TECNOLOGIA DO DNA RECOMBINANTE

Tamanho: px
Começar a partir da página:

Download "TECNOLOGIA DO DNA RECOMBINANTE"

Transcrição

1 UNIVERSIDADE DE SÃO PAULO FACULDADE DE MEDICINA DE RIBEIRÃO PRETO TECNOLOGIA DO DNA RECOMBINANTE Alexandra A. C. Nacimento Enilza Maria Epreafico Maria Luia Paçó Laron Nádia Monei Nilce Maria Martinez Roi Vanderlei Rodrigue Revião 1: Eliana Valéria Patui Márcia A. S. Graminha Revião 2: Fábio Márcio Squina Joane de Freita Soua Roberto Ruller Valeria Valente 2003

2 I. CONCEITOS BÁSICOS 1. INTRODUÇÃO Até a década de 70, o DNA era o componente celular mai difícil de er analiado. Sua equência de nucleotídeo de enorme tamanho e monotonia química era geralmente analiada atravé de meio indireto como a equência de proteína e análie genética. A partir da década de 70 nova tecnologia foram deenvolvida permitindo o iolamento e a purificação de gene epecífico num proceo chamado de clonagem gênica. Na verdade, muita deta técnica ão proveniente da Microbiologia, Bioquímica, Imunologia e Genética Microbiana e permitiram que a análie do DNA ganhae um novo enfoque. O DNA tornou-e então, a molécula mai fácil de er analiada, endo poível iolar regiõe epecífica, obtê-la em grande quantidade e determinar a ua eqüência numa velocidade de milhare de nucleotídeo por dia. A Tecnologia do DNA recombinante, como e convencionou denominar ete conjunto de técnica, tem uma ampla aplicação. Ela pode er uada para etudar mecanimo de replicação e expreão gênica, na determinação da eqüência de um gene e coneqüentemente da proteína que ele codifica, ou no deenvolvimento de cultura microbiana capaze de produzir ubtância útei tai como a inulina humana, hormônio de crecimento, vacina e enzima indutriai em grande quantidade. Sua aplicação comercial ou biotecnológica parece ter um potencial inegotável. Como coneqüência do deenvolvimento deta tecnologia é atualmente poível realizar invetigação de paternidade e o diagnótico de doença genética e infeccioa atravé da análie de DNA. 2. CONCEITO DE CLONAGEM MOLECULAR A origem do termo clonagem vem da Genética Bacteriana que conidera uma colônia de bactéria como um clone porque todo o indivíduo ão geneticamente idêntico à bactéria inicial. A técnica central da metodologia do DNA recombinante é a clonagem molecular, a qual conite no iolamento e propagação de molécula de DNA idêntica. A clonagem molecular compreende pelo meno doi etágio importante. Primeiro, o fragmento do 1

3 DNA de interee chamado de inerto é ligado a uma outra molécula de DNA chamada de vetor para formar o que e chama de DNA recombinante. Segundo, a molécula do DNA recombinante é introduzida numa célula hopedeira compatível, num proceo chamado de tranformação. A célula hopedeira que adquiriu a molécula do DNA recombinante é agora chamada de tranformante ou célula tranformada. Um único tranformante, em condiçõe ideai, ofre muito ciclo de divião celular, produzindo uma colônia que contém milhare de cópia do DNA recombinante. 3. ENZIMAS DE RESTRIÇÃO Em 1953 foi decrito um etranho fenômeno no qual a eficiência da replicação de um bacteriófago (víru de bactéria) dependia da célula hopedeira na qual ele etava inerido. Algum tempo depoi percebeu-e que a inabilidade de certo fago crecerem em determinada linhagen bacteriana era devido a preença de nucleae altamente epecífica que clivavam o eu DNA. Ito pode er encarado como um itema de defea bacteriano que degrada DNA que lhe é etranho (retrição). A bactéria protege eu próprio DNA deta degradação camuflando-o atravé da metilação de alguma bae epecífica (modificação). Como coneqüência, ete itema é frequentemente decrito como fenômeno da retrição/modificação e exite em um grande número de bactéria. A enzima de retrição ou endonucleae de retrição ão dividida em vária clae, dependendo da etrutura, da atividade e do ítio de reconhecimento e clivagem. A enzima do Tipo II, a mai importante na Tecnologia do DNA Recombinante, ão proteina monomérica ou dimérica e clivam o DNA no memo ítio do eu reconhecimento. O ítio de reconhecimento dete tipo de enzima é normalmente uma eqüência palindrômica, ito é, ela tem um eixo de imetria e a eqüência de bae de uma fita é a mema da fita complementar, quando lida na direção opota (Figura 1). 2

4 a) Clivagem no eixo de imetria b) Clivagem imétricamente ituada ao redor do eixo de imetria...tc GA......AG CT......GAA TTC......CTT AAG Molécula com extremidade abrupta Molécula com extremidade coeiva Figura 1. O doi tipo de clivagem feito por enzima de retrição. A eta indicam o ítio de clivagem e a linha pontilhada repreentam o centro de imetria da equência. Eta enzima reconhecem eqüência epecífica de 4 a 8 pare de bae (pb) na molécula de DNA e fazem doi corte, um em cada fita. Há 2 tipo ditinto de clivagen: a) o doi corte ocorrem no eixo de imetria da eqüência epecífica, gerando extremidade abrupta, ou b) o corte ão feito imetricamente, porém, fora do eixo de imetria, gerando extremidade coeiva. Ete doi tipo de clivagen e ua coneqüência etão motrado na Figura 1. Atualmente, mai de 1000 enzima de retrição já foram identificada. A nomenclatura deenvolvida foi baeada na abreviação do nome do microrganimo do qual a enzima foi iolada. A primeira letra repreenta o gênero e a outra dua a epécie, eguido de um algarimo romano (ou outra letra) que indica a ordem da decoberta ou a linhagem da qual ela foi iolada. Por exemplo, a enzima de retrição denominada de EcoRI é purificada de uma Echerichia coli que carrega um fator de tranferência de reitência RI, enquanto que a Hind III é iolada da Haemophilu influenzae, linhagem d III. A Tabela 1 motra a eqüência palindrômica e o local de clivagem de alguma enzima de retrição. Note que alguma enzima deixam terminaçõe coeiva enquanto que outra fazem corte abrupto ou não coeivo. 3

5 Microrganimo Enzima Sequência Alvo Echerichia coli EcoRI G A A T T C C T T A A G Bacillu amyloliquefacien H BamHI G G A T C C C C T A G G Bacillu globigii BglII A G A T C T T C T A G A Haemophilu aegyptiu HaeII P u P i y G C G C P i C G C G Pu Haemophilu aegyptiu HindIII A A G C T T T T C G A A Providencia tuartii PtI C T G C A G G A C G T C Streptococcu albu G SalI G T C G A C C A G C T G Thermu aquaticu TaqI T C G A A G C T Brevibacterium albidium BalI T G G C C A A C C G G T Haemophilu aegyptiu HaeIII A G G C C T T C C G G A Serratia marcecen SmaI C C C G G G G G G C C C Tabela 1. Alguma endonucleae de retrição: origem e ítio de clivagem. A eta indica o local de clivagem. Pu e Pi referem-e, repectivamente, a qualquer purina e pirimidina. O interee por eta enzima de retrição aumentou em 1973 quando e percebeu que ela poderiam er uada para fragmentar o DNA deixando extremidade de fita imple de DNA que permitiam a ligação do fragmento. Ito ignificava que a recombinação poderia er efetuada em tubo de enaio. Além dito, DNA bacteriano poderia recombinar com DNA humano ou de qualquer outra epécie, abrindo a poibilidade de clonar gene humano ou iolar proteína de cultura bacteriana. Uma importante coneqüência da epecificidade deta enzima de retrição é que o número de clivagen feito por cada uma dela no DNA de qualquer organimo é definido e 4

6 permite o iolamento de fragmento dete DNA. Portanto, cada enzima de retrição gera uma família única de fragmento quando cliva uma molécula de DNA epecífica. Enzima que reconhecem ítio de retrição compoto por 4 pare de bae clivam o DNA em média a cada 256 nucleotídeo (4 4 =256). Aquela que reconhecem ítio com 6 e 8 pb clivam o DNA em média a cada 4096 e pb, repectivamente. No entanto, eta média pode ofrer variaçõe ignificativa, dependendo principalmente da compoição de bae do DNA analiado. Por exemplo, a enzima NotI reconhece um ítio de retrição contendo 8pb, incluindo nucleotídeo CpG, que raramente ocorre no DNA de mamífero. A família de fragmento gerado por digetão com enzima de retrição é geralmente detectada pela eparação dete fragmento por eletroforee em gel de agaroe. O fragmento migram em função de eu peo moleculare endo que o menore migram mai rapidamente (Figura 2). Pare de bae Sentido da migração Figura 2. Molécula de DNA de tamanho diferente podem er eparada por eletroforee. Molécula menore movem-e mai rapidamente que molécula maiore, tornando-e portanto eparada em banda. O DNA é corado com brometo de etídio, uma molécula que fluorece quando iluminada com luz Ultra Violeta. 4. CONSTRUÇÃO DO DNA RECOMBINANTE Uma enzima de retrição particular reconhece omente uma eqüência única de bae. DNA de origen diferente ob a ação da mema enzima de retrição produzem fragmento com o memo conjunto de extremidade fita imple. Portanto, fragmento de 5

7 doi diferente organimo (por exemplo, bactéria e homem) podem er ligado por renaturação da regiõe de fita imple. Além dito, e a ligação for "elada" com a enzima DNA ligae, depoi do pareamento de bae, o fragmento erão ligado permanentemente. A técnica de DNA recombinante tem um interee epecial e uma da fonte de DNA clivado for um plamídeo. TGCA ACGT Plamídeo de E.coli DNA humano TGCA TGCA ACGT ACGT Enzima Enzima GCA T T ACG DNA ligae TGCA ACGT TGCA ACGT Plamídeo híbrido Figura 3. Contrução de uma molécula de DNA híbrida a partir de fragmento de diferente organimo obtido com o uo de enzima de retrição. A figura 3 motra uma molécula de DNA de plamídeo que tem omente um ítio de clivagem para uma determinada enzima de retrição. A mema enzima é uada para clivar DNA humano. Se o fragmento de DNA humano ão miturado com o DNA plamidial linearizado, permitindo a ligação entre ele, uma molécula de DNA plamidial contendo DNA humano pode er gerada. Ete plamídeo híbrido pode er inerido numa bactéria atravé de tranformação e então o inerto erá replicado como parte do plamídeo. Geralmente, antibiótico ão acrecentado ao meio da cultura para elecionar omente a linhagen que portam o plamídeo (o plamídeo uado para eta finalidade porta reitência a pelo meno um antibiótico). 6

8 5. DNA LIGASE Conforme mencionado anteriormente, eta enzima promove a ligação do fragmento de DNA em vetore previamente clivado por endonucleae de retrição. A DNA ligae requer um grupo OH livre na extremidade 3' de uma da cadeia de DNA e um grupo fofato na extremidade 5' da outra cadeia (Figura 4). A E.coli e o fago T4 codificam uma DNA ligae capaz de elar fragmento de DNA com dupla fita. DNA ligae iolada de E.coli e de outra bactéria requer NAD+, enquanto que a iolada do bacteriófago T4 requer ATP como cofator. O DNA 3 OH + - O P O 5 DNA - O DNA-Ligae ATP ou NAD O DNA 3 O P O 5 DNA - O Figura 4. DNA ligae cataliza a junção de dua fita de DNA que ão parte da molécula da duplahélice Tipo de fragmento de DNA que ão ligado pela DNA ligae a) Fragmento com extremidade coeiva A extremidade coeiva produzida por vária enzima de retrição permitem que doi fragmento de DNA ejam mai facilmente ligado. Ito porque ocorre inicialmente o pareamento da fita imple da extremidade coeiva da dua diferente molécula, atravé da formação de ponte de hidrogênio pela complementariedade da bae. Finalmente, a ligação covalente (fofodiéter) do fragmento é realizada pela DNA ligae (ver figura 4). b) Fragmento com extremidade não coeiva DNA portando extremidade não coeiva ão ligado com muito meno eficiência que aquele que tem extremidade coeiva. Uma concentração muito maior de DNA ligae 7

9 e memo do DNA envolvido é neceária para que a molécula com extremidade não coeiva ofram reação de ligação. No entanto, a ligação dete tipo de fragmento é facilitada pela tranformação prévia da extremidade não coeiva em coeiva. Ete procedimento pode er feito atravé de doi proceo: a) Adição de polideoxiadenina na extremidade 3' de um fragmento de DNA e polideoxitimina na extremidade 3' de um outro fragmento de DNA, atravé da enzima deoxinucleotidil-tranferae-terminal ou implemente tranferae. Eta enzima, uma DNA polimerae incomum, adiciona nucleotídeo à extremidade 3 -OH de fragmento fita imple proeminente de uma cadeia de DNA. Para gerar ete tipo de extremidade proeminente a molécula é tratada previamente com uma exonucleae 5 -epecífica para remover algun nucleotídeo terminai. Apó a mitura do doi tipo de fragmento complementare e anelamento do memo, a molécula ão unida preenchendo-e o epaço exitente com o auxílio da DNA pol I e elando-o com DNA ligae (Figura 5) b) Adição de adaptadore à extremidade não coeiva. O adaptadore ão oligonucleotídeo intético que contém ítio de clivagem para uma ou mai enzima de retrição. Ele ão unido ao DNA com o auxílio da DNA ligae (Figura 6). Alternativamente, no lugar de modificar a extremidade não coeiva, pode-e optar pela utilização de T4 ligae em grande concentração, o que permitirá a ligação entre molécula de DNA em proeminência. 6. TRANSFORMAÇÃO BACTERIANA 6.1.Conceito de tranformação induzida O proceo de tranformação contitui um evento de alta importância na técnica de manipulação gênica. A tranformação natural decrita por Griffith, em 1928, e por Avery e colaboradore, em 1944, é um evento raro. No entanto, em 1970, Mandel e Higa encontraram que a E.coli tornou-e marcadamente competente para tranformação com DNA exógeno, quando a bactéria foi upena em cloreto de cálcio gelado e ubmetida a um curto choque térmico à 42oC. Ete memo autore também verificaram que a bactéria crecida até a fae log eram mai competente do que aquela iolada de outro etágio do crecimento. 8

10 Exonucleae epecífica Deoxinucleotídio tranferae terminal +datp +dttp AAAA TTTT AAAA TTTT Epaço preenchido com DNA Pol I. DNA ligae para completar a ligação Figura 5. Fragmento de DNA com extremidade não coeiva podem er tranformada em coeiva pela adição de poli (A) e poli (T). Vetor GAATTC CTTAAG DNA a er inerido + GAATTC CTTAAG Adaptador Sintético T4 DNA ligae EcoRI GAATTC CTTAAG GAATTC CTTAAG EcoRI G CTTAA AATTC G AATTC G G CTTAA Figura 6. Fragmento de DNA com extremidade não coeiva podem er tranformado em coeiva pela adição de adaptadore e poterior tratamento com a enzima de retrição que reconhece o adaptador. 9

11 O procedimento do cloreto de cálcio que é uado até hoje produz uma eficiência de tranformação da ordem de 105 a 107 tranformante por micrograma de DNA (a eficiência de tranformação é geralmente exprea como o número de célula tranformada, obtido a partir de um micrograma de DNA plamidial intacto). O tamanho e a conformação da molécula do DNA, afetam o proceo de tranformação. Plamídeo pequeno ão mai facilmente incorporado pela célula bacteriana competente; DNA linear é pobremente incorporado, talvez pelo fato de ofrer degradação pela enxonucleae preente no epaço periplamático Mecanimo de captação do DNA O mecanimo de captação da molécula do DNA pela bactéria competente ainda é deconhecido. Uma hipótee é que a molécula do DNA paam atravé de canai ituado na chamada zona de adeão, que ão locai onde a membrana interna e externa da célula bacteriana unem-e formando poro. Ete poro ó etão preente durante o crecimento bacteriano (fae de crecimento exponencial). Em condiçõe naturai, a captação do DNA torna-e difícil devido a repulão eletrotática exitente entre a carga negativa da camada de fofolipídeo da membrana bacteriana e do grupo fofato da molécula do DNA. O papel do cálcio é explicado pela hipótee de que a 0oC a fluidez da membrana celular é critalizada, etabilizando a ditribuição do fofato carregado. O íon Ca +2 formam um complexo com ete grupamento, cobrindo a carga negativa e aim facilitando a atração eletrotática com a molécula do DNA na zona de adeão. O choque térmico, complementa ete proceo de captação, provavelmente criando um debalanço térmico entre o interior e o exterior da célula bacteriana, auxiliando o bombeamento do DNA atravé da zona de adeão. A figura 7 ilutra ete proceo. 10

12 DNA genômico Célula Bacteriana - Zona de adeão Plamídeo Bicamada lipídica (interna) Camada peptido glucan Bicamada lipídica (externa) Fofolipídeo Íon de cálcio Figura 7. Mecanimo molecular propoto para explicar a tranformação de E. coli com uma molécula de DNA exógeno. II. VETORES DE CLONAGEM MOLECULAR Apó o iolamento de uma informação genética, por exemplo um fragmento de DNA obtido pela clivagem com enzima de retrição, ete fragmento deverá er inerido numa outra molécula de DNA diferente, capaz de amplificar aquela informação genética em centena de cópia. Ete proceo de amplificação é obtido atravé do uo de molécula de DNA que ão o chamado vetore de clonagem molecular. Atualmente, o tipo báico de vetore uado na metodologia do DNA recombinante apreentam caracterítica epeciai que o tornam excelente veículo de clonagem em diferente ituaçõe. A eguir, vamo apreentar o principai tipo de vetore atualmente em uo na biologia molecular. 11

13 1. PLASMÍDEO Plamídeo ão pequena molécula de DNA dupla fita, contendo o elemento neceário para a ua replicação e pelo meno um gene que confere reitência a antibiótico. Ete elemento genético extra cromoomai variam de 5 a 400 kilobae e comumente etão preente em dua ou mai cópia por célula. O plamídeo preente num grande número de cópia ão uado como veículo de clonagem dede que capacitem a amplificação do egmento do DNA nele clonado. Um plamídeo para er um bom vetor de clonagem deve conter a eguinte propriedade: a) pouir uma origem de replicação (O), ou eja, uma eqüência de DNA que permita que o vetor eja replicado na célula hopedeira; b) apreentar doi ou mai ítio único de clivagem para endonucleae de retrição. O conjunto dete ítio, denominado de Múltiplo Sítio de Clonagem (MSC), é o local onde o inerto é incorporado ao vetor de clonagem; c) pouir um gene que codifica um produto que ditingue a célula tranformada da célula não tranformada. Por exemplo, muito vetore de clonagem carregam o gene que confere reitência à ampicilina (Amp R ). A célula tranformada com tai vetore ão capaze de crecer num meio contendo o antibiótico, enquanto que a célula não tranformada acabam morrendo. A figura a eguir ilutra a principai caracterítica etruturai de um plamídeo. O AmpR MSC Figura 8. Etrutura molecular de um plamídeo típico uado em clonagem molecular. Etão repreentado o gene de reitência (Amp R ), a região de múltiplo ítio de clonagem (MSC) e a origem de replicação (O). 12

14 Um do pao fundamentai no proceo de clonagem molecular é o uo de enzima de retrição que produz extremidade compatívei durante a clivagem do DNA a er clonado (inerto) e a do DNA receptor (vetor). Uma vez que o DNA foi ligado ao vetor, eta molécula híbrida deverá er introduzida numa célula hopedeira geralmente bactéria, por um proceo chamado de tranformação, para que o vetor poa ofrer replicaçõe e conequentemente amplificar o número de cópia do inerto. A bactéria tranformada erá facilmente reconhecida pela aquiição de um novo fenótipo dado pelo plamídeo, ou eja, capacidade de crecer em meio contendo antibiótico. 2. FAGOS Um do vetore mai utilizado no proceo de clonagem molecular é o denominado bacteriófago, o qual comporta-e como um víru da E.coli. Ante de analiarmo o uo dete elemento como veículo de clonagem molecular, vamo motrar reumidamente a ua propriedade biológica e etruturai. 2.1 Biologia do fago O fago λ é um paraita obrigatório da E.coli, o qual neceariamente deve injetar o eu DNA na bactéria hopedeira para a ua multiplicação. Apó a infecção da E.coli o genoma do fago pode eguir dua via: a) No primeiro cao denominado etado lítico, o DNA do fago permanece na bactéria como uma molécula independente, havendo a ativação de algun gene do fago e a concomitante inativação de outro, dentro de um programa etritamente definido. Como reultado o cromoomo do fago é replicado ativamente, ocorre a íntee da proteína da capa e da cauda e formam-e nova partícula virai. Em aproximadamente 45 minuto apó a infecção a célula hopedeira é liada havendo a liberação de cerca de 100 novo fago. b) A outra via que o cromoomo do fago pode eguir é o denominado etado liogênico. Nete cao, o DNA do fago é integrado no cromoomo da bactéria paando a er chamado profago. No etado liogênico, todo o gene do profago etão inativo com exceão do gene que produz a proteína repreora. A bactéria hopedeira carregando o profago multiplica-e e ete é replicado paivamente e ditribuído para a bactéria decendente. 13

15 Em condiçõe naturai a opção entre eguir o etado lítico ou liogênico depende da condiçõe do meio. Aim, via de regra, em meio rico em nutriente o etado lítico é preferencial, por exemplo o fago λ na bactéria E.coli intetinal. Por outro lado, em meio pobre de nutriente como é o cao da E.coli no olo, o fago prefere o etado liogênico. Em condiçõe experimentai, o etado a er eguido depende de um balanço entre o fatore do meio intra e extra celular e de fatore genético da bactéria hopedeira e do bacteriófago. 2.2 Genoma do fago O bacteriófago λ é uma partícula viral contituída de aproximadamente 50% de proteína e 50% de DNA. O DNA do fago λ, na forma como ele é iolado da partícula viral, é uma molécula linear com dupla fita de aproximadamente pare de bae. A extremidade da molécula contêm uma fração de DNA fita imple com cerca de 12 nucleotídeo, o quai ão complementare na equência de bae e atravé dela é que o DNA aume a forma circular quando ele é injetado na célula hopedeira. Eta extremidade ão denominada de ítio co. O genoma do fago λ codifica para aproximadamente 50 proteína, cujo gene tem um cronograma de expreão bem definido, o que determina a intalação do etado lítico ou liogênico. A figura 9 e 10 ilutram o ciclo biológico do fago λ em uma célula hopedeira e o genoma do fago λ com algun do eu principai gene, repectivamente. 2.3 Controle de expreão do gene do fago Seja qual for a via a er eguida pelo fago λ, ou eja via lítica ou liogênica, a expreão do gene envolvido nete circuito começa pelo produto do gene N e Cro, regulado pelo promotore pl e pr repectivamente ituado à equerda (pl) e à direita (pr) do gene ci. Durante o trancuro da via lítica, o produto do gene cro etá diretamente relacionado com a replicação do genoma do fago λ, atravé da indução da expreão do gene OP. Por outro lado, o produto do gene N etá diretamente relacionado com a expreão do gene da região de empacotamento, ou eja gene A e J, reponávei pela 14

16 íntee da proteína da cabeça e da cauda do fago λ, como também da expreão do gene S e R, diretamente envolvido com a lie da célula hopedeira Figura 9. Replicação do fago λ no interior da célula hopedeira. Apó adorção (1) e injeção (2) do genoma do fago λ na bactéria, a via lítica indicada pelo número 3, 4 e 5 leva a formação de nova partícula virai. Alternativamente, a via liogênica (6) pode er ativada levando à integração do material genético viral ao genoma da bactéria hopedeira. Empacotamento Recombinação Regulação Replicação Lie co A J int.ciii ci cii O P S R N pl Cro pr Figura 10. Repreentação equemática do genoma do fago λ. Durante a via liogênica, a trancrição também inicia-e pelo promotore pl e pr coordenando a expreão do gene cii e ciii. O produto dete doi gene coordena a expreão do gene ci que produz uma proteína repreora inibindo a expreão do gene reponávei pelo empacotamento e a lie. Por outro lado, um outro gene importante é o int, 15

17 cujo produto relaciona-e com a integração do fago no genoma bacteriano etabelecendo o etado liogênico. 2.4 O uo do fago como vetor de clonagem molecular Durante o ciclo lítico, o gene envolvido no proceo de liogênia ão dipenávei e conequentemente a região de integração do genoma do fago pode er totalmente ubtituída por um outro fragmento de DNA, em que haja qualquer alteração no proceo envolvido na via lítica. Uma da maiore vantagen de uar o fago λ como vetor de clonagem é que o DNA inerido no fago é empacotado in vitro. Embora a eficiência de empacotamento eja cerca de 10%, uma vez que o fago ão empacotado teremo 100% de eficiência na infecção da E.coli hopedeira. Ete proceo é altamente eficiente quando comparado com o da tranformação bacteriana com plamídeo. Nete cao, o melhore reultado ituam-e ao redor de 10 8 tranformante por µg de DNA o que ignifica que meno de 1 em 1000 plamídeo ão incorporado na E.coli hopedeira. Atualmente, exitem vário derivado do fago λ no quai um ou mai ítio de retrição flanqueiam a região de recombinação, facilitando a ua ubtituição por um outro DNA. Ete ão o chamado vetore de ubtituição. Um exemplo típico dete vetore é o EMBL3, no qual a região de recombinação é flanqueada pela enzima de retrição EcoRI, BamHI e SalI. Ee vetor quando quando clivado pode receber fragmento de DNA variando de 10,4 a 20 kb, como motra a figura abaixo. Outro derivado do fago λ ão o chamado vetore de inerção. Nete tipo de vetor, o fragmento de DNA que podem er inerido devem ter no máximo até 7kb de tamanho para não alterar o proceo de empacotamento do genoma do fago. O vetore de inerção derivado do fago λ mai bem utilizado epecialmente na clonagem de cdna, ão o vetore λgt10 e o λgt11. Vamo a eguir fazer alguma conideraçõe obre ete doi tipo de vetore. No fago λgt10, o inerto geralmente cdna, é inerido no ítio da EcoRI ituado no gene repreor ci. O fago recombinante terá agora o gene ci obtruído e conequentemente durante a cultura provocará a lie da colônia de bactéria tranformada. Ea colônia liada ão viualizada como círculo com o centro claro (placa de lie), batante ditinto 16

18 da colônia não recombinante, que por pouírem o gene ci íntegro não ão liada e permanecem como colônia turva. DNA bacteriófago a b b b c EcoRI a b ligae c informaçõe deneceária ã replicação EcoRI empacotamento in vitro bacteriófago contendo gene do camundongo DNA camundongo Figura 11. Repreentação equemática da clonagem de um fragmento de DNA genômico no fago λ. A regiõe indicada por a contém toda a informaçõe neceária para replicação em E. coli e empacotamento in vitro. O diferente fragmento obtido da digetão do DNA de interee com enzima apropriada etão indicado pela letra b e c, onde omente c poui tamanho adequado para o empacotamento. Por outro lado, o fago λgt11 contêm um ítio de retrição EcoRI localizado num gene chamado LacZ, a 53 nucleotídeo do códon de término da enzima codificada por ee gene (β-galactoidae). Ea enzima, cuja expreão pode er induzida por IPTG (iopropil- 17

19 β-d-galactoídeo), degrada o ubtrato X-gal produzindo um precipitado de cor azul. Portanto, colônia de bactéria carregando o DNA do fago com o gene LacZ intacto (em inerto), na preença do indutor IPTG e do ubtrato X-gal, ficarão azui. Enquanto que, aquela portanto o DNA o fago que incorporou o inerto no ítio de EcoRI, não expream a β-galactoidade e permanecem de cor branca, o que facilita a identificação do clone recombinante. 3. COSMÍDEO A clonagem de fragmento de DNA no fago λ apreenta uma limitação, poi o fragmento a er clonado não pode er maior do que cerca de 15kb (Figura 12). Na maioria da veze, eta dimenão é uficiente para conter um gene completo, incluindo a equência flanqueadora. Entretanto, muito gene apreentam dimenõe da ordem de 35 a 40 kb e nete cao, a técnica uada para a clonagem dete tipo de fragmento é a chamada clonagem em comídeo. O comídeo, ão plamídeo que contêm um fragmento de DNA do fago λ que inclui o ítio co. Ete comídeo podem er uado como veículo de clonagem molecular empregando o itema de empacotamento in vitro que recontitui a etrutura do fago (cabeça e cauda) e aim é uado para infectar a célula hopedeira. A enzima do itema de empacotamento do fago λ reconhecem o doi ítio co ituado de 35 a 49 kb de ditância e nete cao, omente fragmento deta ordem de tamanho erão convenientemente empacotado. O DNA genômico de interee é clivado com uma enzima de retrição que produz grande fragmento de DNA, o quai erão ligado ao comídeo, também clivado com a mema enzima. A ituação ideal é que cada fragmento do DNA genômico apreente um ítio co na ua extremidade. Durante o empacotamento, a enzima do itema reconhecem o ítio co ituado a uma ditância dentro de 49Kb, clivam ete ítio e empacotam eta molécula. O DNA do comídeo é injetado no interior da célula hopedeira, circulariza igual ao DNA do fago e replica como um plamídeo normal, em expreão de qualquer função do 18

20 fago. A célula infectada erão elecionada com bae na reitência adquirida a um determinado antibiótico. A figura 12 ilutra um típico proceo de clonagem em comídeo. R Amp Sítio alvo de retrição fragmento de retrição de 35 a 40 kb co eleção de clone reitente a ampicilina DNA circulariza apó infecção Figura 12. Equema de clonagem em comídeo. 4. VÍRUS A biologia molecular do víru de DNA e RNA foi extenivamente etudada ante do advento da metodologia do DNA recombinante. O víru SV40, iolado de célula tumorai de macaco, foi um do primeiro itema virai utilizado para introduzir gene em célula de mamífero. O DNA do SV40 apreenta pare de bae e pode er dividido em dua regiõe quanto a expreão gênica viral. Eta regiõe ão chamada de região precoce e região tardia. 19

21 A região precoce é exprea atravé do ciclo lítico, enquanto que a expreão do gene da região tardia ocorre omente apó o início da replicação do DNA viral. Entre eta dua regiõe itua-e a origem de replicação do DNA do víru. Um produto de expreão da região precoce é o antígeno T, o qual é reponável pela tranformação maligna de célula não permiívei (célula na quai o víru não completa a ua replicação), como também pelo início da replicação viral em célula permiívei. O produto de expreão codificado pela região tardia correpondem à proteína que formam o capídeo da partícula viral. A figura 13 ilutra o genoma do viru SV40. o Expreão precoce Expreão tardia SV40 Genoma do SV40 Figura 13. O DNA do viru SV Clonagem no víru SV40 A produção de DNA recombinante no víru SV40, pode er realizada atravé da ubtituição do egmento de expreão precoce ou do egmento de expreão tardia. No primeiro cao, o víru recombinante não produz o antígeno T, ao pao que na egunda opção não haverá produção da proteína do capídeo. Entretanto, eta funçõe deletada podem er uprimida como veremo a eguir Clonagem no SV40 pela ubtituição da região tardia Quando a região tardia do SV40 é ubtituída com outro DNA, perde-e a expreão da proteína do capídeo (funçõe tardia). Para que o itema de clonagem 20

22 funcione adequadamente pode-e realizar a infecção imultânea com um outro víru SV40 que tem uma deleção no gene da região precoce, ma a região tardia intacta. Na célula co-infectada a proteína da região precoce erão produzida pelo víru recombinante e a proteína do capídeo pelo víru deletado. Como reultado, teremo a produção de uma população de partícula virai mita, ou eja, víru deletado e víru recombinante. A figura 14 ilutra ete procedimento. O Região funcional precoce SV40 Região funcional tardia gene da globina SV40 SV40-globina cotranfecção empacotamento e lie partícula Virai Figura 14. Clonagem no SV40 pela ubtituição da região tardia 21

23 Clonagem no SV40 pela ubtituição da região precoce Quando a clonagem no SV40 é feita na região precoce, a produção de partícula virai depende do uprimento, por uma outra fonte, da proteína codificada pela região precoce (antígeno T). Para evitar uma infecção mita com um víru SV40 deletado, ua-e uma linhagem celular, a célula COS a quai, apreentam uma porção do genoma do SV40 integrado ao eu próprio cromoomo. Eta linhagem celular produz a proteína viral denominada antígeno T, a qual liga-e na origem de replicação do víru e induz a ua replicação. A figura 15 ilutra ete tipo de clonagem. Apear dete itema viral ter ido uado como vetor de expreão em muita etratégia de clonagem, exitem alguma devantagen de eu uo. Uma dela é que o gene a er clonado não pode er grande, a outra é que a célula hopedeira ó podem er célula de macaco e finalmente, o genoma da célula hopedeira pode ofrer rearranjado ou deleçõe. Atualmente, doi outro itema virai mai verátei etão em uo, ão ele o víru da vacina e o Baculovíru, o quai podem aceitar gene bem maiore do que aquele aceito pelo SV40. Um inconveniente para ete doi itema virai é que ambo apreentam um grande genoma e o gene a er clonado ó pode er inerido por proceo de recombinação dentro da célula, o qual é batante lento em relação ao proceo tradicionai em uo na metodologia do DNA recombinante. Finalmente, um itema viral batante promior ão o retrovíru que ão víru cujo material genético é o RNA e apreentam um ciclo batante diferente do mencionado anteriormente que ão ciclo lítico. O retrovíru infectam uma grande variedade de célula de mamífero e o eu RNA é trancrito reveramente para DNA o qual é incorporado ao genoma da célula hopedeira. Nete etado ele produz continuamente nova partícula virai, juntamente com o produto do gene nele clonado. Devido a ua veratilidade, o retrovíru ão atualmente o vetore eleito para uo em terapia gênica. 5. BACTERIÓFAGO M13 O bacteriófago M13 é um fago filamentoo da E. coli e contém uma única fita de DNA envolvida por proteína virai. Durante o eu ciclo, a célula hopedeira é infectada 22

24 pela fita (+) a qual ervirá como molde para a íntee da outra fita (-). A dupla fita denominada de forma replicativa, permanece no interior da célula hopedeira e é amplificada até 200 cópia por célula, quando então a fita negativa não mai e replica e a fita poitiva continua a er intetizada, adquire a proteína da cápula viral e ai da célula hopedeira atravé de proceo não lítico (Figura 16). O Região funcional precoce SV40 Região funcional tardia gene da hemaglutinina (Ha) SV40 mutante SV40-Ha co-tranfecção SV40 mutante integrado ao genoma da célula COS antígeno T replicação empacotamento e lie Partícula Viral Figura 15. Equema de clonagem no SV40 pela ubtituição da região precoce. 23

25 E.coli + M Figura 16. Replicação do bacteriofago M Clonagem no bacteriófago M13 A grande utilidade dete itema de clonagem é a ua facilidade na produção de DNA fita imple, facilmente recuperável do obrenadante de uma cultura líquida da E.coli infectada com ete vetor. Como veremo futuramente, ete DNA fita imple é batante útil no proceo de equenciamento do DNA pelo método deenvolvido por Sanger e colaboradore (1977). Para facilitar o eu uo epecialmente em etratégia de eqüenciamento, foram deenvolvido vetore da érie M13mp, o quai contém o MSC inerido no gene que exprea a β-galactoidae. Mutaçõe foram realizada de tal modo que a enzima ó é ativa quando o vetor etá na célula hopedeira, convenientemente preparada. Ete proceo denomina-e de alfacomplementação. A incluão do múltiplo ítio de clonagem no gene da β galactoidade via a identificação do poívei recombinante quando na preença de um ubtrato cromogênico o X-gal ou Bluogal (5-bromo-4-cloro-indolil-β-D-galactoídeo) e o indutor IPTG. Quando o vetor etá intacto (não recombinante), a enzima é funcional e frente ao ubtrato cromogênico ete é clivado produzindo placa de cor azul. Por outro lado, quando um fragmento de DNA é inerido no múltiplo itio de clonagem, a expreão da enzima é uprimida, portanto a célula ão incapaze de metabolizar o ubtrato cromogênico formando placa incolore. 24

26 5.2. Etratégia de clonagem em vetore da érie M13mp A utilização de vetore com diferente orientaçõe do múltiplo ítio de clonagem, tai como M13mp8 e o M13mp9, facilita a inerção de um fragmento de DNA em amba a orientaçõe. Como veremo adiante, eta etratégia apreenta grande aplicação no programa de equenciamento de um DNA pelo método de Sanger. A figura 17 ilutra a inerção de um fragmento de DNA clivado com a enzima Pt1 (P) e EcoRI (E) no vetore M13mp8 e M13mp9, ambo clivado com a mema enzima. Eta clonagem orientada permite a inerção do fragmento de DNA na orientação 5' 3' no vetor M13mp8 e na orientação 3' 5' no vetor M13mp9. P E 5 3 P E E P M13 mp9 M13 mp8 P E E P Figura 17. Clonagem de um fragmento de DNA no vetore M13mp8 e M13mp9 clivado com a enzima EcoRI (E) e PtI (P). 6. FAGOMÍDEOS Apear do bacteriófago M13 apreentar grande aplicabilidade epecialmente no proceo de eqüenciamento de DNA, foram deenvolvida outra geraçõe de fago, o quai reunem a vantagen do fago M13 e a do plamídeo. O primeiro foram o vetore da érie pembl e mai tarde o plamídeo ptz, pbluecript e pgem (+/-). Ete vetore ão chamado de famídeo ou fagomídeo e apreentam a eguinte caracterítica principai: 25

27 fagomídeo apreenta um verátil MSC, permitindo a clonagem de grande inerto em maiore dificuldade, além de que, a enzima ituada nete ítio foram ordenada de tal modo a permitir uma alternativa intereante durante o proceo de equenciamento. utilizando uma combinação etratégica de dua enzima de retrição, é poível criar terminaçõe 5' e 3' proeminente, tornando agora uma extremidade (a do inerto) uceptível à ação da Exonucleae III. Eta etratégia, permite a obtenção progreiva e controlada de vário fragmento deletado do inerto, o quai apó a recircularização tornam-e apropriado para o equenciamento. Ete procedimento, facilita o eqüenciamento de um grande inerto de DNA, em a neceidade de múltipla ubclonagen como é uual no itema M13 ou a íntee de vário oligonucleotídeo interno, uado como iniciadore no proceo de eqüenciamento Clonagem no fagomídeo Vamo utilizar como exemplo, o fagemídeo λzap que é particularmente útil para clonagem de cdna. Ete vetor, incorpora a biologia do fago M13 de tal modo que um cdna clonado nete vetor pode er automaticamente exciado do fago para um fagomídeo denominado pbluecript. Baicamente, qualquer DNA clonado no MSC inativa o gene LacZ, produzindo uma proteína de fuão quando na orientação correta, podendo aim também er ratreada com anticorpo. Quando uma cepa da E.coli (F') é infectada com o fago recombinante e uperinfectada com o fago auxiliar, ee produz a proteína do itema M13. Ea proteína reconhecem o inai de iniciação e término da íntee de DNA do fago auxilar (f1) que etão flanqueando o pbluecript, que por ua vez etá incorporado no fago λzap e carrega o inerto. Com a clivagem deta dua eqüência, o DNA é automaticamente circularizado na bactéria para originar a forma recombinante do plamídeo Bluecript SK(M13). O inerto clonado no Bluecript é flanqueado por promotore para a RNA polimerae do fago T3 e T7. Nete entido, apó o vetor er convenientemente 26

28 linearizado, cópia do RNA relativo ao inerto, podem er obtida em amba a direçõe atravé do uo da RNA polimerae T3 e T7. 7. VETORES PARA TRANSFORMAÇÃO DE LEVEDURAS O grande interee exitente no etudo da levedura Saccharomyce cereviiae e Schizoacharomyce pombe deve-e ao fato de que tratam-e de organimo eucarioto inferiore e como tai pouem organização celular imilar à de eucarioto uperiore. Além dio, muita proteína de levedura ão imilare etrutural e funcionalmente à ua homóloga em mamífero. A utilização de levedura como um modelo de etudo traz a eguinte vantagen: tempo de crecimento reduzido que permite a obtenção de grande quantidade de levedura em pouco tempo. genoma de pequeno tamanho, cerca de 200 veze menor que o genoma de mamífero, o que implifica análie moleculare e genética. poibilidade de manter a levedura como célula haplóide ou diplóide, o que permite a obtenção de mutaçõe receiva em célula haplóide, bem como a realização de experimento de complementação genética. A célula de mamífero ão diplóide o que torna impoível a detecção de mutaçõe receiva. Exitem diferente marcadore de eleção que ão utilizado em levedura. A maior parte do gene marcadore utilizado em levedura ão gene envolvido na bioíntee de aminoácido e nucleotídeo. Um do marcadore frequentemente utilizado é o gene de levedura LEU2 que codifica para uma da enzima da via de íntee da leucina, a enzima β- iopropilmalato dehidrogenae. A linhagem mutante de levedura, leu2, não crece em meio de cultura que não contém leucina. Aim quando o gene LEU2 é utilizado na tranformação da linhagem leu 2, a célula deta linhagem que adquiriram o gene LEU2 erão capaze de crecer em meio de cultura deficiente no aminoácido leucina. Eta etratégia é emelhante a reitência à ampicilina adquirida por bactéria que foram tranformada com plamídeo que contém o gene que promove a reitência à ampicilina. A tabela a eguir lita algun do marcadore de eleção comumente utilizado em levedura. 27

29 GENE ENZIMA SELEÇÃO HIS3 Imidazol glicerolfofato deidratae Hitidina LEU2 β-iopropilmalato deidrogenae Leucina LYS2 α-aminoadipato redutae Liina TRP1 N-(5'-foforiboil)- antranilato iomerae Triptofano URA3 Orotidina-5'fofato decarboxilae Uracil Tabela 2. Gene marcadore de eleção em levedura. O meio de cultura utilizado em geral contém todo o aminoácido neceário à manutenção da levedura com exceção de um. Aim, por exemplo, célula tranformada com o gene HIS 3 ão elecionada em meio de cultura deficiente em hitidina. O vetore utilizado na tranformação de levedura ão capaze de e propagar tanto em E. coli quanto em levedura. A manipulação dete vetore (clonagem, mutagênee, eqüenciamento, etc) é realizada em bactéria como para qualquer plamídeo convencional e então o memo é tranferido para levedura, organimo onde o enaio de interee ão realizado. Tai vetore ão denominado vetore do tipo ponte ( huttle vector ) e contêm entre outro elemento origen de replicação de bactéria e levedura bem como gene marcadore que funcionam para a eleção no doi organimo. Diferente tipo de vetore ão utilizado na tranformação de levedura: Vetore de integração: tai vetore contêm origem de replicação de bactéria e gene marcadore para eleção em bactéria e levedura. Nete cao o plamídeo não é capaz de replicar de modo autônomo na levedura. O modo pelo qual ete tipo de vetor é propagado e é capaz de exprear o marcador de eleção é atravé da integração em um do cromoomo de levedura. Vetore que replicam em levedura: tai vetore também contém origem de replicação de bactéria e gene marcadore para eleção em bactéria e levedura. Doi tipo de origen de replicação de levedura ão empregada nete plamídeo. O primeiro tipo conite na origem de replicação do plamídeo de 2 µm, que é de ocorrência natural em levedura. O egundo conite de origen de replicação iolada de DNA cromoomal denominada ARS (Autonomouly Replicating Sequence, equência de replicação autônoma). Plamídeo contendo a origem de replicação do plamídeo de 2µm ou equência tipo ARS replicam em múltipla cópia em levedura (Figura 18). Uma variante dete tipo de vetor inclui, além da equência ARS, uma equência tipo centromérica, denominada CEN, que garante que a replicação dete plamídeo eja etável, ocorrendo uma única vez por ciclo 28

30 celular e que ele ejam egregado de modo precio durante a mitoe e meioe. Vetore contendo equência tipo CEN ão mantido em cópia única na levedura (Figura 18). YAC: (Yeat Artificial Chromoome, cromoomo artificial de levedura) ão uma variação de um vetor de cópia única, que contêm equência centromérica (CEN) e equência telomérica, que ão equência da extremidade do cromoomo. A preença de equência telomérica nete vetore permite que ejam replicado como molécula lineare, com comportamento emelhante ao do DNA cromoomal. YAC não ão utilizado de rotina em experimento de clonagem, entretanto, têm e motrado uma ferramenta valioa na caracterização de grande egmento genômico na medida em que é poível clonar em um YAC fragmento que vão de 100 a 2000 kb (Figura 19). LEU2 LEU2 ARS ARS Puc118 Multicópia Puc118 Cópia única CEN DNA Levedura DNA Levedura Figura 18. Vetore de levedura. Contêm equência de plamídeo (aqui de puc118) que permitem a propagação e dão reitência a ampicilina em E.coli, o gene de eleção em levedura (nete cao LEU 2) e ítio único de retrição. Vetore multicópia: Ete plamídeo exitem na forma circular na levedura. Algun dete vetore empregam a origem de replicação do plamídeo de 2 µm, outro utilizam origen de replicação iolada de cromoomo que ão denominada ARS. 2µm e ARS permitem a replicação do plamídio em múltipla cópia. Vetore cópia única: Vetore que contém origen de replicação tipo ARS podem er mantido etavelmente atravé da adição de equência centromérica, CEN. A exitência de equência tipo CEN aegura que o plamídeo eja mantido em 1 ou 2 cópia na levedura e egregado de modo precio durante a divião celular. GLOSSÁRIO - ARS: (autonomou replication equence, equência de replicação autônoma). Sequência que funciona como uma origem de replicação em cromoomo de levedura. - BAC: (bacterial artificial chromoome, cromoomo artificial de bactéria). Vetor utilizado na clonagem de DNA genômico, baeado no fator F de plamídeo que aegura que o plamídeo eja mantido em pequeno número de cópia na bactéria. - Centrômero: região do cromoomo que apreenta uma contricção e à qual liga-e o fuo mitótico durante a meioe ou mitoe. É neceária para a manutênção da etabilidade e egregação correta do cromoomo durante a divião celular. 29

31 - Origem de replicação: região onde é iniciada a íntee de DNA em um dado fragmento de DNA. - Telômero: extremidade do cromoomo que contém equência repetitiva de DNA intetizada pela enzima telomerae e importante na manutenção da integridade cromoomal. - YAC: (yeat artificial chromoome, cromoomo artificial de levedura). Sitema de clonagem em levedura que conite de um vetor linear que tem capacidade de replicação autônoma e que contém um centromêro de levedura e dua equência telomérica em ua extremidade. ARS1 TRP1 CEN4 EcoRI YAC URA3 R Amp +EL BamHI +EL Figura 19. YAC: Contêm um centrômero, doi telômero, gene() marcadore para eleção em levedura e uma eqüência tipo ARS. Devido à preença deta eqüência o YAC ão replicado como pequeno cromoomo lineare na levedura. III. CONSTRUÇÃO E USO DE BIBLIOTECAS DE DNA RECOMBINANTE A obtenção de uma molécula de DNA recombinante, atravé da ligação de um fragmento de DNA de interee com o DNA de um vetor, é um proceo direto e relativamente imple. Entretanto, problema epeciai urgem quando o fragmento de interee contitui uma fração pequena do DNA total. Ete é o cao encontrado comumente quando o objetivo é o iolamento de gene preente em uma única cópia num genoma complexo, ou quando o objetivo é o iolamento de clone portadore do DNA complementar à RNA menageiro raro. Dete modo, é claro que quando queremo clonar um determinado gene ou o DNA complementar da menagem ou menagen por ele codificado() é neceário à obtenção de coleçõe de clone recombinante, portadore de 30

32 molécula repreentante de todo o genoma, ou de coleçõe de clone de cdna derivado de toda a população de menageiro da célula ou tecido de interee. Ea coleçõe de clone de DNA recombinante ão chamada de biblioteca: Biblioteca Genômica, no cao do clone terem ido obtido a partir do DNA genômico ou Biblioteca de cdna, no cao do clone terem ido contruído a partir de DNA complementar. O DNA de organimo uperiore é batante complexo: por exemplo, o genoma haplóide de mamífero é compoto de aproximadamente 3x109 pare de bae (pb). Portanto, e o fragmento de interee tiver 3000 pb, ele compreenderá omente 1 parte em 106 de uma preparação do DNA total. De modo imilar, uma epécie de RNAm particularmente rara pode compreender omente 1 parte em 105 ou 106 da fração de RNA menageiro de uma célula. Dete modo, para que eja garantida a preença na biblioteca de pelo meno uma verão de toda a eqüência da população alvo, um do ponto principai na contrução de biblioteca útei é a obtenção de grande quantidade de clone. Embora a olução dete problema envolva etratégia epecífica no preparo do DNA alvo e na ecolha do vetor de clonagem, em linha gerai a contrução de biblioteca genômica e de cdna egue um procedimento báico batante emelhante. No doi cao, o DNA genômico ou o cdna ão preparado para a inerção no vetor ecolhido. O vetor e o DNA alvo ão ligado e introduzido em E. coli atravé de infecção ou em algun cao, por tranformação direta (Figura 20). 1. BIBLIOTECA DE cdna A decoberta da enzima trancriptae revera, uma DNA polimerae dependente de RNA encontrada predominantemente em víru de RNA de tumor, tornou poível a íntee in vitro de DNA uando-e como molde RNAm. O DNA produto dea reação é o DNA complementar ou cópia da menagem, abreviadamente chamado de cdna. A íntee e poível clonagem de cdna contribuíram para grande avanço na análie da etrutura e expreão de gene de eucarioto e propiciaram uma revolução tecnológica na indútria farmacêutica e de alimento. Ee clone ão comumente iolado de biblioteca de cdna, contruída a partir da população de RNAm iolada da célula ou do tecido de interee. Portanto, em comparação com biblioteca do genoma total ea biblioteca ão enriquecida com eqüência gênica. Uma vez que o cdna é cópia da menagem, ele não contém intron e apreenta ignificativamente pouca eqüência que não codificam para 31

33 proteína (Figura 21). A auência de intron permite que cdna relativo a célula de eucarioto uperiore ejam diretamente trancrito e traduzido em bactéria e em outro microorganimo, permitindo aim a produção em grande ecala de polipeptídio importante tanto na área de pequia como na área aplicada. A auência de intron também facilita a determinação direta da eqüência da menagem e ubeqüente dedução da eqüência de aminoácido da proteína por ela codificada. Io tem reultado na identificação da eqüência de uma enorme quantidade de proteína, alguma veze memo ante de terem ido identificada genética ou bioquimicamente. Tecido Ecolha do Vetor mrna DNA Digerir o DNA, Parcial ou completamente cdna Fracionar por tamanho DNA clonável Ligar DNA a um vetor Introduzir o produto da ligação em E.coli Titulação e caracterização da Biblioteca Figura 20. Pao envolvido na contrução de Biblioteca de cdna e Biblioteca genômica. 32

34 Figura 21. Diagrama repreentando de forma implificada a diferença entre um fragmento de DNA genômico e do cdna relativo a ele. De modo reumido, o procedimento para a íntee, clonagem e iolamento de cdna epecífico envolve 4 etapa: 1) Síntee in vitro de cdna de fita dupla a partir de RNA menageiro iolado do tecido de interee. 2) Preparo do cdna para a ligação com o vetor ecolhido. 3) Introdução do cdna recombinante na célula hopedeira, onde erão replicado. Ito reultará na amplificação do recombinante e dependendo do vetor utilizado, na expreão da proteína codificada pela menagen que deram origem ao cdna. 4) Identificação do clone de interee atravé de um proceo de triagem do clone recombinante Síntee de cdna de fita dupla A contrução de uma biblioteca de cdna inicia-e com o iolamento do RNA total do tecido e ubeqüente eleção da fração de RNA poli(a)+, que compreende a maioria da menagen preente na célula. O iolamento de RNA poli(a)+ de boa qualidade é 33

35 eencial, uma vez que qualquer degradação do RNAm afetará a repreentatividade da eqüência na biblioteca. Uma vez obtida a fração de RNA poli(a)+, procede-e à íntee do cdna atravé de uma érie de reaçõe enzimática (Figura 22). No último dez ano foram decrito vário método para íntee de cdna, cada um apreentando vantagen e devantagen particulare. Como exemplo, apreentamo a eguir um procedimento amplamente uado para ee fim: a) Síntee da fita de DNA complementar ao RNAm (cdna) atravé da enzima trancriptae revera. Ea enzima é capaz de cataliar in vitro a polimerização de DNA a partir RNA e requer um "primer" com a extremidade 3'OH livre para iniciar a íntee. Na maioria da veze, a molécula utilizada como "primer" é um oligo (dt), que e anela na cauda poli (A)+ do RNA. b) Apó a íntee dea fita de cdna, o RNAm é parcialmente removido, pelo uo da RNae A para cortar pedaço do RNA da molécula híbrida RNA-DNA. c) Utilizando como "primer" o fragmento de RNA não digerido pela RNaeA, a DNA polimerae de E. coli ubtitui eficientemente o RNA por DNA, reultando em uma molécula de cdna de fita dupla. d) O cdna fita dupla é tratado com T4 polimerae. Atravé da atividade 3'-5' exonucleáica dea enzima remove-e poívei nucleotídeo extra na extremidade 3'. e) O produto final dee conjunto de reaçõe é uma molécula de DNA de fita dupla, cópia exata da menagem Preparo do cdna para a ligação com o vetor Uma vez obtido o cdna, o próximo pao é prepará-lo para a inerção em um vetor de clonagem (Figura. 22). Para io também exitem vário método diponívei, que diferem entre i dependendo do tipo de vetor ecolhido: plamídio ou fago. O fago λ tem ido o vetor de ecolha para a contrução de biblioteca de cdna. A razão báica deta preferência é a eficiência. Em comparação com plamídio, o fago λ requer cerca de 16 veze meno cdna por µg do vetor para produzir número equivalente de clone recombinante. Além dio, biblioteca em fago λ ão mai fácei de erem manipulada do 34

36 que biblioteca em plamídio. Entretanto, uma devantagem do vetore λ é que não ão favorávei para procedimento de eqüenciamento do DNA e de mutagênee dirigida. Mai recentemente, outro tipo de vetor foi idealizado para uprir ea deficiência. Ea clae de vetore compreende o fagemídio que, como o próprio nome ugere, ão plamídio contendo porçõe do genoma de fago e que reúnem vantagen dee doi vetore. Figura 22. Síntee de cdna fita dupla. Para dar uma noção do pao implicado na clonagem do cdna relatamo a eguir um procedimento adotado para a clonagem de cdna em fago λ. metilação do ítio de EcoRI atravé do tratamento do cdna com EcoRI, na preença de S-adenoil metionina. Ee pao é eencial para proteger o ítio EcoRI que poam exitir no cdna contra a ação da EcoRI em digetão a er realizada ubeqüentemente no proceo de clonagem. adição de adaptadore, com o ítio EcoRI, na dua extremidade do cdna. Ea reação reulta em molécula de cdna com adaptadore múltiplo ligado na dua ponta (ver figura 23). 35

37 um único ítio de EcoRI é produzido em cada ponta do cdna pela digetão com EcoRI, liberando o exceo de adaptadore ligado na molécula. A metilação prévia do cdna garante que não haja digetão interna do cdna. ante de er inerido no vetor, o cdna é eparado do exceo de molécula de adaptadore. Io é feito atravé de filtração em coluna de Sephadex. a molécula de cdna ão ligada ao vetor, atravé de reação com T4 ligae. o produto da ligação é empacotado com a proteína formadora do capídeo do fago. o fago obtido ão utilizado para infectar bactéria de linhagem que favorece o crecimento do recombinante. apó a infecção da bactéria com o cdna recombinante temo como produto uma biblioteca de cdna, que deve conter cópia de toda a eqüência de RNAm da população original. Ea biblioteca pode er etocada na geladeira, ou ubmetida a uma triagem em buca do clone de interee. 2. BIBLIOTECA GENÔMICA Para e obter informaçõe obre a etrutura molecular de um gene de eucarioto é neceário o iolamento da porção do DNA genômico que contenha toda a unidade de trancrição, mai a regiõe flanqueadora onde e localizam o elemento controladore da expreão dee gene. O modo mai eficiente para e coneguir iolar ea porção do DNA é atravé do uo de uma biblioteca genômica, que deve conter clone portando fragmento de DNA repreentante de todo o genoma do organimo em quetão. Dete modo, o apecto principal coniderado na contrução de uma biblioteca genômica etá na obtenção de um número grande de clone portando fragmento do genoma, obtido aleatoriamente. O tamanho neceário de uma biblioteca genômica, para que um dado fragmento de interee eteja entre o fragmento clonado, é determinado pelo tamanho do fragmento clonado e pelo tamanho do genoma. Dete modo, a etratégia báica na contrução de biblioteca genômica buca minimizar o número de clone neceário atravé da clonagem de fragmento de DNA de maior tamanho poível, e maximizar a eficiência da clonagem, 36

38 atravé da utilização de vetore baeado no fago λ. biblioteca genômica envolve o eguinte pao: Baicamente, a contrução da a) iolamento de DNA de alto peo molecular, que é poteriormente quebrado de modo a produzir fragmento de tamanho compatível com o vetor de clonagem. b) ligação dee fragmento no vetor e introdução do recombinante obtido na célula hopedeira Me Me Metilação do cdna para proteger o ítio interno de Eco RI Ligação do adaptadore EcoRI com o cdna Digetão com EcoRI para gerar ítio coeivo EcoRI Separação do cdna do exceo de adaptadore cdna purificado Ligação do cdna do braço do fago lambda Empacotamento do recombinante com a proteína formadora da partícula viral Infecção da bactéria hopedeira o fago recombinante Plaqueamento do recombinante Figura 23. Clonagem de cdna em fago λ. Dentre ee pao, o modo de preparo do fragmento a erem clonado (inerto) merece er dicutido criticamente dada ua importância na repreentatividade da biblioteca. 37

39 2.1. Preparo do DNA do inerto A repreentatividade de uma biblioteca genômica depende grandemente da aleatoriedade com que o fragmento a erem clonado ão gerado, para que não haja excluão itemática de nenhuma eqüência. O fracionamento mecânico do DNA é o meio de e obter completa aleatoriedade na fragmentação do DNA. Entretanto, ee método não é comumente adotado devido à trabalhoa manipulação neceária para que o fragmento aim obtido poam er inerido no vetor. Com bom eno e cuidado é poível coneguir fragmentação uficientemente aleatória atravé de digetõe parciai do DNA com enzima de retrição. Uma vantagem em e utilizar a digetão parcial do DNA é a produção de fragmento com ponta coeiva e que, portanto, podem er diretamente ligado ao vetor. Para garantir que a digetão atinja todo o genoma ão utilizada enzima de retrição que cortam freqüentemente o DNA e que não apreentam devio de ditribuição de ítio. A enzima Sau3A I, que reconhece o ítio de 4 bae GATC, e que gera fragmento compatívei com ítio de clonagem de vário fago e comídio, tem provado er batante útil na produção de biblioteca de DNA genômico digerido parcialmente. Apó a digetão parcial, o fragmento gerado preciam er fracionado ante de erem ligado ao vetor. Sem ee fracionamento, fragmento pequeno poderão ligar-e entre i produzindo falo recombinante. Fragmento muito grande que não permitem o crecimento do fago poderão ligar-e ao braço do fago, alterando a relação entre a quantidade de DNA de inerto e vetor. Um método de fracionamento freqüentemente adotado é o de centrifugação em gradiente de acaroe. Apó a digetão parcial, a olução de DNA é aquecida para que poívei fragmento agregado e diociem, e então, é aplicada obre um gradiente de acaroe de alta alinidade. Apó a centrifugação, ão coletada fraçõe dee gradiente. Ea fraçõe ão analiada por eletroforee em um gel de agaroe. A fraçõe contendo o fragmento de DNA de tamanho apropriado ão utilizada para a ligação com o vetor. A figura abaixo ilutra ee procedimento. 38

40 Tubo capilar Tubo de plático Bomba Gradiente de Tubo de coleta acaroe Figura 24. Método para fracionamento do DNA por centrifugação em gradiente de acaroe. O gradiente é apirado, de baixo para cima, com ajuda de uma bomba peritáltica. A porção mai dena do gradiente contendo o DNA de maior peo molecular, é apirada primeiro. Uma vez garantida a aleatoriedade do fragmento clonado, é batante razoável e penar que a probabilidade de uma dada eqüência de interee etar preente em uma biblioteca genômica poa er etimada etatiticamente, com bae na ditribuição de Poion. Epecificamente, o número de clone independente (N) que preciam er triado para uma probabilidade (P) de e iolar uma eqüência epecífica é dada por: N = ln(1-p)/ ln[1-(i/g)] onde I é o tamanho médio do fragmento clonado, em pare de bae, e G é o tamanho do genoma, em pare de bae. Dete modo, preciamo triar cerca de clone de uma biblioteca que ua como vetor um fago λ, para termo 99% de chance de iolar qualquer dada eqüência preente em uma única cópia em um genoma típico de mamífero. N = ln(1-0,99)/ln[1- (2x104/3x109)]= Vetore utilizado na contrução biblioteca genômica Fago λ e comídeo ão comumente uado na contrução de biblioteca genômica. No doi cao, fragmento grande de DNA gerado por fragmentação aleatória ão ligado com o DNA do vetor para formar concatâmero que podem então er empacotado em partícula de fago λ. A biblioteca contruída em vetore λ ão armazenada e propagada 39

41 na forma de fago recombinante. No cao de clonagem em comídio, entretanto, ea partícula virai ervem meramente como veículo para introduzir o DNA recombinante dentro da bactéria. Uma vez dentro da bactéria o comídio e comporta como um plamídio grande. O comídio podem aceitar inerto de aproximadamente 45kb, quae dua veze o tamanho do inerto clonávei em fago λ. Dete modo, uando-e o comídio como vetor, é neceário gerar omente recombinante para atingir 99% de probabilidade de uma eqüência de cópia única etar repreentada em uma biblioteca genômica de mamífero. Entretanto, biblioteca em comídio ão mai difícei de e contruir e manter do que a biblioteca de fago. Comídio ão então uado quando o gene de interee é muito grande ou quando uma região extena do DNA cromoomal é deejada. No cao de iolamento rotineiro de egmento de gene ou em circuntância onde a biblioteca erá uada muita veze, o uo de vetore λ é mai recomendado. Na figura abaixo apreentamo um diagrama da etrutura de um vetor tipo λ, batante utilizado na contrução de biblioteca genômica. 5' co 3' BE B S E Fragmento central B E S BD 3' co 5' BE=braço equerdo BD=braço direito Figura 25. Etrutura do vetor λ EMBL3. BE=braço equerdo; BD=braço direito; tuffer= fragmento central; S=SalI; B=BamHI; E=EcoRI. Conforme indicado no diagrama ete vetor apreenta um fragmento central flanqueado por doi fragmento eenciai (direito e equerdo). O fragmento à equerda, chamado de braço equerdo, codifica para a proteína do capídeo e o fragmento à direita, chamado de braço direito, contém a origem de replicação do fago e promotore de outro gene eenciai. Entre o fragmento central e o doi braço encontram-e o ítio de retrição utilizado na clonagem - SalI, BamHI, EcoRI - em orientação invera. 40

42 Como todo fago λ, a extremidade de cada braço apreenta um egmento de fita imple (co). Ee egmento ão complementare entre i e permitem a recircularização da molécula, e a coneqüente replicação do DNA do fago dentro da célula hopedeira. Ee tipo de vetor é chamado de vetor de ubtituição por que no proceo de clonagem a parte central do DNA do fago é ubtituída pelo fragmento de DNA a er clonado, originando a molécula recombinante. Mai recentemente outro vetore com capacidade para grande inerto foram deenvolvido. O cromoomo artificiai de levedura (YAC) ão molécula lineare de DNA cuja arquitetura mimetiza a etrutura de um cromoomo autêntico (Figura 26). O YAC recombinante ão criado pela ligação de fragmento grande de DNA genômico exógeno (até 2000 kb) com o doi "braço" do vetor YAC e o produto da ligação é introduzido na levedura por tranformação. No YAC recombinante, o egmento de DNA genômico exógeno é flanqueado de um lado por um centrômero, uma origem de replicação e uma marca de eleção e pelo outro lado, por uma egunda marca de eleção. A levedura tranformante com cromoomo artificial ão elecionada como colônia em meio com a droga de eleção. O cromoomo artificiai de bactéria (BAC) ão molécula de DNA circulare que carregam uma marca de eleção a antibiótico. O egmento de DNA genômico exógeno ão clonado no vetor BAC in vitro e o produto da reação de ligação é introduzido por eletroporação em cepa de E. coli, onde é mantido como um plamídio de cópia única. O vetore BAC carregam marcadore que permitem a dicriminação do clone vazio e cheio. A média de tamanho do clone de BAC é 120 kb, ma algun clone podem chegar 300kb. O vetore de bacteriófago P1 acomodam fragmento genômico de 70 a 100Kb. Nete itema, a molécula lineare recombinante gerada a partir de eqüência do vetor e do genoma ão empacotada in vitro em bacteriófago P1. Apó a injeção em E. coli, a molécula e tornam circulare pela atividade de uma recombinae, que promove a recombinação de eqüência epecífica preente no vetor. Ete vetore carregam marca de eleção para antibiótico, marca de eleção poitiva para eleção do clone com inerto de DNA genômico exógeno e uma origem de replicação plamídial P1, que mantém uma ou dua cópia do plamídio recombinante na célula. Uma egunda origem de replicação pode er ativada para amplificação do plamídio ante do iolamento do DNA. 41

43 Figura 26. Contruindo um cromoomo artificial de levedura (YAC). O vetor YAC carrega uma origem de replicação (ORI), um centrômero (CEN), doi telômero e marca de eleção (X e Y). Lehninger, Principle of Biochemitry. Figura 29-16, p O cromoomo artificiai P1 combinam a caracterítica do bacteriófago P1 e do BAC, incluindo a marca de eleção poitiva e a origen de replicação do bacteriófago P1. O clone circulare recombinante de PAC gerado durante a reação de ligação in vitro ão introduzido em E.coli por eletroporação e mantido como um plamídio de cópia única na célula. O inerto da biblioteca de DNA do genoma humano em PAC variam de 60kb a 150kb. 42

44 IV. DETECÇÃO E ANÁLISE DO CLONE RECOMBINANTE Um pao crucial na Tecnologia do DNA recombinante é encontrar o clone correto na mitura de clone que foi criada durante o procedimento da confecção da biblioteca genômica ou de cdna. Embora eja relativamente fácil elecionar a colônia que abrigam o vetore de clonagem uando o marcadore de reitência a antibiótico que etão preente no vetore (Figura 27A), é muito mai difícil elecionar o clone que contenha o gene de interee. Note que no cao do vetor er um plamídio deverão er examinada milhare de colônia de bactéria crecida em placa de petri contendo agar, para a detecção daquela() colônia() que produza(m) pequena quantidade da proteína exprea pelo gene de interee ou então que poua(m) o gene de interee em qualquer expreão protéica que o caracterize (Figura 27B). Será dicutida inicialmente a ituação na qual a proteína é exprea no hopedeiro. Em eguida erá dicutida a ituação mai comum onde a proteína não é exprea e a análie erá feita atravé da própria preença do DNA de interee no fago ou na bactéria. 1. QUANDO O GENE DE INTERESSE É EXPRESSO NO HOSPEDEIRO Se o gene de interee é capaz de e exprear na célula hopedeira pode-e identificar o clone que carrega ete gene pela preença deta proteína entre a colônia recombinante. Para ito, o hopedeiro não deve produzir eta proteína, a meno que ele carregue o clone que a produza. Se eta proteína for produzida normalmente pela célula hopedeira, erá então neceário o uo de uma célula hopedeira defectiva ou mutante para o gene de interee. Quando ete gene for incorporado ele pode er detectado por complementação daquela função. Se a proteína a er detectada for epecífica de mamífero, por exemplo, a célula hopedeira já erá naturalmente defectiva. Se a proteína for uma enzima que catalia uma reação menurável pode er poível triar a colônia por ua atividade enzimática. Se a proteína de interee não for uma enzima com função detectável, uma outra etratégia erá neceária para a identificação do clone correto, como por exemplo, o uo de um anticorpo epecífico para a proteína de interee. Anticorpo é uma proteína do oro produzida pelo mamífero que e combina com alta epecificidade com outra proteína, o antígeno. Nete cao, a proteína de interee é o antígeno. Como o anticorpo e combina epecificamente com o antígeno, e o antígeno etiver preente em uma ou mai colônia de 43

45 uma placa de petri, a identificação deta colônia poderá er feita obervando-e a reação antígeno-anticorpo. Figura 27. Em A, etrutura do plamídio pbr322, um típico vetor de clonagem. Em B, método da inativação inercional para iolar plamídio contendo DNA exógeno. A inerção do DNA exógeno no plamídio pbr322 caua inativação da reitência à tetraciclina, permitindo o iolamento de tranformante contendo o fragmento de DNA clonado (B). Lehninger, Principle of Biochemitry. Figura 29-6, p Para que o antígeno eja produzido na célula hopedeira a biblioteca de cdna terá de er contruída num vetor de expreão. Nete cao o cdna ão inerido nete vetore em regiõe que promovam ua expreão em E.coli, normalmente em promotore que poam er regulado. Eta proteína antigênica erá exprea como uma proteína de fuão, ou eja, erá intetizada ubeqüente a algun aminoácido pertencente à proteína do vetor bacteriano. Eta proteína de fuão ão geralmente mai etávei que a 44

46 correpondente proteína de eucarioto produzida em bactéria e, portanto podem er obtida em grande quantidade. Para viualizar a produção deta proteína, uma parte do fago de cada placa de lie (ou bactéria) recombinante deenvolvido numa placa de Petri ão tranferido (como um carimbo) para uma membrana de nitroceluloe, tratado para expor ua proteína e então ubmetido a uma olução contendo um anticorpo epecífico para a proteína deejada. Depoi que o anticorpo livre ão removido, um egundo anticorpo é adicionado para localizar a poição do primeiro. O egundo anticorpo é normalmente radioativo e pode er identificado por autoradiografia utilizando-e um filme de raio X. Se uma colônia radioativa etiver preente, uma mancha no filme de raio-x erá obervada depoi que o filme for revelado (Figura 28). A localização deta mancha no filme correponde à localização da colônia que produziu aquela proteína, na placa de petri original. Eta colônia erá então recuperada da placa original e cultivada. Uma limitação dete procedimento é que o anticorpo utilizado neta triagem precia er epecífico para a proteína de interee. A produção de anticorpo pode er obtida pela injeção da proteína (antígeno) em um animal. No entanto, eta proteína injetada deve er pura, cao contrário mai que um anticorpo erá formado. 2 O USO DE SONDAS MOLECULARES DE ÁCIDOS NUCLÉICOS PARA IDENTIFICAR O GENE DE INTERESSE Como pode er detectado um gene de interee entre a colônia da biblioteca genômica ou de cdna, e ete gene não é expreo? Quando o DNA em olução aquoa é aquecido à 100 C, ou expoto à ph alto, a bae complementare que normalmente eguram a dupla hélice junta ão diociada em dua fita imple. Ete proceo é chamado de denaturação. Eta mema fita imple poderão e reaociar e forem conervada à 65 C, por longo período, num proceo chamado de renaturação (ou hibridação, quando a aociação ocorre entre ácido nucléico de diferente origen). Reaçõe de hibridação ocorrem entre quaiquer dua cadeia de ácido nucléico de fita imple (DNA:DNA, RNA:DNA ou RNA:RNA) dede que tenham eqüência de nucleotídeo complementare. 45

47 Promotor EcoRI lac λgfll β -Galactoidae EcoRI EcoRI " linker " cdna EcoRI EcoRI Proteina de Fuão Empacotamento do fago in vitro e plaqueamento em camada bacteriana Membrana de nitroceluloe Placa de lie Nitroceluloe obre a placa de lie Remoção da membrana Proteína e ligam a nitroceluloe Filme de raio-x anticorpo ecundário Incuba membrana com anticorpo primário Lava membrana Incuba membrana com anticorpo ecundário anticorpo primário Figura 28. Triagem de biblioteca de expreão com anticorpo. Se o inerto etiver na orientação correta e na apropriada eqüência aberta de leitura é traduzido em proteína de fuão (antígeno). O anticorpo identificam a placa de lie epecífica dete antígeno. 46

48 Ete princípio da hibridação molecular é fundamental para caracterizar DNA recombinante quando o gene de interee não é expreo. Sonda de ácido nucléico (fragmento de ácido nucléico marcado radioativamente, geralmente com 32 P) ão utilizada para localizar clone, numa biblioteca genômica ou de cdna, que carreguem uma eqüência de DNA de interee. Apó a confecção da biblioteca genômica (ou de cdna) o fago carregando DNA recombinante ão epalhado juntamente com uma upenão de bactéria numa placa de petri contendo meio de cultura ólido. Uma vez viualizada a placa de lie (ou a colônia, no cao do vetor er um plamídio) é preparada uma réplica de cada placa de petri com uma membrana de náilon ou de nitroceluloe. Ete proceo permite a tranferência de uma porção de fago de cada placa de lie (ou de bactéria de cada colônia) para a membrana, de tal maneira que o padrão da placa de lie da placa de petri original eja mantido na membrana. Para identificar qual da placa de lie porta o gene de interee eta membrana é tratada para expor e denaturar o DNA da colônia ali preente e incubado com uma olução de DNA ou RNA fita imple, marcada radioativamente e complementar ao gene de interee para permitir a hibridação. Doi polinucleotídio imple fita omente irão e hibridar e forem complementare. A localização da placa de lie que e hibridou à onda é determinada apó a expoição da membrana a um filme de Raio-X (autoradiografia) e a comparação dete filme com a dipoição da colônia na placa de petri original (Figura 29). Eta onda molecular radioativa pode er parte de um gene já clonado para o qual e procura o gene total, pode er o DNA de um gene vizinho ao gene de interee, pode er o RNA de gene que ão expreo em tecido epecífico ou em etágio epecífico do ciclo celular, ou memo o gene de uma outra epécie que codifica para a mema proteína. Nete último cao, a reação de hibridação pode er realizada em baixa temperatura (42 0 C ao invé de 65 0 C) e em baixa concentração de al (baixa etringência) para permitir a hibridação memo entre DNA que tenham alguma bae não complementare. 47

49 Membrana de nitroceluloe Placa de lie Fago aborvem a nitroceluloe Placa metra Sonda de ácido nucleico marcada com 32p Membrana réplica Sonda Hibridiza DNA ligado ao filtro Lavagem da onda não incorporada Sonda hibridiza ao DNA do fago que contem a equência complementar Filme de raio-x DNA lambda iolado da placa de lie DNA clonado Placa metra Clone lambda purificado Figura 29. Triagem de uma biblioteca genômica ou de cdna, contruída no fago λ, com uma onda molecular para encontrar um clone de interee. Eta triagem é feita epalhando-e o fago previamente incubado numa cultura de bactéria, em vária placa de agar. Depoi que a placa de lie tornam-e viívei, ão feita a réplica em membrana de nitroceluloe, eu DNA é expoto e hibridizado com a onda molecular. A poição do clone recombinante de interee é identificada atravé de autoradiografia. O DNA é iolado do fago preente na placa de lie poitiva, identificada na placa de petri original e ubmetida a análie poteriore. 48

50 Gene que repondem a um memo mecanimo de regulação podem er identificado numa biblioteca de cdna por hibridação diferencial. Ito é, gene expreo em tecido epecífico, em etágio epecífico do deenvolvimento ou do ciclo celular e gene regulado por fatore de crecimento ão adequado para erem analiado por ete tipo de abordagem. Para eta identificação é neceário produzir dua populaçõe celulare (ou extrair mrna de doi diferente tecido) uma na qual ele não e expream e outra na qual ele e expream. Suponha por exemplo, que uma biblioteca de cdna eja preparada uando o mrna iolado de célula tratada com fatore de crecimento. Eta biblioteca é plaqueada e tranferida para doi conjunto de membrana de nitroceluloe. Um conjunto é enaiado com DNA marcado radioativamente preparado por trancrição revera do RNA da célula tratada com o fatore de crecimento. O outro conjunto de filtro é hibridado com cdna preparado de célula não tratada. Clone poitivo identificado por hibridizar mai fortemente com a primeira onda codificam mrna induzívei pelo fatore de crecimento (Figura 30). Quando o DNA a er clonado exprea uma proteína cuja eqüência é conhecida pode-e inferir a eqüência de um trecho de DNA que lhe deu origem e intetizar oligonucleotídeo que lhe ejam complementare para erem utilizado como onda moleculare. Ete nucleotídeo devem ter pelo meno 17 a 20 nucleotídeo de comprimento para er epecífico para a eqüência procurada. Um problema enfrentado para intetizar ete oligonucleotídeo é a degenerecência do código genético. Algun aminoácido ão codificado por quatro ou memo ei diferente códon e, portanto memo um pequeno polipeptídio pode ter ido codificado por vária eqüência de DNA. Para contornar ete problema a onda oligonucleotídica ão alguma veze intetizada como uma mitura de toda a poívei combinaçõe do códon que ão traduzida naquela eqüência protéica (Figura 31). Uma deta eqüência é correta e irá hibridar com o clone de interee, ma a poível hibridação do outro oligonucleotídeo com eqüência em interee pode levar a obtenção de clone falo poitivo. Uma variação dete método é utilizar o menor número poível de oligonucleotídeo como onda, ecolhendo a região da proteína que contém o menor número poível de códon degenerado (por exemplo, metionina é omente codificada pelo códon AUG). Deve-e levar em conta também qual é o códon de uo mai freqüente para cada aminoácido, na epécie que etá endo analiada. 49

51 Célula com fatore de crecimento Célula Quiecente Crece em 3 h Iola o mrna poli(a) Iola o mrna poli(a) AAAAA AAAAA AAAAA AAAAA AAAAA mrna induzido pelo fatore de crecimento AAAAA AAAAA AAAAA AAAAA Oligo(dt) Trancritae Revera 32p-dNTPA hibridação Prepara bibliotéca de cdna com fago lambda e infecta Ecoli Oligo(dt) Trancritae Revera 32p-dNTPA hibridação Placa metra Réplica em membrana de nitroceluloe cdna comum Autoradiográfia Clone de cdna induível por fatore de crecimento Hibridação negligenciavel Iola o clone do fago Autoradiográfia Filme de raio-x Filme de raio-x Placa metra Figura 30. Clonagem de gene regulado por fatore de crecimento atravé de hibridação diferencial. Eta etratégia é utilizada para clonar uma família de gene que ão induzida quando célula quiecente ão etimulada a crecer pela adição do fatore de crecimento. 50

52 Cy-Met-Ap-Glu-Met-Ly-Arg-An-Ile Sequência Parcial de Aminoácido A T C A A A C TG -ATG-GA -GA -ATG-AA -AG -AA -ATT C T G G G T C Parte da equência com pouca ambigüidade A CGC G T Sequência Poívei do DNA Sonda contendo toda a poívei combinaçõe de condon de parte da equência TGTATGGATGAAATGAA TGCATGGATGAAATGAA TGTATGGACGAAATGAA TGCATGGACGAAATGAA TGTATGGATGAGATGAA TGCATGGACGAGATGAA TGCATGGATGAGATGAA TGTATGGATGAGATGAA 5' Sonda tentativa TGCATGGACGAGATGAAGCGCAACATC 3' Hibridação com cdna 5' TGCATGGACGAAATGAA 3' TGCATGGACGA G 5' ATGAAGCGCAA C ATC3' ---ACGTACCTGCT T TACTTCGCGTT TAG--- A ---ACGTACCTGCTTTACTTCGCGTTATAG--- Figura 31. Deenho de onda oligonucleotídica baeada na eqüência protéica. Como a maioria do aminoácido é epecificada por doi ou mai códon ete oligonucleotídeo ão intetizado uando-e uma mitura do nucleotídeo da poiçõe ambígua. A eqüência correta etará repreentada entre o oligo. Uma outra poibilidade é uar uma onda tentativa cuja ecolha é baeada na freqüência de uo do códon na epécie em etudo. Nete cao pareamento incompleto podem ocorrer. 3 ANÁLISE DO DNA E RNA POR ELETROFORESE EM GEL E BLOTTING Vária técnica foram deenvolvida baeada na propriedade de hibridação do ácido nucléico viando a triagem e iolamento de eqüência epecífica deta molécula. A maioria deta técnica, conforme já mencionado, trabalha com uma réplica do DNA de interee imobilizado num uporte ólido tal como uma membrana de náilon ou de 51

53 nitroceluloe. Um dete método, deenvolvido na década de 70 por E. M. Southern, tornou-e conhecido por "Southern blotting". Neta técnica o DNA é digerido com uma ou mai enzima de retrição e o fragmento reultante eparado por eletroforee num gel de agaroe. O fragmento de DNA dupla fita ão viualizado por coloração com brometo de etídio, denaturado 'in itu' com hidróxido de ódio e tranferido para uma membrana por capilaridade, com o auxílio de uma olução de alta concentração alina. Tai condiçõe permitem que o DNA eja retido na membrana no ponto de contacto entre o gel e a membrana, criando uma réplica do gel. O DNA é covalentemente ligado à membrana uando-e calor ou luz ultravioleta. Sonda de ácido nucléico (DNA ou RNA marcado radioativamente) podem er utilizada para hibridar com o DNA fixado na membrana e a poição na qual a ligação epecífica ocorrer pode er detectada por autoradiografia da membrana (Figura 32). O padrão de hibridação pode er comparado diretamente com a região no gel original que contém a eqüência de DNA de interee. Southern blotting é uma técnica tão poderoa que permite que a informaçõe obtida ejam utilizada para a contrução de um mapa de retrição de uma determinada parte do DNA clonado, por exemplo, para identificar a região que contém o gene de interee. Eta técnica poibilita também que a onda de ácido nucléico ejam utilizada para diagnótico de ditúrbio genético, enaiando-e o DNA genômico do indivíduo afetado e de eu familiare. De modo análogo, molécula de RNA também podem er identificada apó erem eparada por eletroforee, tranferida para nitroceluloe, ofrerem hibridação com onda de DNA ou RNA. Eta técnica de analiar RNA, por analogia ao Southern blotting, recebeu o nome de Northern blotting. Eta técnica é útil como auxiliar na análie de clone de cdna porque, o tamanho do mrna epecífico pode er comparado com o tamanho do cdna clonado, revelando a integridade do clone. Além dito, eta técnica permite indicar em qual tecido ou tipo celular um determinado gene é expreo ou quai ão o fatore que regulam a ua expreão. 52

54 Sonda de DNA marcada com 3 2 P eletroforee tranferência do DNA por "blotting". autoradiografia gel de agaroe papel de nitroceluloe autoradiograma Figura 32. Southern blotting. Um fragmento de DNA epecífico pode er identificado eparando-e a mitura de fragmento por eletroforee, tranferindo-e para nitroceluloe e hibridizando-e com uma onda molecular complementar à eqüência e marcada com 32 P. 4 COMO OS GENES CLONADOS SÃO UTILIZADOS? O clone de interee pode er explorado ob vário apecto. Ele pode er eqüenciado e comparado com outra eqüência já decrita, er utilizado no etudo da expreão gênica do() gene() contido() no clone, er alterado epecificamente por mutagênee ítio dirigida ou er uado para gerar um produto de interee comercial. Para ito quae empre erá neceário tranferir o clone, ou parte dete para um vetor mai apropriado para atingir o objetivo deejado. A tranferência de parte do DNA clonado para um novo vetor é conhecida como ub clonagem. Alguma deta aplicaçõe erão abordada no capítulo eguinte. 5. MAPA DE RESTRIÇÃO O mapa de retrição do DNA clonado ou de pequena molécula de DNA de fago, plamídio ou mitocôndria pode er batante útil na caracterização da molécula. Eta técnica envolve a eparação por eletroforee do fragmento de DNA obtido apó digetão do DNA total com determinada enzima de retrição. A ordem do fragmento na molécula pode er decoberta com o uo de outra enzima de retrição, em dupla digetõe e/ou por digetõe eqüenciai uando 2 enzima. Aim cada fragmento obtido apó digetão com a 53

55 enzima x é removido do gel e ubmetido à digetão com a enzima y e vice-vera (Figura 33). Informaçõe obre o mapa de retrição de um fragmento de DNA ão utilizada, por exemplo, para ubclonar parte dete fragmento para o eqüenciamento. O mapa de retrição do DNA mitocondrial vem endo útil na caracterização de linhagen e/ou epécie de vário organimo, auxiliando em etudo taxonômico e evolutivo. Figura 33. Mapa de retrição do DNA do fago λ para vária endonucleae. A barra verticai indicam o locai de clivagem de cada enzima e o número no alto indicam o tamanho da molécula em unidade de 5000 pare de bae. Eta molécula poui no total pare de bae. V. REAÇÃO EM CADEIA DA POLIMERASE (PCR) A reação em cadeia da polimerae poibilita a amplificação de uma eqüência rara de DNA a partir de uma mitura complexa, em a neceidade de clonagem molecular. Eta técnica é amplamente utilizada em pequia báica, em medicina forene e no diagnótico de doença genética e infeccioa. Inicialmente, é neceária a contrução por íntee química de doi oligonucleotídeo de DNA (iniciadore) complementare a extremidade de cada fita de DNA, flanqueando a região de interee. Ete oligonucleotídeo ervem como iniciadore da íntee de DNA in vitro, que é cataliada pela DNA polimerae. Um ciclo de PCR começa com a denaturação por calor (95 C), que promove a eparação da fita dupla de DNA. A reação é refriada na preença de um exceo do doi oligonucleotídeo, poibilitando a hibridização do doi iniciadore com a eqüência complementar preente no DNA alvo. Em eguida, a reação é incubada para atividade da DNA polimerae, produzindo nova fita de DNA a partir do iniciadore e utilizando o quatro deoxirribonucleotídio (datp, dctp, dgtp e dttp) (Figura 34). 54

56 Figura 34. A 3 etapa do ciclo de PCR (http://allerv.rug.ac.be/~aviertr/index.html). A cada novo ciclo da reação inicia-e com o aquecimento para denaturação da dupla fita de DNA, eguido de refriamento para hibridação do iniciadore e íntee de uma nova fita pela DNA polimerae a partir do iniciadore, endo que a fita de DNA recém intetizada ervem de molde no ciclo eguinte. Portanto, em cada ciclo é intetizado o dobro do DNA produzido no ciclo anterior (Figura 35). Uualmente, ão realizado de 20 a 30 ciclo para amplificação de um egmento de DNA epecífico dentro de um genoma. Na primeira iniciativa para amplificar fragmento de DNA utilizava-e a enzima DNA polimerae da Echerichi coli, que poui atividade máxima a 37 C. Eta enzima deveria er adicionada a cada ciclo poi o pao de denaturação inativa a enzima. Um importante avanço ocorreu com a decoberta da enzima Taq DNA polimerae (Saiki et al, 1988) oriunda da bactéria Thermu aquaticu. A Taq DNA polimerae poui atividade ótima a 72 C e permanece razoavelmente etável memo a 95 C e com ito, a enzima é adicionada omente no inicio do proceo. 55

57 Figura 35. O primeiro 4 ciclo de um PCR em detalhe.no terceiro ciclo, dua dupla fita que apreentam o tamanho correto ão copiada (a dua fita com o memo tamanho). No quarto ciclo, 8 dupla fita que apreentam o tamanho ão copiada (http:// allerv.rug.ac.be/ ~aviertr/index.html). Além de er utilizada para a amplificação de um egmento epecífico de DNA dentro de um genoma, a metodologia de PCR pode er utilizada para amplificar um egmento ou toda a eqüência de um produto gênico. Io pode er feito a partir da população de RNA de uma determinada célula ou tecido. Entretanto, como a Polimerae utilizada na metodologia de PCR é uma DNA Polimerae depedente de DNA, ela não pode uar RNA diretamente como molde para a amplificação. Aim, inicialmente é realizada uma reação de trancrição revera, onde pela ação da trancriptae revera o RNA é utilizado como molde para geração de cdna, que é então utilizado como molde em uma PCR ubequente. Ea abordagem denominada de RT-PCR (Revere Trancription and Polimerae Chain Reaction) é muito útil para e analiar de maneira rápida a expreão de gene de interee, poi uma vez que a PCR é realizada a partir de cdna, o fragmento correpondente ao gene de interee ó erá amplificado naquela célula ou tecido onde o gene é expreo. Eta técnica pode er utilizada para clonagem de um cdna de interee, dede que já e tenha alguma informação de ua eqüência, em a neceidade de e contruir uma biblioteca de cdna para iolá-lo. 56

58 VI. SEQÜENCIAMENTO DE DNA A partir do final da década de 70 tornou-e poível a determinar a eqüência nucleotídica de fragmento de DNA. O deenvolvimento da metodologia decrita por Sanger e col aociado a avanço tecnológico, permite que hoje genoma inteiro ejam eqüenciado. O princípio do método de terminação da cadeia para eqüenciamento de DNA baeia-e na íntee de DNA in vitro realizada na preença dideoxirribonucleotídeo. Um DNA purificado pode er intetizado in vitro em uma mitura que contém molécula de fita única de DNA, enzima DNA polimerae, um DNA iniciador que poibilita a polimerae iniciar a íntee de DNA utilizando o deoxirribonucleotídio. Alternativamente, na preença de dideoxirribonucleotídeo (ddatp, ddctp, ddgtp e ddttp) na reação, o elongamento da cadeia de DNA é bloqueado pela incorporação do nucleotídeo em um grupo OH na poição 3'. No método originalmente deenvolvido por Sanger para eqüenciamento de DNA, uma fita complementar é intetizada utilizando um mitura de deoxirribonucleotídeo, um dele marcado com P 32 ou S 35. São realizada 4 reaçõe independente, contendo uma pequena quantidade de um tipo de dideoxirribonucleotídio em cada uma da reaçõe. Cada reação produz um conjunto de cópia do DNA inicial que terminam em diferente ponto da ua eqüência. O produto deta quatro reaçõe ão eparado por eletroforee, utilizando quatro raia paralela em um gel de poliacrilamida e o fragmento ão detectado atravé da marcação radioativa. Em cada um da raia, a banda repreentam fragmento que foram terminado em dado nucleotídeo em diferente poiçõe do fragmento inicial de DNA. Pela análie da ordem da banda, começando pelo final do gel atravé da quatro raia, pode-e determinar a eqüência do DNA recém intetizado (Figura 36). Ete método ainda é amplamente utilizado, endo que vário avanço tornaram o eqüenciamento de DNA uma técnica imple e rápida. O principai avanço foram a adaptação da PCR ao método de terminação da cadeia e a utilização de dideoxirribonucleotídeo marcado com diferente corante fluorecente (fluorocromo). A utilização de fluorocromo permite que toda a quatro reaçõe ejam realizada em um único tubo e o produto da reação de eqüenciamento eja eparado em uma única raia do gel. 57

59 Figura 36. Seqüenciamento de nucleotídeo pelo método do término do crecimento da cadeia. Lehninger, Principle of Biochemitry. Figura 10-36, p Atualmente, todo o proceo de eqüenciamento de DNA pode er realizado em eqüenciadore automático. Nete equipamento o produto da reação de eqüenciamento é eparado por eletroforee em gel ou em capilar, o fluorocromo ão excitado por um feixe laer, o inai fluorecente ão amplificada e detectado por tubo fotomultiplicadore ou no modelo mai moderno por câmara CCD. Análie computacionai identificam cada nucleotídeo pelo comprimento de onda de emião epecífico de cada fluorocromo. A bae ão identificada de acordo com a forma do pico fluorecente e a ditância entre pico uceivo (Figura 37). 58

60 Figura 37. O produto da reação de eqüenciamento é ubmetido à eletroforee em uma raia de gel. À medida que o fragmento paam pelo feixe de laer, o fluorocromo ão excitado e a luz emitida é detectada por um fotomultiplicador. Eta informação é traduzida na forma de eqüência atravé de um computador. VII. EXPRESSÃO DE PROTEÍNAS HETERÓLOGAS 1. INTRODUÇÃO A decoberta de promotore e repreore epecífico do genoma de E. coli, de uma variedade de víru de E. coli e de célula eucariótica permitiu a manipulação da expreão de proteína e a clonagem de gene ob o controle de um dado promotor, cuja expreão pode er indutível ou contínua. O primeiro, e mai comumente uado, itema de expreão de proteína heteróloga em E. coli é baeado no operon lac (Figura 38). Nete itema, o DNA de interee é clonado em fago (no cao de biblioteca de cdna de expreão) ou plamídeo contendo o laci (repreor), lacp (promotor) e lacz (gene etrutural trancrito para mrna da β-galactoidae). A indução da trancrição é obtida pela adição de um análogo de lactoe intético e não degradável (iopropiltio-β-d-galactoídeo, IPTG), o qual e aocia ao repreor e inibe-o, deixando o promotor livre para a interação com a RNA polimerae e conequente trancrição do gene. 59

61 Gene etrutural trancrição Gene etrutural Figura 38. Equema ilutrando o funcionamento do operon lac. (a) Na auência de indutor. (b) Na preença de indutor. O itema mai comumente utilizado para expreão de proteína heteróloga é o que utiliza E. coli como célula hopedeira. Ete itema é amplamente difundido devido à facilidade e baixo cuto de e cultivar E. coli, e pela reprodutibilidade e abundância de proteína que produz. Além dio, modificaçõe no vetore e linhagen de E. coli ão frequentemente feita no entido de aumentar a eficiência e veratilidade do itema original. Com ito, e com o advento de novo itema de expreão em célula de eucarioto (levedura, ineto, mamífero), a expreão de proteína clonada tornou-e uma abordagem poderoíima que vem revolucionando o etudo de etrutura, função, purificação e identificação de nova proteína. Nete outro itema, o recombinante a er introduzido no hopedeiro alvo pode er facilmente contruído e amplificado em E. coli. Por io o plamídeo de levedura, mamífero, etc. ão contruído por fuão de uma porção de um plamídeo de E. coli (origem de replicação e reitência a um antibiótico) com eqüência epecífica para e obter expreão em célula eucariótica, conforme veremo adiante. 60

62 2. EXPRESSÃO DE PROTEÍNAS HETERÓLOGAS EM E.COLI O uo de E. coli para a obtenção de proteína em quantidade uficiente para o etudo da etrutura e função da mema ou para aplicaçõe clínica ou indutriai é hoje dieminado e contitui-e em um marco na hitória do noo conhecimento de etrutura de proteína. Ete tópico pretende obretudo decrever o pao báico envolvido na contrução de recombinante e expreão, em bactéria, de uma proteína clonada. 2.1 Subclonagem em plamídeo de expreão O procedimento de clonagem de um fragmento de DNA para expreão é exatamente igual a qualquer clonagem, no entanto, deve e ter em mente que o propóito erá obter a proteína correta. Para tanto, é neceário repeitar o inal de tradução de gene procariótico (inal de Shine-Dalgarno), em outra palavra, o DNA deve er clonado de maneira que ua fae de leitura correta fique em fae com o ATG iniciador (Figura 39). Além dio, um vetor para expreão em E. coli deve apreentar a eguinte caracterítica: - origem de replicação - marcador para eleção: gene que confere reitência a antibiótico como ampicilina, tetraciclina, cloranfenicol, neomicina. Ex. o gene da β-lactamae que confere reitência a ampicilina. - um promotor para trancrição: como o vetore de expreão ão normalmente projetado no entido de produzir proteína em abundância, o DNA codificante para uma dada proteína deve er colocado ob o comando de um promotor forte (exemplo: lacz, tac (trp+lacz), λ-pr, λ-pl, p φ10 do bacteriófago T7) e regulável, ito é, contendo um repreor para manter o níveí baai de expreão do gene inignificante até a indução, o que e faz geralmente por adição de IPTG, no cao por ex. do repreor laci, ou choque térmico, no cao do repreor cit inal de terminação da trancrição - equência para controle da tradução, como por ex., um ítio de ligação ao riboomo para a iniciação da tradução (Shine-Dalgarno) e um ATG iniciador. Um inal de terminação da tradução (códon de terminação) também deve etar preente no vetor ou no inerto a er clonado, ou deve er adicionado. 61

63 - um MSC para facilitar a inerção do gene de interee na orientação correta. Figura 39. Procedimento para clonagem de um fragmento de DNA em fae de leitura correta em um plamídeo de expreão. Uma vez contruído, o vetor de expreão contendo a equência codificadora da proteína de interee é introduzido em E.coli por tranformação. Ao planejar uma ubclonagem para a expreão de proteína, além de e repeitar a fae de leitura correta, deve-e também tentar na medida do poível fazer a clonagem unidirecional do inerto. Na clonagem unidirecional utilizam-e dua enzima de retrição para digerir o vetor e o DNA inerto. Na bidirecional utiliza-e uma única enzima, de modo que a ponta ão iguai, permitindo a inerção do fragmento em amba a orientaçõe. 62

64 Aim, em uma clonagem bidirecional há 50% de probabilidade de e obter o recombinante na orientação correta (eno) e 50% na orientação invertida (anti-eno). 2.2 Análie do plamídeo e eleção do ubclone correto A análie de DNA plamidial para a eleção do ubclone correto é feita por digetão com enzima de retrição e confirmada por equenciamento e julgar neceário. A análie de retrição é um procedimento batante imple; entretanto deve er feito com cautela e atenção. Seu objetivo é elecionar o clone recombinante correto quanto ao tamanho do inerto e ua orientação. Como regra a primeira digetão deve er feita com a() enzima() utilizada() para a clonagem; ito produzirá doi fragmento: plamídeo linear + inerto, e permitirá avaliar e o ítio de clonagem foram recuperado intacto. Se a ligação for realizada entre extremidade cega, preenchida pela ação da Klenow polimerae, verifica-e em um catálogo de enzima de retrição e haverá a formação de um novo ítio, o qual poderá er clivado para análie. Outra alternativa conite em clivar em ítio próximo ao da clonagem em amba a extremidade. A egunda digetão, no cao da clonagem bidirecional, deve er planejada para determinar a orientação do inerto. Deve-e ecolher um ítio único e não centralizado no inerto e um ítio no MSC que eja auente no inerto, produzindo de preferência doi fragmento de tamanho facilmente ditingüívei no gel. Calcular previamente o tamanho do fragmento eperado para amba a orientaçõe. A digetão completa é fundamental para a correta interpretação do reultado. A Figura 40 equematiza um projeto de ubclonagem de um gene e a análie de retrição do ubclone obtido com o objetivo de: a) elecionar o recombinante, b) elecionar o recombinante correto. 3. PRODUÇÃO DE PROTEÍNAS HETERÓLOGAS EM E. COLI 3.1. Produção de proteína híbrida De maneira ideal, quando e pena em expreão heteróloga, epera-e que a proteína de interee eja etável, não tóxica para a bactéria, olúvel, produzida em grande quantidade e poa er facilmente purificada. Um procedimento muito utilizado é o de exprear a proteína de interee em fuão com um tag epecífico que permita a fácil 63

65 purificação da mema atravé de cromatografia por afinidade em reina à quai e encontram acoplada ligante, ao quai o tag poa e ligar epecificamente. Uma outra vantagem óbvia de e produzir uma proteína híbrida, ou de fuão, é no cao da expreão de polipeptídeo pequeno ou memo peptídeo, o quai, em fuão, eriam intávei e rapidamente degradado na célula. BamHI 1kb HindIII BamHI HindIII Inerto eno P Recombinante Eperado (eno) BamHI HindIII P Recombinante Invertido (anti-eno) BamHI HindIII 3kb MSC Figura 40. Subclonagem de um fragmento de DNA em plamídeo de expreão e análie de retrição de doi recombinante obtido. Nota : O clone 1 e 2 foram digerido com BamHI e Hind III, eparadamente. Reponda: Qual do doi clone tem o inerto na orientação correta (eno) para a expreão da proteína? 64

66 Em geral projeta-e ainda um ítio enível a uma determinada proteae (ex: fator Xa, trombina), inerido imediatamente acima do ítio de clonagem, de maneira que a proteína híbrida poa er clivada liberando a proteína clonada que pode então er facilmente purificada utilizando-e a mema coluna de afinidade. A coluna reterá a proteína de fuão e eliminará no "void" a proteína de interee. Um exemplo de proteína híbrida obtida por clonagem no vetor pmal é dado na Figura 41. O procedimento de proteólie é relativamente trabalhoo e nem empre eficiente, por io quando a proteína de fuão não interfere e utiliza a própria proteína híbrida, por exemplo, para experimento funcionai, produção de anticorpo, etc. Note que nete cao pode er etratégico ter o memo DNA clonado em doi itema de fuão diferente. Ito permitirá que anticorpo produzido contra uma proteína híbrida ejam purificado por afinidade contra a outra, purificando-e aim apena anticorpo cujo epitopo localizam-e na proteína clonada. Dentre o vetore utilizado com uceo para a produção de proteína híbrida podemo citar: - pgex: apreenta a glutationa-s-tranferae de Schitooma japonicum (26 kda) como proteína de fuão, permitindo a purificação da proteína de fuão em coluna de agaroeglutationa - pmal: apreenta a proteína ligante de maltoe (PLM) de bactéria (42 kda) como fuão, permitindo a purificação da proteína de fuão em coluna com amiloe acoplada - pqe: apreenta um tag de 6 reíduo de hitidina como fuão e permite a purificação da proteína de fuão em coluna quelante de Ni 2+ - pur: cuja fuão é um fragmento da β-galactoidae A produção de proteína híbrida é geralmente muito imple, eficiente e de baixo cuto financeiro, podendo uprir de imediato neceidade da pequia báica, tai como, produção de anticorpo e purificação dete por afinidade, onda em experimento variado e para etudo funcionai/etruturai da proteína exprea. Permite, também, a expreão em grande ecala, para fin indutriai ou clínico de enzima, hormônio, anticorpo, etc., quando a atividade da proteína é preervada. Além dito, é poível e obter, por mutagênee, proteína com a atividade de interee potenciada e livre de efeito advero ou atividade indeejada. (b) 65

67 (a) CLONAGEM pmalc EXPRESSÃO (INDUÇÃO) PLM Proteina de interee PURIFICAÇÃO POR AFINIDADE CLIVAGEM (proteólie) Separação Lavagem Fator Xa Retida Eluíção Eliminada Figura 41. a) Equema ilutrando o pao para a expreão, purificação e clivagem de uma proteína de fuão. b) Gel de poliacrilamida-sds de fraçõe da purificação da proteína de fuão PLMparamioina. Em A ão motrado o extrato de célula não induzida (1) e de célula induzida (2). Em B, proteína de fuão PLM-paramioina apó eluição da coluna de amiloe por adição de maltoe (1), apó clivagem por fator Xa (2) e fração coletada no "void"apó paagem na coluna para a retenção da PLM (3). É importante etar alerta de que a ituação ideal expota acima nem empre é atingida. Na realidade, na grande maioria da veze, proteína de eucarioto produzida em bactéria não ão olúvei; à veze podem er tóxica para a célula; alguma ão exprea em baixo nívei; alguma interferem com a ua fuão inibindo-a de e ligar à reina de afinidade e tornando a purificação meno eficiente; outra formam agregado extremamente inolúvei memo na preença de SDS/β-mercaptoetanol; alguma têm a ua atividade biológica plenamente recuperada, porém outra ão inativa. Aim, dentre o problema mai comun que ocorrem com a produção de proteína heteróloga em E. coli, podemo citar: - Proteína tóxica: alguma proteína ão tóxica para a célula hopedeira. Nete cao, pode-e proceder a ecreção. Uma alternativa à produção de proteína citoplamática, é a 66

68 produção de proteína que ão ecretada. Para tanto bata clonar o DNA codificante em fuão com uma eqüência codificante para um peptídeo inal de procarioto. Ete peptídeo é clivado pela peptidae inal quando a proteína é ecretada para o periplama. Embora ete método freqüentemente traga problema com o rendimento ou a clivagem do peptídeo inal, há vantagen em algun cao: no cao de proteína tóxica para a bactéria; alguma proteína degradada por proteae no citoplama ão etávei no periplama; alguma que ão inativa quando produzida intracelularmente ão ativa quando ecretada; a proteína produzida já tem a ua metionina N-terminal proceada. Um exemplo de uceo é a expreão do hormônio fator de crecimento epidermal humano (hegf) ob o comando do promotor da fofatae alcalina (phoa) e com a eqüência inal deta. A indução é obtida ob privação de fofato do meio. - Proteína intávei: ito pode er reolvido reduzindo-e a temperatura de crecimento ou mudando-e para uma linhagem de bactéria deficiente em uma ou mai proteae. Memo aim é comum e obter algum nível de fragmentação da proteína exprea (ver Fig. 39 b, raia 1). - Baixo nívei de expreão: pode ocorrer pela razõe acima dentre outra, como, por exemplo, intabilidade do mrna, término prematuro da menagem, tradução ineficiente. - Proteína inolúvei: proteína de eucarioto produzida em bactéria ão geralmente precipitada na forma de corpo de incluão e requerem procedimento adicionai de denaturação para olubilizá-la e de renaturação para mantê-la olúvei e funcionai. Ito nem empre é um problema, poi a formação de corpo de incluão pode proteger a proteína contra a degradação por proteae bacteriana e também facilitar a purificação, uma vez que ão corpo deno, precipitado à baixa velocidade de centrifugação, enquanto a maior parte da proteína bacteriana permanecem no obrenadante. Ma alguma veze não e conegue renaturação adequada da proteína purificada. Nete cao deve-e tentar atenuar a formação de corpo de incluão alterando a condiçõe de expreão, por exemplo, crecendo-e a cultura a temperatura mai baixa apó a indução ou utilizando um promotor mai fraco. 67

69 3.2. Produção de proteína intacta A vantagem de e produzir proteína intacta em fuão é que ela poderá er utilizada em a preocupação de que o egmento de fuão eteja interferindo em ua etrutura e atividade. A principal devantagem é que nem empre e encontra um método eficaz para a purificação da mema. Contudo há exemplo demontrando que para etudo funcionai e de etrutura é preferível invetir na produção de proteína intacta. Vário vetore encontram-e diponívei no mercado para a expreão de proteína em fuão em E.coli. O mai referido ão da érie pet (plamid for expreion by T7 RNA polimerae), cuja expreão etá ob o controle do promotor de trancrição φ10 e do inai de iniciação de tradução 10 da proteína do gene 10 (a principal proteína do capídeo) do bacteriófago T7. A grande vantagem dete vetor é que ele é trancrito pela T7 RNA polimerae, a qual é muito eletiva e ativa, endo capaz de elongar cadeia de RNA aproximadamente 5 veze mai rápido que a RNA polimerae de E. coli. Algun vetore da érie pet apreentam o promotor T7-lac, colocando a expreão da proteína ob o controle lac e reduzindo portanto o background de expreão da proteína alvo na auência de IPTG. 4. EXPRESSÃO DE PROTEÍNAS HETERÓLOGAS EM ORGANISMOS EUCARIOTOS Ao e ecolher um itema de expreão, deve-e empre coniderar a aplicação final da proteína a er exprea. Embora o itema de expreão de proteína heteróloga em E. coli eja batante difundido, no cao de proteína eucariótica complexa torna-e, a veze, neceário lançar-e mão de itema de expreão em célula eucariótica para e produzir proteína na ua forma nativa, poi ete itema permitem modificaçõe pó-traducionai eenciai para a função de determinada proteína, como, por exemplo, glicoilação. Conideraremo algun dete itema a eguir Expreão em célula de mamífero O vetore para expreão em mamífero contém equência para facilitar a propagação em bactéria (origem de replicação e um marcador para eleção), bem como eqüência epecífica para e obter expreão em célula eucariótica. 68

70 Aim, um vetor para expreão em célula de mamífero deve apreentar a eguinte caracterítica: - origem de replicação para célula eucariótica: por exemplo a do víru SV40 - promotor: como, por exemplo, do SV40 ou do citomegalovíru (CMV). Exitem também vetore com promotore induzívei como, por exemplo, o da tetraciclina e o reponivo à ecdiona. - inai para o término da trancrição e para a poliadenilação do trancrito - marcador para eleção: como por exemplo o gene que codifica a aminoglicoídeo fofotranferae, conferindo reitência à geneticina (um análogo de neomicina). - equência para ligação ao riboomo (equência de Kozak) O itema de expreão em célula de mamífero podem er dividido em doi tipo: a) aquele envolvendo expreão tranitória da proteína em quetão (1-4 dia apó a introdução do DNA); b) aquele envolvendo a expreão etável e que requerem, portanto, a integração do gene no DNA cromoômico. 4.2 Expreão em fungo Fungo ão eucarioto unicelulare potencialmente capaze de realizar toda a modificaçõe pó-traducionai obervada em célula de mamífero. A facilidade de cultivo em larga ecala e o fato de S. cereviiae er um microrganimo eguro, legalmente uado na indútria de alimento e farmacêutica, ão caracterítica adicionai que tornam a expreão heteróloga de proteína nete itema particularmente atrativa e com perpectiva para uo, por exemplo, no deenvolvimento de vacina orai atravé da imobilização de antígeno na uperfície dete microrganimo. Exemplo da expreão de proteína heteróloga em fungo encontram-e decrito no íten e SISTEMA DE EXPRESSÃO EM CÉLULAS DE INSETO UTILIZANDO BACULOVÍRUS COMO VETOR É um do itema de expreão em célula eucariótica mai poderoo e verátei. O genoma do Baculovíru é muito grande para permitir a inerção direta de gene heterólogo; por io, ete ão clonado em vetore de tranferência, o quai contém equência flanqueadora que ão homóloga (5 e 3 ao inerto deejado) ao genoma do Baculovíru. Procede-e, então, à co-tranfecção do vetor de tranferência contendo o gene 69

71 de interee clonado e do DNA linearizado do víru Autographa californica (AcNPV) em célula do ineto Spodoptera frugiperda (Sf). Neta célula ocorre recombinação homóloga, com tranferência do gene heterólogo do vetor para o DNA do AcNPV. A infecção da célula Sf com o DNA do víru reulta na parada total da expreão da proteína do hopedeiro, permitindo alta produção do mrna e da proteína recombinante. Uma variedade de vetore de tranferência foram contruído para utilização nete itema. Cada vetor contem : - uma origem de replicação de E.coli - um marcador de reitência à ampicilina - o promotor da polihedrina ou da p10 (proteína do baculovíru): promotore forte. - um MSC para permitir inerção do gene de interee - equência flanqueadora pertencente ao genoma do víru para facilitar a recombinação homóloga Vantagen dete itema de expreão: - Modificaçõe pó-traducionai - Obtenção de proteína olúvei e funcionalmente ativa - Altíimo nívei de expreão - Capacidade para grande inerto - Expreão imultânea de vário gene: vário plamídeo com promotore múltiplo encontram-e diponívei comercialmente, permitindo a expreão de dua ou mai proteína numa única célula infectada. - Facilidade de purificação: vetore apreentando tag de 6xHi e GST permitem a purificação por afinidade da proteína recombinante. - Facilidade de monitoramento da expreão: vetore Biocolor permitem a obtenção da proteína de interee em fuão com GFP (green), BFP (blue) ou YFP (yellow), permitindo o monitoramento da expreão em a neceidade da utilização de anticorpo. 6. EXPRESSÃO EM CÉLULAS DE Droophila Combina alguma da melhore caracterítica do itema de expreão em célula de mamífero com aquele em célula de ineto utilizando baculovíru. É um itema mai barato e eficiente que expreão em célula de mamífero e mai rápido que expreão 70

72 utilizando baculovíru. Ete itema utiliza vetore plamidiai para expreão tranitória ou etável da proteína de interee. Encontram-e diponívei comercialmente vetore para expreão: a) contitutiva (promotor da actina), b)induzível (promotor da metalotioneína, expreão induzida pela adição de cobre ou cádmio) e c) indúzivel e com ecreção da proteína para o meio. Todo o vetore apreentam tag de 6xHi no C-terminal, facilitando a purificação por afinidade da proteína de interee. 7. EXPRESSÃO DE PROTEÍNAS HETERÓLOGAS: APLICAÇÕES E PERSPECTIVAS 7.1- Biblioteca de expreão e identificação de nova proteína atravé de anticorpo ou outro ligante epecífico Sitema convencional - expreão de biblioteca de cdna em E. coli Você já viram em capítulo anteriore que uma biblioteca de cdna pode er contruída em vetor de expreão (fago ou plamídeo). Para ea finalidade, um do vetore mai utilizado atualmente, pela ua veratilidade, é o λzap e o hopedeiro mai uado é E. coli. Quando e clona um dado fragmento de DNA pode-e planejar previamente e deejae uma clonagem uni ou bidirecional. Quando e intetiza uma biblioteca de expreão é uual que e opte pela clonagem unidirecional. Para io bata digerir o vetor com dua enzima que geram ponta incompatívei e preparar o inerto com adaptadore que geram ponta compatívei com a do vetor, de tal maneira que a orientação eja a correta (fita ene, entido 5' 3', a partir do promotor) para a expreão de proteína. A biblioteca é amplificada como qualquer outra e a expreão de proteína é induzida pela adição de IPTG; uma réplica da placa de ágar contendo a placa de lie é obtida em um filtro de nitroceluloe colocado obre a mema por um certo tempo para que a proteína ejam aderida. Ete filtro é em eguida tratado como em um Wetern blot para a detecção de proteína, com anticorpo ou um outro ligante epecífico para a proteína de interee. O itema λzap é intereante porque apó o iolamento do clone o fagomídeo pode er facilmente obtido por excião in vivo por co-infecção com fago filamentoo auxiliar (Figura 42). 71

73 Figura 42. Equema do fago λzap, iolamento do clone e excião do fagemídeo pbluecript por coinfecção com fago filamentoo auxiliar. A proteína clonada pode então er exprea e ua propriedade etudada, incluive pode er prontamente purificada para a injeção em coelho a fim de gerar anticorpo. Ete podem er uado como contra-prova da clonagem e como onda importantíima para diagnótico, imunocitoquímica, etc. Há também a poibilidade de e contruir a biblioteca em um λzap modificado que contém o promotor de citomegalovíru (CMV) e outro elemento neceário para a expreão do gene clonado em célula eucariótica Novo itema para a detecção de receptore ou proteína ligante A identificação de molécula que interagem com uma dada proteína, ito é peptídeo ligante, proteína ligante ou receptore, é fundamental para o mapeamento da via de ação de uma dada proteína na célula. O itema convencional de "creening" (eleção) decrito acima pode er utilizado. Ma, novo itema começam a aparecer com o 72

74 objetivo de elecionar ligante ou anticorpo. Um dete é a clonagem do DNA (biblioteca de cdna comum ou biblioteca combinatoriai de peptídeo intético) em fuão com uma proteína que forma a capa do fago lambda (Felici et al., 1991). Ito tem permitido iolar ligante de uma biblioteca complexa por paagem da partícula de fago obre determinado ligante epecífico imobilizado em uma matriz. Uma evolução dete itema que parece er promiora é a clonagem da biblioteca de cdna de interee em fuão com uma proteína da parede bacteriana, de tal maneira que a proteína exprea ficarão expota recobrindo a uperfície da bactéria, a qual poderá então er incubada com um ligante marcado por fluorecência que marcará aquela célula que exprear o receptor ou ligante epecífico. A célula marcada poderá, então, er elecionada (iolada) por um aparelho de eleção de célula, "Fluorecent Aited Cell Sorter", comumente referido como FACS. Para a análie de milhõe de bactéria, entretanto, erá neceário o deenvonvimento de FACS mai ofiticado. A Figura 43 exemplifica equematicamente uma proteína (anticorpo, nete cao) exprea na uperfície de uma bactéria (Little et al., 1993). Ete itema tem ido coniderado promior para a produção de vacina orai e kit para diagnótico. cadeia peada cadeia leve conector Porção variável do anticorpo PAL gene que codifica para o anticorpo membrana externa PAREDE CELULAR membrana externa citoplama Figura 43. Equema ilutrando a apreentação na uperfície bacteriana de uma proteína heteróloga exprea em fuão com uma proteína da parede bacteriana. Ete cao demontra a expreão do domínio variávei de um anticorpo unido por um peptídeo "conector" em fuão com a lipoproteína aociada a peptídeoglicano (PAL). Foi projetado para preervar a conformação nativa da região variável do anticorpo de maneira a manter ua propriedade ligante intacta. Além do exemplo citado acima, o "itema de doi híbrido" (Field & Song, 1989), para expreão em levedura, tem ido batante utilizado para a detecção e 73

75 identificação de proteína capaze de interagir com uma determinada proteína (Figura 44). Nete itema doi plamídeo ão contruído para poterior co-tranfecção e expreão do híbrido. O primeiro híbrido (ica) é a proteína conhecida (x) em fuão com o domínio ligante de DNA do fator de trancrição GAL4; o egundo ão gene deconhecido de uma biblioteca de um determinado tecido ou epécie (proteína y) em fuão com o domínio da GAL4 ativador da trancrição. É um proceo engenhoo, cuja lógica baeia-e no fato de que a GAL4, como a maioria do fatore de trancrição, é uma proteína com doi domínio bem definido (um ligante de DNA e o outro ativador da maquinaria de trancrição), ambo indipenávei para o efeito final de ativação da trancrição de gene ituado ob eu controle (controle do promotor GAL). Quando e exprea ete domínio eparadamente, a proteína erá inativa, exceto e o doi polipeptídeo e aociarem de tal maneira que encontrar-e-ão junto na região promotora para exercerem eu papel de ativação da trancrição. Quando e expream ete híbrido em uma linhagem de levedura, cujo determinado gene marcador de elecão etá ob o comando de GAL4 e, cultivam-e a célula na auência de um nutriente eencial intetizado pelo gene marcador, a ativação dete gene torna-e eencial para a obrevivência da célula. Um gene comumente utilizado como marcador de eleção nete itema é o HIS3, cujo produto é uma enzima da via de bioíntee de hitidina; nete cao, a célula ão capaze de crecer em meio com hitidina, ma ão incapaze na ua auência, a meno que a trancrição do gene HIS3 eja ativada pelo fator GAL4 recontituído (ativo). Ito ignifica que no interior da célula que obreviveram encontram-e doi híbrido que formam um complexo; ito é, a proteína conhecida x interage com uma proteína deconhecida y, a qual pode er então identificada por equenciamento de eu cdna e caracterizada. Merece detaque o fato de que a interação entre a proteína x e y, por ete proceo, ocorre no interior de uma célula eucariótica viva, endo, por io, provavelmente mai confiável que outro método utilizado para o etudo de interaçõe entre proteína. 74

76 (a) GAL4 nativa Trancrição (b) Híbrido com domínio ligante de DNA da GAL4 Gene HIS3 X (c) Híbrido com domínio da GAL4 ativador da trancrição Gene HIS3 Y (d) Interação entre híbrido recontituindo a atividade da GAL4 Gene HIS3 X Y trancrição Gene HIS3 Figura 44. Etratégia para detectar proteína ligante utilizando o itema de doi híbrido A utilização da tecnologia do DNA recombinante no conhecimento de receptore de membrana Para informaçõe epecífica em clonagem de receptore de uperfície celular, incluindo abordagen que viam decobrir ou projetar nova droga efetiva direcionada a ee receptore, conulte a revião de Luyten & Leyen (1993). Ete autore enfatizam que a expreão heteróloga de receptore clonado proporciona uma fonte rica, reprodutível, inexaurível e barata de ubtipo de receptore humano. Ee receptore expreo podem er utilizado no creening de droga e também para o deign de nova droga atravé de um melhor entendimento da relação etrutura-função, vito que a clonagem molecular dee receptore revelou uma abundância de ubtipo, bem como modelo etruturai do memo (Figura 45). Agora, uma nova era pode ter lugar, em que a droga começam a er projetada e contruída com bae na etrutura de eu alvo no organimo (Bugg et al., 1994). 75

77 Exemplo da utilização da tecnologia do DNA recombinante nete cao incluem a expreão heteróloga de receptore acoplado a proteína G no fungo Saccharomyce cereviae, Schizoaccharomyce pombe e Pichia patori, viando etudo etruturai e funcionai. Célula de S. cereviiae expreando o receptor de omatotatina de rato foram uada com uceo no creening de análogo de omatotatina e biblioteca combinatoriai para identificar agonita e antagonita eletivo para ubtipo com potente efeito in vivo (M. H. Pauch, 1997). Figura 45. Modelo etruturai de família de receptore de uperfície celular. O domínio tranmembrana e algun domínio funcionai ão repreentado. O enrolamento da cadeia proteica é hipotético, poi o único que teve ua etrutura determinada por critalografia até o momento foi o domínio extracelular do receptor de hormônio de crecimento. 76

78 7.3. Expreão de proteína para intervenção terapêutica Podemo dizer que há dua maneira gerai de e fazer terapêutica por expreão de proteína: a) a expreão heteróloga de uma proteína humana em bactéria ou célula eucariótica para a produção em grande ecala, purificação e utilização deta para injeção em paciente: o exemplo mai conhecido é provavelmente o da inulina (Britow, 1993), a qual foi o primeiro produto comercial obtido pela tecnologia do DNA recombinante e aprovado para uo em humano em 1982 pela U.S.FDA (Food and Drug Adminitration). A Figura 46 motra a etratégia empregada para a produção de inulina para fin terapêutico; a bovina e a uína em modificaçõe química ão meno eficiente. A inulina produzida pela tecnologia do DNA recombinante apreenta a vantagem de eliminar a poibilidade de contaminante ou agente infeccioo que podem etar preente na proteína purificada de animai. Uma da maiore expectativa nete campo é a poibilidade de e obter mutante com atividade muito uperior ao da proteína nativa e em certo efeito advero. Outro exemplo de produto obtido pela tecnologia do DNA recombinante e utilizado com finalidade terapêutica ão o anticoagulante TPA (ativador de plaminogênio tipo tecidual), o fator VIII de coagulação e a eritropoietina (hormônio que etimula a produção de eritrócito). A determinação e caracterização refinada da etrutura de proteína começa a ganhar maior impacto pela poibilidade de expreão/purificação de proteína em larga ecala e mutageniada. Além de no proporcionar a atifação de e conhecer uma nova etrutura, ee conhecimento no permite projetar droga e penar em outra etratégia terapêutica, tai como, exprear apena um domínio ativo da proteína. Por exemplo, o domínio variávei de anticorpo podem er expreo como uma única cadeia polipeptídica ativa. Pode-e penar também na expreão de receptore olúvei (ou domínio ativo dete) para um dado víru, no entido de inibir a ua interação com o receptor da célula; um exemplo eria a expreão do receptor CD4 para o víru da AIDS. Uma idéia epetacular que começa a emergir a partir do noo conhecimento da etrutura atômica e função de fatore de trancrição, é a poibilidade da íntee de droga que inibiriam ou ativariam epecificamente um dado fator de trancrição (Figura 47). 77

79 E.coli E.coli E.coli levedura cadeia A cadeia B Pró-inulina Humana Precuror de inulina Inulina uína pâncrea bovino pâncrea uíno A B Ala A B A B A B A B A B A B Thr A B A B A B Inulina bovina Inulina uina Inulina humana (emp) Inulina humana (crb) Inulina humana (prb) Inulina humana (pry) Figura 46. Repreentação equemática de etratégia uada para produzir inulina para fin terapêutico. Um outro exemplo da potencial aplicação da expreão de proteína heteróloga em intervenção terapêutica eria a produção de grande quantidade de anticorpo em planta, viando eu uo em imunoterapia. A planta ão capaze de intetizar e montar virtualmente qualquer tipo de molécula de anticorpo, dede fragmento até cadeia completa e memo anticorpo multimérico. Ma & Ben (1995) decreveram a expreão e montagem em planta da molécula de IgA, que é a forma predominante de imunoglobulina em ecreçõe de uperfície mucoa como o trato gratrointetinal. Até então a produção de IgA em itema heterólogo tinha ido frutante devido a complexidade deta molécula. Anticorpo produzido em planta podem vir a er particularmente útei para imunoterapia tópica. No cao, por exemplo, de cárie, Ma et al. (1990) motraram que a aplicação tópica de anticorpo monoclonai contra uma proteína da uperfície (de adeão) do Streptococcu mutan em dente humano conferiu proteção a longo prazo contra ee microrganimo em adulto. 78

80 Domínio de ativação Droga inibe domínio de ativação DNA Domínio de ligação ao DNA Domínio de dimerização Droga inibe domínio de ligação ao DNA Droga inibe domínio de dimerização Figura 47. Modelo hipotético da ação de droga que poderiam er efetiva em terapêutica atuando obre um fator de trancrição. b) a terapia gênica por tranfecção de célula retirada do próprio paciente com retrovíru, ou outro tipo de víru, com o intuito de repor um gene mutante ou para o tratamento de doença multi-fatoriai como câncer e doença cardíaca. A primeira terapia gênica realizada para ubtituir um gene mutante único, iniciada em 1990, foi a terapia para a deficiência da adenoina deaminae (ADA), a qual conite em implantar linfócito T tranfectado com retrovíru expreando a proteína auente no portadore deta doença. Eta tem ido coniderada o protótipo da terapia gênica e tem ido bem ucedida (ver o artigo de F. Waton, 1993). 79

81 VIII. ANÁLISE DE EXPRESSÃO ATRAVÉS DE MICROARRANJOS DE DNA Como vimo até agora, a tecnologia do DNA recombinante vem permitindo grande avanço na identificação e caracterização de gene epecífico. Com relação ao etudo de expreão gênica, abordagen amplamente utilizada, como Northern blot e RT-PCR, ão batante enívei e precia, porém permitem o etudo de um ou pouco gene de cada vez. O Projeto Genoma, além de terem gerado informação obre a equência do genoma de divero organimo, impulionaram um grande deenvolvimento tecnológico que reultou no aparecimento de nova metodologia de análie genética. Uma dea nova metodologia, o microarranjo de cdna, permite não ó a análie de expreão de gene epecífico ma de padrõe de expreão caracterítico de certo tipo celulare, etágio de deenvolvimento, condiçõe patológica e muito mai. Com a utilização dea nova metodologia é portanto poível analiar a expreão de milhare de gene imultaneamente, determinando-e quai dele ão expreo em tipo celulare epecífico, em momento e condiçõe particulare, empre atravé da comparação de dua ituaçõe diferente. Como no cao do Northern blot, a metodologia de microarranjo baeia-e na propriedade de hibridação do ácido nucléico. Ma ao contrário do Northern, onde o RNA total de determinada célula ou tecido etá imobilizado em uma membrana de nylon e o fragmento correpondente ao gene de interee é marcado para a hibridação; no microarranjo, o milhare de fragmento de DNA que repreentam gene epecífico etão imobilizado num uporte ólido, que pode er uma membrana de nylon, ou uma lâmina de vidro e o RNA total é que é marcado ante de hibridar com o fragmento gênico imobilizado. 80

82 A metodologia que ua a lâmina de vidro como uporte é a que permite a análie de maior número de gene. Na figura 48 podemo ver um equema repreentando o principai pao de um experimento com microarranjo de DNA. Figura 48. Equema da preparação e análie de microarranjo de DNA. Primeiramente, o fragmento repreentando gene epecífico (derivado, por exemplo, de uma biblioteca de clone de cdna) ão amplificado por PCR e aplicado obre a lâmina por um robô que automaticamente fixa à lamina o fragmento de DNA em minúculo círculo com diâmetro da ordem de 0,1 mm ou meno, formando o pot. Cada pot na lâmina contém milhare de cópia do fragmento de DNA que repreenta um determinado gene e ua poição exata fica regitrada. Então, o RNA total de célula em dua diferente condiçõe é iolado e marcado com doi fluorocromo (corante fluorecente) ditinto. A marcação do RNA geralmente ocorre atravé da íntee de cdna utilizando a trancriptae revera, onde um do nucleotídeo fornecido etá conjugado com o corante fluorecente. Para o RNA extraído de célula na condição 1, a íntee de cdna é feita fornecendo-e um do nucleotídeo marcado com um fluorocromo vermelho e para o 81

DNA recombinante_ Desconheço a origemda apostila. Mas, é muito Boa!

DNA recombinante_ Desconheço a origemda apostila. Mas, é muito Boa! Conteúdo I. CONCEITOS BÁSICOS 2 1. INTRODUÇÃO 2 2. CONCEITO DE CLONAGEM MOLECULAR 3 3. ENZIMAS DE RESTRIÇÃO 3 4. CONSTRUÇÃO DO DNA RECOMBINANTE 7 5. DNA LIGASE 8 5.1. Tipo de fragmento de DNA que ão ligado

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

Enzimas e Clonagem Molecular

Enzimas e Clonagem Molecular Universidade Estadual de Maringá Enzimas e Clonagem Molecular Disciplina: Biologia Molecular 6855 Profa. Dra Maria Aparecida Fernandez Enzimas: Enzimas de Restrição Endonucleases de restrição; Fazem o

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

CAPÍTULO 10 Modelagem e resposta de sistemas discretos

CAPÍTULO 10 Modelagem e resposta de sistemas discretos CAPÍTULO 10 Modelagem e repota de itema dicreto 10.1 Introdução O itema dicreto podem er repreentado, do memo modo que o itema contínuo, no domínio do tempo atravé de uma tranformação, nete cao a tranformada

Leia mais

Tecnologia do DNA Recombinante-TDR

Tecnologia do DNA Recombinante-TDR Tecnologia do DNA Recombinante-TDR (clonagem de DNA) CONSTRUINDO A MOLÉCULA DE DNA RECOMBINANTE, BIOTECNOLOGIA:Engenharia genética. A utilização de microorganismos, plantas e animais para a produção de

Leia mais

Competências/ Objetivos Especifica(o)s

Competências/ Objetivos Especifica(o)s Tema B- Terra em Tranformação Nº previta Materiai Contituição do mundo material Relacionar apecto do quotidiano com a Química. Reconhecer que é enorme a variedade de materiai que no rodeiam. Identificar

Leia mais

Margarida Borges e Elsa Bronze da Rocha

Margarida Borges e Elsa Bronze da Rocha Alteraçõe à avaliação da unidade curricular de Genética Molecular do Metrado Integrado de Ciência Farmacêutica (MICF) com impacto ignificativo na aprovaçõe e claificaçõe Margarida Borge e Laboratório de

Leia mais

Máquinas Eléctricas. Motores de indução. Motores assíncronos. Arranque

Máquinas Eléctricas. Motores de indução. Motores assíncronos. Arranque Motore de indução Arranque São motore robuto e barato (fabricado em maa), embora tendo o inconveniente de não erem regulávei. Conequentemente, uma vez definido um binário e uma corrente, ete apena dependem

Leia mais

SITE EM JAVA PARA A SIMULAÇÃO DE MÁQUINAS ELÉTRICAS

SITE EM JAVA PARA A SIMULAÇÃO DE MÁQUINAS ELÉTRICAS SITE EM JAVA PARA A SIMULAÇÃO DE MÁQUINAS ELÉTRICAS Reumo Luca Franco de Ai¹ Marcelo Semenato² ¹Intituto Federal de Educação, Ciência e Tecnologia/Campu Jataí/Engenharia Elétrica/PIBIT-CNPQ lucafranco_jty@hotmail.com

Leia mais

Lider. ança. para criar e gerir conhecimento. }A liderança é um fator essencial para se alcançar o sucesso também na gestão do conhecimento.

Lider. ança. para criar e gerir conhecimento. }A liderança é um fator essencial para se alcançar o sucesso também na gestão do conhecimento. Liderança para criar e gerir conhecimento Lider ança para criar e gerir conhecimento }A liderança é um fator eencial para e alcançar o uceo também na getão do conhecimento.~ 48 R e v i t a d a ES P M janeiro

Leia mais

DNA recombinante in a nutshell

DNA recombinante in a nutshell DNA recombinante in a nutshell Biologia Molecular Aplicada A tecnologia do DNA recombinante Prof. Dr. Francisco Prosdocimi Teoria bem fundamentada Por volta do início da década de 70, os fundamentos básicos

Leia mais

Figura 3.1 - Curva granulométrica por peneiramento e sedimentação de uma amostra de solo residual (Minas de calcáreo Caçapava do Sul)

Figura 3.1 - Curva granulométrica por peneiramento e sedimentação de uma amostra de solo residual (Minas de calcáreo Caçapava do Sul) Nota de Aula - Mecânica do Solo 23 UNIDADE 3 GRANULOMETRIA DOS SOLOS 3.1 Introdução Todo o olo, em ua fae ólida, contêm partícula de diferente tamanho em proporçõe a mai variada. A determinação do tamanho

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Reconhece e aceita a diversidade de situações, gostos e preferências entre os seus colegas.

Reconhece e aceita a diversidade de situações, gostos e preferências entre os seus colegas. Ecola Báic a 2º º e 3º º Ciclo Tema 1 Viver com o outro Tema Conteúdo Competência Actividade Tema 1 Viver com o outro Valore Direito e Devere Noção de valor O valore como referenciai para a acção: - o

Leia mais

UMA ABORDAGEM GLOBAL PARA O PROBLEMA DE CARREGAMENTO NO TRANSPORTE DE CARGA FRACIONADA

UMA ABORDAGEM GLOBAL PARA O PROBLEMA DE CARREGAMENTO NO TRANSPORTE DE CARGA FRACIONADA UMA ABORDAGEM GLOBAL PARA O PROBLEMA DE CARREGAMENTO NO TRANSPORTE DE CARGA FRACIONADA Benjamin Mariotti Feldmann Mie Yu Hong Chiang Marco Antonio Brinati Univeridade de São Paulo Ecola Politécnica da

Leia mais

Experimento #4. Filtros analógicos ativos LABORATÓRIO DE ELETRÔNICA

Experimento #4. Filtros analógicos ativos LABORATÓRIO DE ELETRÔNICA UNIVESIDADE FEDEAL DE CAMPINA GANDE CENTO DE ENGENHAIA ELÉTICA E INFOMÁTICA DEPATAMENTO DE ENGENHAIA ELÉTICA LABOATÓIO DE ELETÔNICA Experimento #4 Filtro analógico ativo EXPEIMENTO #4 Objetivo Gerai Eta

Leia mais

Curso de Análise Matricial de Estruturas 1 I - INTRODUÇÃO

Curso de Análise Matricial de Estruturas 1 I - INTRODUÇÃO Curo de Análie Matricial de Etrutura 1 I - INTRODUÇÃO I.1 - Introdução O proceo de um projeto etrutural envolve a determinação de força interna e de ligaçõe e de delocamento de uma etrutura. Eta fae do

Leia mais

BA.02: Vírus e Reino Monera BIOLOGIA

BA.02: Vírus e Reino Monera BIOLOGIA BA.02: Víru e Reino Monera ATIVIDADES 1. (CEFET) O víru podem er incluído na categoria do ere vivo por: a) erem contituído por proteína. b) reproduzirem-e por ciiparidade. c) crecerem por jutapoição de

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

3 Fuga de cérebros e investimentos em capital humano na economia de origem uma investigação empírica do brain effect 3.1.

3 Fuga de cérebros e investimentos em capital humano na economia de origem uma investigação empírica do brain effect 3.1. 3 Fuga de cérebro e invetimento em capital humano na economia de origem uma invetigação empírica do brain effect 3.1. Introdução Uma da vertente da literatura econômica que etuda imigração eteve empre

Leia mais

Afetação de recursos, produtividade e crescimento em Portugal 1

Afetação de recursos, produtividade e crescimento em Portugal 1 Artigo 65 Afetação de recuro, produtividade e crecimento em Portugal 1 Daniel A. Dia 2 Carlo Robalo Marque 3 Chritine Richmond 4 Reumo No período 1996 a 2011 ocorreu uma acentuada deterioração na afetação

Leia mais

Exercícios Resolvidos de Biofísica

Exercícios Resolvidos de Biofísica Exercício Reolvido de Biofíica Faculdade de Medicina da Univeridade de oimbra Exercício Reolvido de Biofíica Metrado ntegrado em Medicina MEMBRNS HOMOGÉNES Exercício 1. Numa experiência com uma membrana

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

CAPÍTULO 6 - Testes de significância

CAPÍTULO 6 - Testes de significância INF 16 CAPÍTULO 6 - Tete de ignificância Introdução Tete de ignificância (também conhecido como Tete de Hipótee) correpondem a uma regra deciória que no permite rejeitar ou não rejeitar uma hipótee etatítica

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

ESTUDO COMPARATIVO ENTRE OS PROCEDIMENTOS DE AMOSTRAGEM CASUAL SIMPLES E AMOSTRAGEM SISTEMÁTICA

ESTUDO COMPARATIVO ENTRE OS PROCEDIMENTOS DE AMOSTRAGEM CASUAL SIMPLES E AMOSTRAGEM SISTEMÁTICA Etudo comparativo entre o procedimento de amotragem... 67 ESTUDO COMPARATIVO ENTRE OS PROCEDIMENTOS DE AMOSTRAGEM CASUAL SIMPLES E AMOSTRAGEM SISTEMÁTICA EM INVENTÁRIOS DE ARBORIZAÇÃO URBANA Comparative

Leia mais

Confrontando Resultados Experimentais e de Simulação

Confrontando Resultados Experimentais e de Simulação Confrontando Reultado Experimentai e de Simulação Jorge A. W. Gut Departamento de Engenharia Química Ecola Politécnica da Univeridade de São Paulo E mail: jorgewgut@up.br Um modelo de imulação é uma repreentação

Leia mais

Palavras-chave:Algoritmo Genético; Carregamento de Contêiner; Otimização Combinatória.

Palavras-chave:Algoritmo Genético; Carregamento de Contêiner; Otimização Combinatória. Reolução do Problema de Carregamento e Decarregamento 3D de Contêinere em Terminai Portuário para Múltiplo Cenário via Repreentação por Regra e Algoritmo Genético Aníbal Tavare de Azevedo (UNICAMP) anibal.azevedo@fca.unicamp.br

Leia mais

2 Introdução à Fluorescência

2 Introdução à Fluorescência 2 Introdução à luorecência 2. O fenômeno da fluorecência Luminecência é a emião de luz por alguma ubtância, ocorrendo a partir de etado eletrônico excitado. Para ecrever ee capítulo conultamo principalmente

Leia mais

Professora FLORENCE. Resolução:

Professora FLORENCE. Resolução: 1. (FEI-SP) Qual o valor, em newton, da reultante da força que agem obre uma maa de 10 kg, abendo-e que a mema poui aceleração de 5 m/? Reolução: F m. a F 10. 5 F 50N. Uma força contante F é aplicada num

Leia mais

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica.

Clonagem Molecular. Esta tecnologia permite estudar os genes e os seus produtos, obter organismos transgênicos e realizar terapia gênica. Clonagem Molecular A clonagem molecular é o processo de construção de moléculas de DNA recombinante e da sua propagação em hospedeiros apropriados que possibilitam a selecção do DNA recombinante. Esta

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

6.2.1 Prescrições gerais

6.2.1 Prescrições gerais CAPÍTULO 6.2 PRESCRIÇÕES RELATIVAS AO FABRICO E AOS ENSAIOS SOBRE OS RECIPIENTES SOB PRESSÃO, AEROSSÓIS, RECIPIENTES DE BAIXA CAPACIDADE CONTENDO GÁS (CARTUCHOS DE GÁS) E CARTUCHOS DE PILHAS DE COMBUSTÍVEL

Leia mais

Modelagem Matemática e Simulação computacional de um atuador pneumático considerando o efeito do atrito dinâmico

Modelagem Matemática e Simulação computacional de um atuador pneumático considerando o efeito do atrito dinâmico Modelagem Matemática e Simulação computacional de um atuador pneumático coniderando o efeito do atrito dinâmico Antonio C. Valdiero, Carla S. Ritter, Luiz A. Raia Depto de Ciência Exata e Engenharia, DCEEng,

Leia mais

Inclusão Social dos Jovens nos Assentamentos Rurais de Areia com ênfase no trabalho da Tutoria e recursos das novas TIC s

Inclusão Social dos Jovens nos Assentamentos Rurais de Areia com ênfase no trabalho da Tutoria e recursos das novas TIC s Incluão Social do Joven no Aentamento Rurai de Areia com ênfae no trabalho da Tutoria e recuro da nova TIC MIRANDA 1, Márcia C.V.; SILVA 2, Fátima do S.; FÉLIX 3, Jânio 1 Profeora orientadora e coordenadora

Leia mais

Enterprise Quality Management [EQM] Excelência em Gestão da Qualidade

Enterprise Quality Management [EQM] Excelência em Gestão da Qualidade Enterprie Quality Management [EQM] Excelência em Getão da Qualidade A Getão da Qualidade Total, do inglê Total Quality Management - TQM é uma etratégia de adminitração completa que tem como objetivo principal

Leia mais

PENSAMENTO SISTÊMICO APLICADO A SISTEMAS DE INFORMAÇÃO UM ESTUDO DE CASO. Leila Lage Humes lhumes@usp.br

PENSAMENTO SISTÊMICO APLICADO A SISTEMAS DE INFORMAÇÃO UM ESTUDO DE CASO. Leila Lage Humes lhumes@usp.br V I I S E M E A D E S T U D O D E C A S O M É T O D O S Q U A N T I T A T I V O S E I N F O R M Á T I C A PENSAMENTO SISTÊMICO APLICADO A SISTEMAS DE INFORMAÇÃO UM ESTUDO DE CASO Leila Lage Hume lhume@up.br

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

Avaliação de Ações. Mercado de Capitais. Luiz Brandão. Ações. Mercado de Ações

Avaliação de Ações. Mercado de Capitais. Luiz Brandão. Ações. Mercado de Ações Mercado de Capitai Avaliação de Açõe Luiz Brandão O título negociado no mercado podem de renda fixa ou de renda variável. Título de Renda Fixa: Conhece-e de antemão qual a remuneração a er recebida. odem

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

METODOLOGIA DE PROJETO DE FILTROS DE SEGUNDA ORDEM PARA INVERSORES DE TENSÃO COM MODULAÇÃO PWM DIGITAL

METODOLOGIA DE PROJETO DE FILTROS DE SEGUNDA ORDEM PARA INVERSORES DE TENSÃO COM MODULAÇÃO PWM DIGITAL METODOLOGIA DE PROJETO DE FILTROS DE SEGUNDA ORDEM PARA INVERSORES DE TENSÃO COM MODULAÇÃO PWM DIGITAL Leandro Michel * Robinon F. de Camargo * michel@ieee.org robinonfc@bol.com.br Fernando Botterón *

Leia mais

Um exemplo de Análise de Covariância. Um exemplo de Análise de Covariância (cont.)

Um exemplo de Análise de Covariância. Um exemplo de Análise de Covariância (cont.) Um exemplo de Análie de Covariância A Regreão Linear e a Análie de Variância etudada até aqui, ão cao particulare do Modelo Linear, que inclui também a Análie de Covariância Em qualquer deta trê ituaçõe

Leia mais

Compensadores. Controle 1 - DAELN - UTFPR. Os compensadores são utilizados para alterar alguma característica do sistema em malha fechada.

Compensadores. Controle 1 - DAELN - UTFPR. Os compensadores são utilizados para alterar alguma característica do sistema em malha fechada. Compenadore 0.1 Introdução Controle 1 - DAELN - UTFPR Prof. Paulo Roberto Brero de Campo O compenadore ão utilizado para alterar alguma caracterítica do itema em malha fechada. 1. Avanço de fae (lead):

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

EXPERIÊNCIA 7 CONVERSORES PARA ACIONAMENTO DE MÁQUINAS ELÉTRICAS

EXPERIÊNCIA 7 CONVERSORES PARA ACIONAMENTO DE MÁQUINAS ELÉTRICAS FACULDADE DE ENGENHARIA ELÉTRICA E DE COMPUTAÇÃO - UNICAMP EE-832 - LABORATÓRIO DE ELETRÔNICA INDUSTRIAL EXPERIÊNCIA 7 CONVERSORES PARA ACIONAMENTO DE MÁQUINAS ELÉTRICAS 7. Introdução A máquina de corrente

Leia mais

PROTEÇÕES COLETIVAS. Modelo de Dimensionamento de um Sistema de Guarda-Corpo

PROTEÇÕES COLETIVAS. Modelo de Dimensionamento de um Sistema de Guarda-Corpo PROTEÇÕES COLETIVAS Modelo de Dimenionamento de um Sitema de Guarda-Corpo PROTEÇÕES COLETIVAS Modelo de Dimenionamento de um Sitema de Guarda-Corpo PROTEÇÕES COLETIVAS Modelo de Dimenionamento de um Sitema

Leia mais

XLVI Pesquisa Operacional na Gestão da Segurança Pública

XLVI Pesquisa Operacional na Gestão da Segurança Pública PROBLEMA DE CORTE UNIDIMENSIONAL COM SOBRAS APROVEITÁVEIS: RESOLUÇÃO DE UM MODELO MATEMÁTICO Adriana Cherri Departamento de Matemática, Faculdade de Ciência, UNESP, Bauru adriana@fc.unep.br Karen Rocha

Leia mais

Capítulo 5: Análise através de volume de controle

Capítulo 5: Análise através de volume de controle Capítulo 5: Análie atravé de volume de controle Volume de controle Conervação de maa Introdução Exite um fluxo de maa da ubtância de trabalho em cada equipamento deta uina, ou eja, na bomba, caldeira,

Leia mais

CLONAGEM DE DNA. CLONAGEM: é multiplicar assexuadamente. Primeiros experimentos bem sucedidos de clonagem foram mostrados no início da década de 1970.

CLONAGEM DE DNA. CLONAGEM: é multiplicar assexuadamente. Primeiros experimentos bem sucedidos de clonagem foram mostrados no início da década de 1970. Clonagem de DNA CLONAGEM DE DNA CLONAGEM: é multiplicar assexuadamente. Na Biologia Molecular, significa mais especificamente crescer uma colônia de bactérias a partir de uma célula única. Clonagem de

Leia mais

CATÁLOGO DE CURSOS SELECIONADOS

CATÁLOGO DE CURSOS SELECIONADOS CATÁLOGO DE CURSOS SELECIONADOS Laureate Network Product & Service Copyright 2013 Laureate Education, Inc. ÍNDICE C A T Á L O G O L N P S ÍCONE Nome do Curo Língua Duração Deenvolvimento do Corpo Acadêmico

Leia mais

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA

ELEMENTOS CELULARES ENVOLVIDOS NA GENÉTICA BACTERIANA GENÉTICA BACTERIANA INTRODUÇÃO O DNA existe como uma hélice de fita dupla, mantidas pelo pareamento de bases nitrogenadas específicas (AT; CG). - A seqüência de bases codifica a informação genética; -

Leia mais

XX SNPTEE SEMINÁRIO NACIONAL DE PRODUÇÃO E TRANSMISSÃO DE ENERGIA ELÉTRICA GRUPO DE ESTUDO DE ANÁLISE E TÉCNICAS DE SISTEMAS DE POTÊNCIA CA E CC - GAT

XX SNPTEE SEMINÁRIO NACIONAL DE PRODUÇÃO E TRANSMISSÃO DE ENERGIA ELÉTRICA GRUPO DE ESTUDO DE ANÁLISE E TÉCNICAS DE SISTEMAS DE POTÊNCIA CA E CC - GAT XX SNPTEE SEMINÁRIO NACIONAL DE PRODUÇÃO E TRANSMISSÃO DE ENERGIA ELÉTRICA Verão.0 22 a 25 Novembro de 2009 Recife PE GRUPO IV GRUPO DE ESTUDO DE ANÁLISE E TÉCNICAS DE SISTEMAS DE POTÊNCIA CA E CC GAT

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

A PRODUÇÃO DE SENTIDOS NOS CAMINHOS DO HIPERTEXTO THE PRODUCTION OF SENSE IN THE HYPERTEXT WAY

A PRODUÇÃO DE SENTIDOS NOS CAMINHOS DO HIPERTEXTO THE PRODUCTION OF SENSE IN THE HYPERTEXT WAY 27 A PRODUÇÃO DE SENTIDOS NOS CAMINHOS DO HIPERTEXTO THE PRODUCTION OF SENSE IN THE HYPERTEXT WAY 1 RESUMO: A tecnologia da informação e comunicação - TIC ampliam o epaço para comunicação e interação na

Leia mais

Artigos. Comunicação organizacional e relações públicas: caminhos que se cruzam, entrecruzam ou sobrepõem?

Artigos. Comunicação organizacional e relações públicas: caminhos que se cruzam, entrecruzam ou sobrepõem? E t u d o17 Artigo Comunicação organizacional e relaçõe pública: caminho que e cruzam, entrecruzam ou obrepõem? IVONE DE LOUDES OLIVEIRA Metre em Ciência da Comunicação pela ECA-USP e doutora em Comunicação

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Estrutura geral de um sistema com realimentação unitária negativa, com um compensador (G c (s) em série com a planta G p (s).

Estrutura geral de um sistema com realimentação unitária negativa, com um compensador (G c (s) em série com a planta G p (s). 2 CONTROLADORES PID Introdução Etrutura geral de um itema com realimentação unitária negativa, com um compenador (G c () em érie com a planta G p (). 2 Controladore PID 2. Acção proporcional (P) G c ()

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

O CORPO HUMANO E A FÍSICA

O CORPO HUMANO E A FÍSICA 1 a fae Prova para aluno do 9º e 1º ano LEIA ATENTAMENTE AS INSTRUÇÕES ABAIXO: 01) Eta prova detina-e excluivamente a aluno do 9 o ano do enino fundamental e 1º ano do enino médio. Ela contém trinta quetõe.

Leia mais

EFEITOS DO COEFICIENTE DE POISSON E ANÁLISE DE ERRO DE TENSÕES EM TECTÔNICA DE SAL

EFEITOS DO COEFICIENTE DE POISSON E ANÁLISE DE ERRO DE TENSÕES EM TECTÔNICA DE SAL Copright 004, Intituto Braileiro de Petróleo e Gá - IBP Ete Trabalho Técnico Científico foi preparado para apreentação no 3 Congreo Braileiro de P&D em Petróleo e Gá, a er realizado no período de a 5 de

Leia mais

Nestas notas será analisado o comportamento deste motor em regime permanente.

Nestas notas será analisado o comportamento deste motor em regime permanente. MOTO DE INDUÇÃO TIFÁSICO 8/0/006 Ivan Camargo Introdução O motor de indução trifáico correponde a, aproximadamente, 5 % da carga elétrica do Brail, ou eja, 50 % da carga indutrial que, por ua vez, correponde

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais

A CAPACIDADE DE SUBITIZING EM CRIANÇAS DE 4 ANOS

A CAPACIDADE DE SUBITIZING EM CRIANÇAS DE 4 ANOS A CAPACIDADE DE SUBIIZING EM CRIANÇAS DE 4 ANOS Maria João Ramalho Cordeiro Diertação apreentada à ecola Superior de Educação de Liboa para obtenção de grau de metre em Educação Matemática na Educação

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais

31.1 Treliça de Mörsch

31.1 Treliça de Mörsch Univeridade Católica de Goiá - Departamento de Engenharia Etrutura de Concreto Armado I - Nota de Aula conteúdo 31 cialhamento 31.1 Treliça de Mörch O comportamento de peça fletida (fiurada) de concreto

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Intruçõe Breve Verão 1 0 junho 2005 INSTRUÇÕES APENAS PARA PESSOAL QUALIFICADO APERTO DO CONJUNTO DE SUPORTES AVISO: O funcionamento da ua coluna como componente de um itema upeno pode potencialmente expor

Leia mais

Resolução de Equações Diferenciais Ordinárias por Série de Potências e Transformada de Laplace

Resolução de Equações Diferenciais Ordinárias por Série de Potências e Transformada de Laplace Reolução de Equaçõe Diferenciai Ordinária por Série de Potência e Tranformada de Laplace Roberto Tocano Couto rtocano@id.uff.br Departamento de Matemática Aplicada Univeridade Federal Fluminene Niterói,

Leia mais

ANÁLISE LINEAR COM REDISTRIBUIÇÃO E ANÁLISE PLÁSTICA DE VIGAS DE EDIFÍCIOS

ANÁLISE LINEAR COM REDISTRIBUIÇÃO E ANÁLISE PLÁSTICA DE VIGAS DE EDIFÍCIOS Anai do 47º Congreo Braileiro do Concreto - CBC005 Setembro / 005 ISBN 85-98576-07-7 Volume XII - Projeto de Etrutura de Concreto Trabalho 47CBC06 - p. XII7-85 005 IBRACON. ANÁLISE LINEAR COM REDISTRIBUIÇÃO

Leia mais

s Rede Locais s Shielded Twisted Pair (STP); s Unshielded Twisted Pair (UTP); s Patch Panels; s Cabo Coaxial; s Fibra Óptica;

s Rede Locais s Shielded Twisted Pair (STP); s Unshielded Twisted Pair (UTP); s Patch Panels; s Cabo Coaxial; s Fibra Óptica; Rede de Computadore Rede Locai Shielded Twited Pair (STP); Unhielded Twited Pair (UTP); Patch Panel; Cabo Coaxial; Fibra Óptica; 2 2010 Airton Junior. All right reerved. Rede de Computadore É um conjunto

Leia mais

CONTROLO DE SISTEMAS. APONTAMENTOS DE MATLAB CONTROL SYSTEM Toolbox. Pedro Dinis Gaspar António Espírito Santo J. A. M.

CONTROLO DE SISTEMAS. APONTAMENTOS DE MATLAB CONTROL SYSTEM Toolbox. Pedro Dinis Gaspar António Espírito Santo J. A. M. UNIVERSIDADE DA BEIRA INTERIOR DEPARTAMENTO DE ENGENHARIA ELECTROMECÂNICA CONTROLO DE SISTEMAS APONTAMENTOS DE MATLAB CONTROL SYSTEM Toolbox Pedro Dini Gapar António Epírito Santo J. A. M. Felippe de Souza

Leia mais

Programa de Formação Técnica Continuada. Categoria de Emprego para Motores CA / CC

Programa de Formação Técnica Continuada. Categoria de Emprego para Motores CA / CC Programa de Formação Técnica Continuada Categoria de Emprego para Motore CA / CC Índice.Introdução.... Chave manuai etrela triângulo.... O motore.... Motore de indução tipo gaiola.... Motore de indução

Leia mais

Vicente Leite (1), Henrique Teixeira (1), Rui Araújo (2), Diamantino Freitas (2) Resumo

Vicente Leite (1), Henrique Teixeira (1), Rui Araújo (2), Diamantino Freitas (2) Resumo Sitema Electrónico de Condicionamento e Proceamento, em Tempo Real, da Tenõe e Corrente do Motor de Indução Trifáico Alimentado por Converore de Frequência Vicente Leite (1), Henrique Teieira (1), Rui

Leia mais

ANÁLISE DOS RESULTADOS BIÓTICOS E ABIÓTICOS DA RESTAURAÇÃO DA MATA CILIAR DE NASCENTE UTILIZANDO TÉCNICAS DE NUCLEAÇÃO

ANÁLISE DOS RESULTADOS BIÓTICOS E ABIÓTICOS DA RESTAURAÇÃO DA MATA CILIAR DE NASCENTE UTILIZANDO TÉCNICAS DE NUCLEAÇÃO 164 ANÁLISE DOS RESULTADOS BIÓTICOS E ABIÓTICOS DA RESTAURAÇÃO DA MATA CILIAR DE NASCENTE UTILIZANDO TÉCNICAS DE NUCLEAÇÃO Carla Tiemi Fukumoto; Renata Ribeiro de Araújo. Engenharia Ambiental. Departamento

Leia mais

PRE/OO UM PROCESSO DE REENGENHARIA ORIENTADA A OBJETOS

PRE/OO UM PROCESSO DE REENGENHARIA ORIENTADA A OBJETOS UNIVERSIDADE FEDERAL DE SÃO CARLOS CENTRO DE CIÊNCIAS EXATAS E DE TECNOLOGIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIA DA COMPUTAÇÃO PRE/OO UM PROCESSO DE REENGENHARIA ORIENTADA A OBJETOS COM ÊNFASE NA GARANTIA

Leia mais

Equações Diferenciais (GMA00112) Resolução de Equações Diferenciais por Séries e Transformada de Laplace

Equações Diferenciais (GMA00112) Resolução de Equações Diferenciais por Séries e Transformada de Laplace Equaçõe Diferenciai GMA Reolução de Equaçõe Diferenciai por Série e Tranformada de Laplace Roberto Tocano Couto tocano@im.uff.br Departamento de Matemática Aplicada Univeridade Federal Fluminene Niterói,

Leia mais

Quantas equações existem?

Quantas equações existem? www2.jatai.ufg.br/oj/index.php/matematica Quanta equaçõe exitem? Rogério Céar do Santo Profeor da UnB - FUP profeorrogeriocear@gmail.com Reumo O trabalho conite em denir a altura de uma equação polinomial

Leia mais

Marés, fases principais da Lua e bebês

Marés, fases principais da Lua e bebês Maré, fae principai da ua e bebê CADERNO BRASIEIRO DE ENSINO DE FÍSICA, FORIANÓPOIS, V.0, N. 1: P.10-9, ABR. 003 Fernando ang da Silveira Univeridade Federal do Rio Grande do Sul UFRGS Intituto de Fíica

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

Filtros Analógicos Ativos

Filtros Analógicos Ativos Filtro Analógico Ativo Topologia Sallen-Key FPB Prof. láudio A. Fleury onteúdo. Introdução. Filtro Paa-Baixa de a. Ordem 3. Mudança de Ecala 4. Filtro Paa-Alta de a. Ordem 5. Filtro Paa-Faixa e ejeita-faixa

Leia mais

TRATAMENTO DE SEMENTES COM CLORETO DE MEPIQUAT PARA REDUÇÃO DO CRESCIMENTO DA MAMONEIRA

TRATAMENTO DE SEMENTES COM CLORETO DE MEPIQUAT PARA REDUÇÃO DO CRESCIMENTO DA MAMONEIRA TRATAMENTO DE SEMENTES COM CLORETO DE MEPIQUAT PARA REDUÇÃO DO CRESCIMENTO DA MAMONEIRA Diego de M. Rodrigue 1,2, Maria Iaura P. de Oliveira 1,2, Maria Aline de O. Freire 1,3, Lígia R. Sampaio 1,2, Walker

Leia mais

Pescando direitos. Medidas Provisórias nºs 664 e 665 de 30 dezembro de 2014. Sobre as MP's 664 e 665 de 2014:

Pescando direitos. Medidas Provisórias nºs 664 e 665 de 30 dezembro de 2014. Sobre as MP's 664 e 665 de 2014: Pecando direito Boletim Jurídico do CPP/ Abril de 2015. 1ª edição. Medida Proviória nº 664 e 665 de 30 dezembro de 2014. Sobre a MP' 664 e 665 de 2014: Em 30 dezembro de 2014 foram promulgada a Medida

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

DISTRIBUIÇÃO DE TEMPOS DE RESIDÊNCIA EM SISTEMAS ALIMENTADOS COM VAZÃO VARIÁVEL. Renata Akemi Sassaki

DISTRIBUIÇÃO DE TEMPOS DE RESIDÊNCIA EM SISTEMAS ALIMENTADOS COM VAZÃO VARIÁVEL. Renata Akemi Sassaki DISTRIBUIÇÃO DE TEMPOS DE RESIDÊNIA EM SISTEMAS ALIMENTADOS OM VAZÃO VARIÁVEL Renata Akemi Saaki TESE SUBMETIDA AO ORPO DOENTE DA OORDENAÇÃO DOS PROGRAMAS DE PÓS-GRADUAÇÃO DE ENGENHARIA DA UNIVERSIDADE

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

Implementando modelos DEA no R

Implementando modelos DEA no R Implementando modelo DEA no R Joé Francico Moreira Peanha profeorfmp@hotmail.com UERJ Alexandre Marinho alexandre.marinho@ipea.gov.br UERJ Luiz da Cota Laurencel llaurenc.ntg@terra.com.br UERJ Marcelo

Leia mais

Livro para a SBEA (material em construção) Edmundo Rodrigues 9. peneiras

Livro para a SBEA (material em construção) Edmundo Rodrigues 9. peneiras Livro para a SBEA (material em contrução) Edmundo Rodrigue 9 4.1. Análie granulométrica Granulometria, graduação ou compoição granulométrica de um agregado é a ditribuição percentual do eu divero tamanho

Leia mais

AULA 02 POTÊNCIA MECÂNICA. = τ. P ot

AULA 02 POTÊNCIA MECÂNICA. = τ. P ot AULA 0 POTÊNCIA MECÂNICA 1- POTÊNCIA Uma força pode realizar um memo trabalho em intervalo de tempo diferente. Quando colocamo um corpo de maa m obre uma mea de altura H num local onde a aceleração da

Leia mais

O URBANO E A PRODUÇÃO IMOBILIÁRIA EM CACHOEIRO DE ITAPEMIRIM - ES

O URBANO E A PRODUÇÃO IMOBILIÁRIA EM CACHOEIRO DE ITAPEMIRIM - ES P A N Ó P T I C A O URBANO E A PRODUÇÃO IMOBILIÁRIA EM CACHOEIRO DE ITAPEMIRIM - ES Daniel Pitzer Zippinotti Univeridade Federal do Epírito Santo - UFES 1. INTRODUÇÃO O preente trabalho procura apreentar

Leia mais

Vestibular 2013 2 a fase Gabarito Física

Vestibular 2013 2 a fase Gabarito Física etibular 203 2 a fae Gabarito Fíica Quetão 0 (alor: 5 ponto) Cálculo da variação da quantidade de movimento A velocidade inicial no momento do impacto erá a velocidade final da queda Aplicando conervação

Leia mais

Estratégias MIMO-OFDM para Sistemas de

Estratégias MIMO-OFDM para Sistemas de XXII SIMPÓSIO BRASILEIRO DE TELECOMUICAÇÕES - SBrT 05, 04-08 DE SETEMBRO DE 005, CAMPIAS, SP Etratégia -OFDM para Sitema de Comunicaçõe Móvei Walter C. Freita Jr., Charle C. Cavalcante e F. Rodrigo. P.

Leia mais

PROCEDIMENTO DE MERCADO AM.04 Cálculo de Votos e Contribuição

PROCEDIMENTO DE MERCADO AM.04 Cálculo de Votos e Contribuição PROCEDIMENTO DE MERCADO AM.04 Cálculo de Voto e Contribuição Reponável pelo PM: Acompanhamento do Mercado CONTROLE DE ALTERAÇÕES Verão Data Decrição da Alteração Elaborada por Aprovada por PM AM.04 - Cálculo

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

Aula 4 Modelagem de sistemas no domínio da frequência Prof. Marcio Kimpara

Aula 4 Modelagem de sistemas no domínio da frequência Prof. Marcio Kimpara FUDAMETOS DE COTROLE E AUTOMAÇÃO Aula 4 Modelagem de itema no domínio da requência Pro. Marcio impara Unieridade Federal de Mato Groo do Sul Sitema mecânico tranlação Elemento Força deloc. tempo Laplace

Leia mais