Quem é o criminoso? Apostila da Oficina Prática de Genética, Genoma e Biotecnologia

Tamanho: px
Começar a partir da página:

Download "Quem é o criminoso? Apostila da Oficina Prática de Genética, Genoma e Biotecnologia"

Transcrição

1 Todos os direitos reservados ao O DNA vai à Escola Conteúdo deste módulo Polimorfismo de DNA Técnica de eletroforese de DNA Teste de DNA Enzimas de restrição Apostila da Oficina Prática de Genética, Genoma e Biotecnologia Quem é o criminoso? Cada um de nós possui cerca de 20 mil genes e todos nós, inde- 1 pendente da cor, raça ou credo, pertencemos a espécie humana. A definição do conceito de espécie não é tarefa simples, mas podemos simplificar dizendo que dois indivíduos são da mesma espécie se o cruzamento entre eles produzir indivíduos férteis. Além disso, indivíduos de uma mesma espécie possuem o mesmo número de cromossomos em suas células. E apesar de tudo isso, somos diferentes uns dos outros. O que determinam essas diferenças? Porque uns são louros, outros morenos, uns brancos outros negros? Essas diferenças são determinadas pelos alelos que possuímos. Alelos são as diferentes formas que um gene pode ter. Assim como existem variações para uma mesma cor, existem variações para um mesmo gene. Sendo assim, cada um de nós possui um grupo de alelos e o que faz sermos quem somos é a soma da combinação de todos os nossos alelos (genótipo) com as influências recebidas do meio ambiente (que determina o nosso fenótipo). Cada indivíduo possui um genótipo diferente, com exceção dos gêmeos monozigóticos (ou gêmeos idênticos) e dos organismos clonados a partir das células de outro indivíduo. Alguns genes existem sob um grande número de formas, ou seja, apresentam um grande número de alelos. Estes genes são chamados genes polimórficos. Para melhor entendermos este conceito, vamos chamar cada gene pelo nome de uma cor. Vamos supor que estamos trabalhando com 3 genes que chamaremos de gene azul, gene preto e gene verde. Destes 3 genes, quais você acha que são polimórficos? Você consegue imaginar diferentes formas de verde? Que tal verde escuro, verde claro, verde musgo...o mesmo pode ser feito com a cor azul: azul marinho, azul celeste, azul anil... Agora tente o mesmo para a cor preta. O nosso gene preto é um gene monomórfico porque não apresenta nenhuma variação; preto é sempre preto. Já os genes verde e azul são os chamados genes polimórficos. Os alelos para um mesmo gene são semelhantes o suficiente de modo que possamos reconhecê-los como alelos (todas as formas de verde são antes de tudo verde, esta é a característica), mas não são idênticos (verde claro não é idêntico ao verde escuro). Além disso, os alelos estão localizados na mesma posição nos cromossomos homólogos. Deste modo, alelos de um mesmo gene apresentam seqüências de DNA semelhantes (mas não idênticas - lembre-se que verde claro não é igual ao verde escuro) e estão localizados na mesma posição em cromossomos homólogos. Indivíduos que possuem o mesmo alelo para um determinado gene são chamados homozigotos

2 Os alelos podem ser comparados aos diferentes tons de uma cor enquanto indivíduos que possuem alelos diferentes são chamados de heterozigotos. O principal processo que origina as variações gênicas é chamado de mutação. Pelo processo de mutação, alterações específicas ocorrem na seqüência de DNA de um determinado gene, surgindo deste modo um novo alelo. O processo de mutação acontece ao acaso. No entanto, a permanência ou não deste novo alelo na população poderá depender de alguns fatores, entre eles, a seleção natural. Existindo fatores que favoreçam a permanência de um determinado alelo na população, dizemos que este alelo está sendo positivamente selecionado. Nós iremos entender melhor todos estes conceitos nas atividades seguintes. Atividade 1 Nesta atividade nós entenderemos melhor o conceito de gene polimórfico. Cada grupo receberá 1 conjunto de giz de cera. Em cada conjunto, vocês encontrarão diferentes tonalidades de lápis laranja, azul, amarelo e um lápis preto. Escolha um tom para cada cor (pode ser repetido) e faça o seu genótipo preenchendo os quadrados abaixo. Seu genótipo Gene laranja Gene azul Gene amarelo Gene preto Agora, repita o mesmo exercício DE OLHOS FECHADOS. Separe as cores na mesa, feche os olhos, e pegue um tom sem olhar. É muito importante que, após preencher um quadrado com o tom escolhido ao acaso, você coloque o lápis utilizado novamente junto aos outros, misture os tons e então feche os olhos e pegue outro lápis ao acaso. Você verá que pode acontecer de você pegar o mesmo lápis. Se isso acontecer, você deverá utilizar o lápis escolhido ao acaso, mesmo que seja igual ao anterior. Gene laranja Gene azul Gene amarelo Gene preto 2 Exercícios: Compare os resultados obtidos nos dois exercícios. Para isto, complete a tabela com as freqüências dos alelos de cada uma das cores. A freqüência do alelo representa o número de vezes que aquele alelo é encontrado na população, em relação ao número total de alelos. Se nosso grupo tem 20 alunos, então, o número total de alelos deve ser 40! Se por exemplo, 4 alunos escolheram o alelo Blue uma vez, então a freqüência do alelo Blue é 4/40, ou seja, 0,10. A soma

3 de todas as freqüências de todos os alelos para um determinado gene deve ser sempre 1. Tabela de cores: Gene Laranja Com os olhos abertos Melon Red Orange Yellow Orange Macaroni and cheese Apricot Orange Com os olhos fechados Melon Red Orange Yellow Orange Macaroni and cheese Apricot Orange Gene Azul Com os olhos abertos Turquoise Blue Sky Blue Blue Green Cornflower Com os olhos fechados Turquoise Blue Sky Blue Blue Green Cornflower Gene Amarelo Com os olhos abertos Dandelion Yellow Com os olhos fechados Dandelion Yellow Agora, responda às seguintes perguntas: 1)Existe alguma diferença na freqüência dos alelos entre o exercício feito de olhos abertos e o exercício de olhos fechados? A que fatores você atribuiria tais diferenças? 2)Compare o seu genótipo com os genótipos de seus colegas. Há alguém com o mesmo genótipo que o seu? 3)Que genes, neste exercício, são polimórficos? 4)Quais são os mais polimórficos e quais os menos polimórficos? 5)Como você chegou à esta conclusão? 3

4 A primeira enzima de restrição foi isolada em 1968 por Werner Arber, Hamilton O. Smith, e Daniel Nathans quando trabalhavam na Johns Hopkins University, nos Estados Unidos. Em 1978 os três receberam juntos o prêmio Nobel. Para saber mais sobre essa importante descoberta, visite o Nobel e-museum no link se/medicine/laureates/1978/ Teste do DNA A identificação humana por DNA tem sido usada como prova de perícia judicial de investigação de paternidade, maternidade e identificação em certos crimes e homicídios. O DNA pode ser isolado de sangue ou sêmen desidratado, ossos, bulbo capilar, saliva, células da pele, esfregaço anal, vaginal e bucal, tecidos derivados de biópsias ou cirurgias, tecidos mumificados, congelados, ou de líquido amniótico. Além disso, é possível coletar DNA de pontas de cigarro, tampa de caneta mordida, chiclete, pentes, selos, e envelopes entre outros. Os genes utilizados na investigação por análise de DNA são altamente polimórficos e, para a realização de um teste, são utilizados vários genes. Assim como no jogo das cores, onde variações de tons de uma mesma cor representam os alelos, na análise por DNA, a variação diz respeito ao tamanho do fragmento ou às diferenças na seqüência de DNA, onde fragmentos que apresentam o mesmo tamanho representam o mesmo alelo. A diferença de tamanho nos alelos pode ser observada através da ação de enzimas de restrição. Endonucleases de restrição, também chamadas enzimas de restrição, são proteínas bacterianas que cortam o DNA em pedaços. Uma enzima de restrição reconhece uma seqüência específica de nucleotídeos, como AGCT, cortando o DNA nos locais onde estas combinações de letras ocorrer. Por exemplo, EcoRI é uma enzima de restrição que reconhece o sítio GAATTC. W. Arber D. Nathans H.O. Smith 4 Diferentes enzimas reconhecem diferentes sítios de restrição

5 Os testes de investigação por DNA podem ser utilizados para diversos fins tais como determinação da paternidade, determinação de vínculo genético entre indivíduos, e estabelecimento de casos de homicídio e estupro, onde neste caso as amostras encontradas no local do crime são comparadas com amostras recolhidas de suspeitos. A seqüência de DNA testada nestes casos geralmente se encontra localizada em cromossomos autossômicos, mas em alguns casos pode se utilizar também seqüências localizadas no cromossomo Y ou mesmo DNA mitocondrial. Seqüências localizadas nestas regiões não sofrem recombinação (porque não possuem homólogos) e deste modo são transmitidas para a geração seguinte intactas. Esta estratégia é utilizada quando se deseja investigar a linhagem parental de um indivíduo ou mesmo de uma população. Uma vez que o DNA mitocondrial é transmitido apenas pela linhagem materna (somente a mãe transmite DNA mitocondrial para todos os filhos e filhas) e o cromossomo Y é transmitido pelo pai somente para os filhos homens, a análise destas regiões pode fornecer importante informação quanto à origem parental dos indivíduos. Havendo a possibilidade, o cientista sempre utiliza as seqüências localizadas nos cromossomos autossômicos porque produz resultados com maior grau de confiança já que um maior número de seqüências podem ser testadas. Genes polimórficos podem ser usados para se determinar a paternidade biológica de um indivíduo. Exercício Se o DNA de cada amostra abaixo for incubado com a enzima Eco RI (que reconhece o sítio GAATTC), responda: Amostra 1: CAGTGATCTCGAATTCGCTAGTAACGTTGAATTCGTAACTTTCCCT Amostra 2: TCATGAATTCCTGGAATTCCGGAATTCAGCAAATGGAATTCCATTC Amostra 1:...número de sítios de Eco RI...número de fragmentos gerados após a clivagem....tamanho do fragmento (pb) Amostra 2:...número de sítios de Eco RI...número de fragmentos gerados após a clivagem....tamanho do fragmento (pb) Atividade 2 No laboratório de Investigação Forense O Dr. Silva é um cientista renomado que trabalha com casos complicados de investigação de vínculo genético por análise de DNA. E como tantas outras vezes, mais um caso complexo de assassinato chega ao laboratório do Dr. Silva. 5

6 A técnica de estabelecimento de vínculo genético a partir de sequências polimórficas do genoma foi desenvolvida pelo pesquisador inglês Alec Jaffrey em O corpo de um homem jovem foi encontrado num descampado. O homem, identificado como Miguel Antunes, foi brutalmente assassinado com 7 facadas. Graças ao trabalho de Cardoso, um detetive esforçado e talentoso, descobriu-se que Miguel Antunes estava prestes a receber uma herança milionária devido à morte recente de seu pai, de um ataque do coração. Miguel Antunes já havia perdido sua mãe (que teve seu corpo cremado) e não possuía nenhum outro parente conhecido vivo. No entanto, uma vizinha informou à polícia que Miguel Antunes tinha um irmão por parte de pai que nunca havia conhecido. Vasculhando a casa de Miguel, a polícia descobriu que este irmão, quando soube da morte do pai e também da herança que o mesmo havia deixado, enviou uma carta à Miguel informando que por ser filho do mesmo pai ele também tinha direito à herança. Miguel ignorou os apelos deste susposto irmão, dando entrada ao processo de pedido de herança. Alguns dias depois, Miguel foi assassinado. O detetive Cardoso então formulou a hipótese de que este suposto irmão poderia ter matado Miguel para mais tarde requisitar a herança deixada pelo pai. O trabalho de investigação da polícia levantou o nome de mais 1 suspeito que foi visto nos arredores do local do crime, no mesmo horário em que o crime foi cometido. No local do crime foram encontradas pistas e restos de material biológico suficientes para investigação genética por análise de DNA. O Dr. Silva arregaçou as mangas e começou a trabalhar. Análise do perfil genético Para realizar a análise genética, o Dr. Silva primeiro isolou um fragmento do DNA de cada um dos suspeitos e também do material biológico encontrado na cena do crime. Em seguida, ele submeteu cada um dos fragmento de DNA à ação de 2 enzimas de restrição diferentes, que reconhecem sítios de restrição distintos. Essas reações originaram fragmentos de DNA de tamanhos diferentes em cada amostra de DNA analisada. Através do padrão de fragmentos gerado em cada amostra, o Dr. Silva poderá dizer qual dos suspeitos estava presente na cena do crime. A comparação entre as amostras será feita através da digestão com 2 enzimas de restrição específicas e subseqüente análise por eletroforese em gel de agarose. 6 Técnica de eletroforese de DNA Os fragmentos gerados através da digestão por enzimas de restrição podem ser analisados através da técnica de eletroforese de agarose. Eletroforese é a técnica pela qual fragmentos de DNA de diferentes tamanhos são separados. A amostra contendo o DNA é colocada em uma canaleta do gel e este é submetido a um campo elétrico. O DNA irá se mover na direção do pólo positivo, uma vez que a molécula de DNA é negativa devido à presença de grupamentos de fosfato. Durante a corrida eletroforética, os fragmentos de

7 menor tamanho correm mais rapidamente que os fragmentos maiores e, deste modo, a posição relativa dos fragmentos no gel depende dos tamanhos dos mesmos. Após a corrida eletroforética, o gel deve ser tratado com um corante específico que permite a visualização dos fragmentos de DNA. Preparação do Gel de agarose O preparo do gel depende da concentração desejada e do volume da bandeja. Por exemplo, o volume da bandeja é de 30 ml e você deseja preparar um gel a 1%: 1% significa 1 g em 100 ml, portanto em 30 ml você usará 0,30g para fazer um gel a 1%. Lembre-se de que o gel sempre deve ser preparado em tampão, nunca em água. Por convenção, os géis são interpretados da esquerda para a direita, com as canaletas orientadas para cima e as amostras são aplicadas no poço da esquerda para a direita. As amostras ficarão separadas no gel de acordo com o tamanho sendo que os fragmentos menores migraram mais rapidamente enquanto que os maiores migraram mais lentamente. Preparação do gel de agarose 1) Coloque a agarose pesada (0,3g) num erlemeyer contendo 30ml de tampão de eletroforese. Vede o frasco com filme plástico e faça pequenos furos para o vapor escapar; 2) Usando o microondas, deixe a mistura ferver. Quando a solução estiver totalmente em ebulição e já não for mais possível observar a agarose, remova o erlemeyer do microondas. 3) Deixe a solução esfriar por aproximadamente 10 minutos. 4) Enquanto a agarose estiver esfriando, prepare a forma para o gel. Se necessário, use fita adesiva para selar as extremidades da forma. Adicione o pente a uma das extremidades do gel. 5) Quando a solução chegar a aproximadamente 60 graus, derrame o gel na forma. 6) Deixe-o solidificar por uns 15 minutos. 7) Quando o gel ficar duro, remova a fita adesiva e também o pente, com cuidado para não furar o gel. 8) Coloque o gel na cuba de eletroforese. 9) Adicione o tampão de eletroforese até que cubra o gel totalmente. 7

8 Gel de agarose corado com brometo de etídio O processo de polimerização de gel de agarose é semelhante àquele que ocorre quando fazemos gelatina. Preparação das amostras pra corrida 1) Mantenha os tubos contendo as amostras de DNA digeridos no gelo e marque os tubos (A, B, C, D, E e F) com seu nome; 2) Usando uma ponteira para cada tubo adicione 5 µl de corante de aplicação LD em cada tubo; 3) Centrifugue por 20 segundos para reunir todo o volume no fundo do tubo; 4) Usando uma ponteira para cada amosta aplique 25 µl das amostras no gel na seguinte ordem: Canaleta 1 - tubo A - CS (Cena do Crime), enzima 1; Canaleta 2 - tubo B - CS (Cena do Crime), enzima 2; Canaleta 3 - tubo C - S1 (suspeito 1) enzima 1; Canaleta 4 - tubo D - S1 (suspeito 1) enzima 2; Canaleta 5 - tubo E - S2 (suspeito 2) enzima 1; Canaleta 6 - tubo F - S2 (suspeito 2) enzima 2; 5) Certifique-se que a amostra correrá para o pólo positivo (eletrodo vermelho) e ligue a fonte de acordo com as instruções do instrutor. Corra o gel a 100 volts por 45 minutos 6) Quando o corante azul atingir 1/3 do gel desligue a fonte. Diferentes tampões têm sido recomendados para a eletroforese de DNA. Os mais usados são TAE (Tris-acetato-EDTA) etbe (Tris-borato-EDTA). Os fragmentos de DNA migram ligeiramente diferentes nestes dois tampões devido a diferenças na força iônica dos dois tampões. Visualização dos fragmentos de DNA: Depois da corrida eletroforética retire o gel da cuba e adicione algumas gotas de tampão sobre o gel. Pressione um dos papelotes sobre o gel e faça pressão com seus dedos por toda superfície do gel, com cuidado para não parti-lo. Use a placa de acrílico do gel e coloque sobre o gel, adicione um pesinho (leve) sobre a placa. Deixe o papelote em contato com o gel por uns 15 minutos. Retire o papelote e jogue no lixo. Use água destilada morna (não é absolutamente necessário que seja morna) pra descolorar o gel. Troque a água umas 3 vezes em um período de 30 minutos. Transfira o gel pra luz branca e analise. Cuidado: O processo de coloração não é tóxico, mas pode manchar as roupas. No dia seguinte o Detetiver Cardoso telefonou para o Dr. Silva pra saber se ele já possuía alguma pista de quem era o criminoso. O que o Dr. Silva disse para o Detetive Cardoso? Laudo: 8

Exercício 2 DNA e Eletroforese

Exercício 2 DNA e Eletroforese Exercício 2 DNA e Eletroforese Você já aprendeu sobre as enzimas de restrição e como elas clivam o DNA em fragmentos. Você também deve ter notado que, em alguns mapas de restrição, uma enzima pode produzir

Leia mais

ELETROFORESE APLICADA À ANÁLISE DE DNA

ELETROFORESE APLICADA À ANÁLISE DE DNA ELETROFORESE APLICADA À ANÁLISE DE DNA Eletroforese Separação de moléculas carregadas em um campo elétrico. As moléculas em uma mistura são separadas umas das outras conforme o tamanho ou a carga Eletroforese

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Atividade prática Quem é o pai? Quem é o criminoso?

Atividade prática Quem é o pai? Quem é o criminoso? Aluno: nº Atividade prática Quem é o pai? Quem é o criminoso? OBJETIVOS Compreender a importância prática da Engenharia Genética na identificação das pessoas. Conhecer os princípios básicos da manipulação

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica.

Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica. Pontifícia Universidade Católica de Goiás Departamento de Biologia Prof. Hugo Henrique Pádua M.Sc. Fundamentos de Biofísica Eletroforese Introdução a Eletroforese Eletroforese migração de moléculas ionizadas,

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

GENÉTICA FORENSE E PATERNIDADE

GENÉTICA FORENSE E PATERNIDADE GENÉTICA FORENSE E PATERNIDADE Alessandra Dias Laboratório de Biologia Molecular O primeiro teste de DNA para investigação de paternidade era feito através do sistema de HLA, entretanto o resultado era

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

Prova Experimental Física, Química, Biologia

Prova Experimental Física, Química, Biologia Prova Experimental Física, Química, Biologia Complete os espaços: Nomes dos estudantes: Número do Grupo: País: BRAZIL Assinaturas: A proposta deste experimento é extrair DNA de trigo germinado e, posteriormente,

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

A eletroforese é uma técnica utilizada para separar, identificar e purificar

A eletroforese é uma técnica utilizada para separar, identificar e purificar 7. ELETROFORESE DE ÁCIDOS NUCLÉICOS João José de Simoni Gouveia Luciana Correia de Almeida Regitano A eletroforese é uma técnica utilizada para separar, identificar e purificar moléculas carregadas (como

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

DNA profiling parte 2

DNA profiling parte 2 Faculdade Milton Campos Curso Lato Sensu em Medicina Legal Disciplina: Bioinformática e Investigação Criminal Professor: Eduardo Campos dos Santos DNA profiling parte 2 Belo Horizonte Outubro/Novembro

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

Dúvidas Frequentes 1) O que é o teste de paternidade por DNA?

Dúvidas Frequentes 1) O que é o teste de paternidade por DNA? Dúvidas Frequentes 1) O que é o teste de paternidade por DNA? A análise em DNA é o meio mais preciso disponível atualmente para a determinação de paternidades ou maternidades duvidosas. É a extrema sensibilidade

Leia mais

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA

TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA TRANSMISSÃO DA VIDA ÉTICA E MANIPULAÇÃO GÊNICA OS FUNDAMENTOS DA HEREDITARIEDADE EXPERIMENTO Teste de paternidade 1. Resumo Essa aula propõe a simulação de um teste de paternidade por meio da análise de

Leia mais

FORMAÇÃO EM AÇÃO 2014

FORMAÇÃO EM AÇÃO 2014 FORMAÇÃO EM AÇÃO 2014 2º SEMESTRE PROPOSTA DISCIPLINAR - BIOLOGIA 3. BIOLOGIA 1. Título da proposta: DNA 2. Conteúdos: Conteúdo estruturante: Manipulação Genética. Conteúdo Básico: Transmissão das Características

Leia mais

PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert

PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert 1. DADOS DE IDENTIFICAÇÃO Nível de Ensino: Ensino Médio Ano/Série: 3º ano Disciplina: Biologia Quantidade de aulas: 2 2. TEMA

Leia mais

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade

DIFERENCIAIS: TIPOS DE EXAMES. Investigação de paternidade e/ou maternidade HOME O laboratório Sabin, desde 2002, emprega a biologia molecular no estudo do DNA. Essa tecnologia é conhecida pela alta qualidade nos procedimentos adotados que asseguram os resultados dos exames oferecidos.

Leia mais

Manual prático de como fazer sabonete artesanal em casa

Manual prático de como fazer sabonete artesanal em casa Manual prático de como fazer sabonete artesanal em casa Este manual foi elaborado a partir de pesquisas nos vários sites de artesanato da Internet brasileira. Ele é gratuito e seu uso e leitura é reservado

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC

UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC UNIVERSIDADE DO ESTADO DE SANTA CATARINA - UDESC Laboratório de Análises Genéticas DNA UDESC PROPOSTA DE IMPLANTAÇAO DE COLETA DE MATERIAL GENÉTICO PARA ANÁLISE DE VÍNCULO DE PATERNIDADE PELO DNA, DURANTE

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

Entendendo a herança genética. Capítulo 5 CSA 2015

Entendendo a herança genética. Capítulo 5 CSA 2015 Entendendo a herança genética Capítulo 5 CSA 2015 Como explicar as semelhanças entre gerações diferentes? Pai e filha Avó e neta Pai e filho Avó, mãe e filha Histórico Acreditava na produção, por todas

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA

UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA UNIVERSIDADE FEDERAL DO PARANÁ DEPARTAMENTO DE ESTATÍSTICA RAZÃO DE PROBABILIDADE BAYESIANA COMO EVIDÊNCIA PARA TESTE DE VÍNCULO DE PATERNIDADE Curitiba 2012 I Dianna Lo Wai Yan Maurício Fernandes do Nascimento

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

ENSINO MÉDIO. Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC

ENSINO MÉDIO. Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC ENSINO MÉDIO Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC 1- A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante, cuja manifestação ocorre na fase adulta, com uma progressiva

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Rede de cientistas cria "guia" do DNA

Rede de cientistas cria guia do DNA Rede de cientistas cria "guia" do DNA Pacotão de estudos faz a análise mais completa do DNA Na maior série de descobertas sobre o DNA humano desde a realização do projeto genoma humano em 2003, 442 cientistas

Leia mais

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto Genética Humana Faculdade Anísio Teixeira Prof João Ronaldo Neto Segregação dos Genes Segregação independente ou Herança diibrida; Com base nos experimentos de Mendel com as ervilhas chamamos de segregação

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 55 HERANÇA LIGADA AO SEXO

BIOLOGIA - 2 o ANO MÓDULO 55 HERANÇA LIGADA AO SEXO BIOLOGIA - 2 o ANO MÓDULO 55 HERANÇA LIGADA AO SEXO Mulher portadora Homem não afectado Gene normal Gene alterado Mulher portadora Mulher não afectada Homem não afectado Homem afectado Homem afectado

Leia mais

Genética I: Mendel, Mitose e Meiose

Genética I: Mendel, Mitose e Meiose Página 1 de 6 Genética I: Mendel, Mitose e Meiose Uma forma de estudar a função biológica é pegar um organismo/célula e dividi-lo em componentes, como as proteínas, e então estudar os componentes individuais.

Leia mais

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR

LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR LINHA DE REAGENTES PARA BIOLOGIA MOLECULAR Linha de reagentes fabricados dentro de restritos controles de qualidade. Testados para assegurar os melhores resultados nas técnicas de pesquisa em Biologia

Leia mais

Lei da Segregação. Experimentos de Mendel

Lei da Segregação. Experimentos de Mendel Lei da Segregação Os trabalhos do monge Agostinho Gregor Mendel, realizados há mais de um século, estabeleceram os princípios básicos da herança, que, até hoje, são aplicados nos estudos da Genética. A

Leia mais

DNA Darwin Não Atento?

DNA Darwin Não Atento? DNA Darwin Não Atento? PÁGINA 1 DE 6 CIÊNCIAS BIOLOGIA QUÍMICA Darwin foi um dos maiores cientistas de todos os tempos. Ele percebeu que variações ocorrem nas populações ou seja, diferenças são encontradas

Leia mais

Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam

Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam Um estudante de 23 anos, doador de sangue tipo universal, é moreno, tem estatura mediana e pesa 85 kg. Todas as alternativas apresentam características hereditárias desse estudante que são influenciadas

Leia mais

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna).

Ancestralidade Materna polimorfismos matrilínea DNA Mitocondrial (mtdna). Ancestralidade Materna A atual população dos países latino-americanos foi gerada por um complexo processo de mistura genética entre ameríndios, europeus e africanos. As porcentagens relativas destas três

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

2. (FATEC) Um casal cujo filho é do grupo sanguíneo A, com fator Rh positivo, pode ter os seguintes genótipos:

2. (FATEC) Um casal cujo filho é do grupo sanguíneo A, com fator Rh positivo, pode ter os seguintes genótipos: Foz do Iguaçu, de de 2015. Nome: nº Professor Ailton Pastro. 1 a série A, B, C e D Nota: LISTA DE QUESTÕES TRABALHO BIMESTRAL 1. (MACK) Um indivíduo de tipo sanguíneo O, Rh-, filho de pais tipo sanguíneo

Leia mais

Hereditariedade. Leis da hereditariedade GENÉTICA

Hereditariedade. Leis da hereditariedade GENÉTICA Hereditariedade Definição: É a transferência de informações sobre as características próprias de um ser vivo para outro, de geração para geração, por meio dos gametas ou por transferência direta deácidos

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

ELETROFORESE DE ÁCIDOS NUCLÉICOS: UMA PRÁTICA PARA O ENSINO DE GENÉTICA

ELETROFORESE DE ÁCIDOS NUCLÉICOS: UMA PRÁTICA PARA O ENSINO DE GENÉTICA ISSN 1980-3540 03.01, 43-48 (2008) www.sbg.org.br ELETROFORESE DE ÁCIDOS NUCLÉICOS: UMA PRÁTICA PARA O ENSINO DE GENÉTICA Emanuel Ricardo Monteiro Martinez 1, Luiz Ricardo de Souza Paiva 1 Autor para correspondência:

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I

DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I Leia o texto abaixo com atenção. Considere que, nos pombos, a ausência de s é condicionada geneticamente. Nos cruzamentos que um criador realizava, ele observou

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Exercícios Genética e sistema imunitário. Professora: Ana Paula Souto

Exercícios Genética e sistema imunitário. Professora: Ana Paula Souto Exercícios Genética e sistema imunitário Professora: Ana Paula Souto Nome: n o : Turma: 1) Cite as diferenças entre mitose e meiose. Relacione o número de cromossomos da célulamãe com o das células-filhas.

Leia mais

As enzimas de restrição

As enzimas de restrição As enzimas de restrição A Engenharia Genética é possível graças a um grupo especial de enzimas que cortam o DNA. Estas enzimas são chamadas de enzimas de restrição ou endonucleases de restrição. As enzimas

Leia mais

Ubiquidade de microorganismos. Introdução. Materiais Necessários

Ubiquidade de microorganismos. Introdução. Materiais Necessários dução Os microorganismos (fungos, bactérias e vírus) são chamados assim por terem um tamanho bastante reduzido. Eles são tão pequenos que não conseguimos enxergá-los a olho nu, mas apenas utilizando microscópio

Leia mais

Os exames. de DNA nos tribunais

Os exames. de DNA nos tribunais Avanços científicos ocorridos nas últimas décadas alteraram as investigações policiais: se antes as impressões digitais e outras pistas eram usadas para desvendar os crimes, hoje pode-se extrair DNA de

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

A ANÁLISE DE DNA POR ELETROFORESE

A ANÁLISE DE DNA POR ELETROFORESE A ANÁLISE DE DNA POR ELETROFORESE Co autores: Elisete Marcia Corrêa Patrícia Abrão Possik Eletroforese de DNA em gel A análise de DNA por eletroforese é uma das técnicas fundamentais nos laboratórios de

Leia mais

3M TM Petrifilm TM Placa para Contagem de Leveduras e Bolores. Guia de. Interpretação

3M TM Petrifilm TM Placa para Contagem de Leveduras e Bolores. Guia de. Interpretação 3M TM TM Placa para Contagem de Leveduras e Bolores Guia de Interpretação 3M TM TM Placa para Contagem de Leveduras e Bolores Este guia apresenta resultados das placas 3M para Contagem de Leveduras e Bolores.

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

das espécies Chegamos à aula 50! Durante as aulas do Os trabalhos de Charles Darwin

das espécies Chegamos à aula 50! Durante as aulas do Os trabalhos de Charles Darwin A evolução das espécies A UU L AL A Chegamos à aula! Durante as aulas do telecurso, você viu vários temas relacionados com a Biologia: genética, botânica, zoologia, fisiologia, ecologia entre outros. Finalizaremos

Leia mais

AULA PRÁTICA DE QUÍMICA GERAL Estudando a água parte 32

AULA PRÁTICA DE QUÍMICA GERAL Estudando a água parte 32 AULA PRÁTICA DE QUÍMICA GERAL Estudando a água parte 32 9º NO DO ENSINO FUNDAMENTAL - 1º ANO DO ENSINO MÉDIO OBJETIVO Diversos experimentos, usando principalmente água e materiais de fácil obtenção, são

Leia mais

Lista de Exercícios Herança Sexual

Lista de Exercícios Herança Sexual Meus queridos alunos, preparei para vocês uma lista de atividades abordando o conteúdo estudado por nós esta semana. Espero que vocês aproveitem o final de semana para resolver esses exercícios segundo

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Diversidade Genética das Populações Amazônicas

Diversidade Genética das Populações Amazônicas PAINEL I Particularidades genéticas das populações amazônicas e suas possíveis implicações Coordenação de Mesa: Wim Degrave. Diversidade Genética das Populações Amazônicas Sidney dos Santos Será apresentado

Leia mais

LOCALÍSTICA FORENSE. Rogéria M. Ventura, Ph D FMU - 2011

LOCALÍSTICA FORENSE. Rogéria M. Ventura, Ph D FMU - 2011 LOCALÍSTICA FORENSE Rogéria M. Ventura, Ph D FMU - 2011 PERÍCIA CRIMINAL INVESTIGAÇÃO DO CRIME Chegada do perito investigador ao local do crime e certificação da preservação; Reconhecimento inicial da

Leia mais

DNA: Passado, Presente e Futuro

DNA: Passado, Presente e Futuro DNA: Passado, Presente e Futuro O passado O modelo do DNA que hoje nos é tão familiar foi divulgado em abril de 1953 na revista científica Nature pelos cientistas James Watson e Francis Crick. Eles afirmaram

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012

Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 Entendendo a herança genética (capítulo 5) Ana Paula Souto 2012 CÂNCER 1) O que é? 2) Como surge? CÂNCER 1) O que é? É o nome dado a um conjunto de mais de 100 doenças que têm em comum o crescimento desordenado

Leia mais

Genética III: Genética Humana

Genética III: Genética Humana Genética III: Genética Humana 1. Genética Humana As árvores genealógicas são usadas para mostrar a herança de doenças genéticas humanas. Uma árvore genealógica na qual é possível rastrear o padrão de herança

Leia mais

UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA

UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA UNIVERSIDADE ABERTA DO BRASIL UNIVERSIDADE FEDERAL DA PARAIBA - UFPB VIRTUAL LICENCIATURA EM CIÊNCIAS BIOLÓGICAS A DISTÂNCIA DISCIPLINA BIOQUÍMICA ESTRUTURAL Ministrante: Prof. Dr. Carlos Alberto de Almeida

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais

SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII

SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII SEQUÊNCIA DIDÁTICA PODCAST ÁREA CIÊNCIAS CNII Título do Podcast Área Segmento Duração Por que você se parece com sua avó? A genética vai ajudá-lo a entender como isso é possível! Ciências Ciências da Natureza

Leia mais

Genética Conceitos Básicos

Genética Conceitos Básicos Genética Conceitos Básicos O que é genética? É o estudo dos genes e de sua transmissão para as gerações futuras. É dividida em: Genética Clássica Mendel (1856 1865) Genética Moderna Watson e Crick (1953).

Leia mais

O AR. Do sopro da vida ao DNA

O AR. Do sopro da vida ao DNA O AR Do sopro da vida ao DNA O ar e a mitologia Antes de tudo existir havia o Caos. Uma força misteriosa criou o disco terrestre (Gaia) e a abóbada celeste (Urano), enchendo o universo de ar e luz. Da

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

E X P E R I Ê N C I A S D E 1º A N O

E X P E R I Ê N C I A S D E 1º A N O E X P E R I Ê N C I A S D E 1º A N O PROF. AGAMENON ROBERTO < 2007 > Prof. Agamenon Roberto 1º ANO EXPERIÊNCIAS 2 1ª e 2ª EXPERIÊNCIAS DESTILAÇÃO SIMPLES E DESTILAÇÃO FRACIONADA OBJETIVO: Mostrar como

Leia mais

CADERNO DE EXERCÍCIOS 3F

CADERNO DE EXERCÍCIOS 3F Questão CADERNO DE EXERCÍCIOS 3F Ensino Médio Ciências da Natureza II Conteúdo 1. Ligações de hidrogênio interação intermolecular Habilidade da Matriz da EJA/FB H27 2. Ligações de hidrogênio e tensão superficial

Leia mais

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI.

EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. EXTRAÇÃO DE DNA EM GENÓTIPOS DE ACEROLA NO DISTRITO DE IRRIGAÇÃO DO PIAUÍ-DITALPI. Antonia Cardoso Almeida ( ICV/ UFPI); Francilene Leonel Campos(orientadora, Curso de Licenciatura em Ciências Biológicas/

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 91) No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Ervilhas, Hereditariedade e o Nascimento da Genética

Ervilhas, Hereditariedade e o Nascimento da Genética Volume 1 Módulo 2 Biologia Unidade 3 Ervilhas, Hereditariedade e o Nascimento da Genética Para início de conversa... Desde a unidade 1, estamos construindo um conhecimento importante sobre o campo da Biologia,

Leia mais

INTRODUÇÃO AO ESTUDO DA GENÉTICA

INTRODUÇÃO AO ESTUDO DA GENÉTICA INTRODUÇÃO AO ESTUDO DA GENÉTICA PROFESSORA: SANDRA BIANCHI ASSUNTOS ESTUDADOS NA GENÉTICA ESTUDO DOS GENES E DA HEREDITARIEDADE A GENÉTICA E A MATEMÁTICA ESTUDANDO PROBABILIDADE FÓRMULA GERAL: P(A) =

Leia mais

(baseado em 1 avaliações)

(baseado em 1 avaliações) Experimento cadastrado por Luara augusta batista em 01/08/2011 Classificação Total de exibições: 2029 (até 07/08/2012) (baseado em 1 avaliações) Palavras-chave: mendel, ervilhas, segunda lei de mendel,

Leia mais

9 + OBJETIVO COMEÇANDO COMPONENTES: MONTAGEM

9 + OBJETIVO COMEÇANDO COMPONENTES: MONTAGEM Atenção: este brinquedo só deve ser entregue a criança após ter sido montado por um adulto. Cód. Produto: 04000 IDADE 9 + 2 6 JOGADORES ATENÇÃO: NÃO RECOMENDÁVEL PARA MENORES DE 03 ANOS, POR CONTER PARTES

Leia mais

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel 1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel Quadrado de Punnet Segregação fenotípica 3/4 Preto 1/4 marron

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

INTERAÇÃO GÊNICA EPISTASIA POLIGENIA OU HERANÇA QUANTITATIVA. PM/Bombeiro - PR. Oromar Ciências Humanas Parte 03. Foto das cristas de galinhas

INTERAÇÃO GÊNICA EPISTASIA POLIGENIA OU HERANÇA QUANTITATIVA. PM/Bombeiro - PR. Oromar Ciências Humanas Parte 03. Foto das cristas de galinhas INTERAÇÃO GÊNICA Ocorre quando dois ou mais pares de genes, situados em cromossomos homólogos diferentes, interagem entre si para determinar uma mesma característica. FENÓTIPOS Crista ervilha Crista rosa

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Guia de administração para os doentes pediátricos dirigido aos cuidadores. Leia este guia antes de administrar a injeção à sua criança.

Guia de administração para os doentes pediátricos dirigido aos cuidadores. Leia este guia antes de administrar a injeção à sua criança. Humira Guia de administração para os doentes pediátricos dirigido aos cuidadores Leia este guia antes de administrar a injeção à sua criança. Mantenha o medicamento no frigorífico (a uma temperatura entre

Leia mais

Ervilhas, Hereditariedade e o Nascimento da Genética

Ervilhas, Hereditariedade e o Nascimento da Genética Módulo 1 Unidade 3 Ervilhas, Hereditariedade e o Nascimento da Genética Para início de conversa... Bactérias e micro-organismos estão presentes em qualquer lugar. Em laboratório, uma experiência simples

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais