Tamanho: px
Começar a partir da página:




2 Biologia Molecular

3 Genome Transcriptome The OME -Era Proteome Metabolome

4 - Entendimento da fisiologia e reprodução de microorganismos - Entendimento dos mecanismos de replicação, transcrição e tradução - Enzimas de restrição - Plasmídeos - Purificação de proteínas e Enzimologia - Polymerase Chain Reaction (PCR) - Transcriptase reversa e RT-PCR - Sequenciamento - Fluoróforos - Automação

5 Plasmídeos Cromossomo bacteriano Plasmídeos DNA extracromossômico capaz de se replicar independentemente da replicação cromossomal - Resistência a antibióticos - Produção de toxinas - Conjugação (transmissão de material genético entre as bactérias) - Origem de replicação própria


7 Transferência horizontal de genes Conjugação Transmissão de material genético entre as bactérias Transferência de material genético entre reinos Agrobacterium tumefaciens

8 Transformação Competência Habilidade de uma célula receber DNA extracelular vindo do meio ambiente. -Natural: Bactérias adquirem DNA do meio para nutrição, reprodução e reparo de seu DNA, através de mecanismo de transporte membranar. - Artificial: Uso de procedimentos de laboratório que tornam as células passíveis de serem transformadas.

9 Transdução Fagos vírus que infectam bactérias

10 Enzimas de restrição (endonucleases) Daniel Nathans, Werner Arber, Hamilton Smith Sistema de modificação - restrição - Enzimas bacterianas que reconhecem e clivam DNA invasor - Reconhecimento de seqüência palindrômica de DNA exógeno - Seqüências bacterianas equivalentes são metiladas Seqüência palindrômica 5'-GTATAC-3' 3'-CATATG-5'

11 Pontas coesivas Cohesive ends Pontas cegas Blunt ends

12 Manipulação dos plasmídeos e a tecnologia do DNA recombinante Sítio de clonagem Resistência a antibióticos Origem de replicação

13 Clonagem em vetores -Plasmídeo é digerido com enzimas -Gene específico é ligado no plasmídeo, replicado em diversas cópias

14 Transformação Choque térmico Choque osmótico


16 Shuttle vectors Plasmídeos que se propagam em duas espécies -Transformação de plantas, leveduras, fungos filamentosos e células animais

17 Fagos como vetor Bacteriófagos

18 Vetores Tamanho do inserto Plasmídeos de alta cópia Bacteriófago λ (inserção) Bacteriophage λ (substituição) Cosmídeos Bacteriófago P1 BAC (cromossomos artificiais de bactérias) YAC (cromossomos artificiais de leveduras) 0 10 kb 0 10 kb 9 23 kb kb kb até 300 kb Mb

19 PCR - A REVOLUÇÃO DA TAQ Kari Mullis 1985 Premio Nobel de química -1993

20 PCR 1

21 PCR 2 95 C Tm 72 C n Ciclos de PCR

22 PCR Otimização da reação - Concentração dos reagentes Tris-HCl ph 8,8 (20 mm) KCl (10-50 mm) MgCl 2 (1 a 4 mm) Menos Mg mais especificidade Glicerol (menos que 5%) dntps (200 a 10 µm Menos dntp - mais especificidade) Taq (1 unidade) -Condições dos ciclos Etapa de denaturação inicial (1-3 min a 95 C) Etapa de denaturação (30 seg a 2 min a 95 C) Etapa de anelamento Etapa de extensão (30 seg a 1min e 30 seg a C) - Desenhos dos primers

23 Características desejáveis em um Primer Temperatura de melting (Tm) na faixa de 50 ºC a 65 ºC. Tamanho de 15 a 28 pares de bases Ausência da capacidade de dimerização. Ausência significativa da formação de grampos (>3 bp) Inexistência de sítios secundários de anelamento dos primers. Temperaturas de anelamento de primers formando um par devem ser próximas

24 Comprimento - Quanto maior o comprimento do primer, maior a possibilidade deste ser exclusivo; da mesma forma que maiores serão as temperaturas de melting e anelamento. - De uma forma geral, o comprimento do primer não deve ser inferior a 15 bases para assegurar a unicidade. - A existência desta faixa está baseada no fato de se buscar unique primers que apresentem temperatura de anelamento dentro da faixa considerada como a mais adequada.

25 Temperatura de Melting (TM) - É a temperatura na qual metade das fitas de DNA está na forma de fitas simples e a outra metade na forma de dupla hélice. - Tm é dependente da composição do DNA, de modo que aumento do conteúdo de G+C no DNA gera um incremento na Tm ocasionado pelo maior número de ligações de H. Temperatura de Anelamento É a temperatura na qual os primers se pareiam ao DNA molde. Ela pode ser calculada a partir da Tm. T anneal = Tm_primer 4 C

26 Estringência no Anelamento do Primer - A estringência determina a especificidade no produto de DNA a ser amplificado. - T anneal é o fator mais significante que afeta a estringência no anelamento do primer. -T anneal : Muito baixa = menor estringência = primer pareia em qualquer lugar. muito alta = maior estringência = primer pode não parear.

27 Estrutura interna do primer - Evitar essas estruturas.....pode-se utilizar primers com estas estruturas se estas forem formadas a uma temperatura em torno de 30 C menor que a Tm

28 atgatagaggctctcgaagctgaggtgaccaggagaacgctcgagtttgacacgtgtaaa M I E A L E A E V T R R T L E F D T C K gtcgtcgctctcccaatggtataa V V A L P M V * Tm = 4 (G+C) + 2 (A+T) 5 - atgatagaggctctcgaagctgaggtgaccaggagaacgctcgagtttgacacgtgtaaagtcgtcgctctcccaatg 3 - tactatctccgagagcttcgactccactggtcctcttgcgagctcaaactgtgcacatttcagcagcgagagggttac gtataa 3 catatt atgatagaggctctcgaag ttataccattgggagagcg 3


30 RT REVOLUTION PRIMERS UTILIZADOS Oligo(dT) Somente mrna Hexâmeros randômicos - Anelamento em regiões aleatórias Primer específico do gene - Amplificação somente do gene alvo

31 Bibliotecas

32 Expressed Sequence Tags (ESTs) Extrair RNA de diferentes tecidos/condições cdna 5 EST 3 EST Clonar em vetor Bibliotecas

33 Full-Lenght cdna

34 Controle Tratado Northern Eletrônico Extração de RNA e síntese de cdna sequenciamento sequenciamento clusterização Sequência consenso tratado controle = 2x

35 Biblioteca subtrativa RNA Pools Control Treated 1-cDNA synthesis Driver Tester 2-cDNA digestion with 4 cutter enzyme Driver Driver and Tester Tester Adaptors 3-Adaptor ligation to tester sample 4-Tester/ driver hybridization No amplificated Linear Amplification Exponential Amplification 5-PCR with primers that anneal specifically to adaptor previously ligated to tester sample Eliminated Eliminated Enriched Tester 6-Enrichment of cdna library in genes preferentially expressed in tester sample

36 Fluoróforos e molecular beacons Cianinas Emissão fluorescente nm (região do verde do espectro de luz) Emissão fluorescente nm (região do verde do espectro de luz) Emissão fluorescente nm (região do verde do espectro de luz) SYBR GREEN

37 molecular beacons Loop complementar a seqüência alvo

38 PCR Quantidade X Qualidade Análise Qualitativa Visa detectar a presença ou não do gene Análise Quantitativa Visa detectar a quantidade (expressão) do gene na amostra Difícil diferenciar 10 cópias de 50 cópias em gel de agarose

39 Detecção do Real Time PCR Detecção do PCR tradicional

40 SYBR green assay SYBR se liga a DNA dupla fita e fluoresce. Durante o processo de amplificação, a fluorescência vai aumentando, tornando mais fácil a quantificação de DNA

41 Taq Man Sonda anela no gene alvo Polimerase desloca repórter liberação de fluorescência verde Polimerase desloca quencher



44 Clonagem de genomas DNA genômico Quebrar em pedaços aleatórios ~2000pb (shotgun) reads clonar em vetor sequenciamento

45 Reconstrução do DNA original a partir do fragmentos (clusterização) reads Sequência consenso (DNA original) A reconstrução é feita a partir de sobreposição dos fragmentos

46 Shotgun de pedaços do genoma DNA genômico Quebrar em pedaços aleatoriamente desde 50Kpb até 300Kpb Clonar em BAC s e sequenciar apenas as pontas de cada fragmento ~800 bp ~800 bp Quebrar em pedaços de 2000pb clonar em vetor e sequenciar os fragmentos

47 Primer Walking Vector Clone to sequence Primer Sequence New Primer Sequence Repeat Sempre desenhar o primer de forma que a sequência amplificada tenha sobreposição com a anterior (tipicamente 100 pb de sobreposição)




51 denaturação anelamento dos primers


53 TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCC O programa PHRED lê o chromatograma identificando e dando uma nota para cada base que forma a sequência :

54 - A identificação dos picos é feita através de uma transformada de fourier do sinal - A nota é ligada com a resolução entre os picos vizinhos e a altura do background

55 Analisando o cromatograma Região de qualidade alta Picos bem definidos e grandes. Linha de base boa. Distância entre picos anterior e posterior constante.

56 Região de qualidade média poucas ambigüidades Picos razoavelmente bem definidos e de tamanho médio. Linha de base boa a razoável. Distância entre picos anterior e posterior razoável.

57 Região de qualidade baixa baixa confiabilidade Picos mal definidos e de tamanho pequeno. Linha de base confusa. Distância entre picos anterior e posterior inconstante.

58 Pirosequenciamento Roche (454) GS FLX sequencer

59 Fita simples Reação de degradação Câmera de CCD

60 Shotgun do genoma inteiro DNA genômico Quebrar em pedaços aleatórios ~2000pb (shotgun) Ligação do adaptador e separação em fita simples

61 - O adaptador permite que o DNA se ligue em grânulos minúsculos (diâmetro de 28 mm). Apenas um DNA é ligado em cada grânulo - Os grânulos são envolvidos em gotas de óleo que contêm todos os reagentes necessários para amplificar o DNA - Cada gota contendo o grânulo é mantida isolada para evitar contaminação e consegue produzir 10 milhões de cópias numa reação de pirosequenciamento - Um pmol de DNA numa reação de pirosequenciamento produz moléculas de ATP gerando mais de 10 9 fótons, num comprimento de onda de 560 nm, e num período de 3-4 segundos. Facilmente detectado por uma câmera de CCD



64 O sequenciador 454 Câmara de fluxo contendo as amostras e as fibras ópticas (1,6 milhões/slide) Câmera de CCD Bombeamento de fluídos Computador

65 Pirograma Linearidade é mantida até homopolímeros de 8 nt

66 Illumina/Solexa Genome Analyzer Sequenciamento por síntese + clustering PCR

67 - O adaptador permite que o DNA se ligue a uma placa na superfície dos canais de fluxo - PCR em fase sólida permite que as moléculas resultantes de uma PCR fiquem próximas. Ciclo é repetido várias vezes - Adição de polimerase, primers e de nucleotídeos, - Adição de polimerase, primers e de nucleotídeos, marcados por fluoróforos, com o 3 OH inativado adição de um nucleotídeo por vez. Após incorporação, há a detecção do fluoróforo, reverte-se a inativação do 3 OH e e retira-se o fluoróforo. Ciclo se repete.



70 Applied Biosystems SOLiD TM Sequencer

71 - O adaptador ligado ao DNA e a grânulos magnéticos. Ocorre PCR em emulsão e as fitas de DNA são depositadas numa placa - Ligação de primer universal n ao adaptador e de óligos degenerados (7 bases) marcados contendo duas primeiras bases fixas. - Ocorre detecção do sinal, clivagem das duas últimas bases e adição de novos óligos - Ao fim de n rounds, a fita resultante é liberada e há a ligação de um novo primer universal, (agora n-1). Ciclo se repete mais três vezes (até n-4).





76 Sanger vs Novas tecnologias SANGER Depende de clonagem em bactéria (2 semanas de trabalho) 1 milhão de pb em 24 horas Novas tecnologias Não há clonagem Reads de ~700 bp Reads de 200 a 25 pb Clones de fita dupla permitem seqüenciamento em ambas direções (facilita orientação e montagem) 6 meses de sequenciamento, 24 horas por dia, para sequenciar o genoma de um fungo Milhões de bp em menos de 4 horas Fragmentos fita simples não permitem seqüenciamento em ambas direções. Aplicação da técnica de paired-end 24 horas para sequenciar o genoma de um fungo Conclusão : a união faz a força

77 Novas Tecnologias Sequencing chemistry Amplification approach Paired ends/separation 454 Solexa SoliD Pyrosequencing Polymerase-based sequencingby-synthesis Ligation-based sequencing Emulsion PCR Bridge amplification Emulsion PCR Yes/3 kb Yes/200 bp Yes/3 kb Mb/run 100 Mb 1300 Mb 3000 Mb Time/run (paired ends) 7 h 4 days 5 days Read length 250 bp bp 35 bp Cost per run (total direct a ) $8439 $8950 $ Cost per Mb $84.39 $5.97 $5.81 Sibele Borsuk Sibele Borsuk Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA Sibele Borsuk Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14 4/11/14 Aula 2 Sequenciamento de genomas procariotos utilizando tecnologia de nova geração Introdução ao sequenciamento de nova geração Ana Marcia de Sá Guimarães, Méd Vet, MSc, PhD Aula 2 Tópicos 1. Sequenciamento

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais


ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais


Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D

Rachel Siqueira de Queiroz Simões, Ph.D Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais


WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ Diagnóstico molecular para Campylobacter spp.

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Novas Tecnologias de Sequenciamento

Novas Tecnologias de Sequenciamento Novas Tecnologias de Sequenciamento Tecnologias de sequenciamento Sanger (Capilaridade) Uma das inovações tecnológicas de maior influência na pesquisa biológica, desde que foi lançada em 1977 Abordagem

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais


SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Polymerase Chain Reaction

Polymerase Chain Reaction Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF PCR Desenvolvida

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais


RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

The next generation sequencing

The next generation sequencing The next generation sequencing Cesar Martins ( Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP 1 Métodos Atuais Sequenciamento

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais


PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais


LICENCIATURA EM MEDICINA LICENCIATURA EM MEDICINA Disciplina de Biologia Molecular (2º Ano) Ano Lectivo de 2006/2007 3º AULA PRÁTICA 1 - Introdução à tecnologia de PCR 1.1. A reacção de PCR Príncipios e variantes da técnica 2.

Leia mais

Conceitos Básicos de Técnicas em Biologia Molecular

Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 1 2 Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 3 ISSN 0103-0205 Setembro, 2008 Empresa Brasileira

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais



Leia mais



Leia mais

Seqüenciamento (continuação )

Seqüenciamento (continuação ) Seqüenciamento (continuação ) Embrapa Recursos Genéticos e Biotecnologia Novas metodologias promissoras (2001) Seqüenciamento por hibridização Khrapko et al. (1989). FEBS Lett. 256: 118-122

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático)

TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) TEÓRICA 6 DOCENTES: Prof. Helena Galvão (responsável componente teórico) Prof. Margarida Reis (componente prático) VIRUS CONCEITOS E DEFINIÇÕES Características: 1. Não têm estrutura celular, mas multiplicam-se»

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais


ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais


CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais


BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Sequenciamento de DNA em

Sequenciamento de DNA em Sequenciamento de DNA em MegaBACE DNA Analysis Systems Prof. Dr. Luciano da Silva Pinto TGTGAACACACGTGTGGATTGG... Sequenciamento do DNA Definição Identificação da ordem exata dos pares

Leia mais

Transgênicos - 3º. Colegial Professor Fernando

Transgênicos - 3º. Colegial Professor Fernando Transgênicos - 3º. Colegial Professor Fernando 1. (Ufsm) Bioma é uma região com o mesmo tipo de clima, possui plantas e animais característicos [Planeta Terra: Ecossistemas, 2008]. Mas, como a interferência

Leia mais

Dezembro - 2006. Bioinformática. e Anotação. Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP

Dezembro - 2006. Bioinformática. e Anotação. Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP Dezembro - 2006 Bioinformática e Anotação Eduardo Fernandes Formighieri Laboratório de Genômica e Expressão / UNICAMP Hoje 1. Introdução à Genômica 2. Introdução à Bioinformática 3. Introdução à Anotação

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais



Leia mais

O que é a Reacção em Cadeia da Polimerase (PCR)?

O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? 3 5 F R 3 5 Um processo para multiplicar selectivamente um determinado segmento de DNA Esse segmento pode

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais


ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA GENÉTICA BACTERIANA INTRODUÇÃO O DNA existe como uma hélice de fita dupla, mantidas pelo pareamento de bases nitrogenadas específicas (AT; CG). - A seqüência de bases codifica a informação genética; -

Leia mais


PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min

Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min Nome: Curso: Nº Exame de 1ª Época Engenharia Genética 16 de Janeiro de 2009 Duração: 2h30min As bactérias Gram-negativas como Salmonella typhi têm de se adaptar a uma variedade de stresses ambientais extremos

Leia mais

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction)

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) - Realiza a replicação selectiva e rápida de uma sequência específica de nucleotídeos a partir de uma mistura complexa de DNAs amplificação

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais


MAPA DO CROMOSSOMA DE E.coli REPLICAÇÃO DE DNA MAPA DO CROMOSSOMA DE E.coli TERMINOLOGIA Regras básicas para a designação de genes e proteínas: Genes bacterianos 3 letras minúsculas em itálico que reflectem a sua função aparente Ex:

Leia mais

KT6384. Tecnologista em Saúde Pública. Prova Objetiva e Discursiva. Genômica e Sequenciamento de DNA

KT6384. Tecnologista em Saúde Pública. Prova Objetiva e Discursiva. Genômica e Sequenciamento de DNA Genômica e Sequenciamento de DNA Tecnologista em Saúde Pública Prova Objetiva e Discursiva 01. Durante o processo de replicação do DNA, a enzima requerida para a ligação entre as extremidades dos fragmentos

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais


Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

CLONAGEM DE DNA. CLONAGEM: é multiplicar assexuadamente. Primeiros experimentos bem sucedidos de clonagem foram mostrados no início da década de 1970.

CLONAGEM DE DNA. CLONAGEM: é multiplicar assexuadamente. Primeiros experimentos bem sucedidos de clonagem foram mostrados no início da década de 1970. Clonagem de DNA CLONAGEM DE DNA CLONAGEM: é multiplicar assexuadamente. Na Biologia Molecular, significa mais especificamente crescer uma colônia de bactérias a partir de uma célula única. Clonagem de

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais


ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

PCR Reação de Polimerase em Cadeia. Termociclador

PCR Reação de Polimerase em Cadeia. Termociclador PCR Reação de Polimerase em Cadeia Termociclador REAÇÃO EM CADEIA DA POLIMERASE (PCR) Técnica que permite a amplificação da quantidade de DNA específico utilizando a enzima Taq DNA polimerase, sequências

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais



Leia mais