Manipulação molecular e Biotecnologia

Tamanho: px
Começar a partir da página:

Download "Manipulação molecular e Biotecnologia"

Transcrição

1 FACULDADE DE CIÊNCIAS DA UNIVERSIDADE DO PORTO Manipulação molecular e Biotecnologia Sebenta Sandra Isabel Cunha Silveira Ano lectivo 2010/2011 Professora: Susana Vieira

2 Plasmídeos Plasmídeos, pequenos fragmentos de DNA, são conhecidos em quase todas as células bacterianas. Encontram-se separados do material DNA principal da bactéria, representando 2% da informação genética total do organismo. Contem de dezenas a centenas de genes, comparando com o material DNA principal, que contém milhares de genes. O plastídeo é uma molécula de DNA extra cromossómico separado do DNA cromossómico, que é capaz de replicar-se independentemente do DNA cromossómico. Em muitos casos, é circular e de dupla cadeia. Os plasmídeos ocorrem naturalmente em bactérias, mas, por vezes, são encontrados em organismos eucarióticos (ex: Saccharomyces cerevisiae) Os plasmídeos são: Fechados e peças circulares de DNA; Capazes de auto replicação; São transportados por muitas bactérias; Fornecem funções únicas à bactéria, permitindo-as replicarem-se sexualmente e na passagem de material genético entre elas; Responsáveis pelos factores genéticos que facultam a resistência a antibióticos e fornecem enzimas necessárias para quebrar os recursos alimentares pouco metabolizados. Os plasmídeos são, tipicamente moléculas circulares de dsdna com tamanho entre 2kb e 100b. Estes plasmídeos serão super enrolados na célula. Os plasmídeos possuem uma origem de replicação, que é uma sequência de DNA que permite copiar as moléculas de DNA. 2

3 Dois plasmídeos diferentes que são originados da mesma origem de replicação não coexistem. Alguns plasmídeos são capazes de replicar num número limitado de espécies bacterianas; eles têm um estreito intervalo hospedeiro. Exemplos como os plasmídeos ColE1, pbr322, puc18 são limitados para E. coli e para algumas espécies. Outros plasmídeos são capazes de replicar numa largo intervalo de espécies bacterianas; têm um amplo intervalo hospedeiro. Controlo das cópias do plasmídeo O número de cópias do plasmídeo pode variar de 1 (o plasmídeo F) a centenas (puc18). Este número é uma propriedade do plasmídeo e depende do mecanismo que regula a sua própria replicação. Exemplo: Replicação do plasmídeo ColE1 ColE1 é um pequeno e circular plasmídeo que codifica uma toxina (proteína) de 57 kdal que consegue matar outra E.coli por despolarização da membrana bacteriana. O plasmídeo ColE1 carrega os seguintes genes: 3

4 Transferência de plasmídeo Alguns plasmídeos conseguem auto transferir-se entre células bacterianas por conjugação bacteriana. Esses plasmídeos codificam todas as funções proteicas que são necessárias e que requerem mobilização e transferência de célula hospedeira para a célula receptora. Alguns plasmídeos são incapazes. Não codificam as proteínas necessárias. Contudo, coexistem na células com plasmídeo que automobiliza-se. Assim, eles podem conseguir mobilizar-se, se transportarem a sequencia correcta ou sítios que são reconhecidos pelas proteínas que são sintetizadas do outro plasmídeo. O plasmídeo ColE1 é um bom exemplo de um plasmídeo mobilizador. Ele contém uma região bom (base da mobilização) com local nic que é ligado por proteínas codificadas na região mob (mobilização). Quando as bactérias juntam-se, a estreita ligação forma um complexo com a proteína mob que lida através do canal de conjugação para a célula receptora. Como estudar um gene? Cada cromossoma é uma molécula contínua de DNA, que pode ser de milhares ou de milhões pares de base. O vasto tamanho dos cromossomas coloca um problema para os cientistas que tentam isolar e estudar porções de DNA que compõe os genes. Um cromossoma é uma de DNA contínua. Pode ter milhares ou milhões de pares de bases. Tesouras moleculares Em 1962, Werner arber, um bioquímico suíço, forneceu a primeira existência de tesouras moleculares que conseguem cortar DNA. Ele mostrou que a bactéria E.coli possui um sistema imunológico enzimático que reconhece e destrói DNA estranho, e modifica o DNA nativo para o prevenir de autodestruição. Arber e os seus associados denominam o grupo que corta DNA de enzimas de restrição endonucleases. Eles mostraram que as endonucleases de restrição são específicas no seu corte. Uma enzima dada irá cortar o DNA apenas quando reconhece a sequência certa. Utilizamos endonucleases de restrição para podermos estudar os genes individualmente e, para cortar DNA. 4

5 Bacteriófago é um vírus que infecta bactérias. O DNA do vírus que entrava, era cortado, levando assim á descoberta das enzimas de restrição. Cola molecular Não muito depois das descobertas de Arber, Arthur Kornberg identificou um mecanismo de colar para a o DNA, uma enzima denominada ligase. Kornberg estava a tentar construir um DNA viral artificial de fragmentos virais, mas não consegui criar uma molécula activa, biologicamente. Depois de ele adicionar ligase, descobriu que a enzima torna possível colar as extremidades da molécula de DNA. A DNA ligase torna possível ligar as extremidades da molécula de DNA. Fazer mais cópias Pelo fim de 1960, a molécula de DNA podia ser cortada e colada. Mas os cientistas necessitavam de um mecanismo de cópia a fim de manter uma grande amostra para trabalhar. Essa descoberta veio em 1971, quando cientistas descobriram uma maneira eficiente de introduzir pequenos loops de DNA chamados de plasmídeos na bactéria e.coli. estes loops de DNA plasmídico consegue transportar um pacote de DNA estranho para as células hospedeiras, e conferir um benefício como a resistência a drogas. Cientistas conseguem importar plasmídeos que contêm uma parte selectiva do DNA para uma bactéria. A reprodução normal de bactérias produz uma grande quantidade do DNA desejado. A revolução recombinante A etapa foi definida pela revolução tecnológica. Cientistas descobriram como cortar, colar e copiar DNA. O que ficou por fazer foi como aplicar estas técnicas para editar e personalizar DNA. Esta criação de DNA recombinante poderia manipular coisas vivas no seu nível mais básico. Poderão os cientistas criar organismos que combinem os genes de diferentes espécies? Poderá ajudar a salvar vidas, ou pode ameaçá-la? 5

6 Técnica de transformação/células competentes A transformação é a introdução de plasmídeos num organismo, como por exemplo bactérias. A bactéria ao multiplicar-se origina milhares de cópias de DNA clonagem de genes seleccionados. Esta técnica induz a bactéria a incorporar o DNA plasmídico. Espalhamos a bactéria transformada numa placa de petri que contém tretaciclina e Canamicina. Apenas as bactérias transformadas contendo os dois genes de resistência poderão crescer na presença de ambos antibióticos. O resultado foi consistente com a bactéria ter sido transformada com um plasmídeo com os genes tet r e kan r. Contudo, também é possível que algumas bactérias possam ter sido duplamente transformadas por versões re-ligadas do plasmídeo original. Estas bactérias vivas deixam entrar as moléculas porque não as reconhecem como desconhecidas. Extracção de DNA plasmídico e electroforese em gel de agarose Análise da restrição mostra que algumas colónias foram transformadas pelo plasmídeo recombinante. É permitido saber quando cortamos o plasmídeo e corremo-lo em gel de agarose. Crescimento do fago Existem dois tipos de bacteriófagos, o fago lamda e o fago M13. O fago lambda pode existir em pró-fago (integrado no genoma bacteriano, lisogénico) ou como um elemento genético independente (lítico). O fago lambda é um bacteriófago linear de cadeia dupla quando carrega no fago uma película proteica. 6

7 Durante a infecção, um fago ataca a bactéria e injecta o material genético no citoplasma da bactéria. A informação genética do fago assume maquinaria da bactéria, desligando a síntese dos componentes da bactéria e redirecciona a síntese do material bacteriano para fazer mais componentes fágicos. No ciclo de infecção do fago, a lise é quando a célula rebenta para libertar os componentes. Depois da lise, os fagos descendentes infectam as células vizinhas. Este é um fenómeno exponencialmente explosivo (causa um crescimento exponencial do numero de células que sofrem lise). Como quantificar o crescimento do fago? Existe uma camada contínua de bactérias (filmes) e são colocados os fagos em baixa. Cada roda clara foi um fago que lisaram a bactéria e os pontos são as bactérias que foram destruídas e são fagos que ficaram placa fágica. Restrição do crescimento de fagos É conhecido desde 1950, de que as partículas dos fagos crescem bem e eficientemente infectam uma linhagem de bactérias que frequentemente são incapazes de crescer bem e infectam outras linhagens da mesma espécie bacteriana. Em adição, as partículas fágicas que conseguem, com sucesso, infectar uma segunda linhagem, frequentemente demonstram um padrão oposto. Estes são capazes de 7

8 infectar, eficientemente uma segunda linhagem enquanto crescem pobremente na linhagem original. Uma série de estudos mostra que as partículas fágicas que crescem eficientemente e infectam a célula hospedeira têm moléculas de DNA que são quimicamente modificadas pela adição de grupos metilo em algumas das suas bases adeninas e/ou citosinas, enquanto o DNA do fago que pobremente infecta não mostra este tipo de modificação química ou metilação. Partículas fágicas sem metilação do DNA não crescem e nem infectam eficientemente porque as suas moléculas de DNA são clivadas e degradadas por enzimas da célula hospedeira, enquanto as que possuem DNA metilado estão protegidas da degradação. Este fenómeno da degradação do DNA não metilado destrói a habilidade de crescimento do fago e é responsável pelo padrão de restrição do crescimento. Descoberta dos sistemas de modificação-restrição Apesar do fenómeno biológico do sistema de modificação-restrição crescer das observações dos microbiologistas, a variedade das células hospedeiras dos fagos é influenciada pela estirpe bacteriana em que o fago se propagou. Apesar dos fagos produzirem numa estirpe de Escherichia coli, poderão infectar uma cultura da mesma estirpe, eles não alcançam uma infecção de sucesso em células de estirpes diferentes da E.coli. Esta descoberta implica que os fagos transportam um imprint que identifica as suas proveniências imediatas. Testes biológicos simples demonstram que a infecção com sucesso numa estirpe diferente resulta na produção de fagos que perderam os seus imprint e adquiriram um novo. Observação: Fagos produzidos numa estirpe de E. coli, infectavam a mesma estirpe. Mesmos fagos não infectavam eficazmente SEGUNDA estirpe: PORQUÊ? Em 1960, experiências moleculares demonstraram que o imprint de um DNA modificado foi perdido quando o DNA fágico numa estirpe bacteriana diferente. Esses fagos, que conservam uma parte original da cadeia de DNA retêm o imprint, ou a modificação, enquanto fagos que contêm as duas cadeias de um novo DNA sintetizado não retêm o imprint. A modificação fornece protecção contra a endonuclease, a barreira que previne a replicação do genoma fágico. Mais tarde, foi comprovado que as enzimas de modificação e de restrição reconhecem o mesmo alvo, uma sequência nucleótica especifica. 8

9 1960: o imprint é uma MODIFICAÇÃO do DNA perdida na nova estirpe bacteriana Os fagos com UMA das cadeias modificadas retinham o imprint Os fagos com DNA completamente novo perdiam o imprint A MODIFICAÇÃO deveria dar PROTECÇÃO contra uma ENDONUCLEASE Mais tarde: A modificação e a restrição reconheciam o mesmo alvo (sequência nucleotídica) Nota: Nesta altura não estavam caracterizados os sistemas de Modificação/Restrição As enzimas de modificação são um DNA metiltransferase que metila bases específicas da sequência alvo e na ausência da metilação específica, o DNA da sequência alvo é sensível às enzimas de restrição. Quando falta no DNA o imprint de modificação apropriado, entra a célula competente da restrição que reconhece o DNA como estranho e é degradado por uma endonuclease. A barreira controlo-hospedeiro para uma infecção com sucesso pelos fagos que não possuem uma correcta modificação foi referida como restrição e as endonucleases adquiriram o nome de enzimas de restrição. Similarmente, as metiltransferases são, normalmente, denominadas de enzimas de modificação. Classicamente, a enzimas de restrição é acompanhada pela enzima de modificação e as duas compreendem o sistema de modificação-restrição. O hospedeiro barra uma infecção por fagos = restrição não protegidos pela modificação correcta. E.coli C aparentemente não apresenta sistema R- M. Prever: eficiência de fagos crescido em C quando infectam K-12. Fagos crescidos em K-12: diferenças quando infectam K-12 e C? Prever eficiência na formação de lambda K em E.coli B. E.coli B possui um sistema R-M com especificidade diferente de K-12. Eschericia coli K-12 possui, enquanto a Escherichia coli C tem em falta, o sistema Restrição Modificação do tipo I. o fago λ (lambda) propagado na E.coli C. (λ.c) não é protegido da restrição pela Eco KI e assim, forma placas com eficiência reduzida de plaqueamento (EOP) na E.coli K-12 em comparação com a E.coli C. os fagos que nai sofrem restrição são modificadas pela Eco KI metiltransferase (λ.k) e, consequentemente, forma placas com a mesma eficiência na E.coli K-12 e C. DNA modificado é indicado por hatch marks. 9

10 A descoberta de uma barreira para a infecção do seu hospedeiro natural, E.coli k-12, se o fago foi, previamente, propagado em E.coli C. isto leva a um fenómeno do sistema R-M. Eschericia coli K-12 possui um sistema M-R, Eco KI, ausente na E.coli C. o fago propagado na E. coli C não é protegido da restrição pela Eco KI e forma placas de baixa eficiência na E.coli K-12 em comparação com a E.coli C. Bertani e Weigle: uma barreira para a infecção do bacteriófago no seu hospedeiro natural, Escherichia coli K-12, que pode lifted pela variação hospedeiro controlo do vírus. Arber e um aluno de doutoramento Dussoix mostram que o DNA foi rejeitado e degradado depois da infecção de diferentes hospedeiros bacterianos, a não ser que transporta-se a modificação específica do DNA, e assim, dando fundamentos para o fenómeno da restrição e modificação (R- M). A enzima de restrição da E.coli k-12, Eco KI, foi purificada em 1968 e necessita de S-adenosilmetionina (AdoMet) e ATP como cofactores. Pelo fim da década, houve uma evidência substancial para um locus do cromossoma hsdk com três genes que codificam as subunidades da restrição (C), modificação (M) e especificidade (S) que reúnem num grande complexo de mais de 400 kda. Em 1970 trouxeram a mensagem de que a Eco KI cortam longe do local de reconhecimento do DNA, no local onde a enzima permanece ligada enquanto a translocação do próprio DNA passado, com hidrólise de ATP, e subsequente com espaços na cadeia dupla. Esta translocação DNA loops, claramente, visível no microscópio electrónico. A restrição ocorre quando uma sequência alvo específica (sequência de DNA a azul escuro que é mostrada como um tubo) sem a metilação apropriada (locais amarelos) em ambas as cadeias de DNA é reconhecida pela enzima. Uma enzima de restrição do tipo II, tipicamente uma proteína dimérica, cliva o DNA num local definido dentro ou perto da sequência alvo específica e dissocia do DNA deixando duas terminações livres. Alvos não metilados causa à enzima de restrição do 10

11 tipo I a segurar o alvo e activa a translocação do DNA (direcção mostrada pelas setas vermelhas) pelas subunidades motor. Múltiplos contactos com o DNA que expandem loops são extrusados a partir da enzima como bobinas no DNA. Adiando a translocação por colisão com, por exemplo, com outra enzima de restrição do tipo I, activa a clivagem no local da colisão. Depois da clivagem do DNA, a enzima de restrição do tipo I permanece ligada ao DNA e não vira na reacção de restrição. A enzima de restrição do tipo I compreende as sequências de DNA da subunidade (S), duas subunidades metiltransferase (M) e duas subunidades de restrição (R). O núcleo do M 2 S é responsável pela (i) manutenção da metilação do cromossoma hospedeiro pela modificação sequência específica hemimetilada produzida pela replicação do DNA e (ii) activação da reacção de restrição caso a sequência especifica do DNA reconhecida é não metilada em ambas as cadeias e a partir da fonte estranha. Esta reacção de restrição compreende ATPases dependentes da translocação do DNA pelos motors, que são membros da SF2, que é da família das helicases, e cliva o DNA. A reacção de restrição é transportada pela subunidade R, em que cada uma contém um motor e um domínio de clivagem do DNA. Eco KI tornou-se na arquetípica enzima tipo I do sistema R-M com a translocação do DNA com propriedades reminiscentes das helicases, reconhecendo o local assimétrico bipartido AAC(N6)GTGC. Endonuclease de restrição Quando um bacteriófago é transferido do crescimento em um hospedeiro para um hospedeiro diferente, a sua eficiência é, frequentemente, comprometido várias vezes. Contudo, quando o fago que sobreviveu e multiplica-se é usado para reinfectar um segundo hospedeiro, eles agora crescem normalmente. O pobre crescimento inicial é causado pela acção sobre o DNA do fago numa sequência específica da endonuclease bacteriana (conhecida como endonuclease de restrição porque restrita o crescimento do fago). Seguido da clivagem inicial, o DNA do fago é rapidamente degradado a nucleótidos por acção da exonuclease, embora algumas regiões possam ser resgatadas pela recombinação. O DNA do hospedeiro não é degradado porque a sequência de nucleótidos que é reconhecida pelas enzimas de restrição foi modificada (geralmente por metilação). As poucas moléculas do DNA do fago que sobrevivem à infecção inicial é devido a estas modificarem-se pela metilase do hospedeiro antes da enzima de restrição actuar. Esta metilação do DNA dos descendentes torna-os resistentes a uma segunda infecção. Um processo inverso é a degradação da citosina no DNA na E.coli infectada com T dos bacteriófagos em que o seu próprio DNA contém hidroximetilocitosina. Os cromossomas de E.coli codificam a endonuclease de restrição do tipo I, conhecida por Eco B (na E.coli na estirpe B). outras enzimas de restrição são codificadas por 11

12 plasmídeos e são na maioria enzimas do tipo II, mas alguns fagos e plasmídeos codificam enzimas do tipo III que são conhecidas por intermediarias em propriedades entre as enzimas do tipo I e do tipo II. Enzimas do tipo I e do tipo II catalisam ambas endonucleotídeos. Enzimas do tipo I São proteínas complexas multifuncionais que clivam DNA mão modificado na presença de S-adenosil-l.metionina (AdoMet), ATP e Mg 2+. São multisubunidades de enzimas, que, são, também DNA metilases e ATPases. As subunidades estão presentes em diferentes proporções nas enzimas EcoB e na EcoK. Elas são codificadas por três genes contíguos conhecidos como hsdm (modificação) e hsds (espicificidade). As três subunidades são, respectivamente, responsáveis pela acção das nucleases, pela metilação e pela especificidade da sequência da enzima. Os locais de reconhecimento para as enzimas de restrição EcoK e EcoB do tipo I são mostrados na imagem. As adeninas com um asterisco na sequência EcoB é metilada pela enzima EcoB e as adeninas correspondentes á sequência EcoK são os locais da metilação pela metilase de restrição EcoK. As sequências de reconhecimento consistem num grupo de três bases e num grupo de quatro bases separadas por seis (EcoK) ou oito (EcoB) bases inespecíficas. Sistemas de modificação-restrição Metilase e nuclease No fim de 1960, o cientista Stewart Linn e Werner Arber isolaram amostras de dois tipos de enzimas responsáveis pelo crescimento restrito de fagos na Escherichia coli. Uma destas enzimas metilaram DNA, enquanto que a outra cortou DNA não metilado uma grande variedade de locais ao longo do comprimento da molécula. O primeiro tipo de enzimas foram chamadas de metilases enquanto as outras são chamadas de nucleases de restrição. Estas ferramentas enzimáticas eram importantes para os cientistas que estavam a reunir as ferramentas necessárias para cortar e colar moléculas de DNA. 12

13 O que era necessário agora era uma ferramenta que cortaria o DNA em locais específicos, em vez de locais ao acaso ao longo do comprimento da molécula, para que os cientistas podessem cortar DNA numa forma previsível e reprodutível. Breve história: o Década de 50 descoberta de um sistema imunitário primitivo em bactérias algumas estirpes de E.coli eram resistentes à infecçao por vários bacteriófagos. o Década de 60 descoberta de um sistema enzimático bacteriano que reconhecia e destruía selectivamente DNA estranho, enquanto que modificava o DNA endógeno, prevenindo a sua destruição. Extractos bacterianos capazes de clivar DNA fágico devido à presença de nucleases as quais eram capazes de reconhecer e cortar DNA. Endonucleases cortam DNA em posições internas Exonucleases cortam DNA externamente Para além da actividade nuclease, algumas enzimas apresentavam a capacidade de modificar o DNA por metilação de nucleótidos dentro da sequência por elas reconhecida: Modificação do DNA Metilação 13

14 Exemplos de metilação Metilações mais frequentes M6 A-N6-metiladenina M5 C-C5-metilcitosina M4 C-C4-metilcitosina Hm5 C-C5-hidroximetilcitosina O DNA metilado pode ser passado à descendência. O X está protegido, ou seja, o seu DNA está protegido pelo sistema de metilação. As bactérias que se protegem os fagos pela metilação. Os sistemas de modificação-restrição são e metilação são específicos para cada estirpe. O sistema de modificação-restrição e metilação têm que reconhecer uma sequência da estirpe em locais específicos. Se ocorrer um erro na metilação, o próprio fago pode ser metilado e fica protegido. Tipos de Sistemas de restrição metilação com base na composição das subunidades, tipo de clivagem, tipo de especificidade, necessidade de co factores Tipo I são enzimas complexas, multiméricas, combinando as duas actividades de restrição e modificação, e cortam o DNA em locais aleatórios e distantes do local de reconhecimento. Consomem ATP na reacção da hidrólise. Não têm aplicação prática no laboratório. Tipo II cortam o DNA dentro ou próximo da sequência de reconhecimento, produzem fragmentos de DNA discretos, que formam padrões de bandas característicos, e são as únicas usadas no laboratório para análise de DNA e clonagem. Não necessitam de ATP para a hidrólise, apenas Mg ++. Tipo III são também enzimas com actividade de restrição e modificação. Cortam fora da sequência de reconhecimento e necessitam de duas dessas sequência em 14

15 orientações opostas, numa mesma molécula de DNA, para executar a clivagem. Raramente produzem digestões completas, e também consomem ATP. Características das enzimas dos Sistemas de Modificação-Restrição de tipo I, II, III Enzimas de tipo I ligam-se à sequencia alvo, metilando-a, ou clivando o DNA, consoante o estado de metilação deste Tipo I Para clonagem de sequências de DNA desconhecido na E.coli, a mais importante é o sistema tipo I, codificado por hsdr, hsdm e hsds, o sistema de restrição EcoK. Os produtos dos três genes formam uma enzima multimérica capaz de clivar ou metilar um sequência alvo particular (5 -AAC[N6]GTGC-3 na E.coli estirpe K-12). O sistema de restrição EcoK do tipo I é codificado pelos genes hsdsmr. (hsd significa especificidade para o DNA hospedeiro). O gene hsds produz a subunidade de especificidade que reconhece a sequência de DNA: 15

16 Se a sequência alvo é hemimetilada (apenas uma cadeia é metilada e ocorre durante a replicação do DNA no cromossoma do hospedeiro), então a enzima actua como metilase e protege a sequência da clivagem. Se a sequência não é metilada em nenhuma cadeia, então a enzima actua como uma endonuclease de restrição e corta a sequência alvo. Normalmente, o DNA de outro organismo não será metilado na sua sequência alvo e será degradada quando introduzida na cadeia os tipos dos três genes. O sistema de restrição EcoK codifica proteínas que degradam DNA estranho que não é, propriamente, metilado na sequência 5 -AAC-(N)5-GTGC-3 que irá ocorrer no DNA clonado. Quais são os efeitos do sistema de modificação-restrição do DNA bacteriano na clonagem e manipulação do DNA da E.coli? O gene hsdr é necessário apenas para a clivagem da sequência alvo pela endonuclease. Os genes hsdm e hsds são necessários e suficientes para a metilação da sequência alvo. As estirpes de E.coli que são mutadas pelo gene hsdr são denominadas de minus restrição, modificação mais fenótipo (r -, m + ). Genótipos e fenótipos de mutantes hsd no sistema EcoK A subunidade hsdm é indispensável à função de restrição por hsdr 16

17 O tipo II inclui as típicas enzimas de restrição utilizadas na biologia molecular. Sequências de reconhecimento das enzimas de restrição O segundo tipo do sistema modificação-restrição consiste das endonucleases que clivam, directamente, o DNA alvo que é metilado em certas sequências. Na E.coli existe dois tipos de sistema de restrição metil-citosina denominados de McrA e McrBC. Nenhum destes sistemas cliva DNA que foi metilado por enzimas do tipo I (codificadas pelos genes hsdrms), sistemas Dcm ou Dam. Ambos os sistemas McrA e McrBC restringem DNA hemimetilado assim como DNA metilado nas duas cadeias. O DNA que foi metilado pela metilase Sss (metila as citosinas do dinucleótido CG) e pela metilase Hpa II (metila a segunda citosina da sequência 5 -CCGG-3 ) são restringidas pelo sistema McrA (4,5). O segundo tipo de sistema de modificação é o complexo mcra/mcrb/mrr que degrada o DNA estranho e que não é propriamente metilado, como o DNA metilado obtido de células do rato ou humanas que contêm CpG DNA metilado. 17

18 Quais os efeitos do sistema modificação-restrição do DNA bacteriano na clonagem e manipulação do DNA na E.coli? O DNA de mamíferos tende a metilar as citosinas nas sequências CG e DNA de plantas nas citosinas das sequências CNG. É recomendado em estirpes que são mutadas por esses sistemas (mcra/mcrb/mrr) para aumentar a recuperação do DNA genómico propagado na E.coli durante as experiências de clonagem. E.coli K12 (MG1655) sistemas de restrição Segundo a informação do Ecocyc e Escherichia coli e Salmonella, o seguinte sistema de restrição é encontrado na E.coli K12. Contém enzimas de restrição EcoK do tipo I codificadas pelo hsdr que cliva na sequência AAC(N 6 )GTCG, se o segundo A é não metilado. Contém também o sistema Mcr. Este sistema de restrição não parece ter uma sequência, apenas corta nos resíduos metilados. O sistema mrr, também contido nesta bactéria, que cliva resíduos de m6a e m5c. a sequência de especificidade é desconhecida. A presença do gene hsdr no MG1655 pode explicar porque é que plasmídeos (exemplo psb4a3 e pch1497-asd1) que contêm sequência de reconhecimento para a função da EcoK incerta na MG1655. Pelo contraste, constrói o que não contém a sequência para a função da EcoK na MG1655. Metilação do DNA A maioria das estirpes de E.coli contém duas enzimas que metilam o DNA: 1. dam metiltransferase (DNA Adenina Metilase) Responsável por mais de 90% da metilação do DNA; Introduz grupos metilo na posição N 6 da adenina na sequência 5 GATC 3 As estirpes bacterianas mutantes nesta enzima designam-se por dam - 18

19 2. dcm metiltransferase (DNA Citosina Metilase) Introduz grupos metilo na posição C5 da citosina mais interna da sequência 5 CCAGG 3 ; As estirpes bacterianas mutantes nesta enzima designam-se por dcm - As estirpes bacterianas mais correntemente usadas em Biologia molecular são geralmente dam - e dcm -, em simultâneo, de modo a garantir que o DNA clonado não seja metilado e possa ser processado pela maioria das enzimas de restrição disponíveis. Ao pegar num plasmídeo e coloca-lo numa bactéria Rk - Mk -. Purifica-o e coloca-o numa estirpe Rk + o plasmídeo propaga-se? Sim, o plasmídeo propaga-se porque está protegido pois foi metilado pela bactéria. Sequências de reconhecimento sobrepostas total ou parcialmente às sequências de metiltransferases são um indicador de que bases metiladas podem impedir a acção das enzimas de restrição. 19

20 Quadro resumo: Marcadores moleculares Os marcadores específicos serve para estudar as variações a nível das populações, espécie, ou seja, estudar os polimorfismos (variações fisiológicas). Usando polimorfismos visíveis Vantagens Pouco dispendioso para contar Passíveis de experimentar nas populações naturais Desvantagens Polimorfismos visíveis raros Maioria das variações genéticas difíceis de visualizar Base da variação genética pode ser complexa e não é necessariamente fácil de determinar Espécies secretas Porque é que nos preocupamos com as variações? Estudamos as variações para estudar: As diferenças fenótipicas subjacentes; O que causa doenças hereditárias; Para permitir o historial humano (antigo e moderno) 20

21 Polimorfismos bioquímicos Marcadores bioquímicos Proteínas aloenzimas Variâncias electroforéticas das proteínas produzidas por diferentes alelos dos genes codificantes de proteínas. Método: 1. Homogenizar o tecido; 2. Separar o extracto por electroforese num gel de amido. Coloca-se o gel numa solução com reagentes que necessitam de actividade enzimática da enzima que estamos a monitorizar. 3. Mancha-se o gel com um corante que a enzima pode catalisar num reagente com cor que mancha a proteína. Usando polimorfismos proteicos Vantagens Pouco dispendioso Marcadores são co-dominantes (marcadores co-dominantes analisa um locus Desvantagens Apenas revela uma pequena proporção da variação de DNA Muitas variâncias de DNA não resultam em mudanças na sequência de aminoácidos (e.x. substituições sinónimas) Algumas mudanças na sequência de aminoácidos não resultam em mudanças na mobilidade no gel. Polimorfismos moleculares Marcadores moleculares Marcadores moleculares são baseados em polimorfismos que ocorrem naturalmente na sequência de DNA (e.x. delecções de par de bases, substituições, inversões, adições e repetições). Existe vários métodos para detectar e amplificar estes polimorfismos: RFLP RAPD AFLP Existe cinco condições que caracterizam um marcador molecular adequado: Tem que ser polimórfico; De preferência co-dominante; Distribuído pelo genoma frequentemente e aleatoriamente; 21

22 Fácil e barato de detectar; Reprodutível Um primer amplificando um marcador dominante pode amplificar vários loci na mesma amostra de DNA com uma única reacção de PCR. Um marcador co-dominante analisa um apenas um locus. Um primer que amplifica um marcador co-dominante produziria o produto pretendido. Os marcadores moleculares podem ser utilizados em diferentes aplicações: Caracterização do germplasma (colecção de recursos genéticos de um organismo); Diagnóstico genético (doenças, etc.); Caracterização de transformantes (e.x. análise e detecção GMO); Estudos de paternidade e forenses; Estudos do presente e do passado sobre a distribuição e ecologia das populações; Genética da população e fluxo de genes; Estudo do genoma; Delimitação de espécies e análise filogénica. Técnicas usadas para a análise de marcadores moleculares As técnicas utilizadas para a análise de marcadores moleculares são: Digestão por enzimas de restrição; Electroforese; PCR; Por vezes a combinação de todas (RFLP-PCR) Técnicas de marcadores moleculares Restriction fragment length polymorphism (RFLP) Esta técnica envolve a digestão do DNA genómico por enzimas de restrição. As enzimas de restrição são isoladas de bactérias e consistem em cortar o DNA em locais específicos na sequência de par de bases, em que são denominados de locais de restrição. Os locais de restrição não estão associados a nenhum tipo de gene e encontram-se distribuídos aleatoriamente pelo genoma. Quando o DNA genómico é digerido por uma ou mais enzimas de restrição, uma série de fragmentos são produzidos em vários comprimentos. Os fragmentos são separados por electroforese em gel de agarose ou em gel de poliacrilamida (PAGE) produzem certas características. As variações das características da digestão de RFLP pode ser causados por: o Delecções de par de bases; o Substituições; 22

23 o Inversões; o Translocações e transposições Os resultados são perda ou ganho de locais de reconhecimento, resultando num fragmento de diferente tamanho e polimorfismo. Os locais de restrição são, muitas vezes, palindrómicos Usando RFPL polimorfismos Vantagens Variantes são co-dominantes Variações das medidas ao nível da sequência de DNA, não na sequência da proteína Desvantagens Trabalho intensivo Requere grandes quantidades de DNA PCR baseado nos marcadores moleculares Randomly amplified polymorphormic DNA markers (RAPD) RAPD foram os primeiros PCR baseados em marcadores moleculares desenvolvidos e os mais simples; Pequenos primers de PCR (aproximadamente de 10 bases) são aleatoriamente e arbitrariamente seleccionados para amplificarem segmentos de DNA do genoma; Os produtos da amplificação são criados na região que flanqueia os locais dos 10 bp na orientação apropriada; RADP, muitas vezes mostram relações dominantes devido ao primer ser incapaz de ligar-se a alelos recessivos; Os produtos de RAPD são, normalmente, visualizados em gel de agarose corado com brometo de etídio, SYBR Safe, Gel Red ou outros corantes de DNA. 23

24 Vantagens Rápido Pouco dispendioso Grande variedade Desvantagens Marcadores são dominantes Presença de uma banda pode significar que o indivíduo é ou heterozigótico ou homozigótico para a sequência Análise da informação mais complicada Simple sequence repeats / microssatélites São repetições de pequenas sequências do genoma de todos os eucariontes e consiste em várias a centenas de repetições de 1 a 4 motivos nucleóticos. Amplified fragment lenght polymorphism (AFLP) AFLP é um método altamente sensível baseado na combinação dos conceitos RFLP e RAPD; Esta técnica é aplicada a todas as espécies, dando resultados reprodutíveis; A base do AFLP é o amplificação por PCR com corte dos fragmentos do DNA genómico com enzimas de restrição. Fragmentos restritos produzidos por um cortar frequente (MseI) e um cortador raro (EcoRI). Os adaptadores consistem na sequência núcleo mais enzimas específicas para a sequência. A sequencia núcleo é um segmento de DNA conhecida (20 nucleótidos) que vai ser utilizado como primer no próximo PCR. Adaptadores usados como primers. Para uma primeira selecção dos fragmentos apenas amplificamos DNA que tenha um adaptador ligado em ambas as extremidades. Em adição, os primers têm uma base adicional permitindo a amplificação de um quarto com o adaptador em ambas as extremidades. 24

25 Três mais nucleótidos são adicionados ao primer da amplificação anterior. A amplificação é mais selectiva e os fragmentos restritos diminuem. Um dos primers é marcado com fluorescentes para futura visualização. Electroforese Um capilar fino contendo um polímero substitui o usual gel de acrilamida. As condições da electroforese podem ser resolver a diferenciação de fragmentos de DNA apenas com um par de bases. As amostras são carregadas numa faixa e correm uma atrás das outras através do capilar. Todos os fragmentos são separados pelo tamanho. Depois de passarem o laser, um corante liga-se ao primer, que excita e emite um sinal fluorescente que é recolhido por computador. O resulta da fluorescência é visualizado no computador. Vantagens Rápido Barato Grande variedade Desvantagens Marcador é dominante A presença de uma banda significa que o individuo ou é heterozigótico ou homozigótico para a sequência Variable number tandem repeats (VNTR) Regiões não codificantes; Várias cópias da mesma sequência; Grande quantidade de variações entre indivíduos no número de cópias; Usado para DNA fingerprinting; Microssatélites, minissatélites, short tandem repeats (STR), simple sequence repeats (SSR); ISSR inter-simple sequence repeats O desenho de primers para flanquear a região é necessário. 25

26 Microssatélites VNTRs mais útil; 2, 3 ou 4 par de bases repetidas; De algumas a 100 cópias tandem; Grande variedade; Vários microssatélites loci (1000s) diferentes em várias espécies. Vantagens Grande variedade Grande evolução Co-dominante Desvantagens Relativamente dispendioso e com consumo de tempo para desenvolver Usado em estudos de populações; Não muito entre estudos entre populações que evoluem muito; Análise de paternidade ou outros estudos de parentesco Single nucleotide polymorphisms -SNP Variação da sequência de DNA ocorre quando um único nucleótido, no genoma (ou outra sequência partilhada) difere entre membros da espécie ou emparelhados; Exemplo: duas sequências de fragmentos de DNA de diferentes individuos. AAGCCTA para AAGCTTA, contém a diferença num único nucleótico. Neste caso são dois alelos : C e T. Quase todos os SNPs têm apenas dois alelos. Conceitos chaves de SNP Definição mais do que uma base alternativa ocorre numa frequência apreciável; Disponibilidade - mais de 10 milhões de SNPs têm sido identificados no genoma humano; Função maioria dos SNPs são neutros e menos de 1% presente em regiões codificantes de proteínas. Os SNP são os: O polimorfismo genético mais comum Distribuído pelo genoma com grande densidade Grande causa da diversidade genética entre diferentes indivíduos, como por exemplo, resposta a drogas, susceptibilidade a doenças. Facilita uma grande escala genética associado a estudos como marcadores genéticos. Maioria dos SNPs não alteram a síntese proteica nem causam doenças directamente. Servem como marcadores, uma vez que podem ser fisicamente 26

27 semelhantes ao local da mutação no cromossoma. Por causa desta proximidade, os SNPs podem ser partilhados entre grupos de pessoas com características comuns. Analisando o padrão de SNP entre diferentes grupos de pessoas podem esclarecer a evolução da raça humana e compreender grupos étnicos e raças. Locais SNP SNPs ligado ou isnps não residem entre genes e não afectam o funcionamento da proteína. Contudo, eles correspondem a uma resposta a uma droga particular ou ao risco de apanhar uma certa doença. SNPs causativos afecta a forma como uma proteína funciona, correlacionando a doenças ou influenciando a resposta de uma pessoa à medicação. SNPs causativos acontecem em duas formas: o Coding SNPs ou csnps localizados entre regiões codificantes de um gene, alterando a sequência de aminoácidos do produto do gene da proteína. o Non-coding SNPs or rsnps, localizados entre a sequencia regulatória do gene, alterando o nível da expressão genica e, portanto, quanto RNA e proteína é produzida. puc19 um plasmídeo de engenharia genética 2,7KB (pequeno tamanho permite grande espaço para inserir DNA) DNA não genómico circular o DNA do fago lambda é linear e muito maior (48,5kb) Tem uma origem de replicação e um grande número de cópias (200/célula) Gene resistente à ampicilina o Codifica uma enzima que liga e degrada a ampicilina Gene Lac Z (parte do operão Lac) o Codifica a β-galactosidase o Uma enzima que degrada a lactose em glucose e galactose 27

28 o Local múltiplo de clonagem dentro do LacZ Contém sequências de reconhecimento para várias enzimas de restrição A ruptura deste local previne a produção de β-galactosidase Digestão restrita do plasmídeo puc19 e fago lambda (λ) Usa a enzima de restrição Hind III para cortar tanto o plasmídeo puc19 e o fago lambda. A sequência de restrição para o Hind III é A.AGCTT. esta sequência específica ocorre uma vez no puc19 e sete vezes no fago lambda. Um local do puc19 cria uma porção de DNA linear quando cortada. Sete locais do lambda origina oito fragmentos quando cortado. Os fragmentos de DNA serão separados e analisados em gel de agarose. Enzimas de restrição Na base das experiências clássicas de Berg e de Boyer-Cohen-Chang estão as enzimas de restrição. Os cientistas logo se aperceberam que as enzimas de restrição podiam constituir uma ferramenta notável para investigar a organização, função e expressão génicas. As enzimas de restrição clivam o DNA em locais específicos: 1. Produzindo fragmentos de tamanho discreto que podem ser analisados por electroforese. 2. Constituindo um auxiliar precioso na clonagem de DNA e permitindo a manipulação de fragmentos de DNA relativamente pequenos 28

29 As enzimas de restrição (ou endonucleases de restrição) foram descobertas em 1970 durante investigações sobre o fenómeno de modificação e restrição de bacteriófagos pelo hospedeiro. A restrição à infecção resulta da acção de enzimas de restrição em combinação com DNA-metiltransferases. Estas metilam o DNA bacteriano próprio, tornando-o por sua vez resistente à acção das endonucleases, que assim actuam unicamente sobre o DNA viral. Endonuclease + metilase: sistema que protege o DNA do hospedeiro e digere o DNA viral Nomenclatura das enzimas de restrição Mais de 250 enzimas de restrição com diferentes especificidades de sequência foram já caracterizadas. A maioria reconhece sequências simétricas, palindrómicas (porque se ligam ao DNA como homodímeros), e portanto que se lêem de igual modo em ambas as cadeias. Taq I Microrganismo: Thermusaquaticus A sequência de reconhecimento é simétrica (palindrómica), composta por 4 pares de bases. A enzima produz extremidades coesivas (em cadeia simples), de 2 bases, 5 - protuberantes. As duas extremidades deixadas pelo corte da enzima são iguais? Palindrómica molécula de DNA que dá para ler igualmente nos dois sentidos. Tem simetria 29

30 Hha I Microrganismo: Haemophilushaemolyticus A enzima produz extremidades coesivas 3 - protuberantes. Sma I Microrganismo: Serratiamarcescens A sequência de reconhecimento é composta por 6 pares de bases. A enzima produz extremidades não coesivas (em cadeia dupla). BbvCI Microrganismo: Bacillusbrevis A enzima tem uma sequência de reconhecimento assimétrica (não palindrómica). A forma activa da enzima é um heterodímero. DdeI Microrganismo: Desulfovibrio desulfuricans N pode ser qualquer base. Esta enzima reconhece em cada uma das cadeias qualquer das 4 sequências CTAAG, CTTAG, CTGAG, CTCAG (contudo, estas representam apenas 2 locais de ligação diferentes). MboII Microrganismo: Moraxellabovis A sequência de reconhecimento é contínua e assimétrica. A enzima corta o DNA fora da sequência de reconhecimento. Possui dois domínios, um de ligação ao DNA, outro de clivagem. Extremidade coesiva de uma base (N-3 ). SfiI Microrganismo: Streptomycesfimbriatus A sequência de reconhecimento é descontínua. As metades da sequência de reconhecimento encontram-se separadas por 5 bases. 30

31 NotI Microrganismo: Nocardia otitidiscaviarum A enzima tem uma sequência de reconhecimento de 8 pares de bases, e corta o DNA, em média, muito raramente. Extremidades coesivas de 4 bases. Isoesquizómeros são a mesma sequência de reconhecimento e mesmo local de corte. Por ex. EcoRIe FunII Neoesquizómeros são um subconjunto dos isoesquizómeros: a mesma sequência de reconhecimento mas local de corte diferente. Por ex. SacIe Ecl136II Nos neoesquizómeros, a mesma sequência de reconhecimento mas local de corte diferente. Por ex. ApaI e Bsp120I As enzimas Bsp120I, EaeI e EagI têm sequências de reconhecimento diferentes da de NotI, e diferentes entre si, mas originam extremidades compatíveis(y=py=pirimidina; R=Pu=purina) 31

32 Nomenclatura para bases específicas incompletas nos ácidos nucleicos Sequences Nomenclature Committee of the International Union of Biochemistry (NC-IUB), 1984 A sequência de reconhecimento das enzimas de restrição representa-se normalmente em cadeia simples A sequência de reconhecimento da HindIII é 5 -aagctt e portanto não corta na sequência representada abaixo. A frequência de corte das enzimas de restrição depende essencialmente do número de bases da sequência de reconhecimento, mas é desviado fortemente pela composição de bases do DNA e da presença de bases metiladas 4 bp-> 256 bp em média (4 4 ) 6 bp-> 4096 bp em média (4 6 ) 8 bp-> bp em média (4 8 ) Afectado por: Composição de bases do DNA Presença de bases metiladas 32

33 Star activity Star activity é quando algumas enzimas apresentam relaxamento de especificidade sob certas condições experimentais in vitro. Por ex. BamHI, em condições de baixa força iónica, reconhece e cliva, para além de G/GATCC: o N/GATCC o G/RATCC o G/GNTCC Condições que contribuem para a actividade star de algumas enzimas de restrição Concentração elevada de glicerol [>5% v/v] Proporção Enzima/DNA elevada [Variável para diferentes enzimas, normalmente >100 U/μg] Força iónica baixa [<25 mm] ph alto [>ph 8.0] Presença de solventes orgânico s[dmso, etanol, etilenoglicol, dimetilacetamida, dimetilformamida] Substituição de Mg ++ por outros catiões divalentes [Mn ++, Cu ++, Co ++, Zn ++ ] Subtipos de enzimas de restrição de tipo II SalI e SacI originam extremidades compatíveis? SacI: GAGCTC SalI: GTCGAC BamHI, PsuIe BglII têm extremidades compatíveis? Depois de ligar dois fragmentos de DNA, um cortado com BamHI, o outro com PsuI, pode-se voltar a cortar com BamHI? Depois de ligar dois fragmentos de DNA, um cortado com BamHI, o outro com BglII, pode-se voltar a cortar com BamHI? E com BglII? 33

34 Exemplo de um mapa de restrição Frequentemente as enzimas de restrição não são eficientes na reacção de hidrólise quando a sequência de reconhecimento se encontra demasiado perto da extremidade da molécula A DNA ligase cataliza a formação de ligações fosfodiéster entre grupos terminais 5 - fosfato e 3 -hidroxilo justapostos, em moléculas de DNA em cadeia dupla, com extremidades coesivas ou não. Não tem actividade sobre ácidos nucleicos de cadeia simples. 34

35 Reacção catalisada pela DNA ligase: ATP + (desoxirribonucleótido) n + (desoxirribonucleótido) m = AMP + PP i + (desoxirribonucleótido) n+m Ligação A ligação é a junção de fragmentos de DNA no vector molecular, como um plasmídeo ou um bacteriófago, que pode ser replicado pela célula hospedeira depois da transformação. A junção ou ligação dos fragmentos de DNA é realizado por uma enzima conhecida como DNA ligase. O papel natural da DNA ligase é reparar espaços numa cadeia no ligação açúcar fosfato de uma cadeia dupla de DNA, tal como ocorre através de danos no ADN. A actividade catalítica da enzima necessita da presença de ATP e Mg ++. DNAs em que falta os resíduos de fosfato, podem ser capazes da ligação por fosforilação da cinase polinucleótica T4. A enzima, também, cataliza uma reacção adicional de fosfato entre a pirofosfato e ATP. 1. Ligação do DNA, por complementariedade, a terminações coesivas 35

36 2. Reacção de reparação A acção de ligação necessita que o espaço (nick) exponha o grupo 3 OH e 5 -fosfato. A digestão com endonucleases de restrição corta o DNA dessa forma, por exemplo, deixa o fosfato na posição 5 da desoxirribose. O emparelhamento instável dos dois fragmentos de restrição com extremidades compatíveis podem, portanto, ser consideradas como moléculas de DNA de cadeia dupla com espaços em cada cadeias e, por isso, um substrato para a acção da DNA ligase. A T4 DNA Ligase pode ligar extremidades blunt mas com menor eficiência. Algumas DNA ligases, como a T4 DNA ligase (codificada pelo bacteriófago T4), é, também, capaz de ligar extremidades blunt, embora com menos eficiência, enquanto outras (a E.coli ligase) não são capazes. Apenas se considera a acção da T4 DNA ligase, que é, de longe, a mais extensível de se usar. Referimos-nos à enzima como T4 ligase (ou só ligase) embora é também T4 RNA ligase. A T4 ligase necessita de ATP como co-substrato. No primeiro passo, a ligase reage com o ATP para formar uma enzima covalente, o AMP complexo, que por sua vez reage com 5 -fosfato no local do espaço (nick), transferindo o AMP para o grupo fosfato. O ultimo passo é o ataque pelo grupo 3 OH, formando uma nova ligação fosfodiéster covalente (que restaura a integridade do açúcar-fosfato) e liberta o AMP. A absoluta exigência para o 5 -fosfato é extremamente importante; pela remoção do 5 -fosfato, consegue-se a prevenção da ocorrência de ligações indesejadas. 36

37 Exemplo de remoção do fosfato para impedir ligação (religação de vectores) Qual a enzima utilizada para remoção do fosfato? Desde a reacção, que se que quer, normalmente, envolver duas moléculas diferentes de DNA (ligação intermolecular), que se espera ser extremamente sensível para a concentração de DNA. Portanto, é importante usar altas concentrações de DNA, mas que componente de DNA? Temos dois componentes, o vector e o insert (ignorando por momento, o facto do insert pode ser, ele próprio, uma mistura de fragmentos). Existe, portanto, uma variedade de possibilidades de reacções que podem ocorrer, assim como, a concentração global de DNA, que se pode influenciar a probabilidade destas diferentes reacções. Qual a probabilidade de qualquer destes produtos de reacção ocorrer preferencialmente? Podemos influenciar o tipo de produto preferencialmente obtido manipulando a quantidade e a concentração do DNA? (que DNA?) A baixas concentrações de DNA, é mais provável ter a junção (por reacção intramolecular) de duas extremidades da mesma molécula, desde que a taxa da reacção que envolve uma reacção será linearmente relacionado com a concentração, assim como, a taxa com dois componentes diferentes, será proporcional ao produto das duas concentrações. (ou a reacção que envolve duas moléculas do mesmo substrato, a taxa será proporcional ao quadrado da concentração). Portanto, aumentando a concentração, será dado um maior aumento da taxa da reacção intermolecular (entre duas moléculas) do que numa reacção intramolecular. Se aumentar-mos a concentração do vector mas não do insert, teremos um maior aumento da ligação entre dois vectores (que não pretendemos) do que na produção 37

38 de vector-insert recombinante. Reciprocamente, aumentando a concentração do insert, teremos um aumento dos níveis de dímeros insert-insert (que, também, não pretendemos, apesar de serem de menor problema como não vão dar origem a transformados. Assim, não só precisamos de manter a concentração de DNA alta, mas também criar um óptima relação vector:insert. Não é fácil prever que relação deve ser, mas tipicamente será no intervalo de 3:1 a 1:3. De notar que são as relações molares e tem que se ter em conta o tamanho relativo do vector e do insert. Por exemplo, se o vector tem 5kb e o insert tem 500 bases, então uma relação molar de 1:1 envolveria 10 vezes mais vector, por peso, do que insert (e.x. 500ng de vector e 50 ng de insert). Reciprocamente, para o mesmo vector mas um vector com tamanho de 50kb, se usarmos 500ng de vector, precisaríamos de 5µg de insert para alcançar a relação molar de 1:1. No geral, para converter a quantidade de DNA por peso num valor que pode ser usado para calcular a relação molar, dividimos a quantidade usada (por peso) pelo tamanho do DNA. Assim, se W v e W t são os pesos usados para o vector e para o insert de DNA, respectivamente, e S v e S t para o tamanho do vector e do insert (e.x. em kilobases (kb)), então, a relação vector:insert é (W v /S v ):(W t /S t ). Exercício Qual a massa de vector e insert respectivamente com 5 kb e 500 bp, para obter uma ligação na proporção molecular de 1:1 (partindo de uma massa de 500 ng de vector)? Estimada a concentração do vector e do insert pelo gel de agarose ou por manuseamento OD. Testa-se várias relações vector:insert para descobrir a melhor relação. Na maioria dos casos, as melhores relações são de 1:1 ou 1:3. Formula: ((ng vector) X (tamanho do insert em kb)) / ((tamanho do vector em kb) X (relação molar do vector:insert) = (ng do insert) Exemplo: 500bp de insert vão ser ligados com 100ng de um vector com 3,0kb numa relação de 3:1 ((100ng vector) X (0,5kb de insert) / (3,0 kb de vector) X (3/1)) = (50ng insert) 38

39 Algumas reacções de ligação possíveis Recombinante Sem insert Fragmentos Sem ligação Clonagem de fragmentos de DNA 1. Extremidades protuberantes Compromisso - usar concentrações equimolares de plasmídeo e de insert na reacção de ligação. Não respeitando esta relação: Maior quantidade de plasmídeo religados; Maior quantidade de insert maior quantidade de plasmídeos contendo repetições do insert (insert em tandem) Verificar que resultados foram obtidos: Análise do DNA recombinante com enzimas de restrição; Sequenciação do DNA recombinante PCR Necessidade de verificar a orientação do insert inserido Uma equação para calcular as relações volumétricas necessárias na reacção de ligação A reacção de ligação é fundamente importante para a Biologia Molecular, activando a junção do vector e dos fragmentos do insert de DNA para criar um novo plasmídeo de moléculas de DNA. É importante obter a relação correcta de vector:insert para uma óptimo geração de plasmídeos recombinantes e para reduzir a formação de ligações entre fragmentos, vectores religados, dímeros de plasmídeos e plasmídeos contendo múltiplos inserts. A ligação de reacção é, normalmente, realizada num volume total de 10-20µL a 4-37ºC (muitas vezes em temperatura ambiente) usando a enzima T4 DNA ligase, e um tampão que contém Mg 2+ e ATP ( tipicamente de uma concentração stock 10 vezes maior com a que vamos trabalhar). A T4 DNA ligase cataliza a junção de terminações de DNA adjacentes por formação de ligações fosfodiéster usando ATP como cofactor e consegue ligar extremidades blunt ou coesivas compatíveis. Numa óptima reacção de ligação, o objectivo é inserir um único insert num vector, e as concentrações de 39

40 insert e vector que devemos utilizar que desfavorecem a formação de um anel monomolecular ou concamerico. Existentes equações de ligação apenas permite calcular uma relação molar vector:insert. Como o tamanho da molécula de DNA é directamente proporcional ao seu peso molecular, como equações que não oferecem nenhuma desvantagem sobre a simples determinação da relação do tamanho dos fragmentos. As equações descritas permite calcular facilmente o volume dos componentes dados na concentração do DNA e no tamanho dos fragmentos, tal como a relação molar vector:insert dada é alcançada e a reacção consiste nas soluções de DNA ligase, tampão, insert e vector DNA se forem necessárias. Na relação óptima, teórica, insert:vector que se deve-se ter em conta da relação da concentração em toda a reacção (i) com a concentração de uma extremidade de uma molécula de DNA num volume ocupado por outra extremidade da mesma molécula (j). o valor de j é inversamente proporcional ao tamanho do fragmento de DNA e independente da concentração do DNA, então, só será fixada para uma ligação dada. As variáveis são o total da concentração de DNA e a relação inser:vector. Para extremidades coesivas recomenda-se que j:i seja entre 1:1 e 1:3 (20-60ng/µL para clonar um vector do tamanho do puc18) e a relação insert:vector seja 2:1 para o máximo rendimento de recombinantes úteis. Exemplo: Quanto insert de DNA 0,5kb deve ser adicionado para uma ligação em que 100ng de 3kb de vector deve ser usado? A relação vector:insert desejada será 1:3 Ligações de DNA podem ser frustantes A ligação de reacção tem dois passos básicos: 1. Primeiro as extremidades de DNA têm de colidir por acaso e estarem juntas tempo suficiente para que a ligase as ligue. Este é a parte mais ineficiente da reacção. 2. O segundo passo é a reacção enzimática, onde a DNA ligase cataliza a ligação de 3 OH com 5 -fosfato. Primeiro, os nucleótidos da AMP, que estão ligados aos resíduos de lisina na zona activa da enzima, são transferidos para o 5 -fosfato. 40

41 Depois, a ligação AMP-fosfato é ligado pela 3 OH, formando uma ligação covalente e libertando AMP. DNA ligase A ligação ocorre entre extremidades blunt ou extremidades pegajosas (sticky). As ligações das extremidades blunt não são eficientes. A ligase espera por um encontro. As ligações das extremidades blunt são, usualmente, feitas a altas concentrações. A ligação das extremidades sticky é mais eficiente. Pontes de hidrogénio forma um estado estável. Adicionando extremidades sticky (linkers) Linkers são fragmentos de DNA pequenos de cadeia dupla e com extremidades blunt. Contém local de restrição de extremidades sticky. Linkers são, facilmente, adicionados no fim de uma extremidade blunt da molécula porque conseguem adicionar grandes quantidades. Clivagem resulta em extremidades sticky na molécula. Potencial problema com os linkers Adição de uma cauda homopolímera 41

42 O terminal da enzima desoxinucleótidos transferase (ou terminal transferase) adiciona nucleótidos na extremidade 3 do DNA sem necessidade de um padrão. Desfosforilação Quando o DNA é tratado com a enzima alcalina fosfatase, os grupos 5 -fosfato são removidos. Se um vector linearlizado é desfosforilado, ele não consegue religar-se porque a enzima T4 DNA ligase necessita do grupo 5 - fosfato presente. O fragmento de DNA em que o grupo 5 -fosfato encontra-se presente consegue formar uma ponte entre a extremidade desfosforilada e a inserção é favorecida. 42

43 Quando se tenta combinar duas moléculas, o grupo 5 -fosfato retirado não permite religar-se e estraga a construção. O que temos no fim: existe dois grandes espaços (nick) no produto final, porque duas das quatro ligações são prevenidas pela falta de 5 fosfato. A bactéria irá fixar os espaços depois do DNA ser transformado. DNA circular fechado covalentemente e DNA supercoiled O DNA de cadeia dupla circular fechado covalentemente é mostrado esquematicamente. A não ser uma das duas cadeias de DNA que fica com espaços, a torção da cadeia da hélice dupla não pode relaxar e a tensão induz uma formação espontânea de uma estrutura super enrolada mostrada à direita. O espaçamento de outra cadeia de DNA, alivia a tensão permitindo a rotação na extremidade livre. Clonagem de vectores plasmídicos Clonagem É a inserção de DNA de interesse num vector de clonagem capaz de replicação independente, e da respectiva propagação em células hospedeiro. Há muitos tipos de vectores de clonagem mas os mais usados são os plasmídeos. Os plasmídeos mais usados são aqueles que se multiplicam em Escherichia coli Moléculas circulares de dsdna 1,2 3kbp (máx.20kbp) Capacidade de duplicação independente 43

44 Recombinação de plasmídeos 1. Plasmídeo e DNA a clonar são cortados com a(s) mesma(s )enzima(s) de restrição 2. Plasmídeo pode ser tratado com fosfatasealcalina que remove os grupos fosfato das extremidades 5 do DNA, gerando grupos hidroxilo, impedindo assim a religação das duas extremidades do plasmídeo na presença da ligase. 3. Incuba-se o DNA e o plasmídeo, na presença de ligase. Transformação É incubação de uma suspensão de E. coli competentes (células tratadas de modo a incorporarem mais facilmente DNA) com a reacção de ligação. Selecção de células transformadas com gene de resistência a um antibiótico 44

45 Características básicas dos plasmídeos Origem de replicação (ORI) permite a replicação do plasmídeo independentemente do DNA genómico. Local múltiplo de clonagem (MCS) permite a inserção do fragmento a clonar grande número de locais únicos de restrição. Marcador de selecção permite seleccionar os hospedeiros que incorporaram o DNA estranho (ex: gene que confere resistência a um antibiótico, como a ampicilina) O controlo do número de cópias de plasmídeo/célula é feito pela origem de replicação: 1 a mais de 100 cópias/célula. De um modo geral, os plasmídeos contêm uma só ORI, à qual estão associados elementos reguladores, que constituem uma unidade genética designada por Replicão. A maioria dos plasmídeos em uso possui um replicão derivado do pmb1 ou do ColE1, e que permite a manutenção de mais de 15 plasmídeos/célula plasmídeos de controlo relaxado (ou High-copyplasmids ) Plasmídeos de controlo restrito ou Low-copy plasmids 1 a 5 cópias/célula São menos utilizados na biologia molecular, mas são úteis quando a presença de um número elevado de plasmídeos ou dos seus produtos é deletéria para o hospedeiro. Marcadores de selecção São genes, localizados no plasmídeo, que codificam proteínas relacionadas com a selecção das células transformadas. O mais comum é a resistência a antibióticos quando as células são crescidas em meios de cultura, contendo um determinado antibiótico, apenas as que contêm o plasmídeo que confere resistência a esse antibiótico é que sobrevivem. 45

46 Os antibióticos não podem ser autoclavados. Habitualmente as soluções de antibióticos são esterilizadas por filtração (tamanho de poro 0,22 μm) e guardadas em alíquotas a -20 C. São adicionados aos meios de cultura a temperaturas inferiores a 65 C Antibióticos e genes resistentes a antibióticos Clonagem de fragmentos de DNA 1. Extremidades protuberantes São os mais fáceis de clonar, uma vez que as extremidades foram criadas pela mesma enzima de restrição, deixando 1 a 6 nucleótidos em cadeia simples, que emparelharão com outros existentes no outro fragmento de DNA a) Usando uma enzima de restrição O DNA alvo pode ser introduzido no plasmídeo numa determinada orientação ou na orientação oposta. As moléculas de DNA recombinantes formadas correspondem a inúmeros produtos formados durante a reacção de ligação, entre os quais: plasmídeo vazio, produtos lineares ou circulares de plasmídeo/insert; plasmídeo/plasmídeo; insert/insert; plasmídeo/insert/insert; entre outros... Nos plasmídeos recombinantes o local de restrição usado deixa de ser único. 46

47 Compromisso usar concentrações equimolares de plasmídeo e de insert na reacção de ligação. Não respeitando esta relação: maior quantidade de plasmídeo Maior quantidade de plasmídeos religados maior quantidade de insert - maior quantidade de plasmídeos contendo repetições do insert (inser tem tandem). Verificar que resultados foram obtidos: Análise do DNA recombinante com enzimas de restrição Sequenciação do DNA recombinante PCR Necessário verificar a orientação do DNA inserido. b) Usando duas enzimas de restrição com extremidade incompatíveis (clonagem direccional) Permite aumentar o rendimento de moléculas recombinantes com inserção de um só fragmento Clonagem direccional usando enzimas de restrição com extremidades compatíveis Qualquer DNA alvo cortado com BamHI e com BglII pode entrar no plasmídeo em qualquer direcção, se este também tiver sido cortado com ambas as enzimas. Contudo, se uma das enzimas de restrição for incluída na reacção de ligação (ou se a enzima for usada para digerir o plasmideo recombinante antes da transformação) só as ligações BamHI/BglII (e vice-versa) darão origem a produtos recombinantes em E. coli 47

48 Extremidades 3 -A protuberantes de produtos de PCR obtidos com Taq DNA polimerase (TA cloning) A Taq DNA polimerase adiciona extremidades protuberantes 3 -A a cada extremidade dos produtos formados. Estes podem ser usados para inserirem vectores TA os quais possuem extremidades protuberantes 3 -T 2. Extremidades em cadeia dupla (blunt-end cloning) Comparativamente às anteriores é bastante menos eficiente. Se razão molar plasmídeo/dna alvo muito alta >> plasmídeos vazios Se plasmídeo/dna alvo >> muito baixa >> homo- e heteropolímeros de composição e orientação várias. (A orientação e número de inserts em cada plasmideo recombinante têm sempre que ser validados por análise de restrição ou por qualquer outro processo) Melhores resultados podem ser obtidos com quantidades equimolares de plasmídeo e de DNA alvo, com concentração total de DNA < 100μg/ml O pbr322 foi o primeiro plasmídeo a ser largamente usado pela comunidade científica: uma origem de replicação, um local de clonagem (BamHI), e dois genes de resistência a antibióticos. Permitiu identificar recombinantes por selecção negativa. 48

49 Os plasmídeos de clonagem puc constituíram um novo grande avanço nos métodos de clonagem. São derivados do pbr322 pela substituição do gene de resistência à tetraciclina por um segmento génico que codifica para parte da enzima beta-galactosidase. Podem ser usados em estirpes de E. coli que expressem a região carboxi-terminal da beta-galactosidase Regulação negativa do operão lac Indutores do operão lac, tais como o IPTG, inactivam a proteína repressora, resultando numa des-repressão transcricional do operão. A função enzimática da beta-galactosidase pode ser reconstituída a partir de dois fragmentos polipeptídicos artificiais. Estes fragmentos não são funcionais por si só. A reconstituição é conhecida por alfa-complementação. Este sistema de complementação tem sido usado para monitorizar a clonagem de fragmentos de DNA em plasmídeos que contêm locais de restrição na sequência codificante do segmento alfa (lac Z ). Estrutura de uma única sub-unidadeda beta-galactosidase evidenciando a região alfa N-terminal (azul) e a região ómega C- terminal (amarelo). A enzima funcional é um tetrâmero (à direita). 49

50 X-Gal (5-bromo-4-cloro-3-indolil-β-D-galactósido), um substrato cromogénico da β- galactosidase. Desenvolvimento de vectores plasmídicos Três fases do deseenvolvimento de plasmídeos vectores de clonagem 1. Na primeira fase, os vectores que se encontravam disponíveis em incluíam psc101, Co1E1 e pcr1, e todos eles sofriam com dos seguintes inconvenientes: i. Replicação pobre; ii. Realizavam uma selecção inadequada de marcadores; iii. Transportavam não mais que dois locais de restrição para a clonagem Esses inconvenientes forma tomados em conta no pbr313, mas era desnecessariamente grande, sendo metade do DNA não essencial. O tamanho foi reduzido, dando origem ao pbr322 (4,362kB; ambos pbr313 e pbr322 foram produzidos em 1977), que se tornaram populares durante vários anos. 2. Na segunda fase, o tamanho do plasmídeo for grandemente reduzido, porque a eficiência da transformação é inversamente relacionado com o tamanho do vector, e, também, porque grandes plasmídeos replicam um menor número de cópias. Um número de derivados do pbr322 foram lançados, que incluía pa TI53, pxf3, pbr327, etc. Fizeram uso em resistência a antibióticos para a selecção de clones recombinantes. 3. A terceira fase do desenvolvimento de vectores incluía: i. Incorporação do fragmento de HindI do gene da β-galactosidase para permitir a selecção de colónias azuis/branas devido à α- complementação. (e.x. vectores puc); 50

51 ii. iii. iv. Incorporação de sequências de DNA de uma cadeia simples do fago M 13, para geração de modelos de DNA de cadeia simples para sequenciação. Incorporaçao do promotor de sequências de DNA para transcrição in vitro (e.x. vectores pgem); Incorporação de promotores de alta expressão para expressão de grandes quantidades de proteínas estranhas (e.x. variedade de vectores de expressão) Alfa- complementação Representação - puc8 Os plasmídeos da serie puc foram construídos por Jeffrey Vieira e Joachim Messing e sao derivadosdo pbr322. A região do gene de resistência a tetraciclina foi substituído por um segmento de um gene que codifica parte da enzima, dentro do qual foi inserida uma série de locais únicos de restrição (The multiple cloning site, MCS). A β- galactosidase é uma enzima tetramérica que contém quatro cadeias idênticas com uma sequência conhecida, cada uma com 1021 aminoácidos. Descobriu-se que um extracto de uma mutante de escherichia coli com delecção na região proximal (a região que codifica para a extremidade N-terminal da β- galactosidase) do gene lacz, produz β-galactosidase inactiva. Mas, extractos da espécie de Escherichia coli com pontos de mutação fora do segmento restauram a actividade. Um pequeno péptido LacZ a é codificado pelo plasmídeo enquanto o grande LacZ é codificado em trans pelo cromossoma bacterial. O processo de α-complementação é uma restauração da actividade que ocorre quando os extractos de mutantes do operador proximal 51

52 LacZ tal como laczm15 e laczm122 (aceptores) são misturados com extractos de mutantes de terminação LacZ (dadores) que têm uma região operador proximal intacta. Quando os fragmentos de DNA são inseridos no vector, a produção de LacZ é activada e as células exibem acrtividade de β-galactosidase. IPTG é o indutor do operão Lac que inactiva o repressor X- gal e o substrato análogo a galactose e quando desdobrado produz cor azul Monómeros N- terminal e C-terminal quando unidos, codificam β- galactosidase, x-gal e desdobrado (actividade enzimática). O resultado final é Agar+ampicilina+X-gal Vectores de expressão Promotores bacterianos são sequências de DNA às quais se ligam as RNA polimerases. Os promotores determinam a polaridade duma sequência determinando qual das duas cadeias deve ser transcrita, e são em regra reguláveis, de tal forma que afectam fortemente a capacidade de expressar proteínas. As proteínas podem ser produzidas em grandes quantidades através da utilização de vectores de expressão: uma sequência promotora e uma sequência de ligação aos ribossomas são inseridas no vector a montante do MCS. 52

53 Os primeiros vectores de expressão desenvolvidos para E. coli usavam o promotor regulável lacp Simples expressão do vector em E.coli. utilizando o promotor lac. a) O vector de expressão (plasmídeo) contém um fragmento do cromossoma de E.coli, que contém o promotor Lac e o gene vizinho LacZ. Na presença do análogo de lactose IPTG, a RNA polimerase, normalmente, transcreve o gene LacZ, produzindo LacZ mrna, que é traduzido para proteína, a β-galactosidase. b) O gene LacZ pode ser cortado do vector de expressão com enzimas de restrição e substituído pelo G-CSF cdna. Quando o plasmídeo resultante é transformado na E.coli, a adição de IPTG e a subsequente transcrição do promotor Lac produz G-CSF mrna, que traduz a proteína G-CSF. Sistema de expressão procariótico baseado na RNA polimerase do fagot7 e no promotor tardio T7 O cromossoma de uma E.coli (engenharia genética) contém uma cópia do gene da T7 RNA polimerase debaixo do controlo transcricional do promotor lac. Quando a transcrição do promotor lac é induzido pela adição de IPTG, o gene da T7 RNA polimerase é transcrito e o mrna traduzido em enzima. As moléculas da T7 RNA polimerase produzidas, iniciam, então, a transcrição, numa grande taxa, do promotor tardio T7 no vector de expressão. Cópias múltiplas do vector de expressão estão presentes nas células, apesar de que apenas uma cópia encontra-se esquematizado aqui. A grande quantidade de mrna transcrito do cdna clonado próximo do promtor tardio T7 é traduzida, em abundância, em produto proteico. Vectores de expressão eucarióticos precisam conter sequências regulatórias que sejam reconhecidas pelas células de destino. Abaixo, o vector pvkh18en6 contém vários elementos regulatórios: melhorador de transcriçãox6, promotor 35S do vírus do 53

54 mosaico da couve-flor, sequência líder do vírus do mosaico do tabaco (a montante do MCS) e o terminador do gene da nopalina sintase (a jusante do MCS). Vectores de expressão frequentemente incluem um sistema repórter. Os genes repórter podem ser usados para estudar a actividade de um promotor ou para monitorizar a expressão de um gene em estudo. O sinal das proteínas fluorescentes é detectável à escala subcelular. Beta-Glucoronidase (GUS) GUS é um gene repórter, particularmente usado em plantas na biologia molecular. Vários ensaios do gene repórter encontram-se disponíveis, dependendo do substrato que se utiliza. O termo GUS refere-se á mais comum técnica histoquímica. O susbstrato mais comum da β-glucoronidase é 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc) e o produto de reacção tem uma cor azul clara. Tags são pequenas sequências de aminoácidos que se fundem a uma proteína de interesse através de técnicas de DNA recombinante. (Fusão: justaposição de duas sequências codificantes in frame com o codão de iniciação único, e sem codão de terminação intermédio). Vantagem dos tags : mais anticorpos disponíveis. 54

55 Proteínas de fusão São as proteínas criadas com a junção de dois ou mais genes do qual codificou originalmente para proteínas separadas A inserção de DNA alvo no MCS provoca a respectiva fusão com a sequência codificante do gene lacz. O IPTG induz o promotor lacp, resultando na produção de uma proteína híbrida. As proteínas de fusão têm vantagens e desvantagens relativamente ao uso de tags. Desvantagens Perda de actividade biológica/função da proteína (e/ou do repórter) Alteração da localização subcelular nativa Processamento da proteína defeituoso Toxicidade Vantagens Não são necessários anticorpos Sobre-expressão Sobre-expressão - Experimentalmente, uma proteína pode ser expressa em quantidades elevadas. Isto pode ser atingido aumentando o número de cópias de um gene, ou colocando o gene sob a acção de um promotor constitutivo forte. 1. Estudar a função de uma proteína (normalmente endógena) 2. Produção de uma dada proteína em quantidades acrescidas para purificação (proteína endógena ou não, normalmente se eucariótica usam-se sistemas de expressão eucarióticos: leveduras, plantas). Reacção em cadeia de polimerase (PCR) A reacção em cadeia de polimerase é: Um processo para multiplicar selectivamente um determinado segmento de DNA; Esse segmento pode representar uma pequena parte de uma mistura complexa de DNAs (por ex. um determinado exão numa preparação de DNA genómico total), Através da PCR podemos obter uma quantidade abundante de DNA em cerca de 2 horas, A preparação de DNA alvo não precisa ser pura, Pode amplificar-se uma única cópia de DNA alvo (por ex. uma sequência específica em uma única célula haplóide). 55

56 A reacção de PCR envolve componentes obrigatórios, que são são: DNA, ou seja, a sequência de DNA que queremos amplificar DNA polimerase, enzima estável no calor que cataliza a síntese do novo DNA Primer direito ( reverse ) Primer esquerdo ( forward ) dntps (nucleótidos), que constroem o novo DNA Solução tampão Mg 2+ Os componentes chave da Reacção em Cadeia da Polimerase (PCR) já eram todos conhecidos previamente, só faltando juntar as peças do puzzle. DNA polimerases As DNA polimerases para funcionarem necessitam de uma cadeia molde. Estas incorporam nucleótidos na direcção 5-3, nunca na direcção oposta, mas incorporam os nucleótidos numa cadeia já existente, mas não a iniciam. Duplicação de DNA in vivo vs PCR Para separar as duas cadeias: Helicases e Topoisomerases Para iniciar a nova cadeia: Primers de RNA sintetisados por uma RNA polimerase Primers de DNA sintéticos Ciclos do PCR Cada 30 a 40 ciclos compreende: Desnaturação. Reacção a uma temperatura de 95ºc durante 60 segundos. A cadeia dupla de DNA separa-se, ficando duas cadeias simples e toda as reacções enzimáticas param. Emparelhamento dos primers. Ocorre a uma temperatura de 55ºC a 60ºC durante 45 segundos. As pontes de hidrogénio são constantemente formadas e 56

57 quebradas entre a cadeia do primer e a cadeia de DNA. Se os primers são complementares com a cadeia de DNA, as pontes de hidrogénio são fortes e o primer fica ligado. Extensão, a uma temperatura de 72ºC durante minutos pois depende do tamanho do produto. As bases (complementares da cadeia de DNA) são ligadas ao primer no lado 3 ( a Taq polimerase adiciona dntp s de 5 para 3, lendo o DNA de 3 para 5, complementar ao DNA). Vão sendo adicionados nucleótidos até amplificar toda a cadeia molde. 1º ciclo parte 1 1º ciclo parte 2 2º ciclo parte 1 2º Ciclo parte 2 3º ciclo parte 1 3º ciclo parte 2 57

58 Eficiência do PCR Todo o ciclo resulta na duplicação do número das cadeias de DNA. Depois do primeiro ciclo, a maioria do produto das cadeias de DNA são do mesmo tamanho que a distancia entre os primers. O resultado é uma dramática amplificação do segmento de DNA entre os primers. A quantidade da amplificação é 2n, onde n é o número de ciclos efectuados (1 milhão após 20 ciclos). O sucesso de uma reacção de PCR depende de inúmeros factores Os factores para uma reacção de PCR com sucesso são: Oligonucleótidos: especificidade, tamanho, etc. Concentração de cada oligonucleótido: 0,1-0,5 µm(0,2 µm) Concentração de DNA molde: depende do tipo de DNA (genómico, plasmídeo, cdna) Concentração de dntps (datp, dctp, dgtp, dttp): (200 µm) DNA polimerase: conc. (0,5 U)e tipo (Taq) Mg2+: 1-4 mm (2 mm) Composição do tampão e aditivos: DMSO, glicerol, detergentes Thermus aquaticus (Taq) DNA polimerase Uma DNA polimerase termoestável, utilizada na amplificação de fragmentos de DNA através da técnica de PCR. O seu nome é devido a ter sido identificada pela primeira vez na bactéria Thermus aquaticus, uma extremófila encontrada em fontes hidrotermais. A Taq polimerase suporta as elevadas temperaturas usadas em PCR, tendo uma semi-vida enzimática de 40 minutos (a 95ºC). A Taq polimerase tem a desvantagem de ter uma fidelidade relativamente baixa, ou seja, ao fabricar segmentos de DNA durante o processo de PCR pode incorporar nucleótidos errados. Quantidade de amplificado versus número de ciclos Aumentar o número de ciclos para mais de 35, como por exemplo 40, tem pouco efeito benéfico. O plateau ocorre quando: Os reagentes se esgotam Os produtos re-emparelham A polimerase se degrada 58

59 Podemos obter, também, produtos indesejáveis acumulados. Fidelidade da Taq. Os erros são importantes? A TaqDNA polymerase não possui actividade de revisão (proof-reading) da cadeia 3 5 (frequentemente encontrada em outras DNA polimerases) A Taq tem uma taxa de erro na ordem dos (dependendo do método de aferição). Produtos parciais contendo erros são amplificados pelos subsequentes ciclos de PCR; Num amplificado de 400 bp, 33% das moléculas poderão conter1 erro (após20 ciclos). A distribuição dos erros é aleatória. Outras DNA polimerases com actividade de revisão da cadeia apresentam taxas de erro até 10-7 (ex: Pfu, Tgo, Pwo, etc.) Análise dos Produtos de PCR A análise dos produtos de PCR é: Em regra, por electroforese em gel de agarose (validação por tamanho; falível) Por vezes, por técnicas de hibridação com sondas (dot-blot, etc.) Sequenciação Optimização do PCR Para optimizar-mos a reacção de PCR, temos que ter em conta ao: Tamanho do alvo; Concentrações; Parâmetros do ciclo de PCR o Tempo o Temperatura Desenho dos primers Notas gerais para o desenho de primers Primers ou inciadores de uma reacção de PCR são oligonucleotídeos curtos em cadeia simples que emparelham com DNA e promovem a síntese de uma cadeia complementar na presença de DNA polimerase. Para a amplificação de um fragmento de DNA é sempre necessário estarem presentes dois primers, cada um deles complementares e flanqueando a região do DNA que queremos. 59

60 Temos que ter em conta: Especificidade Comprimento Tm Sequências internas de complementaridade Conteúdo em G/C Polipirimidinas (T,C) ou polipurinas (A,G) Terminação 3 Especificidade Uma reacção de PCR é uma reacção extremamente sensível capaz de amplificar um único fragmento de DNA contido numa mistura de reacção complexa. Esta capacidade depende da especificidade dos primers para realizar essa amplificação. Idealmente os primers serão apenas complementares a uma única sequência alvo que se pretende amplificar. Contudo, em muitos casos poderá haver outras sequências que apresentam complementaridade com os primers em diferentes graus. Um bom primer será apenas complementar com a sequência alvo ou com um número reduzido de sequências para além desta. Na maior parte dos casos este emparelhamento extra dos primers com sequências secundárias não afectará a reacção de PCR uma vez que um emparelhamento de um primer com uma região isolada do DNA não vai resultar na formação de produto amplificado. A amplificação geométrica de um fragmento só ocorre quando os primers emparelham face a face em cadeias opostas da molécula de DNA. Comprimento (tamanho do primer) Se os primers forem muito curtos para além de emparelharem com a região alvo na molécula de DNA têm uma elevada probabilidade de emparelhar adicionalmente com centenas de outros locais complementares no genoma. Por outro lado, se forem muito longos isso afectará a taxa de emparelhamento na reacção de PCR, uma vez que ela é proporcional ao comprimento dos primers. Assim primers muito longos não emparelham de modo eficiente o que leva a uma redução da quantidade de produto PCR formado. Um tamanho de primer que está conforme estes compromissos e que é standard é o de nucleotídeos, apresentando especificidade e eficiência de emparelhamento óptima. Tamanho e especificidade de um primer estão interligados 60

61 Tm (melting temperature) A estabilidade da estrutura primer-dna alvo pode ser medida através do seu T m, o qual representa a temperatura para a qual metade das moléculas de DNA numa solução está em cadeia dupla e metade está em cadeia simples. A temperaturas acima do T m as moléculas tendem a estar desnaturadas, em cadeia simples e a temperaturas abaixo do T m tendem a estar em cadeia dupla. A temperatura de desnaturação de uma cadeia dupla de DNA aumenta quer com o seu tamanho, quer com o conteúdo em G/C (% de Guaninas + Citosinas em relação ao número total de bases). Outros factores numa reacção de PCR têm influência na temperatura de desnaturação são o conteúdo em MgCl 2, em K + ou outros aditivos que influenciem a estringência da reacção. Numa reacção de PCR a temperatura de emparelhamento tem que ser inferior ao T m dos primers. Por regra, a reacção de emparelhamento ocorre a cerca de 5 C abaixo do valor de T m dos primers. Se a temperatura de emparelhamento numa reacção de PCR for muito superior não haverá emparelhamento com a sequência alvo, mas se for muito inferior os primers vão emparelhar com muitas outras sequências que não são perfeitamente complementares com eles. Tendo isto em conta e no que se refere ao desenho de primers, uma consequência importante é que os primers desenhados deverão ter valores de T m semelhantes, idealmente dentro de um intervalo de 5 C de diferença um do outro. Quanto mais próximos forem os valores de T m dos primers envolvidos numa reacção de PCR melhor. T m = 2 (A+T) + 4(G+C) Fórmula empírica e aproximada Válida para oligonucleótidos de bases Adicionalmente o T m dos primers deverá estar entre C A relação entre Tm e temperatura de emparelhamento não é muito clara. Temperatura de emparelhamento (t anneling ) A temperatura de emparelhamento é a temperatura para qual os primers emparelham com a cadeia de DNA. A temperatura de emparelhamento pode ser determinada a partir da temperatura de melting (T m ) o Tm representa uma estimativa da estabilidade do híbrido DNA-DNA e é crítico para a temperatura de emparelhamento (Ta) o Ta muito elevada, maior hibridação primer-molde insuficiente e maior produto de PCR (amplificado) baixo. 61

62 o Ta muito baixa, maior produção de amplificados inespecíficos o Deve testar-se experimentalmente em incrementos de 1-2 ºC para cima e para baixo do Ta estimado o Alguns termocicladores têm função de gradiente de temperatura Existe uma fórmula: Sequências internas de complementaridade Se os primers tiverem uma sequência de bases complementares entre si, pelo menos em parte, emparelharão consigo próprios. Se isto acontece não poderão emparelhar com o DNA alvo. Há dois tipos principais de consequências que podem resultar de um auto-emparelhamento dos primers: as que resultam nos chamados hairpins e as que resultam na formação de dímeros. 1. Hairpins Considere-se o primer GGC GGT ATG ATC CCG CTA GTT AC. Pode emparelhar internamente formando uma estrutura, como a figura abaixo. Deste modo não poderá emparelhar com DNA alvo numa reacção de PCR. Os primers têm que ser desenhados de modo a evitar a formação destas estruturas. Existe software capaz de analisar a sequência dos primers e indicar se existe ou não possibilidade de eles serem autocomplementares. São de evitar primers que contenham mais de 3 pares de bases intramoleculares, como regra geral. 2. Dímeros Os dímeros formam-se ou por emparelhamento intermolecular, ou seja emparelhamento de bases pertencentes aos dois primers em solução, heterodímeros ou por emparelhamento entre as bases de um só primer autodímeros ou homodímeros.o exemplo do primer anterior, GGC GGT ATG ATC CCG CTA GTT AC, pode formar vários homodímeros, por exemplo: 5' GGCGGTATGATCCCGCTAGTTAC 3' CATTGATCGCCCTAGTATGGCGG 5' GGCGGTATGATCCCGCTAGTTAC 3' CATTGATCGCCCTAGTATGGCGG DNA synthesis 5' GGCGGTATGATCCCGCTAGTTACcgcc 62 3' ccgccattgatcgccctagtatggcgg

63 No exemplo á esquerda a estrutura dimérica é bastante estável, numerosas bases estão emparelhadas. No exemplo à direita o auto emparelhamento produz um dímero menos estável (há menos bases envolvidas), mas igualmente problemático uma vez que as bases na terminação 3 estão envolvidas no emparelhamento. Quando isto acontece o segundo primer pode ser usado como alvo para a síntese de DNA e algumas bases extra são adicionadas ao primer, destruindo-lhe a especificidade necessária para a amplificação do produto PCR correcto. Outro exemplo: Composição de bases A composição de bases afecta a hibridização específica, a temperatura de melting e de emparelhamento e estabilidade interna. Normalmente tem se mais em conta ao conteúdo de G/C. O conteúdo G/C afecta o T m dos primers. É pois importante que os primers tenham uma composição equilibrada em termos de A/T e G/C. Primers com um conteúdo de G/C de 40-60% produzem ligações com o DNA alvo suficientemente estáveis para promover amplificação. As ligações G-C contribuem mais para a estabilidade da ligação primer-dna alvo que as ligações A-T, aumentando, pois a temperatura de desnaturação. É ainda importante que o primer não contenha regiões com longas sequências de A/T (polipurinas/polipirimidinas) ou G/C (poli G7poliC). No primeiro caso para evitar emparelhamentos frágeis e no segundo caso para evitar Posição 3 -terminal A presença de G ou C na extremidade 3 dos primers promove o emparelhamento correcto nesta extremidade devido ao maior número de ligações de hidrogénio que se estabelecem entre estas duas bases. Contudo, sequências com mais de 3 repetições de G ou C devem evitar-se nas primeiras 5 bases da extremidade 3 do primer devido à maior probablilidade de se formarem dímeros. A estabilidade no emparelhamento das bases na extremidade 3 é necessária para que as polimerases possam iniciar a síntese de uma nova cadeia. Desenho de primers sumário 1. Idealmente um primer deve ter uma mistura aleatória das 4 bases 2. Os primers devem ter bases de comprimento; 3. Os primers devem terminar em 3 em G ou C, ou GC ou CG; 4. Preferencialmente o T m dos primers deve situar-se entre 55 e 60 C 5. Devem ter um conteúdo de G/C de 40-60%; 63

64 6. Devem evitar-se sequências de primers que formem estruturas secundárias, como hairpins ou dímeros; 7. É especialmente importante que as extremidades 3 dos primers não emparelhem entre si 8. A extremidade 3 do primer deve conter G e C para promover estabilidade da ligação com o DNA molde, mas não conter mais de 3 G ou 3 C; Tamanho do produto PCR A escolha dos primers determina o tamanho do produto PCR. Se os primers forem complementares a região próximas no DNA alvo, então a reacção de PCR formará um produto pequeno, se forem complementares a regiões afastadas, o produto PCR sera maior. As DNA polimerases, sendo a Taq polimerase a mais vulgarmente utilizada, amplificam facilmente produtos até bp. Há outras polimerases capazes de amplificar produtos maiores Programação do termociclador Organização A organização apresenta três áreas de trabalho I II III Preparação de soluções e reagentes Distribuição da Master mix pelos tubos de PCR Extracção de DNA das amostras e de falsas amostras (controlos negativos) Adição dos extractos aos tubos de PCR Abertura dos tubos de PCR para análise electroforese e/ou dotblot 64

65 PCR Proofreading Neste tipo de PCR, os componente do PCR continuam a ser os mesmos que no PCR comum: Sequência de DNA a amplificar Em cada ciclo: dntps Primes Mg 2+ Solução tampão DNA polimerase No PCR proofreading a DNA polimerase utilizada é a PFU DNA polimerase em vez da Taq polimerase. Isso é devido às desvantagens da Taq polimerase, tais como: Não tem actividade de exonuclease de 3 5 Baixa actividade de exonuclease de 5 3 Em elevada concentração aparecimento de produtos não específicos Mispriming e formação de dímeros de primers Os factores para a optimização da reacção de PCR são: Tamanho da cadeia molde Concentração da solução tampão e Mg 2+ Tempos e temperaturas Desenhos dos primers Número de ciclos Fidelidade Nesta reacção de PCR, é necessário uma grande fidelidade. Para isso utiliza-se a PFU polimerase. A PFU DNA polimerase, apresenta as seguintes características: 65

66 Isolada do Pyrococcus furiosus Dois tipos: nativa e recombinante Origina produtos PCR com extremidades blunt Vantagens Com actividade proofreading 3 5 Com actividade de polimerase de 5 3 Muito termostável Menor taxa de erro Maior precisão e fidelidade Desvantagens Sem actividade de exonuclease de 5 3 Preço dutp, ditp e primers que contenham estes nucleoticos, não podem ser usados no PCR High fidelity PCR Tem como diferença o uso de proofreading DNA polimerase ou mistura de enzimas com a mesma actividade, levando a uma redução de erro durante a amplificação. Condições que podem alterar a fidelidade: Mg 2+ Concentração desigual de nucleotídeos ph Exposição prolongada da cadeia molde a temperaturas elevadas Aplicações Clonagem Expressão de genes Estudos de mutagénese Taq polimerase vs Pfu Aplicações PCR rotina RT-PCR DNA rotulação Sequenciaç ão de DNA Clonagem TA PCR preciso PCR para clonagem Model o DNA 3 5 exo inactiv o DNA polimerases termofílicas 5 3 ex Inactivação o Activo Deslocaçã o da cadeia Inactivo Rotação de coluna ou extracção de fenol/clorofórm io Rotação de coluna ou extracção de polimerase Taq polimersase nativa e recombinan te Pfu DNA polimerase recombinan 66

67 de vectores com ext. blunts Mutagénes e localespecífica DNA Activo Inactivo Activo clorofórmio te Pfu Actividade proofreading 3 5 Sem actividade proofreading 5 3 Fidelidade limitada para amplificações superiores a 3-6kb Rendimento PCR menor Taq polimerase Sem actividade proofreading 3 5 Actividade exonuclease de 5 3 Baixa fidelidade Para produtos PCR superiores 3kb Em (elevadas) aumento da quantidade de produtos não específicos Para combater as desvantagens de ambas as enzimas, efectua-se uma mistura da Taq polimerase com a Pfu para, assim, garantir uma maior fidelidade. Aumento da fidelidade AccuPrime Taq DNA Polymerase High Fidelity Mistura de enzimas: Taq DNA Polimerase recombinante, Pyrococcus species GB-D Polimerase e PlatinumR Taq Antibody. Proteínas acessórias aumentam hibridação dos primers à cadeia molde DNA True Start Hot Start Taq DNA Polimerase Activada na fase inicial de desnaturação do PCR. Tempo de activação curto. Hot Start PCR. Variação do PCR onde a reacção de amplificação é iniciada a temperaturas elevadas. 67

68 Hot start PCR vs Standard PCR Aumento da eficiência Número de ciclos Quantidade dos reagentes Presença de inibidores Tempo de exposição a elevadas temperaturas Dream taq DNA polimerase Maior sensibilidade e eficiência Maior tamanho dos produtos PCR RT-PCR Race Transcriptases reversas dos vírus AMV ( Vírus da MieloblastoseAviária ) ou M-MuLV ( Vírus de Moloney da Leucemia do Ratinho ) podem ser usadas para produzir uma cópia de DNA complementar (cdna) a partir de um molde de RNA, com recurso a primers específicos, a oligo(dt) 15-18, ou a oligonucleótidos aleatórios -oligo(dn) 6. R-T PCR em um passo vs R-T PCR em dois passos 68

69 Estudos de expressão e genes de referência. Os genes AGP6 e AGP11 são expressos unicamente no grão de pólen (GP) e tubo polínico (TP). A quantidade de cdna total usada em cada reacção de PCR deve ser equivalente em todas as reacções da experiência. Os genes de referência Ubc9 e Tub4 (housekeeping genes) são usados para uniformizar a quantidade de cdna em cada reacção. RACE ( Rapid amplification of cdna ends ) é uma variação de RT-PCR que amplifica sequências de cdna desconhecidas correspondentes às extremidades 5 ou 3 do mrna. PCR com primers degenerados para, por ex., isolar uma sequência genica num organismo quando só conhecemos a sequência desse gene em organismos relacionados; encontrar o maior número possível de sequências, traduzi-las, alinhá-las, e procurar motivos conservados. Esses motivos podem ser locais adequados para desenhar primers degenerados PCR Multiplex: PCR com 2 a 20 pares de primers 69

70 Verificar sequência dos primers in silico para possíveis interacções primerprimer Testar todos os amplificados separadamente usando o mesmo programa de PCR (idealmente não deve haver amplificados inespecíficos) Testar conjuntamente com todos os primers em concentrações equimolares e mesmo programa. Se alguns amplificados não aparecem (possivelmente os maiores) aumentar a concentração de primers para esses amplificados e limitar para os restantes. Outras variáveis: Temperatura de emparelhamento e extensão, concentração de tampão, concentração de enzima, qualidade dntps. PCR nested Efectua duas amplificações sucessivas com um par de primers internos no 2º PCR. Origina um aumento da especificidade/validação de produto de PCR. PCR invertido (IPCR) 70

71 Desenhando oligonucleotídeos degenerados Uma sequência de primer de PCR é denominada de degenerado se alguma das suas posições têm várias bases possíveis. A degenerência do primer é o número das combinações que a única sequência contém. Um uso comum dos oligonucleótidos é quando a sequência de aminoácidos da proteína é conhecida: AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln Consegue-se uma tradução reversa da sequência para determinar todas sequências de nucleótidos possíveis que pode codificar a sequência de aminoácidos. AspGluGlyPheLeuSerTyrCysTrpLeuProHisGln GATGAAGGTTTTCTTTCTTATTGTTGGCTTCCTCAT CAA C G C CT CAGC C C T C C C G A A A A A G G G G G Podemos seleccionar 14 bases da sequência (em azul) para criar um pequeno conjunto de oligonucleótidos degenerados. Cada oligonucleótido no conjunto terá uma base mudada num momento. Num total de 32 oligonucleótidos únicos serão gerados. TATTGTTGGCTTCC TACTGTTGGCTTCC TATTGCTGGCTTCC TACTGCTGGCTTCC etc. Quando ordenando os oligonucleótidos degenerados, deixa a companhia saber que queremos uma mistura de nucleótidos adicionados numa posição especifica usando o código abaixo: 71

72 Real time PCR Real-time PCR: uma perspectiva histórica Higuchi et al. foram os pioneiros na análise da cinética do PCR desenvolvendo um sistema que detecta os produtos de PCR à medida que eles se acumulam. Este sistema de real-time envolvia brometo de etídio em cada reacção de amplificação, um termociclador adaptado para irradiar as amostras com luz UV (fibras ópticas transmitem a luz de excitação), e a detecção da fluorescência resultante com uma câmara CCD, controlada por um computador. Os produtos de amplificação aumentam as quantidades de DNA em cadeia dupla, que se liga ao brometo de etídio, resultando num aumento da fluorescência. Do PCR ao Real-time PCR Real-time PCR Evolution O PCR revolucionou completamente a detecção de ácidos nucleicos, em que a vantagem mais evidente foi a possibilidade de, a partir de uma simples cópia de RNA ou DNA, uma dada sequência ser especificamente amplificada e detectada. O PCR tradicional tem evoluído para, em vez de detectar os produtos de PCR no final da reacção, permitir um acompanhamento da formação dos produtos de reacção à medida que a reacção ocorre. O gráfico obtido por real-time PCR, que relaciona o aumento da fluorescência com o número de ciclos, ilustra de forma mais completa o processo de PCR, não avaliando a acumulação de produto de PCR apenas após um determinado número de ciclos, como o tradicionalmente usado. Análise semi-quantitativa em gel de agarose Análise baseada no tamanho dos fragmentos; Baixa resolução; Brometo de etídio não fornece uma análise quantitativa; Baixa precisão; Baixa sensibilidade Discriminação de tamanho de fragmentos Taxa de dinâmica baixa 72

73 Métodos tradicionais usam o gel de agarose para a detecção de produtos de amplificação ao fim de n ciclos de reacção ou apenas no final da reacção de PCR. Este método tradicional, para além de demoroso, oferece resultados apenas baseados na discriminação do tamanho, o que não é muito preciso. O gel de agarose, tal como é ilustrado na figura, não permite distinguir muito bem uma banda com 10 cópias de uma com 50 cópias, conseguindo apenas distinguir bandas com cerca de 10x mais fragmentos de DNA do que outra. Já o Realtime PCR consegue detectar variações de 2x na quantidade de DNA. Mas o problema mais grave nos métodos tradicionais de PCR reside nas ilações erróneas que podem surgir da análise dos produtos de PCR quando se atinge a fase de plateau. Como sabemos, uma reacção de PCR pode ser descrita em quatro maiores fases: uma fase linear (normalmente os primeiros 10 a 15 ciclos), uma fase exponencial, em que a duplicação ocorre em cada ciclo (assumindo uma eficiência de reacção a 100 %), uma fase linear, em que os componentes da reacção estão a ser consumidos e a reacção é mais lenta e em que os produtos começam a degradarse, e uma fase de plateau, onde ocorre o end-point, e a detecção por métodos tradicionais em gel de agarose. Na fase de plateau, os reagentes esgotam-se, os produtos reemparelham e a polimerase perde a sua actividade. A quantificação de DNA por métodos tradicionais ocorre no final do PCR, muitas vezes quando a fase de plateau é atingida. Mas, como é demonstrado pela primeira figura, três amostras semelhantes, que começam com a mesma quantidade de DNA, têm quantidades diferentes na fase de plateau. Da mesma maneira, o PCR de amostras diferentemente diluídas mostra que a fase de plateau pode ser atingida ao mesmo tempo em toda a gama de amostras com diferentes diluições, reforçando que as medições efectuadas na fase de plateau não reflectem a quantidade inicial de amostra existente. Por isso, é mais preciso fazer medições durante a fase exponencial, onde as amostras são amplificadas exponencialmente. É esta a área de detecção para real-time PCR. Ct número de ciclos em que o produto amplificados têm um rendimento para um sinal de fluorescência detectável. Ciclo onde a reacção cruza o limiar de detecção Baseline fase onde a intensidade do sinal do produto amplificado ainda não ultrapassa a intensidade da fluorescência encontrada no meio 73

74 Threshold nível de fluorescência onde a reacção é detectada durante a fase exponencial. Linha de comparação entre amostras. Rn sinal do repórter dividido pelo sinal de referência passiva (sinal do Rox). Normalização empregada para corrigir erros de pipetagem. Princípios do Real-time PCR Real-Time PCR monitoriza a fluorescência emitida durante a reacção como indicador dos produtos de amplificação em cada ciclo PCR (em tempo real), em oposição à detecção no final da reacção. Permite detecção da fluorescência associada à amplificação, em cada ciclo, durante o PCR; Análise com recurso a software; Não é necessária a análise do produto em gel de electroforese no final do PCR. O real-time PCR (também designado por qpcr) permite detectar e quantificar ácidos nucleicos em tempo real enquanto são amplificados, mesmo que em fases iniciais da reacção, sem a necessidade de realizar purificações e análises adicionais. Baseado na detecção e quantificação de repórteres fluorescentes, o primeiro aumento significativo do produto de PCR correlaciona-se com a quantidade inicial da amostra. Portanto, para se detectar o número do produto de PCR ao longo de cada ciclo, é necessário marcar o DNA amplificado com algum tipo de molécula fluorescente (Ex: SYBR Green e TaqMan ). O real-time PCR permite obter resultados rápidos, precisos e fiáveis. A quantificação decorre na fase exponencial dos produtos de PCR. Usando sequências específicas de primers, o número relativo de cópias de uma determinada sequência de DNA ou RNA pode ser determinada. O termo relativo é aqui usado uma vez que a técnica compara números de cópias entre tecidos, organismos, ou diferentes genes relativamente a housekeeping genes. Como funciona o Real-time PCR? -Instrumentos: um termociclador para a amplificação, uma fonte luminosa para que ocorra a excitação das sondas fluorescentes, uma câmara para registo e um computador para analisar os dados. A fonte luminosa é apenas uma lâmpada de halogénio que ilumina a amostra através de cinco diferentes filtros de excitação. Uma câmara CCD é posicionada por debaixo das amostras e regista a fluorescência. Algumas marcas e modelos utilizam uma cabeça de leitura que se move sobre a fluorescência da placa, excitando e lendo a fluorescência nos poços individualmente. 74

75 Há vários métodos para marcar o DNA amplificado: 1. Através de sondas que emparelham com o DNA alvo entre os primes (ex. 5 nuclease assay) Dois dyes fluorescentes, um repórter e um quencher, são ligados de 5 para 3 na sonda. Depois de separados do quencher, o repórter dye emite uma característica fluorescente. Quando ambos os dyes são ligados à sonda, o repórter dye emite o seu quenched. Permite detectar apenas produtos específicos de amplificação. Um oligonucleotídio (ex: sonda TaqMan) é adicionado à mistura de reagentes de PCR. A sonda emparelha com a sequência alvo entre o primer foward e o reverse. Quando a DNA polimerase atinge a sonda, a sua actividade de exonuclease permite-lhe degradar a sonda, permitindo que a extensão a partir dos primers continue até ao final da cadeia. Novas moléculas repórter são desligadas das suas respectivas sondas a cada ciclo de PCR, aumentando a intensidade de fluorescência, que é proporcional à quantidade de produto amplificado produzido. Holland et al. foram os primeiros a demonstrar que a clivagem da sonda alvo durante o PCR pela actividade de 5 nuclease da Taq DNA polimerase pode ser usada para detectar a amplificação de produto alvo específico. Para além dos componentes típicos para a amplificação, as reacções incluíam uma sonda marcada com 32P na extremidade 5 e bloqueada na extremidade 3, por isso não podendo ser utilizado como primer. Durante a amplificação, o emparelhamento da sonda à sua sequência alvo gerava um substrato que era digerido pela actividade de 5 nuclease da Taq DNA polimerase quando a enzima atingia a região da sonda. Esta dependência de polimerização assegura que a clivagem da sonda ocorra apenas se a sequência alvo estiver a ser amplificada. Depois do PCR, Holland et al. mediam a clivagem da sonda usavam os princípios da cromatografia para separar os fragmentos digeridos das sondas intactas. 75

76 O desenvolvimento de sondas fluorogénicas por Lee et al. tornaram possivel eliminar o processamento pós-pcr para a análise da degradação da sonda. A sonda é um oligonucleotídeo com um reporter fluorescent dye e um quencher dye. Enquanto a sonda está intacta, a proximidade do quencher reduz a fluorescência emitida pelo reporter dye. Esta técnica chama-se FRET (Fluorescent Resonance Energy Transfer). Quando um corante de alta energia está próximo de um corante de baixa energia, há uma transferência de energia do maior para o menor. 2. Double-Stranded DNA Binding Dyes. Quando o DNA é desnaturado, o SYBR Green Dye fica livre; A fase de extensão inicia-se com o emparelhamento dos primers A polimerização é completa. SYBR Green Dye liga-se ao produto de cadeia dupla e fluoresce. Pequenas moléculas ligam-se às cadeias duplas de DNA. Higuchi et al. usaram brometo de etídio para o seu real-time PCR (ver slide 2). Independentemente do mecanismo de ligação, há dois requisitos para que o corante possa ser aplicado para detecção em Real-time PCR: aumento da fluorescência quando ligados às moléculas de DNA em cadeia dupla e a não inibição do PCR. SYBR Green é um corante que se liga à minor groove da cadeia dupla de DNA. Quando SYBR Green se liga à cadeia dupla do DNA, a intensidade da emissão de fluorescência aumenta. Quantos mais produtos de amplificação em cadeia dupla forem produzidos, maior será o sinal de SYBR Green. No entanto, SYBR Green liga-se a qualquer molécula de DNA em cadeia dupla, enquanto que o método de 5 nuclease é específico para um alvo pré-determinado. A vantagem das sondas fluorogénicas sobre DNA binding dyes é que o emparelhamento entre a sonda e o alvo é necessário para gerar o sinal fluorescente. Por isso, com as sondas fluorogénicas, artefactos devido a amplificação não-específica por mis-priming ou primer-dimer não gera sinal, enquanto que DNA binding dyes não é específico, podendo conduzir a falsos positivos. Análise dos resultados As curvas de amplificação traçam a acumulação de emissão de fluorescência em cada ciclo de reacção. Cada curva pode ser dividida em diferentes fases: uma fase linear, uma fase exponencial, uma fase log-linear e fase de plateau. Rn diz respeito à intensidade da emissão de fluorescência; O aumento do sinal do repórter é capturado por instrumentos que detectam a sequência e processado por um software. A quantidade do sinal do repórter é proporcional à quantidade de produto gerada pela amostra dada. A linha que representa o limiar é o nível de detecção ou o ponto no qual a reacção atinge a intensidade fluorescente acima do background fluorescence. O ciclo no qual a amostra atinge este nível chama-se cycle threshold, Ct. Quanto mais alto for o número de cópias iniciais de ácido nucleico, mais rapidamente se dá um aumento significativo na fluorescência e mais baixo o valor Ct. 76

77 Um gráfico de amplificação relaciona o sinal de fluorescência com o número de ciclos. Nos ciclos iniciais de PCR há pouca variação no sinal de fluorescência, o que define o valor limiar do gráfico de amplificação. Um aumento da fluorescência acima do limiar detecta a acumulação de produto de PCR. Tal como é possivel ver pelo gráfico, os primeiros ciclos de PCR são caracterizados por um aumento exponencial dos produtos de PCR. À medida que os componentes de reacção se tornam limitantes, a taxa de amplificação decai quando a fase plateau é atingida. De 5 séries de diluição resultaram fases de plateau semelhantes mas fases exponenciais bastante distintas, reforçando o facto de, se as quantificações forem realizadas na fase de plateau, os dados não representarão as verdadeiras quantidades iniciais de cada amostra. One-Step ou Two-Step real-time RT-PCR One-step real-time RT-PCR efectua a reacção de transcrição reversa e PCR no mesmo sistema tampão e num tubo; Em two-step RT-PCR estes dois passos são realizados separadamente em tubos diferentes. Utilizado para quantificar o mrna, o real-time PCR pode ser realizado numa reacção que envolve um só passo, onde toda a reacção de síntese de cdna para amplificação por PCR é realizada num único tubo, ou através de uma reacção de PCR em dois passos, onde ocorrem separadamente a transcrição reversa e a amplificação por PCR. Há muitos prós e contras associados a cada método. O primeiro foi pensado para minimizar a variação experimental, um vez que ambas as reacções enzimáticas ocorrem no mesmo tubo. No entanto, este método usa RNA como amostra inicial, que pode sofrer uma degradação se não for convenientemente manipulado. O real-time RT-PCR em dois passos separa a reacção de transcrição reversa da reacção de PCR. 77

78 Vantagens e desvantagens relativamente a métodos tradicionais Vantagens Resultados não são influenciados por amplificação não específica Amplificação é monitorizada em temporeal Baixo risco de contaminação Não é muito mais caro do que o PCR convencional, excepto o equipamento Desvantagens Não é um método ideal para um PCR multiplex (isto é, com 2 a 20 pares de primers) Custo do equipamento elevado O número de produtos detectados é limitado pelo número de fluróforos Aplicações do real-time PCR: 1. Quantificação viral; 2. Quantificação da expressão genética; 3. Drug Therapy Efficacy; 4. DNA Damage measurement 5. Detecção de patogénicos; 6. Genotipagem; 7. Detecção de metilação 8. Discriminação alélica Microarrays DNA microarrays são microslides de vidro ou membranas de nylon que contém amostras de DNA (DNA genómico, cdna ou oligonucleóticos) numa matriz de duas dimensões. DNA microarrays podem ser utilizados para analisar: Expressão genica; Clones genómicos Detecção de polimorfismos de nucleótidos (SNPs) Os métodos tradicionais da Biologia Molecular, normalmente, trabalham com um gene numa única experiencia, que significa que é muito limitado e a figura toda da função de um gene é muito difícil de obter. No passado, uma nova tecnologia, chamada de DNA microarray, foi muito atractiva pelos biologistas. Esta tecnologia promete a monitorização do genoma todo num único chip, para que os investigadores podem observar melhor as alterações entre os genes simultaneamente. Terminologias que têm sido usados na literatura para descrever esta tecnologia: Biochip; DNA chip; 78

79 DNA microarray; Gene array High density filters (macroarrays) 2400 clones por membrana Rotulação radioactiva Uma condição experimental por membrana Glass slides (microarrays) clones por slide Rotulação fluorescentes Duas condições experimentais por slide. Oligonucleótidos chips oligonucleótidos por slide Rotulação fluorescente Uma condição experimental por slide Devido aos métodos de construção destes arrays de síntese de oligonucleótidos foram adoptados dos métodos por manufacturação microscópica integrando circuitos usados em computadores. Este tipo de oligonucleótidos microarrays são, muitas vezes denominadas de DNA chips. DNA microarrays ou DNA chips são fabricados por robôs de grande velocidade, normalmente, de vidro mas, por vezes, em substrato de nylon, em que cada sonda com identidade conhecida sai usados para determinar a complementariedade, que permite uma massiva expressão genica paralela e estudos de descoberta de genes. Uma experiencia com apenas um DNA chip pode fornecer aos investigadores informação de milhares de genes simultaneamente. Processo das experiências microarrays 79

80 Aplicações dos microarrays Existem duas grandes aplicações para a tecnologia de DNA microarrays: Identificação da sequência ( mutação gene/gene); Determinação do nível (abundância) da expressão de genes. Análise da expressão Uma forma dos chips de DNA permitirem os cientistas de observar genes trabalhando em conjunto chama-se de análise da expressão. (relembrando que para expressar um gene como proteína, as células primeiro transcrevem a sequência do gene de DNA numa cópia de mrna complementar. Depois um ribossomas traduz a sequência de mrna numa cadeia de aminoácidos que fazem a proteína. A análise de expressão tem aplicações médicas, permitindo a classificação de diferentes tipos de leucemia, com a ajuda dos chips de DNA. usam os modelos da expressão do gene para encontrar nos dois grupos, que correctamente pensavam e sabendo, assim, que tipo de leucemia o paciente tem. Existem três tipos de leucemia: All acure lymphocytic leukemia AML acure myelogenous leukemia MLL mixed lineage leukemia Outra aplicação dos chips de DNA é o estudo do metabolismo de medicamentos, com o gene CYP

81 Mapeando as nossas diferenças Escolhendo duas pessoas no mundo, descobrimos que os seus DNAs são 99,9% idênticos. Os 0,1% restantes são a base genética para as diferenças da humanidade, desde a forma da cara ao facto das pessoas terem cancro e como os pacientes respondem de maneira diferente ao mesmo medicamento. Os microarrays podem ser utilizados para descobrir a base genética da variação fenotípica entre indivíduos: Single nucleotide polymorphism (SNP) Polimorfismo Expressão de genes Single nucleotide polymorphism Para mapear SNPs é necessário um outro tipo de chip. Para a análise de expressão precisamos de um chip contendo todos os genes possíveis, em que para o SNP funcionar, o chip tem de conter, também, as várias variações possíveis de um gene. Como proceder: Retiramos uma amostra de DNA da pessoa que queremos testar, utilizamos o PCR para múltiplas cópias do gene de interesse e colocamos o gene amplificado no chip. O local onde a luz aparece corresponde à sequência particular de variação que a pessoa tem. Pelo teste ser rápido e não muito caro, podemos fazer muitas vezes. Podemos, então, correlacionar, por exemplo, as diferentes reacções a uma certa droga (farmogenómico), ou a probabilidade de ganhar uma doença no coração, com as diferentes variações genéticas. Mutagénese dirigida A mutagéne dirigida é a capacidade de se poder provocar mutações específicas. Pode-se substituir especificamente um determinado nucleótido de um gene por outro, com a consequência de alterar um aminoácido de proteína codificada por esse gene. Utiliza-se oligonucleótidos mutagénicos sintéticos que emparelham na zona do gene que se pretende alterar. Estes possuem uma (ou mais) base interna que não emparelha e que especifica a mutação a introduzir. Processo da mutagénese dirigida O processo de mutagénese dirigida utiliza um PCR que contém, aproximadamente, 50 ng de dsdna, 125 ng de cada primer, 1 µl de mix de dntp, 1 µl (2,5 U) de polimerase e 5µL de tampão de reacção 10x, numa reacção de 50 µl. Todos os oligonucleótidos excepto os primes são fornecidos num kit. A reacção é efectuda usando Pfuturbo DNA polimerase e dois oligonucleótidos da mutação desejada. 81

82 Os primers são desenhados para incorporar a mutação desejada e a Pfuturbo DNA polimerase replica ambos os cadeias do plasmmídeo com alta fidelidade sem deslocar os oligonucleótidos mutantes. Os ciclos térmicos consistem numa desnaturação inicial a 95ºC durante 30 segundos, seguido de 16 ciclos de desnaturação durante 30 segundos, depois emparelhamento a 55ºC durante 1 minuto e extensão a 68ºC por 15 minutos (2 minutos/kb do tamanho do plasmídeo). Os oligonucleótidos complementam a cadeia oposta do plasmídeo durante o ciclo que origina uma cópia inteira do plasmídeo mutante com quebras. Seguido do PCR, o produto é tratado com a enzima Dpn I ( em que a sequência alvo é 5 -Gm 6 ATC-3 ). O vector de DNA com quebras, contendo a mutação é, então, transformado em células super competentes XL1-Azul. O volume de 1µL do produto é usado para transformar e a transformação foi plaqueado em agar com YT-ampicilina, incubado a 37ºC por 16h aproximadamente. As colónias recombinantes são preparadas num mini-prep, seguido de análise RE e para confirmação mais tarde, a sequenciação. Desenho de primers Na maioria dos casos, os primers são desenhados para facilitar a incorporação de uma novo local de RE ou para remover um local RE existente. Isto foi alcançado pela criação de mutações silenciosas em ou à volta da região da mutação desejada. Tanto o primer forward como o primer reverse contêm o mutante desejado. Os primers emparelham na mesma sequência na cadeia oposta do plasmídeo. Características dos primers: O tamanho do primer deve ser, aproximadamente, de 25 a 30 bases; Dever ter um mínimo de 10 bases a flanquear o local mutante; O conteúdo de G/C deve ser de 40 a 60%; A temperatura de desnaturação (temperatura melting), T m, dos primers é calculada pela seguinte fórmula: T m = 81,5 + 0,41 (%G/C) 675/N (% incompatabilidades) (N é o tamanho do primer) Os primers não devem ter nem formação de hairpins ou formação de dímeros. PCR na mutagénese dirigida Para manipulações de plasmídeos, esta técnica foi suplentada por uma técnica parecida com o PCR, onde um par de primers mutagénicos complementares são usados para amplificar o plasmídeo. 82

83 Este origina uma quebra, em que o DNA circular repara-se por maquinaria endógena bacteriana. Mas, este processo na amplifica o DNA exponencialmente, mas sim linearmente. Isto é devido à reparação da quebra e de o plasmídeo não estar super enrolado, resultando na eficiência da transformação bacteriana. Finalmente, o produto de DNA é do mesmo tamanho que o plasmídeo. Assim, o DNA molde tem que ser eliminado por digestão enzimática com enzimas de restrição específicas para o DNA metilado. Já o plasmídeo mutante é preservado porque foi criado in vitro e por isso é não metilado. Sequenciação genómica Qualquer método de sequenciação de DNA inicia-se com a população de uma fragmento de DNA definido e marcado numa extremidade. Dessa população, um conjunto de moléculas criadas diferem por uma base na outra extremidade. Essas moléculas são depois fraccionadas. O fraccionamento é realizado por electroforese em gel de agarose ou em gel de acrilamida das moléculas de cadeia dupla de DNA. A mobilidade da cadeia é inversamente proporcional ao logaritmo do comprimento. Esta técnica é tão sensível que fragmentos que diferem no comprimento por apenas um nucleótido podem ser separados. A base cortada de cada extremidade das moléculas fraccionadas é determinada e, portanto, a sequência de nucleótido é estabelecida. Moléculas de DNA podem ser rapidamente sequenciadas por dois métodos. As técnicas disponíveis para produzir e separar fragmentos restritos de DNA de algumas centenas de nucleótidos levou ao desenvolvimento de dois procedimentos para determinar a sequência de nucleótidos exacta de fragmentos de DNA até 500 nucleótidos. Estes métodos de sequenciação de DNA juntos com a tecnologia para construir bibliotecas representam o genoma inteiro de um organismo, tornado possível determinar a sequência exacta de todo o DNA do organismo. Método de Maxam Gilbert Neste método uma cadeia simples de DNA é marcada com 32P a extremidade 5. De seguida, separam-se as duas cadeias de DNA. Distribui-se por 4 tubos, um para cada base. Em cada tubo irão ocorrer alterações químicas específicas para uma base (A, C, G ou T). As moléculas são clivadas. Por exemplo, no tubo em que o tratamento foi direccionado para a adenina, após a clivagem, a extremidade do fragmento de DNA marcada com o radioisótopo, apresentará uma base que corresponde à que precede a adenina. O passo seguinte é idêntico ao método de Sanger. Cada molécula é separada em gel de electroforese e a sequência é lida a partir do próprio gel. Os fragmentos menores são clivados mais próximo da extremidade 5 enquanto que os fragmentos maiores são 83

84 clivados mais próximo da extremidade 3. Só os fragmentos radioactivos são detectados por autoradiografia. Método de (dideoxy) Sanger Componentes da reacção O molde é uma cadeia de DNA que queremos sequenciar. Pode ser um produto de PCR, DNA genómico ou fragmentos clonados. O primer é uma fragmento de DNA que se liga à extremidade de DNA molde. Os primers fornecem especificidade à reacção e, também, serve como ancora aos nucleótidos que são adicionados. Deoxynucleótidos (dntps) ampliam o primer, formando uma cadeia de DNA. Todos os nucleótidos (A,T,G,C na forma deoxunucleótidos) são adicionados à reacção de sequenciação. Didesoxinucleótidos (ddntps) são outra forma de nucleótidos que inibem a amplificação do primer. Uma vez o ddntp seja incorporado na cadeia de DNA, mais nenhum nucleótido pode ser adicionado. DNA polimerase incorpora os nucleótidos e os didesoxinucleótidos na cadeia de DNA a ser formada. Tampão é a solução que estabiliza os reagentes e os produtos na reacção de sequenciação. Ciclo de sequenciação Ciclo de sequenciação é o poder de reutilizar o mesmo molde muitas vezes. O ciclo de sequenciação ou, também, denominado por sequenciação de amplificação linear, é um tipo de sequenciação PCR. Tal como a reacção de PCR comum, usa uma DNA polimerase termoestável e um ciclo de temperatura de desnaturação, emparelhamento e síntese de DNA. A diferença do ciclo de sequenciação emprega apenas um primer e inclui ddntps que terminam a reacção. Marcadores fluorescentes são a base da leitura da sequência. 84

85 A terminação do método de sequenciação comum utiliza marcadores radioactivos, e o padrão de bandas no gel de poliacrilamida é visualização por autoradiografia. A marcação fluorescente tem sido importante para o desenvolvimento do método de sequenciação, particularmente devido à detecção de sistemas por fluoromarcação, que abriu caminho para a leitura automática de sequenciação. O marcador é ligado aos ddntp, com diferentes fluorocromos para cada base. Agora é possível cocnhecer as quatro reacções de sequenciação para A, C, G e T, num único tubo e carregar todas as quatro famílias de moléculas num só gel de poliacrilamida, uma vez que o detector de fluorescência consegue descriminar entre a diferença de marcadores de determinar que banda representa um A, C, G ou T. Quando combinado com aparelhos robóticos que preparam as reacções de sequenciação e carregam o gel, o sistema de detecção de fluorescência evita erros que poderiam aparecer quando a sequencia é lida por olho nu e entra manualmente num computador. É pelo uso destas técnicas automáticas que podemos obter rapidamente dados da sequência, para um projecto para estudar um genoma completo num espaço de tempo razoável. Sequenciação completa de genomas Existe duas estratégias gerais para a sequenciação completa de genomas. O método preferido pelo Projecto Genoma Humano é o método de sequenciação shotgun hierárquica. Nesta abordagem, o DNA genómico é cortado em pedaços de cerca de 150 Mb e inserido num vector BAC e transformado na E.coli, onde são replicados e armazenados. Os inserts de BAC são isolados e mapeados para determinar no fim cada fragmento de 150 Mb clonados. Depois são alinahdos e agregados numa sequência final. 85

86 Mapeamento físico Na preparação de mapas físicos de genomas, os vectores que podem carregar uma grande parte de inserts são os mais usados. Cosmídios, YACs (yeast artificial chromossomes), BACs (cromossomas artificiais de bactérias) e PACs ( cromossomas artificiais baseados no fago P1) são os mais utilizados. Cada fragmento BAC é fragmentado aleatoriamente em pequenos pedaços e cada pedaço é clonado num plasmídeo e sequenciado em ambas as cadeias. Esta sequenciação é alinhada para que sequências idênticas sejam sobrepostas. Estes pedaços contíguos são, então, agregadas numa sequencia final quando cada cadeia já foi sequenciada cerca de 4 vezes para produzir 8 vezes uma grande qualidade de informação. Localização do gene por inspecção de sequenciação A inspecção da sequencia pode ser utilizada para localizar genes porque os genes não são séries de nucleótidos aleatórios mas em vez disso tem características distintas. Essas características determinam a sequência do gene ou não, e pela definição não são possuídos por DNA não codificante. Pirosequenciação A pirosequenciação é sequenciar por síntese. Esta técnica assenta na detecção do pirofosfato libertado e não na terminação de cadeias (Sanger). Método de sequenciação baseado no real time pirofosfato No novo método de sequenciação, 4 nucleótidos são adicionados perto da molde hibridizado com um primer. O PPi libertado na DNA polímeras que cataliza a reacção é detectado pelo ATP sulfurilase e luciferase na reacção coplada. Os nucleótidos adicionados são continuadamente degradados pela enzima degradadora de nucleótidos. Depois do primeiro nucleótido adicionado ter sido degradado, o próximo nucleótido pode ser adicionado. 86

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

TRANSFERÊNCIA DE GENES EM BACTÉRIAS

TRANSFERÊNCIA DE GENES EM BACTÉRIAS TRANSFERÊNCIA DE GENES EM BACTÉRIAS SEXO BACTERIANO Bactérias podem trocar ou transferir DNA entre elas por três diferentes vias. Em todos os casos, as células que fornecem o DNA são chamadas de DOADORAS

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

MAPA DO CROMOSSOMA DE E.coli

MAPA DO CROMOSSOMA DE E.coli REPLICAÇÃO DE DNA MAPA DO CROMOSSOMA DE E.coli TERMINOLOGIA Regras básicas para a designação de genes e proteínas: Genes bacterianos 3 letras minúsculas em itálico que reflectem a sua função aparente Ex:

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA GENÉTICA BACTERIANA INTRODUÇÃO O DNA existe como uma hélice de fita dupla, mantidas pelo pareamento de bases nitrogenadas específicas (AT; CG). - A seqüência de bases codifica a informação genética; -

Leia mais

Guia do Professor. (Documento baseado no guião original em inglês)

Guia do Professor. (Documento baseado no guião original em inglês) Guia do Professor (Documento baseado no guião original em inglês) Nota: Este documento é apenas um resumo do conteúdo do guia do professor. Alguns itens de grande importância não estão aqui referidos,

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Ficha de Apoio Teórico: Replicação do DNA

Ficha de Apoio Teórico: Replicação do DNA Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Apoio Teórico: Replicação do DNA Introdução Uma das características mais pertinentes de todos

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

USO DE TECNOLOGIAS MOLECULARES

USO DE TECNOLOGIAS MOLECULARES USO DE TECNOLOGIAS MOLECULARES P= G+A VP = VG + VA Uso de marcadores no estudo de características quantitativas Características quantitativas Controladas por vários genes de pequeno efeito Sofrem maior

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático)

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) VIRUS CONCEITOS E DEFINIÇÕES Características: 1. Não têm estrutura celular, mas multiplicam-se»

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO

ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO ORGANIZAÇÃO DO MATERIAL GENÉTICO CELULAR Massa compacta, ocupando um volume limitado As suas variadas actividades, tal como replicação e transcrição, têm

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

O complexo maquinário de replicação e suas enzimas

O complexo maquinário de replicação e suas enzimas O complexo maquinário de replicação e suas enzimas AULA 10 objetivos Ao final desta aula, você deverá ser capaz de: Apresentar os diferentes componentes do maquinário de replicação. Conhecer as diferentes

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

Genética Molecular Técnicas aplicadas a produção animal

Genética Molecular Técnicas aplicadas a produção animal MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA PROGRAMA DE PÓS-GRADUAÇÃO EM ZOOTECNIA Genética Molecular Técnicas aplicadas a produção

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Técnicas de análise de DNA e RNA

Técnicas de análise de DNA e RNA Técnicas de análise de DNA e RNA Fundamento e aplicação das técnicas de análise de DNA Extracção, purificação, quantificação e detecção de ácidos nucleicos Electroforese convencional em gel de agarose

Leia mais

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009)

EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) INSTITUTO POLITÉCNICO DE BEJA EXAME DE BIOLOGIA Prova de Acesso - Maiores 23 Anos (21 de Abril de 2009) Nome do Candidato Classificação Leia as seguintes informações com atenção. 1. O exame é constituído

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

ESTRUTURA DO DNA E ORGANIZAÇAO DA ATIVIDADE BIOLÓGICA

ESTRUTURA DO DNA E ORGANIZAÇAO DA ATIVIDADE BIOLÓGICA ESTRUTURA DO DNA E ORGANIZAÇAO DA CROMATINA ATIVIDADE BIOLÓGICA 1 Qual é a natureza química da molécula responsável por estocar a informação genética??? CARACTERÍSTICAS 1. Estocar a informação e transmitir

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

Escola Secundária Dr. Manuel Gomes de Almeida

Escola Secundária Dr. Manuel Gomes de Almeida Escola Secundária Dr. Manuel Gomes de Almeida Ficha de trabalho de Biologia - 12º Ano Fermentação e actividade enzimática Nome: N º: Turma: Data: 1. A figura 1 representa um tipo de fermentação. Figura

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC

Relatório. A arte em movimento: a célula. Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Relatório A arte em movimento: a célula Estágio Instituto de Histologia e Embriologia, da Faculdade de Medicina da Universidade do Porto e IBMC Introdução No dia 6 Agosto, iniciamos o nosso estágio no

Leia mais

As enzimas de restrição

As enzimas de restrição As enzimas de restrição A Engenharia Genética é possível graças a um grupo especial de enzimas que cortam o DNA. Estas enzimas são chamadas de enzimas de restrição ou endonucleases de restrição. As enzimas

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA

16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Prova de Química e Biologia

Prova de Química e Biologia Provas Especialmente Adequadas Destinadas a Avaliar a Capacidade para a Frequência dos Cursos Superiores do IPVC dos Maiores de 23 Anos Prova de Química e Biologia Prova modelo Prova Específica de Química

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Cap.2.1. Alterações do Material Genético Mutações UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação Problemática

Leia mais

Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014

Biologia Molecular. Caderno de relatórios. Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva. Licenciatura em Bioquímica 2013/2014 Biologia Molecular Caderno de relatórios Turma 3 Grupo 2 Alexandra Teixeira, Catarina Cunha, Mª Inês Silva Docentes: Dr. Cláudio Sunkel, Prof. Mariana Osswald 1 Extração de DNA genómico de Drosophila Melanogaster

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO?

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO? Mutações O QUE SÃO? As mutações são alterações no material genético, que podem ocorrer naturalmente no percurso da síntese proteica mutações espontâneas ou por acção de agentes externos (agentes mutagénicos)

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

INF 1771 Inteligência Artificial

INF 1771 Inteligência Artificial Edirlei Soares de Lima INF 1771 Inteligência Artificial Aula 04 Algoritmos Genéticos Introdução Algoritmos genéticos são bons para abordar espaços de buscas muito grandes e navegálos

Leia mais

II AS OLIMPÍADAS DE BIOTECNOLOGIA

II AS OLIMPÍADAS DE BIOTECNOLOGIA II AS OLIMPÍADAS DE BIOTECNOLOGIA Duração da prova: 120 minutos 2007 1ª ELIMINATÓRIA Na folha de respostas preencha o cabeçalho com os seus dados e os da escola que representa. O teste tem a duração de

Leia mais