Saúde Infantil - 2.º ano

Escola Profissional Gustave Eiffel Curso Técnico de Apoio à Infância Disciplina de Saúde Infantil - 2.º ano Introdução Apresentação do Módulo Escola Profissional Gustave Eiffel Curso Técnico de Apoio à Infância Disciplina de Saúde Infantil - 2.º ano Introdução Apresentação do Módulo Objectivos de Aprendizagem:

Leia mais

VEGESOY ISOLATED. Proteína Isolada da Soja. Informações Técnicas

VEGESOY ISOLATED. Proteína Isolada da Soja. Informações Técnicas Informações Técnicas VEGESOY ISOLATED Proteína Isolada da Soja INTRODUÇÃO A soja é uma planta leguminosa que está na cadeia alimentar há 5 mil anos e tem sido parte essencial da dieta asiática há muitos

Leia mais

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º

DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º DOCUMENTO DE APOIO AO ESTUDO BIOLOGIA 12.º Avisos 1. Este documento apenas serve como apoio parcial às aulas de Biologia 12.º ano parte da Unidade 2 e Unidade 3 - leccionadas na Escola Secundária Morgado

Leia mais

Biomassa de Banana Verde Integral- BBVI

Biomassa de Banana Verde Integral- BBVI Biomassa de Banana Verde Integral- BBVI INFORMAÇÕES NUTRICIONAIS Porção de 100g (1/2 copo) Quantidade por porção g %VD(*) Valor Energético (kcal) 64 3,20 Carboidratos 14,20 4,73 Proteínas 1,30 1,73 Gorduras

Leia mais

Gripe Proteja-se! Faça Chuva ou faça Sol, vacine-se a partir de Outubro e até ao final do Inverno. Consulte o seu médico

Gripe Proteja-se! Faça Chuva ou faça Sol, vacine-se a partir de Outubro e até ao final do Inverno. Consulte o seu médico Gripe Proteja-se! Faça Chuva ou faça Sol, vacine-se a partir de Outubro e até ao final do Inverno. Consulte o seu médico Gripe Perguntas Frequentes Perguntas frequentes sobre a gripe sazonal O que é a

Leia mais

Imunodepressão em Atletas Os marcadores Laboratoriais

Imunodepressão em Atletas Os marcadores Laboratoriais Imunodepressão em Atletas Os marcadores Laboratoriais Quem Sou? Carlos Ballarati : Formação Medicina: Formado em Medicina pela PUC-SP Sorocaba em 1988. Residência Médica: Clinica Medica Unicamp em 1989

Leia mais

Actualizado em 21-09-2009* Doentes com Diabetes mellitus 1

Actualizado em 21-09-2009* Doentes com Diabetes mellitus 1 Doentes com Diabetes mellitus 1 Estas recomendações complementam outras orientações técnicas para protecção individual e controlo da infecção pelo vírus da gripe pandémica (H1N1) 2009. Destaques - Os procedimentos

Leia mais

Preferências alimentares individuais; Disponibilidade dos alimentos no mercado; Influência das propagandas no mercado, na televisão.

Preferências alimentares individuais; Disponibilidade dos alimentos no mercado; Influência das propagandas no mercado, na televisão. Nutrição na Infância e Adolescência A alimentação e a nutrição constituem requisitos básicos para a promoção e a proteção da saúde, possibilitando a afirmação plena do potencial de crescimento e desenvolvimento

Leia mais

Biologia Celular e Molecular

Biologia Celular e Molecular DEPARTAMENTO DE ZOOLOGIA FACULDADE DE CIÊNCIAS E TECNOLOGIA UNIVERSIDADE DE COIMBRA Biologia Celular e Molecular Detecção de proteínas por western-blotting 2007-2008 Na electroforese em gel de poliacrilamida

Leia mais

A maioria das pessoas sente-se apta para comer outra vez após a cirurgia, aumentando o seu apetite à medida que os dias passam.

A maioria das pessoas sente-se apta para comer outra vez após a cirurgia, aumentando o seu apetite à medida que os dias passam. Dieta durante o tratamento O que comer e o que evitar de comer Após a cirurgia A maioria das pessoas sente-se apta para comer outra vez após a cirurgia, aumentando o seu apetite à medida que os dias passam.

Leia mais

Alergia as proteínas do leite de vaca

Alergia as proteínas do leite de vaca Universidade Federal de Santa Catarina Programa de Pós-graduação em Ciência dos Alimentos Centro de Ciências Agrárias Alergia as proteínas do leite de vaca Profa Marilde T. Bordignon Luiz bordign@cca.ufsc.br

Leia mais

Cartilha de Prevenção. ANS - nº31763-2. Diabetes. Fevereiro/2015

Cartilha de Prevenção. ANS - nº31763-2. Diabetes. Fevereiro/2015 Cartilha de Prevenção 1 ANS - nº31763-2 Diabetes Fevereiro/2015 Apresentação Uma das missões da Amafresp é prezar pela qualidade de vida de seus filiados e pela prevenção através da informação, pois esta

Leia mais

Sistema Digestivo - Função

Sistema Digestivo - Função Sistema Digestivo Fome Saciedade Sistema Digestivo - Função O organismo humano recebe os nutrientes através dos alimentos. Estes alimentos têm de ser transformados em substâncias utilizáveis, envolvendo

Leia mais

FUNDAMENTOS DE ENFERMAGEM II. Nutrição Enteral Profª.Enfª:Darlene Carvalho

FUNDAMENTOS DE ENFERMAGEM II. Nutrição Enteral Profª.Enfª:Darlene Carvalho FUNDAMENTOS DE ENFERMAGEM II Nutrição Enteral Profª.Enfª:Darlene Carvalho NUTRIÇÃO ENTERAL INDICAÇÕES: Disfagia grave por obstrução ou disfunção da orofaringe ou do esôfago, como megaesôfago chagásico,

Leia mais

Recuperação. Células tecidos órgãos sistemas. - As células são as menores unidades vivas e são formadas por três regiões:

Recuperação. Células tecidos órgãos sistemas. - As células são as menores unidades vivas e são formadas por três regiões: Recuperação Capítulo 01 - Níveis de organização Células tecidos órgãos sistemas - As células são as menores unidades vivas e são formadas por três regiões: A- Membrana Plasmática - Revestimento da célula;

Leia mais

QUE LEITE DAR AO MEU BEBÉ?

QUE LEITE DAR AO MEU BEBÉ? QUE LEITE DAR AO MEU BEBÉ? Para lactentes ou Leites 1 (0-4/6 meses) Bebé Saudável De transição ou Leites 2 (4-12 meses) De crescimento ou Leites 3 (12-36 meses) Anti obstipantes Bebé com Desconforto Digestivo

Leia mais

O QUE É O GLÚTEN E POR QUE EXISTEM PRODUTOS SEM GLÚTEN?

O QUE É O GLÚTEN E POR QUE EXISTEM PRODUTOS SEM GLÚTEN? Porquê sem glúten? O QUE É O GLÚTEN E POR QUE EXISTEM PRODUTOS SEM GLÚTEN? Grande parte da população consume diariamente produtos de padaria e pastelaria. Por esse motivo, é importante oferecer uma alternativa

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

treinofutebol.net treinofutebol.net

treinofutebol.net treinofutebol.net Alimentação do Desportista A alimentação pode influenciar positiva ou negativamente o rendimento dum atleta, devendo consequentemente ser orientada no sentido de não só melhorar a sua capacidade desportiva,

Leia mais

PROGRAMA DE EDUCAÇÃO AMBIENTAL

PROGRAMA DE EDUCAÇÃO AMBIENTAL PROGRAMA DE EDUCAÇÃO AMBIENTAL Último Encontro: Vila Velha 1 Escolha dos temas a serem trabalhados. Tema de hoje: Oficina sobre alimentação saudável 1) Alimentos Alimentos construtores: fornecem proteínas

Leia mais

Doença Celíaca. Curso de Especialização em Nutrição nas Doenças Crônicas não transmissíveis no IEP- 2009

Doença Celíaca. Curso de Especialização em Nutrição nas Doenças Crônicas não transmissíveis no IEP- 2009 Doença Celíaca Curso de Especialização em Nutrição nas Doenças Crônicas não transmissíveis no IEP- 2009 Apresentado por: Solange Cavalcante da Silva Redolfi Orientador: Prof. Drª Carolina Dias Doença Celíaca

Leia mais