EXERCÍCIOS DE GENÉTICA VEGETAL

Tamanho: px
Começar a partir da página:

Download "EXERCÍCIOS DE GENÉTICA VEGETAL"

Transcrição

1 EXERCÍCIOS DE GENÉTICA VEGETAL Material Genético, Síntese de Proteínas e Código Genético 1. Uma célula produz cerca de proteínas cada uma com 250 aminoácidos, em média. Calcule o comprimento mínimo que deve ter o DNA desta célula, em número de nucleotídeos. 2. Um filamento simples com as seguintes bases nitrogenadas:...aaagttcc... Pode-se saber se pertence aos RNA s ou ao DNA? Se for do DNA, qual é o seu filamento complementar? Se se formasse um RNAm destes filamentos de que bases seria constituído? 3. Dado um filamento simples de DNA...5 T A C G G G T A T C A G C T G A T T 3...construa: (a) a cadeia de DNA complementar. (b) a cadeia de mrna que seria formada do filamento dado. 4. Um filamento de DNA com a seguinte seqüência de bases...attccgatgc.. será incorporado no DNA de uma célula, durante o processo de duplicação. Em qual setor do DNA da célula é possível que o fragmento dado possa se incorporar? 5. Usando a informação da Tabela de Códons, determine quais são os seguimentos polipeptídicos formados a partir dos mrna s dados a) AUGCCCGAGCCAAACGGUGGUUAA b)...5 AUGUUCCCGUCGACAGCCUAG3... c)...5 AAAACCUGGAGAACCCAUUGA 3`... Considerando o filamento (a) apenas, é possível se determinar a polaridade deste mrna? e do DNA? Se sim, quais serão?

2 2 6. Se uma proteína tiver a seguinte seqüência de aminoácidos: a)..arg - His- PF-.Met - Ile - Val - P.F. b) Met Ile- Asp Val Fen Leu P.F c)... Arg - Ser - Ser - Tri - Gli - Tri - Ser d) Met - Arg - Ile - Tri - P.F - P.F PF - Met - His - Ser - P.F. Quais as seqüências de nucleotídeos no DNA, no mrna e trna que correspondem em cada caso (cite apenas uma possível em cada caso). Determine ainda a polaridade de cada um dos filamentos do DNA que possui a informação genética. 7. Se um DNA tiver nucleotídeos, pergunta-se: a) Quantos nucleotídeos o mrna terá? b) Quantos trnas serão necessários para a tradução? c) Quantos aminoácidos a enzima terá? 8. Se um segmento curto de uma longa molécula de DNA tem a seguinte seqüência de pares de nucleotídeos:...3`ttctatccggcagcta 5` `AAGATAGGCCGTCGAT 3`.. Se o filamento...5` 3`... do DNA servir de molde para a síntese de mrna qual será a sua seqüência de ribonucleotídeos? (b)dê o ribonucleotídeo na extremidade...5` da molécula de RNA assim transcrita. (c) Qual seria a sua resposta `a parte (b) se tivesse sido o filamento...3` 5`... a servir de molde? 9. Se uma proteína tiver a seguinte seqüência de aminoácidos: MET HIS ILE HIS TRE LEU MET - PF A) Determine uma seqüência possível de nucleotídeos para o mrna correspondente a esta seqüência de aminoácidos; B) Determinado o mrna pergunta-se: Qual será a seqüência polinucleotídica da cadeia de DNA com sentido? C) E quantos e quais são os anticódons dos trnas?

3 3 10. A distância entre pares de bases no DNA é de 3,4 angstrons. Qual o tamanho do DNA, em centímetros, do milho, se ele possui 1,36 x pb? E do fumo, já que ele tem 2,18 x 10 9 pb? Dados: 1 angstron = m. 11. Em feijão (Phaseolus vulgaris L.) o gene da enzima málica foi codificado e partes dele se encontram abaixo especificado Exon 1 Intron 1 Exon 2 Intron 2 Exon 3 5 ATGAACTCGCAT GTCAAAT AAGTTG GTACCA TGGATGCAGTTTTAG3 3 TACTTGAGCGTA CAGTTTA TTCAAC CATGGA ACCTACGTCAAAATC5 O fio a ser usado nessa questão é o que tem TIMINA na extremidade 3. A partir dessa informação: A) qual o RNAhn e o RNAm? B) quais os aminoácidos que farão parte dessa enzima? C) quantos RNAt diferentes serão necessários para essa síntese? D) considerando a fita sense, a que inicia por ADENINA na extremidade 5, se ocorrer uma deleção na 5ª base e a adição de uma CITOSINA após o 23º desoxirribonucleotídeo, qual será a cadeia polinucleotídica a partir desse DNA mutado? (Fonte: WALTER, M. et al. Eur. J. Biochem. 224: , 1994) 12. Em duas seqüências de bases nucleotídicas denominadas RNAm foram econtrados vários códons, entretanto a análise da proteína correspondente foi encontrado os mesmos aminoácidos nas duas seqüências, assim como verificaram que havia o mesmo número de códons e aminoácidos. Por fim, foram indentificados códons que permitiam o desligamento do RNA do ribossomo. Baseado nisso, a que propriedades do código genético correspondem os casos estudados? 13. Na cadeia de DNA abaixo descrita estão exemplificadas propriedades do código genético. Assinale os códons que se relacionem com as propriedades e explique cada uma das que consta na seqüência TACGTGTCCAACTTGGCCGTAATC A página seguinte possui a Tabela do Códons (mrna) para que os problemas que necessitem dela possam ser resolvidos.

4 4 TABELA DE CÓDONS (RNAm) PRIMEIRA BASE SEGUNDA BASE G A C U TERCEIRA BASE GLICINA AC. GLUTÂMICO ALANINA VALINA G G GLICINA AC. GLUTÂMICO ALANINA VALINA A GLICINA AC. ASPÁRTICO ALANINA VALINA C GLICINA AC. ASPÁRTICO ALANINA VALINA U ARGININA LISINA TREONINA METIONINA G (INICIO DE CADEIA) A ARGININA LISINA TREONINA ISOLEUCINA A SERINA ASPARAGINA TREONINA ISOLEUCINA C SERINA ASPARAGINA TREONINA ISOLEUCINA U ARGININA GLUTAMINA PROLINA LEUCINA G C ARGININA GLUTAMINA PROLINA LEUCINA A ARGININA HISTIDINA PROLINA LEUCINA C ARGININA HISTIDINA PROLINA LEUCINA U TRIPTOFANO FIM DE CADEIA SERINA LEUCINA G U FIM DE FIM DE CADEIA SERINA LEUCINA A CADEIA CISTEÍNA TIROSINA SERINA FENILALANINA C CISTEÍNA TIROSINA SERINA FENILALANINA U

5 5 14. Responda: A) O que são bases nucleotídicas e onde se encontram? B) O que são aminoácidos e onde se encontram? C) Há relação entre bases nucleotídicas e aminoácidos? Se sim, qual? D) Quais as origens das bases nucleotídicas e dos aminoácidos? E) Por que é formado o prérnam no interior do núcleo? F) Como o prérnam se transforma em RNAm e por que? G) Qual o nucleotídeo do códon que vai determinar, efetivamente, o aminoácido que deve entrar na cadeia polipeptídica? Mutações e alterações cromossômicas 15. Tendo a seguinte seqüência de DNA: seu mrna é: T A C T A G T A A T G A G T A C G A C T G A T C a proteína é constituída dos seguintes resíduos de aminoácidos é: Se houver a inclusão, por ação de mutagênicos, do nucleotídeo ADENINA entre o quarto e o quinto desoxirribonucleotídeo, de quais resíduos será formada a cadeia proteíca? Esta mutação de ponto alterou a estrutura primária da cadeia de proteína? 16. Baseado no DNA da questão anterior: devido a ação dos mutagênicos químicos houve a substituição da GUANINA na posição 6 por uma TIMINA. De quais resíduos ficou formada a proteína? Houve alteração na cadeia proteica? 17. Baseado no DNA da questão anterior, DNA mutante. Sabe-se que o DNA se duplica levando a mutação silenciosa. Verifique se, na próxima geração, é possível aparecer a mutação a partir do RNAm sintetizado tendo como molde o novo fio complementar de DNA ao que foi formado com a mutação na questão 16.

6 6 18. A cor do pimentão pode ser verde ou amarela. A cor verde é dominante sobre a amarela, de forma que em todos os cruzamentos o alelo tem grande probabilidade de aparecer. Se cada alelo condiciona a produção de uma proteína para a cor, através do DNA e se num dos fios de DNA houver a alteração de uma base nucleotídica que modifique a cor de verde para amarelo, qual será a chance da cor verde aparecer novamente na segunda geração após a alteração nucleotídica? 19. Usando a informação da Tabela de Códons realize em (a) uma transversão no 10º desoxirribonucleotídeo; em (b) uma transição no DNA que originou esse RNAm e em (c) ambas mutações em cada ribonucleotídeo das extremidades e determine quais são os seguimentos polipeptídicos formados a partir dos mrna s dados A) AUGCCCGAGCCAAACGGUGGUUAA B)...5 AUGUUCCCGUCGACAGCCUAG3... C)...5 AAAACCUGGAGAACCCAUUGA 3`... D) Considerando o filamento (a) apenas, é possível se determinar a polaridade deste mrna? E do DNA? 20. Considerando o cariótipo com 2n = 8 cromossomos: Represente um nulissômico, um monossômico, um trissômico,um tetrassômico, um haplóide, um triplóide e um tetraplóide. 21. Em trigo, considerando dois genes em cromossomos independentes, um para arista (A determina a presença e a ausência) e outro para cor do grão (B determina cor creme e b cor branca), há possibilidade do aparecimento de aneuplóides, naturalmente, provocando variabilidade na cultura, se o grão de pólen mutado for detectado. Supondo que o gene para a presença de aristas esteja num cromossomo que foi perdido durante a meiose. O grão de pólen, apesar da mutação continua fértil. Execute o cruzamento entre plantas com os dois marcadores genéticos e descreva a freqüência fenotípica em F Proponha o cruzamento entre plantas que possuam 2n=6 cromossomos, mas que uma seja portadora de uma trissomia em qualquer de um dos seus cromossomos. Faça o desenho da formação dos gametas. 23. Considerando o exemplo da cor do endosperma e que haja interação alélica do tipo intermediária em sementes de milho, programe um cruzamento entre dois duplex e determine a sua proporção fenotípica, sabendo que R determina a presença de antocianina na aleurona e o alelo r condiciona a ausência desse pigmento, e, ainda, que o genótipo Rrr condiciona grãos pintados.

7 7 24. Do cruzamento de um simplex com um duplex ambos tetraplóides, qual o resultado em termos fenotípicos apresentados. Considere um gene qualquer com interação de dominância, por exemplo, presença e ausência de clorofila nas folhas, a presença é dominante e a ausência é recessiva. 25. A presença de clorofila é um dos genes considerados em análises do número de cromossomos nas espécies. Espécies poliplóides possuem mais clorofila e são mais verdes do que as diplóides e essas mais verdes do que as haplóides. Construa um esquema, usando desenho de cromossomos, desde um grão de pólen cultivado, in vitro, de um indivíduo autotetraplóide. 26. As células de um progenitor masculino contêm um par de cromossomos homólogos AA e um cromossomo B apenas, sem seu homólogo. Qual é a constituição cromossômica de cada um dos quatro gametas produzidos numa divisão meiótica completa? Analise todas as hipóteses prováveis. 27. Em batatas várias ploidias podem ser encontradas e as plantas cruzadas entre si com o auxílio do melhorista. Plantas diploides de batata portando gene para folha lobada foram cruzadas com plantas tetraploides da mesma espécie, porém com folhas recortadas. Sendo a recortada dominante sobre a lobada, qual o tipo de folhas resultante desse cruzamento. Demonstre os genótipos de ambas as espécies, os gametas de cada genitor e o cruzamento. 28. No centro de origem de Hordeum (espécie de cevada) foram encontradas plantas cujas folhas produziam quantidades diferenciadas de proteínas. Por exemplo, a espécie A produzia cerca de 840 µg de proteína glicolisada, enquanto que a espécie B produzia cerca de 210 µg da mesma proteína. Como essa proteína é produzida por apenas um alelo dominante do gene, o que se pode dizer sobre a constituição genotípica dessas duas espécies? Se houver cruzamento dessas espécies entre si, qual a quantidade prevista de proteína a planta fértil é capaz de produzir? 29. Responda: A) O que é transversão e transição? No teu entendimento qual é a mais prejudicial para o organismo? B) Conceitue mutação homozigótica e descreva o seu efeito no indivíduo que a possui. C) Por que os poliplóides são considerados bons colonizadores de ambientes nos quais os diplóides não se adaptam? D) Nos indivíduos poliplóides ocorrem algumas alterações fenotípicas. Exemplo disso são os estômatos e os cloroplastos. Relate o que acontece com essas estruturas citoplasmáticas quando as células são poliplóides.

8 8 30. Numa população de Phaseolus lunatus foram encontradas células do arqueosporo com 43 cromossomos, enquanto que alguns óvulos possuíam 10 cromossomos. Se houver autofecundação que tipo de aneuplóide poderá ser formado? Explique o que levou a formação de aneuplóides a partir de diplóides normais. 31. Na evolução de plantas foi comum a alopoliploidia seguido da autopoliploidia. Baseado nisso, quantas cromátides irmãs e centrômeros podem ser encontradas numa espécie resultante do cruzamento de duas outras que continham, respectivamente, A células meristemáticas com 32 cromossomos e B células do endosperma com 96 cromossomos? 32. As plantas diplóides produzem gametas normalmente e, na dupla fertilização, originam o embrião e o endosperma. Utilizando então o endosperma, amiláceo (Su) e doce (su), para caracterizar tecidos triplóides verifique qual a constituição genotípica do endosperma a partir do cruzamento entre plantas com fenótipo amiláceo x doce, sendo que o fenótipo amiláceo é dominante sobre doce. 33. A cor amarela no endosperma do grão de milho é dominante sobre a cor branca. O endosperma é derivado da fecundação do mesocisto por um dos núcleos reprodutivos do grão de pólen. Se a constituição genética do mesocisto for yy e houver fecundação por outro y a cor será branca. Entretanto, se o mesocisto for YY e for fecundado por Y então a cor será amarela. A intensidade da cor variará com a quantidade de alelos Y. Da mesma forma, o alelo Y soma 2,20 unidades de vitamina A/g (UVA/g) a quantidade básica de 0,05 UVA/g nos grãos de milho cuja combinação alélica é yyy. Determine a cor do grão e a quantidade de UVA/g usando todas as combinações possíveis a partir da fecundação do mesocisto pelo núcleo do grão de pólen (Fonte: PATERNIANI, E. Genética e melhoramento do milho. Cap.4. In: KRUG et al. Cultura e adubação do milho. São Paulo: Instituto Brasileiro de Potassa p ). Mitose, Meiose, Monohibridismo, Dihibridismo e Polihibridismo 34. Considerem que uma planta possua 2n = 32 cromossomos, diga: A) Quantos cromossomos terão no final da mitose e da meiose? B) Quantas cromátides tem cada célula desse vegetal que sofre divisão? C) Quantos centrômeros uma célula dessa planta possui quando está em metáfase? D) Quantos cromossomos terão as células mãe do grão de pólen e quantos no micrósporo 35. Considerem que uma planta de soja possua 2n = 40 cromossomos, diga:

9 9 A) Quantos cromossomos terão no final da mitose e da meiose? B) Quantas cromátides têm cada célula desse vegetal que sofre divisão? C) Quantos centrômeros possuem uma célula dessa planta que está em metáfase? D) Quantos cromossomos terão as células-mãe do grão de pólen e quantos no micrósporo? As plantas de trigo possuem 2n =7x = 42 cromossomos, portanto, responda as mesmas perguntas da questão anterior para essa cultura. 36. Em Coleus blumei as células somáticas são diplóides e possuem 24 cromossomos. Quantos, de cada um dos seguintes, estão presentes em cada célula no estágio de mitose ou meiose indicados: (Fonte: BURNS, G. W. Genética. Uma Introdução à Hereditariedade, p.94). A) centrômeros na anáfase? B) centrômeros na anáfase I? C) cromátides na metáfase I D) cromátides na anáfase? E) cromossomos na anáfase? F) cromossomos na metáfase? G) cromossomos no final da telófase I e na telófase II? 37. Certa planta tem 8 cromossomos nas células de suas raízes, um par metacêntrico comprido, um par metacêntrico curto, um par acrocêntrico longo e um par acrocêntrico curto. Em sua meiose quantos destes cromossomos aparecerão nas células resultantes. Demonstre o processo por desenho. 38. Considere a existência de um atraso cromossômico na meiose da planta da questão anterior, de forma que um cromossomo do par metacêntrico comprido seja perdido. Como ficarão as células dos micrósporos, produzidas por meiose? 39. Responda: a) Estabeleça uma relação entre a duplicação do DNA e as cromátides-irmãs. b) A formação de anexos vegetais, como gavinhas, por exemplo, ocorre devido alongamento da epiderme nas plantas que a possuem. Qual a origem celular desses acessórios nas plantas? c) No teu entendimento, qual a importância da formação das tétrades na microsporogênese? De onde, imediatamente, derivam? d) Quais os pontos semelhantes entre a microsporogênese e a megasporogênese? 40. Relacione todos diferentes gametas que podem ser produzidos pelos seguintes indivíduos: a) AABBCc b) aabbcc

10 10 c) AABbCcddEeFf d) AABBCCDDEEFFGGHHIi (Fonte: BURNS, G. W. Genética. Uma Introdução à Hereditariedade, 1984, p.95) 41. Responda: a) O que é um indivíduo, ou uma população, homozigota? b) O que é um indivíduo, ou uma população, heterozigota? 42. Um indivíduo é heterozigoto para dois pares de genes que estão situados no mesmo par cromossômico, A e B em um cromossomo com a e b situados no cromossomo homólogo. (a) Quantos e quais os genótipos gaméticos esse indivíduo pode produzir, caso não haja crossing-over? (b) Havendo crossing-over, quantos genótipos gaméticos serão produzidos por esse indivíduo? (c) Faça o mesmo raciocínio quando forem considerados 3 genes que estejam no mesmo cromossomo. (Fonte: BURNS,W. Genética. Uma Introdução à Hereditariedade, p.95) 43. A relação entre cromátides recombinadas e não recombinadas é de, no máximo, 50 %. Quantas cromátides deverão mostrar recombinação para que a relação chegue a 25% numa célula onde o número somático é 2n=24? 44. Um indivíduo é heterozigoto para os 4 pares de genes A, B, C e D. Os alelos A e B estão no mesmo par de cromossomos homólogos, enquanto que C e D estão juntos no outro par de homólogos. Preveja quais os tipos de gametas que esse indivíduo produz considerando uma permuta entre A e B somente. Quais os tipos de gametas se em ambos cromossomos houver uma permuta? 45. Se indivíduos da população F2 com genótipos heterozigotos forem cruzados entre si a proporção de homozigoto e de heterozigoto na F3 se manterá? Demonstre isso a partir do cruzamento das gerações paternais. 46. Em uma determinada planta o cruzamento, púrpura x azul dá uma prole com flores púrpura e azul, em igual proporção, mas azul x azul dá prole azul. (a) Caracterize os tipos dos cruzamentos que foram realizados e demonstre quais são os genótipos das plantas com flores azul e púrpura? (b) Qual o fenótipo dominante? (Fonte: BURNS, G. W. Genética. Uma Introdução à Hereditariedade, 1984, p.33) 47. Em cevada a presença e ausência de aristas nos grãos é dependente de um gene K. K que determina a ausência é dominante sobre seu homólogo k que determina a presença das aristas. Variedades homozigotas com e sem aristas foram cruzadas entre si. (a) Qual o fenótipo das plantas em F 1 e a freqüência fenotípica em F 2? (b) Como se poderá determinar a constituição genética das plantas em F 2?

11 Duas vacas pretas (Polled angus) foram cruzadas várias vezes com o mesmo touro amarelo (Caracu). Da primeira resultaram 3 terneiros amarelos e 2 pretos. Da segunda obtiveram todos os 6 descendentes de cor preta. Determine a relação de dominância e o genótipo de cada bovino mencionado. 49. Do cruzamento de várias plantas de ervilhas, obtiveram-se os seguintes resultados? a) alta x alta = 324 altas e 110 baixas b) alta x baixa = 392 altas e 401 baixas c) alta x baixa = 427 altas Determine a relação de dominância e o genótipo de cada vegetal. 50. STEWART (1960) estudando o tipo de herança que ocorre nas cores das brácteas em Poinsétia (Euphorbia pulcherrima Wild) realizou cruzamentos diversos entre plantas que possuíam flores com brácteas vermelhas com as que as apresentavam brancas, e obteve os seguintes resultados: Cor das brácteas Cruzamentos Vermelhas Brancas a) Ruth Ecke autopolinização 51 0 b) Ruth Ecke F c) White Ecke autopolinização 0 59 d) (White Ecke autop) X White Ecke 0 78 e) White Ecke F f) White Ecke X Ruth Ecke 151 1* g) (White Ecke x Ruth Ecke) X Ruth Ecke 236 2* h) (White Ecke x Ruth Ecke) X white Ecke i) (White Ecke x Ruth Ecke) F * Valores desconsiderado para estabelecer alguma proporção. Provavelmente a ocorrência de uma mutação, por isso deve ser desconsiderada para efeito de cálculo. Baseado nos dados acima determine o alelo dominante e o genótipo de cada planta que fez parte dos cruzamentos. (Fonte: STEWART, R. N. The Journal of Heredity, 51(4), 1960). 51. Usando as combinações superiores, diga qual o tamanho da população necessária quando consideramos 4 pares de alelos envolvidos. E qual será o número de fenótipos de F2 supondo-se dominância completa em todos os loci e ainda qual será o número de genótipos em F2? Prediga ainda os resultados quando tivermos 5 e 6 pares de alelos envolvidos, para as mesmas perguntas.

12 Qual o número de fenótipos seriam obtidas na prole de um cruzamento de Coleus blumei com genótipo DdIiWwYy, considerando: a) Dominância completa em todos os loci? b) Co-dominância em todos os loci? c) Dominância completa nos dois primeiros e co-dominância nos dois últimos? 53. Responda: a) Qual a diferença entre a dominância completa e a co-dominância quanto ao número de fenótipos que aparecem em F 2? Justifique. b) Se dois indivíduos da F 2 com genótipos heterozigotos forem cruzados entre si, a proporção de F 3 se manterá como a da geração anterior? Demonstre a partir de um cruzamento desde as gerações paternais. 54. Mendel cruzou ervilhas que produziam sementes lisas com ervilhas que produziam sementes rugosas. De um total de sementes na F2, eram lisas e eram rugosas. Utilizando os símbolos Ww para os genes, responda: (a) qual é o cruzamento P original; (b) quais são os gametas; (c) como é a constituição genotípica e fenotípica da F 1 ; (d) represente um cruzamentos de duas plantas F; (e) simbolise os gametas; (d) apresente os resultados para F 2 : fenótipo, genótipo, freqüência genotípica e razão fenotípica. Faça o Teste de hipótese e aplique o Teste do Qui- quadrado. 55. A cor do tegumento dos grãos de lentilhas (Lens culinares) é marrom e verde e a forma do grão é lisa e rugosa. A situação abaixo demonstra a segregação de F 2 para a cor do tegumento e do retrocruzamento realizados. Baseado nesses dados, elabore hipóteses de trabalho para ambos os cruzamentos e determine o intervalo da probabilidade (P) usando o teste do qui-quadrado para testar as hipóteses. Marrom lisa Marrom rugosa Fenótipo Verde lisa Verde rugosa Grupo F RC1 200 RC Em pássaros as penas sedosas são determinadas por um gene cujo efeito é recessivo em relação aos de penas normais. (a) se de um cruzamento entre indivíduos heterozigóticos para tal gene se criassem 395 aves, quantos se espera que sejam sedosos e quantos normais? (b) se tivesse uma ave com penas normais, qual seria o caminho mais rápido para se determinar se ela é heterozigótica ou homozigótica para tal gene?

13 Responda: a) O que significa teste de progênie? b) O que determina o teste do retrocruzamento? c) É possível se transferir genes de uma planta para outra através do cruzamento simples? Se sim, como isso se operaria? d) Por que é necessária a utilização de dados estatísticos em cruzamentos de plantas? e) Como se pode conceituar espécies de plantas? 58. Foram realizados cruzamentos entre linhagens homozigotas derivadas de cruzamentos entre as espécies Lycopersicon esculentum x L. peruvianum para estabelecer a herança para resistência a murcha bacteriana em tomate (TSWV) e encontraram em F plantas resistentes e 163 suscetíveis. O retrocruzamento com o pai suscetível apresentou a proporção e 194: 222 (resistente: suscetível) e com o pai resistente apenas 353 plantas todas resistentes. Usando o símbolo criado pelo autor, S W5, para resistência a doença, determine o tipo de herança, diagrame os cruzamentos a partir a geração paternal e teste os valores observados. 59. Foi estudada a herança da resistência à raça 73 de antracnose causada por Colletotrichum lindemuthianum em cultivares de feijão, no sul de Minas Gerais. Duas cultivares, suscetível e resistente, foram utilizadas no cruzamento paternal. A F 1 demonstrou resistência à raça 73 do patógeno e a F 2 segregou na proporção de 155: 50. Determine se a proporção é de caráter mendeliano e diga qual o comportamento segregante da F 1 com o progenitor resistente e com o suscetível. O autor sugere que o gene para resistência seja simbolizado por Co-6. (Fonte: PAULA Jr., T. et al. Revista Ceres. Viçosa, 44(254): , 1997). 60. O alelo Ms do gene para macho esterilidade é dominante sobre ms que determina fertilidade em grãos de pólen de milho. O alelo G determina a cor branca dos cotilédones, enquanto que seu alelo recessivo g determina cotilédones verdes. Baseado nesses dois genes determine a proporção de indivíduos férteis a partir do cruzamento de uma planta MsMsGG com msmsgg. 61. O tegumento verde na semente da soja é controlado pelo gene G, que é dominante sobre g que determina tegumento amarelo. Esses mesmos genes controlam lesão nãoclorótica e clorótica, respectivamente, quando a planta é suscetível a septoriose. Do cruzamento de uma planta de tegumento verde com outra de tegumento amarelo, qual é a proporção de plantas com manchas cloróticas e não-cloróticas, se elas forem atacadas pela septoriose?

14 Responda: a) O que é efeito de pleiotropia gênica? b) Sob o ponto de vista bioquímico molecular, como pode um gene participar de mais de um efeito fenotípico? 63. Quatro das plantas autofecundadas de F 1 que Mendel observou segregavam para cor amarela e verde do tegumento da semente. A tabela abaixo demonstra o resultado: Plantas Sementes Amarelas Verdes Determine a homogeneidade das quatro plantas para a proporção ¾ : ¼ e veja se é possível somar os dados para calcular o Qui-quadrado. 64. Em ervilhas de jardim o efeito do alelo para planta alta T é dominante sobre o alelo para planta baixa t e o efeito do alelo para semente lisa S é dominante sobre o alelo para rugosa s. Também se sabe que estes genes segregam-se independentemente. (a) que proporção fenotípica espera-se entre a descendência de plantas da F 1 altas e de sementes lisas cruzadas entre si (derivadas de genitores homozigóticos para ambos os genes)? (b) haveria variação nos fenótipos da geração F se as plantas da F 1 derivassem de pais Ttss com ttss? (c) que resultados fenotípicos se esperariam do cruzamento entre plantas da F 1 com plantas baixas e de sementes lisas? 65. Um lote de sementes foi obtido de duas populações homozigotas cujas cores das flores eram brancas e amarelas. Em F2 resultaram 305 plantas com flores brancas e 97 amarelas. Após o melhorista introduziu outro marcador genético a essa população e obteve 299 plantas normais e 131 plantas varigegadas. Sendo a branca dominante sobre amarela e normal sobre variegada qual a probabilidade de se aceitar a hipótese de genes independentes para ambas características juntas? 66. Dois genes independentes estão segregando numa população de plantas. O gene para raízes adventícias, recessivo, segregou em 32 raízes adventícias e 97 raízes normais. O outro gene que determina a presença de acúleos, quando estudado sozinho, segregou em 35 plantas sem acúleos, 78 com acúleos pequenos e 30 com acúleos longos. Se esses genes forem estudados juntos, na mesma população, quantos se esperariam de cada fenótipo numa população de 2325 plantas?

15 MENEZES (1953) pesquisou a herança de características contrastantes em variedades de batata doce, como rama verde e arroxeada; casca branca e arroxeada e polpa branca e creme, na Seção de Genética do Instituto de Ecologia e Experimentação Agrícola do Ministério da Agricultura, no Rio de Janeiro e se obteve os seguintes resultados: Quadro 1 Herança da cor das ramas em F 2 Cor das ramas Nº de plantas Verde 70 Arroxeada 26 Quadro 2 - Herança da cor do tubérculo Cor do tubérculo Nº de plantas Branco 68 Arroxeado 28 Quadro 3 - Herança da cor da polpa Cor da polpa Nº de plantas Branca 67 Creme 27 Baseado nessas três tabelas defina a herança de cada uma das características. Proponha uma nomenclatura genética e teste os valores pelo teste do ℵ 2. (Fonte: MENEZES, O B. Revista Ceres, 51: , 1953). 68. Utilizando os dados da tabela abaixo (geração F 2 ) determine a independência dos genes e os genótipos dos pais e da F 1 (Fonte: MENEZES, O B. Revista Ceres,51: ,1953). Fenótipos Nº de plantas Raiz branca e polpa branca 49 Raiz branca e polpa creme 19 Raiz roxa e polpa branca 20 Raiz roxa e polpa creme WANN e HILLS (1973) estudaram dois genes de natureza fisiológica em tomate. Um responsável pelo transporte de ferro (fer) e outro pelo de boro (btl), ambos recessivos. O quadro abaixo demonstra o número de plantas resutantes dos cruzamentos entre as linhagens

16 16 Cruzamentos Fenótipos/ nº de plantas Normal btl fer btl/fer Cruzamento A F F BC BC Cruzamento B F F BC BC Determine o genótipo dos pais e, a independência dos genes no cruzamento B pelo teste do ℵ 2. (Fonte: WANN, E. V. e HILLS, W. A. The Journal of Heredity, 64: , 1973). 70. Responda: a) Qual o objetivo de se testar os valores na segregação fenotípica de F 2 pelo teste do qui-quadrado? b) Esse teste aplica-se somente a geração F 2 ou pode ser aplicado em outra geração? Se sim, qual a geração? 71. Plantas de milho resistentes a Helmintosporium turcicum possuem o alelo Ht do gene para resistência. Da mesma forma o gene Rt determina a resistência a P. sorghi e o genótipo ag ag condiciona plantas resistentes ao ataque de gafanhotos. Se plantas resistentes a todas as características são cruzadas com plantas suscetíveis qual a probabilidade de, em F 2, aparecer plantas suscetíveis a Helmintosporium turcicum e resistentes aos demais fatores estudados? E qual a probabilidade de aparecerem plantas somente suscetíveis ao ataque de gafanhotos? 72. Um pesquisador encontrou certas variedades de linho que mostram distintas resistências a cepas específicas de um fungo chamado ferrugem do linho (Melampsora lini). Por exemplo, a variedade de linho 770B é resistente à raça 24 da ferrugem, porém suscetível a raça 22, enquanto que a variedade Bombay é resistente à raça 22 e suscetível a 24, para o mesmo fungo. O pesquisador cruzou ambas as variedades entre si e encontrou um híbrido resistente as raças 22 e 24, ao mesmo tempo. A geração F 2 produziu os seguintes fenótipos, a partir dos cruzamentos de F 1 x F 1 :

17 17 Raça 24 Raça 22 Resistente Suscetível Resistente Suscetível 32 9 (a) Proponha hipóteses que expliquem a base genética da resistência à ferrugem do linho, para cada uma das raças, independentemente. (b) Baseando-se em suas hipóteses que valores se esperariam para as quatro categorias na F2? (c) Prove sua hipótese pelo teste do ℵ 2. (Fonte: SUZUKI, D. T. et al. Introdução à Genética. 4.ed. 1992, p.95). 73. Em 1901 Bateson realizou o primeiro estudo pósmendeliano de um cruzamento que diferia em dois caracteres. Cruzou galinhas brancas Leghorn, com cristas grandes inteiras e de penas brancas com aves Indian Game com cristas pequenas em ervilha e de penas escuras. A F 1 era branca com cristas em ervilha. Um cruzamento entre essas F 1 resultaram na seguinte descendência, em F 2 : 52 brancas, em ervilha, 17 brancas, inteiras, 14 escuras, em ervilha e 8 escuras, inteiras. (a) Determine a significância ou não dos valores pelo teste do Qui-quadrado. (b) Que valores se esperariam para cada um dos tipos descritos? 74. Baseando-se nos dados do problema anterior, que fenótipos e que proporção se esperaria obter se se cruzasse a F 1 com: a) Com a raça White Leghorn? b) Com a raça Indian Game? c) Com as da F 2 com penas escuras e crista inteira? 75. Se a cor do tegumento dos grãos de lentilha (Lens culinares) for marrom e verde e se a forma for redonda e rugosa, responda a seguinte situação: Considere 3 grupos A, B, C de lentilhas marrons e redondas. Cada grupo foi plantado e cruzado com plantas originadas de uma ervilha verde, rugosa. Exatamente 200 lentilhas resultante de cada cruzamento foram classificadas como se segue: Fenótipo Marrom redonda Amarela rugosa Verde redonda Verde rugosa Grupo A B 200 C Baseado nos dados do quadro acima, defina os genótipos das gerações paternais A, B e C e teste os valores pelo teste do qui-quadrado, determinando o intervalo da probabilidade (P).

18 Em soja há cultivares que possuem nodulação diferencial à estirpe de Rhizobium. A cultivar A é nodulada apenas pela raça 33, enquanto a cultivar B o é pela 61. Das 3328 plantas obtidas na F2, quantas pode se dizer que não serão noduladas por nenhuma das raças. As plantas noduladas pela raça 33 possuem genes rj3 rj3 e plantas noduladas pela 61 apresentam genes rj4 rj4. Os alelos dominantes demonstram pouca ou nenhuma nodulação. Represente o cruzamento. 77. Responda: a) As descrições genéticas são feitas com base nos indivíduos recessivos. Explique o porquê disso. b) O que são genes de ação independente? Há outra forma de ação gênica? Se houver, qual é? 78. Dois genes determinam a resistência à raça 1 e 2 de Cercospora sojina. O gene Res1 e Res2 promovem a resistência, respectivamente. Seus alelos recessivos determinam suscetibilidade. O cultivar Lincoln é suscetível à raça 2, enquanto que o Kente é a raça 1. Qual a probabilidade do aparecimento de plantas resistentes a ambas as raças numa população de plantas, originadas do cruzamento de híbridos provenientes de pais homozigotos resistente e suscetível. 79. Pelo menos três genes de ação independente estão envolvidos na resistência a Puccinia coronata em aveia. As variedades resistentes à raça 1 são Bond, Santa Fé, Victória e Landhafer, entretanto Bond e Victória são suscetíveis à raça 101, enquanto as outras são resistentes. Os genótipos que conferem suscetibilidade a raça 101 a resistência à raça 1 para a variedade Victória é VVllmm e para resistência as mesmas raça para a Landhafer é vvllmm. Qual a probabilidade de se obter resistência as duas raças cruzando-se Victória, com Landhafer. (Fonte: POELHMAN, J. M p.164). 80. Em tomateiros fruto vermelho R é dominante sobre fruto amarelo r; fruto biloculado P é dominante sobre fruto poliloculado p e fruto de pele lisa L é dominante sobre fruto de pele rugosa l. Baseado nesses dados responda: a) Qual será o fenótipo da planta RrppLL? b) Qual será(ão) o(s) genótipo(s) de planta(s) com frutos vermelhos, poliloculados e de pele lisa? c) Se cruzarmos uma planta RrPpLl com outra idêntica, quanto ao genótipo, que proporção de plantas descendentes espera-se que tenha: fruto vermelho, poliloculado e pele lisa? Fruto amarelo, biloculado e pele rugosa?

19 19 Interação Gênica Alelismo Múltiplo, Epistasia e Herança Citoplasmática 81. Responda: a) O que significa interação alélica? b) Quantos genes são necessários para haver uma interação? c) O que significa interação gênica? d) Como se pode distinguir epistasia do dihibridismo? 82. A altura das plantas de soja pode ser condicionada por uma série alélica de genes. O alelo S determina altura reduzida; s altura normal e s t altura aumentada, sendo a seguinte a ordem de dominância: s > S > s t. Realize o cruzamento entre uma planta normal, portadora do alelo para planta reduzida, com outra de altura também normal, porém portadora do alelo para aumentada, e diga quais os fenótipos obtidos e em que freqüência. 83. A série alélica V participa da formação da cor das vagens, junto com os alelo A, a a e a. O gene V junto com a a e junto com a produz vagens estriadas e rosa normal, respectivamente; com A produz vagens amarelas, que também é determinada por, vlae e v junto com a a e a, porém vlae- A- e vva- produz vagens vermelhas. Partindo desses dados determine a cor das vagens, em F 2 do seguinte cruzamento: VV a a a a x vlae vlae AA. (Fonte: MORAES, C. F. e VIEIRA, C. Revista Ceres.Viçosa, 86(15): , 1968). 84. Sabe-se que um par de alelos codominantes controla a cor da folha cotiledonar da soja. O genótipo homozigoto CgCg determina a cor verde escura, o genótipo CyCy determina folhas amarelas, sendo o heterozigoto verde claro. O homozigoto amarelo tem deficiência em clorofila que jamais chega à maturidade. (a) Se plantas verde escuras são cruzadas com plantas verdes claras, quais serão as proporções fenotípicas da descendência em estágio de plântula e qual em estágio de planta adulta? (b) Se plantas verdes claras são cruzadas entre si, quais serão as proporções fenotípicas da descendência em plântula e em estágio adulto? 85. A forma e a cor de rabanetes são controladas por dois pares independentes de alelos que não apresentam dominância; cada genótipo é distinguível fenotipicamente. A cor pode ser vermelha (RR) ou branca (R`R`) e púrpura (RR`) e a forma pode ser longa (LL), oval (LL`) ou arredondada (L`L`). Usando o método do quadrado de Punnet, esquematize um cruzamento entre rabanetes vermelhos, longos (RRLL) e brancos arredondados (R`R`L`L`) e apresente os resultados dos fenótipos, genótipos e freqüência fenotípica da F 2.

20 Determine a ordem de dominância dos seguintes alelos P púrpura, P1 turquesa e P2 azul, para flores boca-de-leão, cujos resultados dos cruzamentos estão na tabela abaixo: Cruzamentos Genitores Descendência 1 Púrpura x azul Todas púrpuras 2 Púrpura x púrpura 76 púrpuras e 25 turquesas 3 Azul x azul Todas azuis 4 Púrpura x turquesa 49 púrpuras e 52 turquesas 87. Nas plantas denominadas dondiego de la noche (Mirabilis jalapa) o alelo para cor roxa das flores tem um efeito que é incompletamente dominante sobre o seu homólogo branco. Se um cruzamento entre duas plantas produziu 18 plantas roxas, 32 plantas rosa e 15 brancas. (a) Elabore o teste de hipóteses; (b) Teste os valores pelo teste do Qui-quadrado; e (c) Determine os genótipos e os fenótipos dos progenitores. 88. Foram cruzadas duas linhagens de ervilhas de flores brancas produzindo uma F 1 de flores púrpuras. O cruzamento aleatório entre a F 1 produziu 96 plantas, 53 com flores púrpuras e 43 com flores brancas. Pergunta-se: (a) Aproximadamente qual a proporção fenotípica da F 2? (b) Que tipo de interação está envolvida? (c) Quais foram os prováveis genótipos das linhagens parentais? (d) Se for aplicado o teste do qui-quadrado, haverá significância dos valores? 89. O pólen de plantas de tomates virescentes (amarelecentos devido a deficiência e clorofila) foi utilizado para fecundar uma planta normal verde (com produção normal de clorofila). Todos os híbridos se apresentaram de cor verde normal. Ao cruzar um desses híbridos com uma planta de cor virescente se obteve uma progênie formada por 112 plantas verdes e 72 plantas virescentes. Que conclusão se pode obter com tal resultado sobre o tipo de interação que está ocorrendo nesse caso? 90. Em populações de feijão (Phaseolus vulgaris) dois genes aparecem para determinar a cor do tegumento das sementes. Na contagem das sementes imaturas foram encontrados os seguintes fenótipos e suas quantidades: sementes esverdeadas 450 e sementes azuladas 150. Baseado nesses dados responda (a) que tipo de interação está ocorrendo? (b) qual a proporção fenotípica esperada para essa interação? 91. Hagiwara, um pesquisador japonês indicou que a cor púrpura da flor dondiego de dia japonês (Pharbitis nil) pode ser determinada por qualquer um de dois pares de genes separados, por exemplo A- bb ou aab-. Quando estão presentes os alelos dominantes de ambos os pares de genes (A- B-) as flores são de cor azul e quando ambos são homozigotos recessivos (aa bb) são de cor escarlate. Desse modo se obteve uma F 1 de cor azul cruzando-se dois tipos púrpuras distintos AA bb x aa BB. Pergunta-se: a) Que fenótipos e em que proporção se esperaria do curzamento da F 1 com qualquer uma das flores paternais? b) Que fenótipos e em que proporção se esperaria de um cruzamento de plantas F 1 s entre si? (Fonte: SUZUKI, D. T. et al. Introdução à Genética. 4.ed. Rio de Janeiro. Guanabara Koogan. l p.).

GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA

GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA UNIVERSIDADE FEDERAL RURAL DA AMAZÔNIA DISCIPLINA DE GENÉTICA GENÉTICA MENDELIANA ou GENÉTICA QUALITATIVA Profa. Dra. Mônica Gusmão Engenheira Agrônoma Profa. Mônica Gusmão PERGUNTAS FUNDAMENTAIS DOS PADRÕES

Leia mais

DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I

DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I DESENVOLVENDO HABILIDADES EM GENÉTICA - PARTE I Leia o texto abaixo com atenção. Considere que, nos pombos, a ausência de s é condicionada geneticamente. Nos cruzamentos que um criador realizava, ele observou

Leia mais

Hereditariedade. Leis da hereditariedade GENÉTICA

Hereditariedade. Leis da hereditariedade GENÉTICA Hereditariedade Definição: É a transferência de informações sobre as características próprias de um ser vivo para outro, de geração para geração, por meio dos gametas ou por transferência direta deácidos

Leia mais

Leis de Mendel. Genética Biologia III

Leis de Mendel. Genética Biologia III Leis de Mendel Genética Biologia III Mendel (1822-1884) Por que ervilhas? Variedades com características bem definidas, sem formas intermediárias; Fácil cultivo; Ciclo reprodutivo curto; Grande número

Leia mais

Lei da Segregação. Experimentos de Mendel

Lei da Segregação. Experimentos de Mendel Lei da Segregação Os trabalhos do monge Agostinho Gregor Mendel, realizados há mais de um século, estabeleceram os princípios básicos da herança, que, até hoje, são aplicados nos estudos da Genética. A

Leia mais

Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal

Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal Universidade Federal de Pelotas FAEM - DZ Curso de Zootecnia Genética Aplicada à Produção Animal Genética clássica: mono, di e polihibridismo, alelismo múltiplo. A PRIMEIRA LEI DE MENDEL OU PRINCÍPIO DA

Leia mais

INTRODUÇÃO AO ESTUDO DA GENÉTICA

INTRODUÇÃO AO ESTUDO DA GENÉTICA INTRODUÇÃO AO ESTUDO DA GENÉTICA PROFESSORA: SANDRA BIANCHI ASSUNTOS ESTUDADOS NA GENÉTICA ESTUDO DOS GENES E DA HEREDITARIEDADE A GENÉTICA E A MATEMÁTICA ESTUDANDO PROBABILIDADE FÓRMULA GERAL: P(A) =

Leia mais

Perspectiva Histórica

Perspectiva Histórica Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI José Ribamar Genética Mendeliana Perspectiva Histórica

Leia mais

BIOLOGIA GENÉTICA PROF ESTEVAM

BIOLOGIA GENÉTICA PROF ESTEVAM BIOLOGIA GENÉTICA PROF ESTEVAM 1) (FUVEST) Dois genes alelos atuam na determinação da cor das sementes de uma planta: A, dominante, determina a cor púrpura e a, recessivo, determina cor amarela. A tabela

Leia mais

1ª e 2ª Lei de Mendel

1ª e 2ª Lei de Mendel Conceitos Básicos 1ª e 2ª Lei de Mendel A Genética estuda os processos de hereditariedade, que explicam como as características podem ser transmitidas para os descendentes. Explicação teórica: cada característica

Leia mais

HERANÇA MONOGÊNICA 1ª LEI DE MENDEL. Gregor Mendel : => Nasceu na Morávia, império Austro-húngaro. Gregor Mendel

HERANÇA MONOGÊNICA 1ª LEI DE MENDEL. Gregor Mendel : => Nasceu na Morávia, império Austro-húngaro. Gregor Mendel Genética Mendeliana: aquela determinada por um ou poucos genes, cuja epressão não é influenciada ou é pouco afetada pelo meio. HERANÇA MONOGÊNICA => Conceito de gene (mas não o termo) => foi proposto pela

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 94) Considere a figura a seguir que representa o resultado da primeira divisão meiótica de uma célula feminina: a) Indique o genótipo do embrião formado a partir da fecundação do óvulo resultante

Leia mais

O primeiro a realizar trabalhos rigorosos nesta área foi Gregor Mendel, baseando-se na análise estatística de resultados experimentais obtidos em

O primeiro a realizar trabalhos rigorosos nesta área foi Gregor Mendel, baseando-se na análise estatística de resultados experimentais obtidos em O primeiro a realizar trabalhos rigorosos nesta área foi Gregor Mendel, baseando-se na análise estatística de resultados experimentais obtidos em cruzamentos realizados com a ervilheira (Pisum sativum).

Leia mais

De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um

De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um indivíduo. 01) Considerando-se um indivíduo AaBbcc pode-se

Leia mais

BATERIA DE EXERCÍCIOS 8º ANO

BATERIA DE EXERCÍCIOS 8º ANO Professor: CRISTINO RÊGO Disciplina: CIÊNCIAS Assunto: FUNDAMENTOS DE GENÉTICA Belém /PA BATERIA DE EXERCÍCIOS 8º ANO 1. (UFMG) Indique a proposição que completa, de forma correta, a afirmativa abaixo:

Leia mais

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE DEFINIÇÃO Palavra de origem grega gennos (fazer nascer- geração). Estudo dos mecanismos de transmissão de características de uma espécie,

Leia mais

UNIVERSIDADE FEDERAL DE SANTA MARIA CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA

UNIVERSIDADE FEDERAL DE SANTA MARIA CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA 1. Introdução UNIVERSIDADE FEDERAL DE SANTA MARIA CENTRO DE CIÊNCIAS NATURAIS E EXATAS CCNE DEPARTAMENTO DE BIOLOGIA DISCIPLINA DE GENÉTICA AGRONOMIA Unidade 5 O estudo atual da Genética leva as mais profundas

Leia mais

GENÉTICA. Prof. André Maia

GENÉTICA. Prof. André Maia GENÉTICA Prof. André Maia É a parte da Biologia que estuda os mecanismos através dos quais as características são transmitidas hereditariamente (de pai para filho) através das gerações. Termos e Conceitos

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

c) 9 tipos diferentes. d) 27 tipos diferentes.

c) 9 tipos diferentes. d) 27 tipos diferentes. 1 EXERCÍCIOS 2ª LEI DE MENDES (César) 1) De acordo com a segunda lei de Mendel, dois caracteres se distribuem, quanto ao genótipo, em F2, em: a) 4 tipos diferentes. b) 8 tipos diferentes. c) 9 tipos diferentes.

Leia mais

1.- De Mendel a Morgan. Componentes básicos das células

1.- De Mendel a Morgan. Componentes básicos das células 1.- De Mendel a Morgan Componentes básicos das células Conceitos mendelianos de genética QUESTÂO: Existe uma base celular para as características hereditárias? Período 1850-1865: Charles Darwin e Gregor

Leia mais

Primeira Lei de Mendel. Natália A. Paludetto nataliaapaludetto@gmail.com http://proenem.sites.ufms.br/

Primeira Lei de Mendel. Natália A. Paludetto nataliaapaludetto@gmail.com http://proenem.sites.ufms.br/ 0 Primeira Lei de Mendel Natália A. Paludetto nataliaapaludetto@gmail.com http://proenem.sites.ufms.br/ Primeira Lei de Mendel Mendel demonstrou que a herança não é obra do acaso e sim determinada por

Leia mais

INTERAÇÃO GÊNICA EPISTASIA POLIGENIA OU HERANÇA QUANTITATIVA. PM/Bombeiro - PR. Oromar Ciências Humanas Parte 03. Foto das cristas de galinhas

INTERAÇÃO GÊNICA EPISTASIA POLIGENIA OU HERANÇA QUANTITATIVA. PM/Bombeiro - PR. Oromar Ciências Humanas Parte 03. Foto das cristas de galinhas INTERAÇÃO GÊNICA Ocorre quando dois ou mais pares de genes, situados em cromossomos homólogos diferentes, interagem entre si para determinar uma mesma característica. FENÓTIPOS Crista ervilha Crista rosa

Leia mais

LEIS BÁSICAS DA HEREDITARIEDADE E EXTENSÕES DAS LEIS DE MENDEL

LEIS BÁSICAS DA HEREDITARIEDADE E EXTENSÕES DAS LEIS DE MENDEL LEIS BÁSICAS DA HEREDITARIEDADE E EXTENSÕES DAS LEIS DE MENDEL Aula 2 META Explicitar os princípios básicos da hereditariedade propostos por Mendel e as variações de mecanismos de herança. OBJETIVOS Ao

Leia mais

Biologia: Genética e Mendel

Biologia: Genética e Mendel Biologia: Genética e Mendel Questão 1 A complexa organização social das formigas pode ser explicada pelas relações de parentesco genético entre os indivíduos da colônia. É geneticamente mais vantajoso

Leia mais

Lista de Exercícios GENÉTICA 1ª e 2ª Lei de Mendel Profº Fernando Teixeira fernando@biovestiba.net

Lista de Exercícios GENÉTICA 1ª e 2ª Lei de Mendel Profº Fernando Teixeira fernando@biovestiba.net Lista de Exercícios GENÉTICA ª e 2ª Lei de Mendel Profº Fernando Teixeira fernando@biovestiba.net 0 - (ACAFE SC/203) A imagem abaixo trata-se de um: a) hemograma, gráfico usado em genética para representar

Leia mais

Apostila de Biologia 11 Leis de Mendel

Apostila de Biologia 11 Leis de Mendel Apostila de Biologia 11 Leis de Mendel Matheus Borges 1.0 Conceitos Básicos Herança biológica ou hereditariedade: características básicas da espécie que herdamos como também as características individuais.

Leia mais

SISTEMAS REPRODUTIVOS DE PLANTAS CULTIVADAS

SISTEMAS REPRODUTIVOS DE PLANTAS CULTIVADAS SISTEMAS REPRODUTIVOS DE PLANTAS CULTIVADAS 4 I. INTRODUÇÃO O conhecimento do sistema reprodutivo das espécies a serem melhoradas é de fundamental importância para o melhorista. O tipo de reprodução é

Leia mais

Genética I: Mendel, Mitose e Meiose

Genética I: Mendel, Mitose e Meiose Página 1 de 6 Genética I: Mendel, Mitose e Meiose Uma forma de estudar a função biológica é pegar um organismo/célula e dividi-lo em componentes, como as proteínas, e então estudar os componentes individuais.

Leia mais

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel

1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel 1ª e 2ª LEI DE MENDEL Professor: Robson Fernando Missio http://people.ufpr.br/~rfmissio/robson.htm Objetivo: apresentara 1a e 2a Lei de Mendel Quadrado de Punnet Segregação fenotípica 3/4 Preto 1/4 marron

Leia mais

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Biologia Princípios Básicos de Genética A genética é a parte da biologia que trata do estudo dos genes e de suas manifestações,

Leia mais

MENDELISMO. Primeira Lei de Mendel ou Princípio da Segregação ou Lei da pureza dos gametas:

MENDELISMO. Primeira Lei de Mendel ou Princípio da Segregação ou Lei da pureza dos gametas: Genética Animal - Mendelismo 1 MENDELISMO Primeira Lei de Mendel ou Princípio da Segregação ou Lei da pureza dos gametas: Mendel concluiu que os padrões hereditários são determinados por fatores (genes)

Leia mais

Avaliação molecular da macho-esterilidade citoplasmática em milho

Avaliação molecular da macho-esterilidade citoplasmática em milho Jornal Eletrônico da Embrapa Milho e Sorgo (Sete Lagoas-MG) Ano 04 - Edição 26 - Agosto / Setembro de 2010 Artigo Avaliação molecular da macho-esterilidade citoplasmática em milho por Sílvia Neto Jardim

Leia mais

1 GENÉTICA MENDELIANA

1 GENÉTICA MENDELIANA 1 GENÉTICA MENDELIANA Gregor J. Mendel nasceu em 1822, no ano de 1843 ingressou no mosteiro Altbriinn, que pertencia à Ordem dos Agostinianos, na antiga cidade de Bruiinn, Áustria, hoje Brno, República

Leia mais

Os estudos de Mendel

Os estudos de Mendel Os estudos de Mendel Além de estudar isoladamente diversas características fenotípicas da ervilha, Mendel estudou também a transmissão combinada de duas ou mais características. Em um de seus experimentos,

Leia mais

A Genética Mendeliana

A Genética Mendeliana MATERIAL DE APOIO A Genética Mendeliana O conceito de um fator hereditário como determinante das características de um indivíduo foi introduzido primeiramente por Gregor Mendel em 1865, embora ele não

Leia mais

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto Genética Humana Faculdade Anísio Teixeira Prof João Ronaldo Neto Segregação dos Genes Segregação independente ou Herança diibrida; Com base nos experimentos de Mendel com as ervilhas chamamos de segregação

Leia mais

Lista de Exercícios Complementares Meiose, Primeira Lei de Mendel e Casos Especiais da Primeira Lei Prof. Daniel Lucena

Lista de Exercícios Complementares Meiose, Primeira Lei de Mendel e Casos Especiais da Primeira Lei Prof. Daniel Lucena Lista de Exercícios Complementares Meiose, Primeira Lei de Mendel e Casos Especiais da Primeira Lei Prof. Daniel Lucena 1-(ANHMEBI-MED 2014) Ao realizar meiose, um organismo diploide, duplo heterozigoto

Leia mais

13.01. Os casos onde dois ou mais genes influenciam uma só característica são denominados de Interações Genéticas. RREE, RrEE, RrEe, RREe

13.01. Os casos onde dois ou mais genes influenciam uma só característica são denominados de Interações Genéticas. RREE, RrEE, RrEe, RREe BIO 5E aula 13 13.01. Os casos onde dois ou mais genes influenciam uma só característica são denominados de Interações Genéticas. 13.02. FENÓTIPOS Rosa Ervilha Noz Simples GENÓTIPOS RRee, Rree rree, rree

Leia mais

GENÉTICA APLICADA AO MELHORAMENTO ANIMAL

GENÉTICA APLICADA AO MELHORAMENTO ANIMAL MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL GENÉTICA APLICADA AO MELHORAMENTO ANIMAL 1. DIVISÃO DO MATERIAL

Leia mais

16.02. A recombinação genética ocorre em todos os pares de cromossomos das células humanas que estão em meiose.

16.02. A recombinação genética ocorre em todos os pares de cromossomos das células humanas que estão em meiose. BIO 6E aula 16 16.01. A pleiotropia ocorre quando um gene influencia mais de uma característica. Em genes que estão localizados no mesmo par de cromossomos porém distante um do outro, a maioria dos gametas

Leia mais

Genética Básica. Coordenador: Victor Martin Quintana Flores. Exercícios Resolvidos

Genética Básica. Coordenador: Victor Martin Quintana Flores. Exercícios Resolvidos Genética Básica Coordenador: Victor Martin Quintana Flores Exercícios Resolvidos Genética Mendeliana 1- Uma planta de ervilha heterozigota que é alta e amarela, HhAa, é autofertilizada. Qual é a probabilidade

Leia mais

Universidade Federal do Paraná Campus Palotina

Universidade Federal do Paraná Campus Palotina Universidade Federal do Paraná Campus Palotina Genética - 4ª Lista de Exercícios/2011 Primeira Lei de Mendel 1. O biólogo francês Cuénot cruzou camundongos cinzentos selvagens com camundongos brancos (albinos).

Leia mais

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto

Genética Humana. Faculdade Anísio Teixeira. Prof João Ronaldo Neto Genética Humana Faculdade Anísio Teixeira Prof João Ronaldo Neto Jan/2012 Princípios Básicos da Herança Jan/2012 Mendelismo 1ª Lei de Mendel É a Lei da Segregação dos fatores onde os fatores que condicionam

Leia mais

COLÉGIO PEDRO II TEXTO COMPLEMENTAR 09 / 2015 PÁGINA 1 DE 8

COLÉGIO PEDRO II TEXTO COMPLEMENTAR 09 / 2015 PÁGINA 1 DE 8 HISTÓRICO COLÉGIO PEDRO II CAMPUS TIJUCA II DEPARTAMENTO DE BIOLOGIA E CIÊNCIAS COORD.: PROFa. CRISTIANA LIMONGI 1º & 2º TURNOS 3ª SÉRIE/ENSINO MÉDIO REGULAR & INTEGRADO ANO LETIVO 2015 PROFESSORES: FRED

Leia mais

Entendendo a herança genética. Capítulo 5 CSA 2015

Entendendo a herança genética. Capítulo 5 CSA 2015 Entendendo a herança genética Capítulo 5 CSA 2015 Como explicar as semelhanças entre gerações diferentes? Pai e filha Avó e neta Pai e filho Avó, mãe e filha Histórico Acreditava na produção, por todas

Leia mais

GENÉTICA HERANÇA MENDELI- ANA

GENÉTICA HERANÇA MENDELI- ANA BIOLOGIA GENÉTICA HERANÇA MENDELI- ANA 1. HEREDITARIEDADE Desde séculos, o homem estabeleceu que, numa infinita diversidade de formas, as gerações se sucedem de tal modo que semelhante origina semelhante.

Leia mais

UDESC - Assinale a alternativa correta relacionada à lei de segregação independente estabelecida por Gregor Mendel.

UDESC - Assinale a alternativa correta relacionada à lei de segregação independente estabelecida por Gregor Mendel. 2ª LEI DE MENDEL UDESC - Assinale a alternativa correta relacionada à lei de segregação independente estabelecida por Gregor Mendel. a) Gametas parentais são aqueles que apresentam as novas combinações

Leia mais

PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert

PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert 1. DADOS DE IDENTIFICAÇÃO Nível de Ensino: Ensino Médio Ano/Série: 3º ano Disciplina: Biologia Quantidade de aulas: 2 2. TEMA

Leia mais

d) a probabilidade de serem negros é maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra.

d) a probabilidade de serem negros é maior do que a de serem brancos. e) 50% apresentam pele branca e 50%, pele negra. INTERAÇÕES GÊNICAS 1) FATEC - A surdez pode ser uma doença hereditária ou adquirida. Quando hereditária, depende da homozigose de apenas um dos dois genes recessivos, (d) ou (e). A audição normal depende

Leia mais

4. Assuntos: 4.1 Introdução aos mecanismos da evolução. 4.2 Introdução à genética moderna.

4. Assuntos: 4.1 Introdução aos mecanismos da evolução. 4.2 Introdução à genética moderna. Universidade Estadual do Rio Grande do Sul Curso Superior de Tecnologia em Gestão Ambiental Biologia Aplicada Aula 8 Professor Antônio Ruas 1. Créditos: 60 2. Carga horária semanal: 4 3. Semestre: 1 4.

Leia mais

Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº. Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh

Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº. Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh . Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh. 1- Em um experimento, preparou-se um conjunto de plantas por técnica de clonagem

Leia mais

Variações numéricas Poliploidia Quando um organismo apresenta mais de dois genomas no mesmo núcleo; É comum em plantas; Desempenha um papel importante na origem e evolução das plantas silvestres e cultivadas.

Leia mais

1ª LEI DE MENDEL 17/05/2012. 1) Conceitos Prévios. a) Genética

1ª LEI DE MENDEL 17/05/2012. 1) Conceitos Prévios. a) Genética 1) Conceitos Prévios a) Genética É a ciência que estuda a transmissão de características hereditárias de pais para filhos ao longo das gerações. b) Gene Segmento da molécula de DNA capaz de determinar

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 91) No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento

Leia mais

Mendel Por que Ervilhas?

Mendel Por que Ervilhas? Mendel Por que Ervilhas? Conclusão: Enunciado da 1 a lei: A 1 a lei também pode ser chamada de: Cruzamentos: 1 a Lei de Mendel Exemplo: altura Base citológica da 1 a lei P: Alta X Baixa F1: Baixa F2: Alta

Leia mais

Escola Secundária Padre António Vieira

Escola Secundária Padre António Vieira CORRECÇÃO Escola Secundária Padre António Vieira Biologia 12º Ano 2008/2009 Teste sumativo nº 1 2º Período I O desenvolvimento de um novo ser depende de factores genéticos, mas também de factores hormonais.

Leia mais

GENÉTICA MENDELIANA. Msc. Carlos Figueirêdo

GENÉTICA MENDELIANA. Msc. Carlos Figueirêdo GENÉTICA MENDELIANA Msc. Carlos Figueirêdo MENDELISMO 1. Termos e expressões 2. Mendel 3. Experimentos de Mendel 4. Primeira lei de Mendel 5. Segunda lei de Mendel Termos e expressões Característica:

Leia mais

Nome: Nº Ano: 3º Turma: Disciplina: Biologia Professor: Wanessa Data: / /

Nome: Nº Ano: 3º Turma: Disciplina: Biologia Professor: Wanessa Data: / / Nome: Nº Ano: 3º Turma: Disciplina: Biologia Professor: Wanessa Data: / / 1ª Lei de Mendel 01. Ordene as duas colunas e assinale a ordem certa. Atividade 1 Lista de exercícios Genética 05. Qual a probabilidade

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 2004) As três cores de pelagem de cães labradores (preta, marrom e dourada) são condicionadas pela interação de dois genes autossômicos, cada um deles com dois alelos: "Ee" e "Bb". Os cães homozigóticos

Leia mais

Curso: Veterinária 2 Semestre Campus Palotina. Professor. Dr. Robson Fernando Missio rfmissio@yahoo.com.br

Curso: Veterinária 2 Semestre Campus Palotina. Professor. Dr. Robson Fernando Missio rfmissio@yahoo.com.br Curso: Veterinária 2 Semestre Campus Palotina Professor Dr. Robson Fernando Missio rfmissio@yahoo.com.br Alelo formas alternativas de um gene; Os genes podem existir em diferentes versões chamadas alelos

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Unesp 97) Em gatos, as cores marrom e branca dos pêlos têm sido descritas como devidas a, pelo menos, um par de genes. Considere o cruzamento de gatos homozigotos brancos e marrons. Qual a proporção

Leia mais

LINKAGE E OS MAPAS GENÉTICOS

LINKAGE E OS MAPAS GENÉTICOS Disciplina: Biologia Série: 2ª série EM - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Linkage e os Mapas Genéticos Humanos LINKAGE E OS MAPAS GENÉTICOS Os trabalhos de Gregor Mendel não foram

Leia mais

a) Qual é a probabilidade de o genótipo da primeira criança ser igual ao de seus genitores?

a) Qual é a probabilidade de o genótipo da primeira criança ser igual ao de seus genitores? 1. (Unifesp 2015) Charles Darwin explicou o mecanismo evolutivo por meio da ação da seleção natural sobre a variabilidade dos organismos, mas não encontrou uma explicação adequada para a origem dessa variabilidade.

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 95) Um homem afetado por uma doença genética muito rara, de herança dominante, casa-se com uma mulher, não consangüínea. Imagine que o casal tenha doze descendentes, seis filhos e seis filhas.

Leia mais

Fuvest 2005 2ª fase BIOLOGIA

Fuvest 2005 2ª fase BIOLOGIA Fuvest 2005 2ª fase BIOLOGIA 1. Os esquemas representam cortes transversais de regiões jovens de uma raiz e de um caule de uma planta angiosperma. Alguns tecidos estão identificados por um número e pelo

Leia mais

Unidade III Tecnologia. Aula 10.2 Conteúdo: Aplicando conceitos: Primeira Lei de Mendel

Unidade III Tecnologia. Aula 10.2 Conteúdo: Aplicando conceitos: Primeira Lei de Mendel Unidade III Tecnologia. Aula 10.2 Conteúdo: Aplicando conceitos: Primeira Lei de Mendel 2 Habilidade: Aplicar os conceitos da Primeira Lei de Mendel por meio de exercícios. 3 REVISÃO Primeira Lei de Mendel

Leia mais

Uma planta que produz rabanetes redondos foi cruzada com outra que produzia rabanetes alongados, resultando no surgimento de 100% de plantas que

Uma planta que produz rabanetes redondos foi cruzada com outra que produzia rabanetes alongados, resultando no surgimento de 100% de plantas que Uma planta que produz rabanetes redondos foi cruzada com outra que produzia rabanetes alongados, resultando no surgimento de 100% de plantas que produziam rabanetes ovais. O cruzamento das plantas que

Leia mais

BIOLOGIA. Ano Lectivo 2013/2014. Aula 11

BIOLOGIA. Ano Lectivo 2013/2014. Aula 11 BIOLOGIA Ano Lectivo 2013/2014 Aula 11 Sumário (2 de Dezembro de 2013) Interpretação das primeiras experiências, descrição das segundas experiências e enunciados das leis de Mendel. Retrocruzamentos e

Leia mais

GENÉTICA 1ª Lei de Mendel

GENÉTICA 1ª Lei de Mendel GENÉTICA 1ª Lei de Mendel 1) Um rato marrom foi cruzado com duas fêmeas pretas. Uma delas teve 7 filhotes pretos e 6 filhotes de cor marrom. A outra teve 14 filhotes de cor preta. Os genótipos do macho

Leia mais

Padrões de Transmissão

Padrões de Transmissão Padrões de Transmissão Gênica Padrões de Transmissão Gênica DISCIPLINA: GENÉTICA BÁSICA PROFA. ZULMIRA LACAVA E LUZIRLANE BRAUN Heranças Monogênicas ou Mendelianas 1 1ª Lei de Mendel Modelo pressupôs que

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

DOMESTICAÇÃO DAS PLANTAS CULTIVADAS

DOMESTICAÇÃO DAS PLANTAS CULTIVADAS DOMESTICAÇÃO DAS 2 PLANTAS CULTIVADAS INTRODUÇÃO A domesticação é um processo evolucionário conduzido pelo homem visando adaptar plantas e animais às necessidades humanas. Plantas domesticadas são geneticamente

Leia mais

Universidade Federal da Paraíba Universidade Aberta do Brasil UFPB VIRTUAL COORDENAÇÃO DO CURSO DE LICENCIATURA EM CIÊNCIAS BIOLÓGICAS À DISTÂNCIA

Universidade Federal da Paraíba Universidade Aberta do Brasil UFPB VIRTUAL COORDENAÇÃO DO CURSO DE LICENCIATURA EM CIÊNCIAS BIOLÓGICAS À DISTÂNCIA CB Virtual 5 Universidade Federal da Paraíba Universidade Aberta do Brasil UFPB VIRTUAL COORDENAÇÃO DO CURSO DE LICENCIATURA EM CIÊNCIAS BIOLÓGICAS À DISTÂNCIA Caixa Postal 5046 Campus Universitário -

Leia mais

3-Esquematize o exame de tipagem sanguínea e possíveis resultados.

3-Esquematize o exame de tipagem sanguínea e possíveis resultados. Lista de exercícios para prova mensal do 3º bimestre 1-Diferencie autossomos de heterossomos. 2-Defina e exemplifique: a) Herança ligada ao sexo b) Herança restrita ao sexo c) Herança influenciada pelo

Leia mais

MEIOSE E AS LEIS DE MENDEL

MEIOSE E AS LEIS DE MENDEL 1 MEIOSE E AS LEIS DE MENDEL Autores: Lyria Mori e Maria Augusta Querubim Rodrigues Pereira. Versão inicial: Carlos Ribeiro Vilela e Maria Augusta Q. Rodrigues Pereira Versão atual: Lyria Mori e Maria

Leia mais

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº

3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº . 3º trimestre- LISTA DE EXERCICIOS - Biologia - CESINHA Ensino Médio 1º ano classe: Prof. Cesinha Nome: nº Valor: 10 Nota:. 1. (Uel 2015) Leia o texto a seguir. Quando se fala em divisão celular, não

Leia mais

2. (FATEC) Um casal cujo filho é do grupo sanguíneo A, com fator Rh positivo, pode ter os seguintes genótipos:

2. (FATEC) Um casal cujo filho é do grupo sanguíneo A, com fator Rh positivo, pode ter os seguintes genótipos: Foz do Iguaçu, de de 2015. Nome: nº Professor Ailton Pastro. 1 a série A, B, C e D Nota: LISTA DE QUESTÕES TRABALHO BIMESTRAL 1. (MACK) Um indivíduo de tipo sanguíneo O, Rh-, filho de pais tipo sanguíneo

Leia mais

MELHORAMENTO DE PLANTAS AUTÓGAMAS POR HIBRIDAÇÃO

MELHORAMENTO DE PLANTAS AUTÓGAMAS POR HIBRIDAÇÃO MELHORAMENTO DE PLANTAS AUTÓGAMAS POR HIBRIDAÇÃO 7 INTRODUÇÃO Vimos no capítulo anterior a utilização da seleção no melhoramento de espécies autógamas. O requisito básico para utilizarmos essa técnica

Leia mais

Primeira Lei de Mendel -> recebe mais dois nomes: dominância completa (heterozigoto manifesta uma das duas características) ou monohibridismo

Primeira Lei de Mendel -> recebe mais dois nomes: dominância completa (heterozigoto manifesta uma das duas características) ou monohibridismo Genética 1ª Lei de Mendel Começa a fazer a divisão com os indivíduos parentais, puros, com base na cor dos parentais. Alelos, partes de um cromossomo, são genes situados na mesma posição de cromossomos

Leia mais

DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS. Prof. Olayr Modesto Jr.

DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS. Prof. Olayr Modesto Jr. DOMESTICAÇÃO DE ESPÉCIES CULTIVADAS Prof. Olayr Modesto Jr. INTRODUÇÃO A domesticação é um processo evolucionário conduzido pelo homem visando adaptar plantas e animais às necessidades humanas. Plantas

Leia mais

Mecanismos de Herança

Mecanismos de Herança Mecanismos de Herança Andréa Trevas Maciel Guerra Depto. De Genética Médica FCM - UNICAMP Mecanismo de Herança Conceitos básicos Herança Monogênica Herança mitocondrial Imprinting Autossomos (1 a 22) Autossomos

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

BIOLOGIA. 08. O desenho ilustra os cromossomos em uma fase da divisão celular e seus respectivos alelos.

BIOLOGIA. 08. O desenho ilustra os cromossomos em uma fase da divisão celular e seus respectivos alelos. BIOLOGIA CURSO APOIO 08. O desenho ilustra os cromossomos em uma fase da divisão celular e seus respectivos alelos. a) Qual fase da divisão celular está representada? Justifique sua resposta. b) Ao final

Leia mais

Genética Monoibridismo e Alelos Múltiplos

Genética Monoibridismo e Alelos Múltiplos Genética Monoibridismo e Alelos Múltiplos Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Hibridação Definição: O cruzamento entre indivíduos homozigotos que apresentam

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

FUNDAMENTOS DE GENÉTICA APLICADA À CANARICULTURA. Fernando A. Bretas Viana

FUNDAMENTOS DE GENÉTICA APLICADA À CANARICULTURA. Fernando A. Bretas Viana FUNDAMENTOS DE GENÉTICA APLICADA À CANARICULTURA Fernando A. Bretas Viana INTRODUÇÃO IMPORTÂNCIA DA GENÉTICA EM CANARICULTURA UM JUIZ PRECISA SABER GENÉTICA? É DIFÍCIL? É UMA CIÊNCIA EXATA? POSSO CONFIAR

Leia mais

NÚCLEO e DIVISÃO CELULAR

NÚCLEO e DIVISÃO CELULAR NÚCLEO e DIVISÃO CELULAR CÉLULA EUCARIONTE Cláudia Minazaki NÚCLEO Único; Normalmente: central Formato: acompanha a forma da célula Tamanho: varia com o funcionamento da célula Ciclo de vida da célula

Leia mais

Primeira Lei de Mendel e Heredograma

Primeira Lei de Mendel e Heredograma Primeira Lei de Mendel e Heredograma 1. (UFC-2006) Leia o texto a seguir. A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Cap.2.1. Alterações do Material Genético Mutações UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação Problemática

Leia mais

Experimentação em Genética e Melhoramento

Experimentação em Genética e Melhoramento 04 Introdução Experimentação em Genética e Melhoramento Na natureza as espécies vegetais podem se reproduzir assexudamente ou sexuadamente. Pode-se ter as seguintes classificação: Assexuada; Sexuadas:

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Unidade 7. Reprodução e hereditariedade

Unidade 7. Reprodução e hereditariedade Unidade 7 Reprodução e hereditariedade O ESTUDO DA HEREDITARIEDADE Teoria da pré-formação ou Progênese: dentro de cada semente (gameta) existiam miniaturas de seres humanos, chamados homúnculos. Gregor

Leia mais

TURMA DE MEDICINA. VESPERTINO - MÓDULO II BIOLOGIA - Parte 02 EDUCANDO PARA SEMPRE

TURMA DE MEDICINA. VESPERTINO - MÓDULO II BIOLOGIA - Parte 02 EDUCANDO PARA SEMPRE 2015 TURMA DE MEDICINA VESPERTINO - MÓDULO II BIOLOGIA - Parte 02 EDUCANDO PARA SEMPRE 2015 - APOSTILA TURMA DE MEDICINA MÓD II Prof. James Scandian CAPÍTULO 11 - HEREDOGRAMAS 1. INTRODUÇÃO Os heredogramas,

Leia mais

Resoluções das atividades

Resoluções das atividades LIVRO BIOLOGIA Resoluções das atividades Sumário Capítulo 5 Genética do sangue e eritroblastose fetal Capítulo 6 Herança dos cromossomos sexuais Capítulo 7 Lei da Segregação Independente e interação gênica

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais