Introdução à análise de dados de sequenciadores de nova geração Versão Leonardo Varuzza

Tamanho: px
Começar a partir da página:

Download "Introdução à análise de dados de sequenciadores de nova geração Versão 2.0.1. Leonardo Varuzza"

Transcrição

1 Introdução à análise de dados de sequenciadores de nova geração Versão Leonardo Varuzza Abril 2013

2 2

3 Sumário 1 Introdução O que é NGS Como funciona o NGS Preparo da amostra Amplificação de biblioteca Sequenciamento Ion Torrent SOLiD Aplicações do NGS Ressequenciamento genômico Target Sequencing RNA Seq Sequenciamento denovo Metagenoma Arquivos de Sequência Fasta e FastQ Files Fasta format FastQ format SFF File Converter arquivo SFF para Fasta ou FastQ Unmapped BAM XSQ Format Mapeamento de Sequências SAM e BAM Files Estrutura do arquivo SAM BAM File Samtools Picard Mapeando os reads com o TMAP Criando o índice Mapeando os reads Exemplo: Mapeando os reads de E. coli com o TMAP Mapeando dados de Long Mate Pair Bowtie Utilizando o Bowtie Utilizando o Bowtie 2 com o Ion Torrent Visualizando arquivos BAM com o IGV Importanto o genoma de referência

4 4 Arquivos de Anotação de Genomas BED Formats Formatos GFF e GTF Gerando arquivos de anotação Obtendo anotações do UCSC Browser Manipulando arquivos BED Extrair sequências da regiões Detecção de Variâncias VCF Files Manipulando arquivos VCF Indexando as variantes Utilizando o samtools para detectar SNPs Gerando um arquivo consenso Utilizando o GATK Chamando Variantes no GATK Anotando as variantes com o dbsnp Utilizando Ion Varriant Caller Anotando os SNP s com o snpeff Montagem denovo Montando o genoma com o Mira Montando uma biblioteca de fragmentos utilizando o Mira Montando uma biblioteca de mate-pair utilizando o Mira Fazendo uma montagem mista com o Mira Fazendo uma montagem mista com o Mira Interpretando os resultados Comparando a montagem com uma referência Visualizando a montagem no Tablet Apêndices Ordem dos genótipos Pileup format Samtools VCF file Script para converter os nomes dos cromossomos em um arquivo VCF

5 Capítulo 1 Introdução 1.1 O que é NGS Sequenciadores de DNA são equipamentos que leem uma amostra de DNA e geram um arquivo eletrônico com simbolos que representam a sequência de bases nitrogenadas A, C, G, T contidas na amostra. O primeiro método popular de sequenciamento da DNA foi o de terminação de cadeia de Sanger, publicado em Em 1986 foi lançado o primeiro sequenciador automático de DNA, o ABI 370, e em 1998, o primeiro sequenciador de eletroforese capilar, o ABI Com a automatização foi possível realizar grandes projetos de sequenciamento, como o genoma humano, do camundongo e outros. Para realizar esses projetos foram montados grandes centros com dezenas de máquinas instaladas e ao custo de bilhões de doláres. O sequenciamento de nova geração Next Generation Sequencing, em inglês, ou simplemente NGS são processos de sequenciamento de DNA que utilizam metodologias diferentes da de Sanger, com o objetivo de acelar e baixar o custo do processo de sequênciamento. Apesar de se diferenciarem consideravelmente entre sí todos os sequenciadores de NGS se baseiam no processamento paralelo massivo de fragmentos de DNA. Enquanto que um sequenciador de eletroforese processa, no máximo, 96 fragmentos por vez, os sequenciadores de nova geração podem ler até bilhões de fragmentos ao mesmo tempo. Na figura 1.1 vemos a evolução do custo por megabase sequenciada. Nota-se um primeiro decrésimo em 2004, ano do lançamento do sequenciador 454 da Roche e um decrésimo mais acentuado a partir de 2006 e 2007, anos em que foram lançados os sequenciadores de nova geração da Illumina e da Life Technologies. No gráfico, vemos também qual seria a redução de custo, se a tecnologia de sequenciamento tivesse evoluido segundo a lei de Moore[23]. Vê-se que a evolução do sequenciamento de DNA foi muito mais acelerada do que dos processadores de computadores. A implicação disso é que os sequenciadores evoluiram muito mais rápido do que os computadores que analisam os dados gerados, daí a necessidade computacional para lidar com os dados gerados ter se tornado muito maior do que há 10 anos. 5

6 Figura 1.1: Evolução do custo de sequenciamento por megabase. sequencingcosts/. Fonte: Apesar da redução impressionante no custo por megabase, o custo por reação, também chamdado do custo de apertar o botão start, ainda é bastante alto, da ordem de dezenas de milhares de dólares. Ou seja, ampliou-se muito a capacidade dos sequenciadores, permitindo até o sequenciamento de mais de um genoma por corrida, mas sem reduzir muito o custo de operação do equipamento. Um fator limitante na redução desse custo é o uso de reagentes caros, como bases marcadas por fluoróforos. No final de 2010, foi lançado o PGM, da Ion Torrent, o primeiro sequenciador a detectar a incorporação dos nucleotídeos através de um semicondutor, reduzindo, dessa forma, a complexidade do equipamento e o custo da reação de sequencimento. 1.2 Como funciona o NGS Cada tecnologia de sequenciamento possui uma estratégia diferente, mas em geral podemos identificar etapas comums entre todos os sequenciadores 1 : preparo da amostra, amplificação da biblioteca e sequenciamento Preparo da amostra Primeiro o DNA é fragmentado por um processo químico, mecânico ou enzimática. Cada um desses fragmentos é chamado de template. Não importa qual o método de fragmentação escolhido, é importante que ele quebre o DNA de maneira aletória, de forma que todo o genoma seja coberto de maneira o mais uniforme possível 2. Após a fragmentação, adaptadores, sequências artificiais conhecidas, são incorporados ao template. Nessa etapa é possível combinar diferentes amostras em uma mesma reação de sequênciamento através do uso de adaptadores com uma pequena parte, normalmente 5 ou 10 bases, diferente. Depois de ligados esses adaptadores, as amostras são misturadas, amplificadas e sequenciadas juntas. Após isso, no processo de sequênciamento, essa parte do adaptador é lida e as amostras são separadas computacionalmente. Um outro tipode de biblioteca são as de Long Mate-Pair[28], ou LMP. Nesse caso, são gerados tamplates maiores, da ordem de algumas kilobases. São ligados adaptadores complementares nas pontas do template e ele é circularizados. Em seguida é feita uma digestão enzimática que gera um único fragmento com as duas pontas do template separadas adaptador interno (ver figura 1.2). Apesar de ser um processo mais trabalhoso para o preparo de uma bibliotecas simples de fragmentos, o LMP permite a detecção de variações estruturais em projetos de ressequenciamento e de geração de scaffolds em projetos de sequenciamento denovo. 1 Nos últimos anos foram propostas tecnologias que tentam eliminar a etapa de amplificação, sequenciando diretamente uma única molecula de DNA, porém todas as tecnologias propostas sofreram de problemas de baixa acurácia e baixo throughput. 2 Uma excessão à essa regra é o sequenciamento de amplicons, nesse caso o objetivo é sequenciar pequenas regiões que tem exatamente o tamanho da leitura gerada pelo sequênciador 6

7 Figura 1.2: Processo da amostra de Long Mate Pair. Um artefato que pode surgir nessa etapa são as duplicações de reads causadas por artefatos de PCR. Esses artefatos podem gerar distorções na cobertura do genoma e impactar as análises de variações do genoma ou de expressão do transcriptoma. Por conta disso, as pipelines de análises normalmente possuem uma etapa em que os reads duplicados são marcados, e consequentemente ignorados nas análises finais Amplificação de biblioteca A amplificação de bibliotecas tem como objetivo gerar em um pequeno espaço físico milhares de cópias de cada fragmento de DNA produzido na etapa de preparo da amostra. O objetivo dessa amplificação é aumentar a fonte de sinal luminoso para a maioria dos sequenciadores, e iônico no o caso do Ion Torrent, que será detectado na etapa de sequenciamento. O primeiro processo de amplificação desenvolvido para esse propósito foi o PCR de emulsão. Nele são criados milhões de micro reatores em uma emulsão de óleo. Esses reatores contêm todos os reagentes necessários para uma reação de PCR e pequenas esferas (também chamdas de beads ou de IonSpheres) cobertas com a sequência complementar ao adaptador. Esses fragmentos, servem para fixar os clones do template na esfera e também como primer para a reação de PCR. Ao final do processo a esfera pode estar em quatro estados: 1. Caso ideal: Um único fragmento foi incorporado à uma única esfera. 2. Beads policlonais: Múltiplos fragmentos foram incorporados a uma esfera. 3. Empty bead: Nenhum fragmento foi incorporado à esfera. 4. Multiple beads: Mais de uma esfera estava presente no micro reator. O caso de Multiple beads é controlado pelo tamanho do reator, de forma que caiba somente uma esfera por reator. As empty beads são eliminadas através de uma operação de enriquecimento para beads com template incorporado. Por fim, as beads policlonais são controladas por meio de um processo estatístico, que segue uma distriuiçãode Poisson. Basicamente temos muito mais beads do que templates. Por exemplo, se tivermos 10 vezes mais beads do que templates, espera-se que somente 0,47% das beads sejam policlonais. Claro que o efeito secundário é que 90% das beads estejam vazias, porém essas beads são eliminadas por meio do processo de enriquecimento. O principal fator que afeta a etapa de amplificação é a quantificação do DNA. Se o DNA for subquantificado, ou seja, existe mais DNA na amostra do que o reportado, o resultado vai ser um aumento da quantidade de beads policlonais. Por outro lado, se o DNA for sobrequantificado, ou seja, se existe menos DNA do que o reportado, o resultado vai ser uma quantidade muito pequena de beads com fragmentos. Na tabela 1.1 vemos a porcentagem esperada de beads policlonais e empty beads, se tivermos uma relação 1 para 1 entre beads e fragmentos esperasse que mais de 26% das beads sejam policlonais. 7

8 Razão Policlonal (%) Empty (%) Tabela 1.1: Relação entre a razão beads/fragmentos, a probabilidade de beads policlonais e a probabilidade de empty beads Sequenciamento O sequenciador é um instrumento que executa uma série de reações químicas. Estes geram sinais que são detectados e determinam a sequência de bases template se está sendo analisado. A seguir, vamos mostra o processo de sequenciamento de dois intrumentos que têm abordagens completamente diferentes: o Ion Torrent e o SOLiD Ion Torrent A maioria dos sequenciadores utiliza uma DNA polimerase para gerar a fita complementar ao template, bases marcadas por fluoroforos, e câmeras a detecção. O Ion Torrent é diferente pois a detecção é feita diretamente. A reação de polimerização gera naturalmente um um H +3, ou seja, um próton, que altera o ph do meio. Essa alteração do ph é detectada por um transistor ISFET[1] e convertida em um sinal elétrico (figura 1.3). Figura 1.3: Reação de incorporação de uma base pela polimerase. Outro ponto importante para determinar a sequência é sincronizar a polimerase com a detecção, tanto no Ion Torrent quanto no 454 essa sincronização é feita pelo controle do tipo disponível para a polimerase. Por exemplo, suponha que o início do fragmento que se deseja sequenciar seja AGT e que o sequenciador disponiblize uma certa quantidade de dttp. A polimerase vai fazer o pareamento do A com o T e o sinal vai ser detectado pelo transitor ISFET. Para continuar a reação, a polimerase necessita de um dctp, porém esse reagente não está disponível e, portanto, a reação para e a leitura da incorporação é feita. Em seguida, ocorre uma lavagem, e a base seguinte é injetada, e assim por diante em uma série 3 A reação de polimerização também gerar um fosfato e esse é o caminho de deteção utilizado pelo 454, com a diferença que a emissão do fosfato não é detectada diretamente, mas indiretamente através da ativação de uma luciferase que gera luz 8

9 de fluxos. Podemos ver na figura 1.4 uma representação dos sinais detectados pelo sensor de um único poço. É essa informação de intensidade de sinal que é convertida depois na sequência de bases. Figura 1.4: Flowgram da sequência AATCTTCGT... Uma questão relevante para os sequenciadores que utilizam fluxos de dntp s são os homopolímeros, sequencias contínuas de bases iguais como AAAA, CCCCC e etc 4. Nesse caso, todas as bases do homopolímero vão ser incorporadas em um único fluxo. Felizmente, o sensor ISFET tem uma resposta bastante linear; portanto, se um A tem um sinal x, um AA vai ter um sinal aproximadamente 2x, e assim por diante. Na prática, é possível detectar com boa acurácia homopolímeros de até 6 bases. O último elemento importante, e que diferencia os sequenciadores da nova geração em relação à anterior, é o paralelismo da reação e da detecção. No Ion Torrent esse paralelismo é obtido pelo uso de chips de silício. Utilizando o processo CMOS, o mesmo utilizado na fabricação de chips de computador ou sensores de câmeras digitais, são construídos milhões de poços microscópicos um pouco maiores do que as esferas com fragmentos de DNA, de forma que, em cada poço, tenha somente uma esfera. No chip estão também os transitores IsFET que fazem a detecção da mudança de ph, ou seja, cada poço possui o seu próprio ph-gâmero para fazer a detecção do sinal[29] SOLiD A sigla SOLiD significa Sequencing by Ligation and Detection e descreve bem o processo de sequenciamento utilizado pelo instrumento. Ao invés de utilizar uma polimerase e detectar a incorparação de cada uma das bases, o SOLiD utiliza octâmeros marcados com fluoróforos para identificar a sequência alvo. As primeiras 5 bases da probe garantem a especificidade da ligação da probe com o template, enquanto que as 3 útimas são inosinas que anelam de maneira inespecífica. Conectado à última, inosina temos o fluróforo que gerará o sinal luminoso a ser detectado pelo sequenciador (ver fig 1.5). Fluoróforo Probe n1 n2 n3 n4 n5 x x x Figura 1.5: Estrutura da probes utilizadas pelo SOLiD No SOLiD, assim como no Ion Torrent, cada fragmento é amplificado milhares de vezes na superfície de uma bead 5. Essas beads são então depositadas e fixadas em uma lâmina de vidro. É muito importante ter essa fixação, porque sabemos que o sinal luminoso que será gerado pelo processo de sequenciamento está vindo da mesma bead (ou seja, da mesma população de clones geradas de um template) por meio das coordenadas do ponto luminoso na lâmina. 4 Notem que microsatélites com mais de uma base na repetição, como ACACAC, não são homopolimeros 5 Esses uma novo modelo do SOLiD, o 5500W, que não utiliza beads. A amplificação dos templates é feita diretamente na lâmina. 9

10 A reação de sequenciamento ocorre para cada um dos milhares de clones em cada uma das centenas de milhões de beads depositadas na lâmina. As etapas dessa reação são, de maneira simplificada, as seguintes: 1. Na etapa de construção de biblioteca, é adicionado um primer em cada extremidade de cada fragmento, chamados de P 1 e P 2. No processo de sequenciamento é adicionado um primer complementar à P 1, chamado de P A. A última base desse primer alinha com a última base de P 1 (fig 1.6 A) 2. É adicionado um pool equimolar de probes. Como temos 4 bases diferentes e uma estrutura de 5 bases mais 3 inosinas, temos portanto 4ˆ5 = 1024 combinações diferentes de probes. As probes vão se anelar ao longo do template. Após o anelamento, é adicionada uma ligase, que vai fixar somente a probe que estiver ao lado de uma ponta 5 6. Após a fixação pela ligase ocorre uma lavagem e todas as probes não fixadas são removidas (fig 1.6 B) 3. É feita a leitura do floróforo. As inosinas, as três últimas bases da probe, são removidas junto com um floróforo, criando assim uma ponta 5 livre para fazer a ligação da próxima probe (fig 1.6 C) 4. É feita uma nova incorporação de probes e o processo se repete (fig 1.6 D) A. Primer se liga ao template C. As 3 últimas bases da probe (as inosinas) são removidas junto com a probe. primer 5 primer p-2 p-1 p0 s1 s2s3 s4 s5 s6s7 Template p-2 p-1 p0 s1 s2s3 s4 s5 s6s7 Template B. Primeira probe anela ao template e fluóroforo é lido. primer Probe D. Uma nova probe é incorporada e o processo se repete. primer Probe p-2 p-1 p0 s1 s2s3 s4 s5 s6s7 Template... p-2 p-1 p0 s1 s2s3 s4 s5 s6s7... Template Figura 1.6: Algumas etapas do processo de sequenciamento: ligação do primeiro primer. A incorporação de probes é repetida 5, 7, 10 ou 15 vezes, dependendo do tamanho desejado de leitura. Terminado esse ciclos o sistema é aquecido e a fita complementar ao template que foi gerada denatura e é eliminada. É então incorporado um novo primer, chamado de P B, que alinha uma base a esquerda de P A. Todo o processo de incorporação de probes é repetido, mas sempre com uma base à esquerda (fig 1.7). Na tabela 1.3 vemos a relação entre primer, ciclo e bases lidas. Vemos que a cada ligação de probe duas bases são lidas e que cada base é lida por duas probes diferentes. Por exemplo, a base s 1 é lida pelo ciclo 1 do P A e pelo ciclo 2 do P B. Essa construção é chamada de Two Bases Encoding ou 2BE 7, e permite que se faça depois a correção de erros que aumenta a acurácia do processo de sequenciamento e esta é a principal característica do SOLiD. Vale a pena também resaltar que na segunda ligação, a última base do primer P 1 é sequenciada, isso é muito importante para fazer depois a decodificação das cores para bases. 6 Duas probes consecutivas não ligam porque na extremidade 5 da probe tem o floróforo, que impede a ligação Existe também uma codificação alternativa chamada de Four Bases Enconding, ou 4BE, que é opcionalmente utilizada para fazer uma segunda correção de erros chamada de Exact Call Chemistry ou ECC. 10

11 Cor Fluoróforo 0 Azul FAM 1 Verde Cy3 2 Amarelo TXR 3 Vermelho Cy5 Tabela 1.2: Codificação das cores em números. Pelo processo de sequenciamento, cada probe 2 de cada 5 bases cobertas por ela, para cobrir todas as bases duas vezes, temos que utilizar 5 probes, que se alinham em posições diferentes de P 1 e permitem que se cubra todo o fragmento 8. Veja a figura 1.8. Primer Ciclo Bases Lidas P A 1 s 1 s 2 P A 2 s 6 s 7 P A 3 s 11 s P B 1 p 0 s 1 P B 2 s 5 s 6 P B 3 s 10 s Tabela 1.3: Leitura de bases pelas probes do SOLiD O resultado do sequenciamento é codificado em números de acordo com a tabela 1.2. A relação entre as duas primeiras bases da probe, n 1 e n 2, e a cor do fluróforo é dada pela tabela 1.4. Essa tabela tem diversas propriedades interessantes: ela é simétrica e nenhuma cor se repete na mesma linha ou na mesma coluna (como em um jogo de Soduko). Por causa dessas propriedades temos que, se soubermos a primeira base do par e a cor fica determinada a segunda base. Suponhamos que a primeira base do par seja um T, se a cor lida pela probe for verde, a segunda base é, portano, um G. Como o primeira probe do primer P B lê a última base do adaptar P 1, que é conhecida, podemos portanto descobrir qual é a primeira base da leitura. Tendo a primeira base da leitura e a segunda cor, podemos descobrir a segunda base, e assim por diante. Podemos pensar nas cores como transformações entre bases, e que se essas transformações forem encadeads, podemos gerar todas as bases da leitura. Suponha que a última base de P 1 seja um T, e que a seguinte sequência de cores tenha sido obtida: Se consultarmos a tabela 1.2, temos que T na primeira base com 3 gera um A, portanto a primeira base da nossa sequência é um A, o que nos gera o seguinte resultado intermediário: A Vendo agora, a combinação de A com 1 gera um C, e o nosso segundo resultado intermediário é: AC Continuando a aplicar as transformações chegamos aos seguintes resultados: ACG ACGT 0 2 ACGT T 2 ACGT T C Portanto, a sequência T codificada em color space representa a sequência ACGTTC em base space. 8 Pela construção das probes sequenciaríamos também as 5 últimas bases de P 1, o que não é interessante. Por isso, após o primer P B, é adicionado um espaçador que desloca a posição inicial do sequenciamento 5 bases para frente. 11

12 A. Um novo Primer se liga ao template uma posição para dentro do primer. primer 5... p-2 p-1 p0 s1 s2s3 s4 s5 s6s7... Template C. Novamente as inosinas e o fluóroforo são removidos. primer p-2 p-1 p0 s1 s2s3 s4 s5 s6s7 Template B. Como no primer anterior a probe se anela, porém deslocada uma base à esquerda. primer Probe D. E o processo segue, sempre com uma base deslocada à esquerda. primer Probe... p-2 p-1 p0 s1 s2s3 s4 s5 s6s7... Template... p-2 p-1 p0 s1 s2s3 s4 s5 s6s7... Template Figura 1.7: Algumas etapas do processo de sequenciamento: Ligação do segundo primer. n1 n 2 A C G T A C G T Tabela 1.4: Codificação de bases para cores 1.3 Aplicações do NGS O número de aplicações do NGS é ilimitado. Qualquer coisa que possa ser transformada em DNA pode ser sequenciada utilizando o mesmo protocolo. Por isso, se alguém quiser criar uma nova análise, basta modificar a etapa de preparo de biblioteca e de análise e teremos uma nova aplicação. Mesmo assim, existe um grupo de aplicações que é mais utilizado pela comunidade científica Ressequenciamento genômico Projetos de ressequenciamento têm como objetivo descobrir diferenças entre o genoma de referência e o genoma de interesse. Os projetos de ressequenciamento normalmente buscam encontrar diferenças entre o genoma de uma pessoa saudável e o genoma de uma pessoa com alguma doença, como o câncer ou uma doença hereditária. O ressequenciamento também tem aplicações agropecuárias: pode-se utiliza-lo para entender a diferença entre genomas de raças de animais, cultivares de plantas ou isolados de bactérias. O resultado de um projeto de ressequenciamento é a lista das variantes detectadas. Tendo em mãos essa lista, o pesquisador pode compará-la com os genes anotados do organismo para tentar entender a relação entre genótipo e fenótipo. Um parâmetro importante para o ressequenciamento é a cobertura média do genoma, ou seja, quantas vezes em média cada base do genoma foi coberta. Suponha um genoma de 3 Gbp: para ter uma cobertura de 20 é preciso gerar 60 Gbp de dados. Para detectar variantes germinativas é recomendada uma covertura entre 20 e 30, porque essas variantes vão ter uma frequência em torno de 100% para mutações homozigotas e 50% para variações heterozigotas. Já para detectar variantes somáticas, é necessária uma cobertura maior, porque essas variantes ocorrem 12

13 P P A P B P C P E P D Figura 1.8: Esquema de cobertura do template pelos probes para uma leitura de 25 bp. com frequências menores do que as variantes germinativas. A capacidade de detecção da variante vai depender da frequência mínima que se deseja detectar e da acurácia das leituras geradas Target Sequencing O ressequenciamento de um genoma inteiro gera um volume enorme de dados e permite fazer uma identificação completa das variações no genoma. Porém, muitas vezes, os pesquisadores só estão interessados nas variações das regiões codificantes, ou até mesmo num subconjunto de genes e, portanto, sequenciar todo o genoma para depois selecionar a parte que interessa é bastante ineficiente. Uma alternativa ao ressequenciamento completo é o target sequencing, na qual a amostra é tratada para selecionar somente as regiões de interesse. Existem duas principais abordagens para o target sequencing: captura por hibridização, método utilizado pelos kits SureSelect da Agilent e TargetSeq da Life, e captura por amplificação como o RainStorm da Rain Dance e o AmpliSeq da Life. Recomenda-se uma alta cobertra da região de interesse pois, como estamos restringindo o sequenciamento às regiões de interesse, queremos garantir que todas as bases tenham cobertura suficiente para que possamos fazer a identificação de variações de maneira confiável. Uma recomendação corrente é cobrir a região de interesse com uma média de cobertura entre 80 e 100 vezes. Mesmo assim, o target sequencing oferece vantagens de custo e de processamento devido ao volume reduzido de dados, um genoma humano sequenciado a 20 gera 60Gbps de sequências, enquanto que um exoma sequenciado a 100 gera 5Gbps de dados RNA Seq RNA Seq, também chamado the Whole Transcriptome Shotgun Sequencing, é o uso de NGS para sequenciar cdna com a intenção de capturar a informação do transcriptoma de um organimo. Ao contrário de outras técnicas, como Microarray ou RT-PCR, o RNA Seq não necessita uma lista pre-definida dos gene que se deseja detectar. A princípio, qualquer transcrito que estiver sendo expresso pode ser detectado se o experimento tiver cobertura suficiente. Além disso, o RNA Seq permite detectar, além da expressão, eventos de splicing alternativo e expressão de genes desconhecidos. Segundo as diretrizes do projeto ENCODE[27], para estudar somente a expressão de transcritos polya, uma cobertura de 20 a 25 milhões de reads curtos mapeados é suficiente. Mas para detectar transcritos raros ou variações e isoformas em uma amostra de mamíferos, é necessário uma cobertura de 100 a 200 milhões de reads. O projeto ENCODE também recomenda a realização de duas ou mais replicatas biológicas. Normalmente não é necessário realizar réplicas técnicas. Um dos problemas em manipular RNA é a sua fragilidade. Por isso é preciso tomar muito cuidado na manipulação da amostra e também é preciso avaliar a sua qualidade antes de fazer o sequenciamento (utilizando, por exemplo, o BioAnalyzer da Agilent). Caso a amostra esteja degradada, o resultado é 13

14 uma taxa muito baixa de reads mapeados. Outro problema é o RNA Ribossomal, ele corresponde a uma grande quantidade da massa de RNA de uma célula e, se não for removido da amostra no final, a maioria dos reads será de RNA ribossomal, o que normalmente não é objetivo do experimento. É possível utilizar um kit de depleção de RNA Ribossomol, como o Ribominus da Invitrogen, ou então fazer um enriquecimento para RNA com calda polya, como o poly(a) Purist também da Invitrogen. Caso haja interesse também em RNAs não codificantes é melhor utilizar somente o Ribominus. Caso contrário, o poly(a) Purist é mais eficiente (alguns grupos utilizam os dois para garantir a remoção dos ribossomais) Sequenciamento denovo Quando não se tem um genoma de referência, é necessário realizar a montagem denovo. O processo de montagem denovo é muito mais trabalhoso do que o mapeamento com referência. É necessário ter uma cobertura muito maior e os programas de montagem cometem muito mais erros do que os programas de mapeamento. Apesar disso, é possível obter bons resultados na montagem de genomas bacterianos com relativo pouco esforço. Para genomas de organismos superiores, é necessário combinar diversas tecnologias de sequenciamento e utilizar computadores com quantidades massivas de memória RAM para efetuar o processo de montagem do genoma Metagenoma A metagenômica é o estudo do material genético extraído diretamente do ambiente. Normalmente, quando se quer estudar o genoma de uma bactéria, é feita uma cultura para garantir que se está sequenciando um único genoma. Porém, a diversidade de micro-organismos presentes no ambiente é muito maior do que é possível acessar via sequenciamento individual de bactérias. Por isso, o estudo do metagenoma é importante. Existem dois tipos de estudo de metagenomas: 1. Estudo de diversidade utilizando o gene ribossomal 16s: Nesse tipo de estudo amplifica-se por PCR a sequência 16s e se compara o resultado contra um banco de dados de bactérias conhecidas. Com isso, é possível avaliar e comparar a diversidade de bactérias presentes na amostra. 2. Shotgun Metagenomics: Nesse segundo caso não se faz nenhuma seleção de alvo. Todo o DNA extraído da amostra é fragmentado e sequenciado. A análise consiste em montar o metagenoma da amostra para tentar identificar, além da diversidade de genomas, novos genes. A metagenômica é uma área muito ativa de pesquisa e os métodos de análise ainda são muito manuais. 14

15 Capítulo 2 Arquivos de Sequência Em princípio, é bastante simples representar uma sequência de DNA em formato texto. Cada base pode ser presentada por um caracter: A para Adenina, C para Citosina, G para Guanina e T para timina. O código oficial para representar DNA é mantido pela IUPAC e inclui também códigos para identificar bases ambíguas, ou seja, os casos em que não se sabe ao certo a base correta, mas se sabe que deve ser um C ou T ou algo similar. O código completo está na tabela 2.1. A Adenina C Citosina G Guanina T (ou U) Timina (ou Uracila) R A ou G Y C ou T S G ou C W A ou T K G ou T M A ou C B C ou G ou T D A ou G ou T H A ou C ou T V A ou C ou G N qualquer base. ou - gap Tabela 2.1: Código IUPAC para representar o DNA Além da informação da base, os sequenciadores também produzem uma estimativa da probablidade da base detectada estar correta. Usualmente essa probabilidade é representada pelo Phred Quality Score, assim chamado porque foi utilizado pela primeira vez no software phred[5]. A fórmula para calcular os valores de phred é: Q = 10 log 10 P erro (2.1) Onde P erro é a probabilidade da base ter sido identificada de maneira errada 1. Na figura 2.1, temos o gráfico da função que calcula o phred score e na tabela 2.2 temos exemplos de alguns valors de phred. Nela vemos que, por exemplo, uma base com phred 20 tem 99% de acurácia, ou seja, uma chance em 100 de estar errada. 1 O score phred é construído com base em uma série de preditores de qualidade que são calibrados com dados reais para gerar uma estimativa de probabilidade de erro. 15

16 Q Chance de erro Acurácia da base 10 1 em % 20 1 em % 30 1 em ,9 % 40 1 em ,99 % 50 1 em ,999 % Tabela 2.2: Valores de qualidade phred, probabilidades de erro e acurácia 40 Phred Score Phred Score P de erro Figura 2.1: Gráfico da função que calcula o Phred Score Tipicamente, os valores de phred score estão entre 1 e 40. Até é possível sequenciar com uma acurácia maior que 40, porém, a acurácia das etapas anteriores de 99,99%, e a acurácia do processo inteiro não pode ser maior do que da parte menos acurada, o que é uma consequência da propagação derros. A maneira mais simples de representar os valores de qualidade em formato texto é uma lista de inteiros, o que adiciona de 2 a 3 bytes de dados para cada base sequenciada (1 a 2 caracteres para o valor da qualidade e um caracter como separador entre os valores). Antes do NGS essa forma de representação era prática porque o volume de dados era pequeno, mas recentemente se tornou necessário criar novos formatos que economizassem bytes. Neste capítulo, vamos analisar os formatos de representação de dados de sequenciamento mais usados e como manipulá-los utilizando ferramentas gratuitas. 2.1 Fasta e FastQ Files Fasta format A forma mais universal de representar sequências biológicas é o formato fasta. Este formato foi criado para o programa de alinhamento de DNA e proteínas FASTA[21]. Por ser um formato texto muito simples, ele foi sendo adaptado para as mais diversas aplicações. Mas por outro lado muitas aplicações não seguem o padrão de maneira estrita. De maneira geral, um arquivo fasta contém uma série de cabeçalhos seguidos pelo texto da sequência. Cada cabeçalho é definido por uma linha que se inicia com o caracter >. Pelo padrão, linhas que iniciam com o caracter ; são consideradas comentários, mas algumas aplicações utilizam o caracter # para essa função. Abaixo vemos um exemplo de arquivo fasta: 16

17 >HSBGPG Human gene for bone gla protein (BGP) (fragment) GGCAGATTCCCCCTAGACCCGCCCGCACCATGGTCAGGCATGCCCCTCCTCATCGCTGGGCACAGCCCAGAGGGT ATAAACAGTGCTGGAGGCTGGCGGGGCAGGCCAGCTGAGTCCTGAGCAGCAGCCCAGCGCAGCCACCGAGACACC ATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGAGTGCCCC CCTGGAGCCCAGGAGGGAGGTGTGTGAGCTCAATCCGGACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGA GGCCTATCGGCGCTTCTACGGCCCGGTCTAGGGTGTCGCTCTGCTGGCCTGGCCGGCAACCCCAGTTCTGCTCCT CTCCAGGCACCCTTCTTTCCTCTTCCCCTTGCCCTTGCCCTGACCTCCCAGCCCTATGGATGTGGGGTCCCCATC ATCCCAGCTGCTCCCAAATAAACTCCAGAAG >HSGLTH1 Human theta 1-globin gene (fragment) CCACTGCACTCACCGCACCCGGCCAATTTTTGTGTTTTTAGTAGAGACTAAATACCATATAGTGAACACCTAAGA CGGGGGGCCTTGGATCCAGGGCGATTCAGAGGGCCCCGGTCGGAGCTGTCGGAGATTGAGCGCGCGCGGTCCCGG GATCTCCGACGAGGCCCTGGACCCCCGGGCGGCGAAGCTGCGGCGCGGCGCCCCCTGGAGGCCGCGGGACCCCTG CTTCTTGCCGTGCTCTCTCGAGGTCAGGACGCGAGAGGAAGGCGC Neste exemplo, vemos duas sequencias: uma identificada com HSBGPG e outra como HSGLTH1. Depois de cada identificador temos um espaço e em seguida um comentário sobre a sequência. Depois disso temos o corpo de cada sequência, o padrão manda que a sequência seja quebrada em linha entre 70 e 132 caracteres. No exemplo, está uma sequência de nucleotídeos, mas o arquivo fasta pode ser utilizado para representar qualquer tipo de sequência biológica. O arquivo fasta pode vir acompanhado de um arquivo com extensão.qual. Nesse arquivo estão os valores de qualidade associados com cada base. Ele tem basicamente o mesmo formato do arquivo.fasta, porém, no lugar da sequência de bases, ele tem os valores de qualidade na escala phred separados por espaços. Abaixo temos um exemplo de arquivo.fasta e o respectivo arquivo.qual. FASTA >RWBG8:4:5 CTCATTGCCCTCAACACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACT ACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGA QUAL >RWBG8:4: Como o fasta é um formato de texto, é possível utilizar ferramentas padrão do unix para manipulá-lo. Para contar o número de sequências em um arquivo fasta, usa-se o seguinte comando: grep -c "^>" <arquivo.fasta> Para contar o número de bases no arquivo pode-se utilizar este outro comando: grep -v "^[>;]" <arquivo.fasta> wc -c FastQ format O formato fasta/qual foi amplamente utilizado para representar sequências geradas por sequenciadores de Sanger. Porém com o aumento da capacidade dos sequenciadores os arquivos neste formato passaram a ficar muito pesados. Uma maneira de reduzir o volume de dados foi a criação do formato fastq. Neste formato as bases e os valores de qualidade são representados no mesmo arquivo. Além disso as qualidades são codificadas com caracteres ASCII ao invés de uma sequência de números. Essa codificação é mais eficiente porque cada valor de qualidade precisa em geral de 3 bytes, dois digitos do valor mais o espaço, enquanto que no fastq cada qualidade precisa de somente 1 byte. Abaixo temos um exemplo de arquivo fastq: 17

18 @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +! *((((***+))%%%++)(%%%%).1***-+* ))**55CCF>>>>>>CCCCCCC65 Nesse formato, o cabeçalho é definido pelo e é seguido pelo identificador da sequência. Na linha seguinte tem-se a sequência e, ao contrário do formato fasta, que manda quebrar a sequência em diversas linhas, no fastq deve-se ter somente uma linha (mas muitas vezes essa regra não é respeitada). Na linha seguinte tem-se o caracter + que pode ser seguido pelo identificador da sequência novamente, e na última linha tem-se os valores de qualidade representados em ASCII. Para converter o valor de qualidade phred para fastq adiciona-se 33 a ele e procura-se o caracter ASCII correspondente. Este é o padrão definido pelo Sanger Institute e mais utilizado atualmente. Porém as primeiras versões da pipeline de análise da Illumina definem o valor de qualidade como phred mais 64, o que pode causar problemas para quem estiver manipulando esses arquivos. A partir da versão 1.8 da pipeline de análises a Illumina também passou a adotar o padrão do Sanger. Para converter de fastq para fasta pode-se utiliar o programa seqtk que vem junto com o samtools: seqtk fq2fa in.fastq > out.fasta 2.2 SFF File O Standard Flow Format[24], ou SFF, é um arquivo binário que foi desenvolvido em conjunto pela 454 Life Science, o Whitehead Institute e pelo Sanger Institute para representar sequências geradas por um sequenciador baseado em fluxos como o 454 ou o Ion Torrent. Nesse arquivo a sequência é representada em termos de fluxos, ou seja, as bases e o tamanho normalizado do sinal detectado. Por exemplo, a sequência AATGG é representada com o equivalente a A3 T1 G2, mas, como a relação entre o sinal e o tamanho do homopolímero não é totalmente exata, o comprimento dos homopolímeros é representado por números fracionados. Assim, o exemplo anterior pode ser algo como: A2.9 T1.1 G1.5. Tal informação é perdida devido aos arredondamentos executados quando se converte de SFF para fasta, mas um programa que trabalhe diretamente com SFF pode utilizar essa informação para resolver ambiguidades. Essa informação em termos de intensidade de sinal para cada fluxo também é chamada de flow space em oposição à sequência pura que está em base space. O arquivo SFF contém um cabeçalho com informações da corrida, assim como um cabeçalho por read. Além de informar o nome de cada read e o tamanho, esse cabeçalho contém as informações de clipping de adaptador e clipping de qualidade. Tendo o arquivo SFF, é possível extrair as sequências sem o clipping, o que pode ser útil para algumas aplicações Converter arquivo SFF para Fasta ou FastQ Muitos programas não lidam diretamente com arquivos SFF, por isso é necessário fazer a conversão para formatos mais antigos, como fasta ou fastq 2. Na tabela 2.3 está a lista de alguns conversores de SFF gratuitos. Nome Linguagem URL sff_extract Python sff2fastq C https://github.com/indraniel/sff2fastq Flower Haskell Tabela 2.3: Conversores de SFF O conversor mais fácil de utilizar é o sff_extract, pois ele é somente um script em python. Porém, ele é o conversor mais lento. O sff2fastq é o mais rápido, porém é menos flexível, pois só gera arquivo no formato fastq. Por fim, o Flower é rápido e flexível, mas necessita ter a linguagem de programação Haskell instalada no sistema. 2 O Torrent Browser fornece o resultado da corrida no formato BAM, mas ele também gera as sequências nos formatos SFF e fastq por meio de plugins. 18

19 Converter utilizando o sff_extract Para utilzar o sff_extract você precisa baixar o script. O nome do arquivo será sff_extract_<versão>. Renomeie para sff_extract e torne o arquivo executável com o comando chmod +x sff_extract. Para converter de SFF para fasta/qual utilize o seguinte comando: sff_extract -o <prefixo> <entrada.sff> Onde <prefixo> é o nome dos arquivos.fasta e.qual que vão ser gerados e <entrada.sff> é o nome do arquivo sff que se deseja converter. Este comando vai gerar três arquivos: <prefixo>.fasta Com as sequências em formato fasta <prefixo>.fasta.qual Com os valores de qualidade em formato phred <prefixo>.xml Arquivo XML com as informações extras de cada read, em especial, as informações de clipping de cada read. Abaixo temos um exemplo de um registro em um arquivo XML gerado: <?xml version="1.0"?> <trace_volume> <trace> <trace_name>rwbg8:4:5</trace_name> <clip_quality_right>149</clip_quality_right> <clip_vector_left>5</clip_vector_left> <clip_vector_right>114</clip_vector_right> </trace>... </trace_volume> Todos os valores de clipping são indexados a partir de 1. Para encontrar a primeira base não trimada, utiliza-se a seguinte expressão: f irst_base_position = max(1, clip_quality_lef t, clip_adapter_lef t) (2.2) E para achar a última base não clipada utiliza-se (caso os clip_adapter_right ou clip_quality_right sejam 0, o valor é substituído pelo número total de bases no read): last_base_position = min(clip_quality_right, clip_adapter_right) (2.3) Portanto, o read no exemplo acima possui bases não clipadas entre as posições 5 e 114. Toda essa informação de clipagem é indicada por soft clipping, ou seja, as bases do adaptador e as de baixa qualidade são indicadas em minúsculas. Para fezer o hard clipping e gerar um arquivo fasta limpo, utilize o seguinte comando: sff_extract -c -o <prefixo> <entrada.sff> Neste caso, serão gerados os mesmos arquivos, porém o arquivo XML não terá as informações de clipping porque o clipping já foi feito nos arquivos fasta e qual. Para gerar o arquivo em formato FastQ, utilize: sff_extract -Q -o <prefixo> <entrada.sff> ou sff_extract -c -Q -o <prefixo> <entrada.sff> Esse comando vai gerar o arquivo <prefixo>.fastq e <prefixo>.xml, e da mesma forma que no exemplo anterior, se for adicionada a opção -c, o resultado será com hard clipping. 19

20 Utilizando o seq_crumbs O sff_extract foi suplantado pelo pacote seq_crumbs. Diferentemente do programa anterior, o seq_crumbs foi concebido em módulos, que podem ser combinados de maneira muito mais versátil. Além disso, ele utiliza a biblioteca biopython. Para baixar o programa, utilize esse endereço: https://github.com/joseblanca/seq_crumbs Já o biopython está disponível em: Para fazer a conversão de SFF para fastq utiliza-se: sff_exrtract -c -o <output> <entrada.sff> Note que a versão do seq_crumbs só gera arquivos em formato fastq, não tendo mais a opção de gerar fasta/qual. Como no programa anterior, a opção -c pede para o programa fazer o trimming das sequências. Para fazer a conversão de arquivos SFF de mate-pair vemos uma diferença muito maior, pois temos que combinar o programa sff_extract com o programa split_matepairs: sff_extract <entrada.sff> split_matepairs -l ION_TORRENT A combinação desses dois comandos é equivalente ao sff_extract -l. Mas o seq_crumbs oferece mais opções de manipulação de arquivos. É possível também gerar dois arquivos de mates desentrelaçados, ou seja, um arquivo com a primeira tag e outro com a segunda. Para isso utilize: sff_extract <entrada.sff> split_matepairs -l ION_TORRENT pair_matcher -p <orphan.fastq> deinterleave_pairs -o <out.1.fastq> <out.2.fastq> O comando pair_matcher remove as tags que estão sem os seus respectivos pares e coloca no arquivo <orpha.fastq>, já o deinterleave_pairs separa os pares nos arquivos <out.1.fastq> e <out.2.fastq>. Utilizando o Flower O Flower é um utilitário para ler arquivos SFF feito na linguagem de programação Haskell. Por ser uma linguagem compilada ele é muito mais do que o sff_extract, que foi escrito em Python. Duas desvantagens é que o runtime do Haskell é menos ubíquo do que do Python e ele não gera o arquivo XML com as informações de clipagem necessárias para o Mira (ver 6.1). Tendo instalado o Haskell, é muito fácil instalar o Flower. Basta utilizar o programa Cabal da seguinte maneira: cabal install biosff Para converter um arquivo SFF para fastq, utiliza-se: flower -q <entrada.sff> > saida.fastq Além de converter o SFF, o flower também permite inspecionar o arquivo. Para visualizar o SFF em formato texto, use: flower entrada.sff more Por fim, o flower gera uma visualização do flow space em um formato tabulado muito útil. Para gera-la: flower -F <entrada.sff> Segue um exemplo de resultado: 20

21 ... RWBG8:9:36 81 T 1.05 Qual {unqual = 34} RWBG8:9:36 82 C 1.03 Qual {unqual = 27} RWBG8:9:36 83 G 0.00 RWBG8:9:36 84 A 5.72 Qual {unqual = 27},Qual {unqual = 27}, Qual {unqual = 27},Qual {unqual = 27}, Qual {unqual = 27},Qual {unqual = 7} RWBG8:9:36 85 T 1.93 Qual {unqual = 27},Qual {unqual = 21} RWBG8:9:36 86 C 0.97 Qual {unqual = 26} RWBG8:9:36 87 G 0.00 RWBG8:9:36 88 A Note que mesmo os fluxos que não tiveram sinal são registrados no arquivo SFF e também que, para os homopolímeros, temos uma estimativa de qualidade para cada uma das bases (quebra de linha adicionada para facilitar a visualização). 2.3 Unmapped BAM O formato BAM, discutido na seção sobre mapeamento (seção 3.1.2), é um formato criado para representar o mapeamento dos reads de NGS em um genoma de referência. Ele é um formato binário, compactado, indexável e amplamento suportado que pode representar tanto reads mapeados como reads não mapeados. Os campos opcionais do formato BAM permite grande flexibilidade. É possível adicionar as informações de flow space do Ion e do 454 ou o color space do SOLiD direto no arquivo BAM, fazendo dele uma alternativa para os formatos nativos. Para converter de Unmapped BAM para fastq, pode-se utizar o comando SamToFastq do Picard (ver seção 3.1.4) da sequinte maneira: java -jar SamToFastq.jar I=<input.bam> FASTQ=<out.fastq> 2.4 XSQ Format O XSQ é o formato nativo do SOLiD Ele é um formato binário que diminiu em até 60% o número de bytes necessários para representar o conjunto de sequências no formato fasta/qual. Ele utiliza como base o HDF5, que é um formato criado para armazenar grandes volumes de dados numéricos. Esse formato permite representar os reads tanto em base quanto em color space assim como reads únicos e pareados. Sendo um formato binário, ele também permite o acesso aleatório dos reads contidos nele. Por fim, é possível adicionar metadados sobre a corrida no próprio arquivo de sequência, facilitando o armazenamento e a organização dos dados. As ferramentas de conversão de XSQ para csfasta e vice-versa, assim como a documentação do formato, estão disponíveis em: html Porém, esses conversores só estão disponíveis para Linux CentOS ou RedHat 4 ou 5. Para converter de XSQ para csfasta utiliza-se:./convertfromxsq.sh -f -o <diretorio de sáida> <in.xsq> Será criado um diretório Libraries dentro do <diretório de saída>. Dentro de Libraries, será criado um diretório para cada tag F3, R3, etc e dentro deste um diretório reads com os arquivos csfasta, qual e fastq (caso o sequenciamento tenha sido feito com ECC). A opção -f pede para o programa filtrar os reads marcados como filtrados pelo basecaller e portanto é altamente recomendável. Também é possível converter de csfasta/qual para XSQ com o comando converttoxsq.sh. Dependendo do tipo de biblioteca, é preciso passar diferentes argumentos. Para biblioteca de fragmentos utiliza-se: 21

22 ./converttoxsq.sh -x <out.xsq> --mode Fragment --c1 <F3.csfasta> --q1 <F3.QV.qual> --libraryname <libname> --runstarttime " :00:00" E para biblioteca de Long Mate Pair:./convertToXSQ.sh -x <out.xsq> --mode LMP --c1 <F3.csfasta> --q1 <F3.QV.qual> --c2 <R3.csfasta> --q2 <R3.QV.qual> --libraryname <libname> --runstarttime " :00:00" --libraryinsertsizeminimum <inserto min.> --libraryinsertsizemaximum <inserto máx.> Nesse caso temos que informar, além dos campos do arquivo utilizados no caso da biblioteca de fragmentos, o arquivos do de sequência e qualidade do mate e, o tamanho mínimo do e máximo do inserto. 22

23 Capítulo 3 Mapeamento de Sequências Após um experimento de NGS é quase sempre necessário fazer o mapeamento das leituras geradas em um genoma de referência. O primeiro programa para fazer esse mapeamento foi o BLAT 1, criado por Jim Kenth para mapear leituras com alta similaridade contra um genoma de referência. Porém, o BLAT não consegue alinhar regiões com menos de 40bp e também não tem performance suficiente para alinhar os milhões de reads gerados por NGS. Os primeiros mapeadores open source otimizados para NGS foram o MAQ[17] e o SOAP[19], ambos mapeadores que utilizam hash tables para acelerar a busca, com a diferença que o MAQ indexa os reads enquanto o SOAP indexa o genoma de referência. Com o aumento do throughput, dos sequenciadores a abordagem de indexar os reads se tornou inviável e por isso os mapeadores mais recentes indexam a referência. O problema do uso de hash table é o uso de memória. Alguns mapeadores, como o mapreads do SOLiD, podem dividir a hash em partes e fazer o mapeamento em etapas de forma a permitir o mapeamento de grandes genomas mesmo com pouca memória. Alternativamente, é possível utilizar um FM-Index, que indexa o genoma de referência compactado pela Burrows-Wheeler[33, 6] e entre os programas que implementam esta técnica estão o BWA[15, 16],bowtie[11] e o SOAPv2[20]. Para aumentar a eficiência os algoritmos citados diminuem a sensibilidade, limitando o número de mismatches permitidos. Como os reads de NGS normalmente possuem uma qualidade maior no início do read, utiliza-se uma estratégia de seed and extend: na primeira fase pega-se o início do read, entre 25 e 30 bases, e faz-se a busca permitindo poucos erros como 2 por exemplo. Encontrada uma posição de ancoramento do read é feita a extensão do alinhamento de modo a maximizar o score de alinhamento 2. Na seção seguinte é explorado o format SAM/BAM, que é o formato universal para representar alinhamentos de NGS e nas próximas seções será mostrado como utilizar alguns mapeadores. 3.1 SAM e BAM Files O formato SAM, Sequence Alignment/Mapping, é um formato texto criado para representar o resultado do alinhamento dos reads de NGS contra um genoma de referência[8, 18]. A versão binária no SAM é chamado de BAM, de Binary SAM, e contém exatamente as mesmas informações, mas em formato binário. Além do formato binário ser mais eficiente, o arquivo BAM também é compactado em blocos, o que permite ao mesmo tempo a redução do uso de armazemento e o carregamento parcial do arquivo, o que é muito importante para programas de visualização Estrutura do arquivo SAM As primeiras linhas do arquivo SAM são o cabeçalho. Estas linhas começam com o seguido por um código de 2 caracteres que identificam o tipo de informação contina na linha. A lista de códigos está na tabela 3.1. Depois do cabeçalho temos os alinhamentos propriamente ditos, um por linha, com campos separados por TABs. Na tabela 3.2 está a lista campos de cada alinhamento. 1 O BLAST e o FASTA são programas mais antigos, mas o objetivo deles é fazer buscas em bancos de sequencias e não especificamente mapear reads em um genoma montado. 2 O BWA-long utiliza uma abordagem um pouco diferente. Em vez de fazer o seed and extend, ele realiza um alinhamento Smith-Waterman contra o índice BWT do genoma 23

24 Descrição Identifica o início do arquivo SAM e a versão dele. Identifica dada uma das sequências no arquivo de referência Read group: identifica conjuntos de reads dentro do arquivo. Esse registro é muito importante quando são combinados os resultados múltiplas corridas em um único arquivo. Lista de programas utilizados no arquivo. Comentários Tabela 3.1: Headers do arquivo SAM Col. Nome Descrição 1 QNAME Nome do read 2 FLAG Bits indicando diversas informações sobre o alinhamento 3 RNAME Nome da sequência na referência 4 POS Posição mais à esquerda do read que se alinha na referência 5 MAPQ Qualidade do Mapeamento 6 CIGAR CIGAR string 7 RNEXT Referência do próximo read no par/segmento 8 PNEXT Posição do próximo read no par/segmento 9 TLEN Tamanho do template observado 10 SEQ Sequência do read 11 QUAL Qualidade do read codificada utilizando a convenção do fastq do Sanger 12 FIELDs Campos opcionais Tabela 3.2: Alinhamento no arquivo SAM Abaixo segue uma descrição mais detalha de cada um dos campos: 1. QNAME: Nome do read ou * para indicar que a informação não está disponível. 2. FLAG: Bits descrevendo algumas propriedades do alinhamento. o layout dos bits esta abaixo e o significado de cada bit está na tabela M A U U M R R M F L S Q D Por exemplo, um read corretamente mapeado vai ter um valor de flag 2, mas se ele mapear na fita oposta a flag vai ser = 18. Caso o read seja o primeiro de um par a flag vai ser = RNAME: Nome da sequência de referência ou um número indicando qual o do header com a correspondente sequência. Um read não mapeado tem o valor * neste campo. 4. POS: Posição mais à esquerda do alinhamento do read com a referência (valores começando em 1). Se o valor for 0, o read não está alinhado. 5. MAPQ: Qualidade do mapeamento. Este valor é representado como um inteiro com interpretação similar ao índice phred de qualidade, ou seja, P = 10 log 10 Q, onde Q é a probabilidade do read estar mapeado de maneira errada. 6. CIGAR: Sequência de caracteres que descrevem como o read está mapeado na referência. O significado de cada caracter é o seguinte: 24

25 Sim. valor Descrição M 1 Template com múltiplos segmentos, ou seja, mate-pair ou pairend. A 2 Cada segmento está corretamente alinhado. U 4 Segmento não mapeado. U M 8 Próximo segmento não mapeado. R 16 O campo SEQ é o reverso complementar do read. R M 32 O campo SEQ do próximo segmento é o reverso complementar do read. F 64 Esse segmento é o primeiro do template. L 128 Esse segmento é o último do template. S 256 Alinhamento secundário. Essa flag indica que existe outro alinhamento desse read que é considerado o primário pelo mapeador. Q 512 Esse alinhamento não passou pelo controle de qualidade. D 1024 Esse read foi considerado uma duplicata de PCR ou ótica. Tabela 3.3: Significado e valor de cada flag do format SAM. M Alignment Match (pode ser um match ou um mismatch) I Inserção na referência D Deleção na referência N Intron (este caracter só é utilizado para representar mrna s) S Soft clipping (corta uma base presente em SEQ) H Hard clipping (corta uma base não presente em SEQ) P Padding (deleção em uma padded reference) = Sequence Match X Sequence Mismatch 7. RNEXT: Sequência na referência do próximo segmento. Se RNEXT for * então esta informação não está presente e se for = RNEXT tem o mesmo valor e RNAME. 8. PNEXT: Posição do próximo segmento, 0 caso esta informação não esteja disponível. 9. TLEN: Tamanho do inserto entre os segmentos. O segmento à esquerda tem sinal positivo e o segmento à direita tem sinal negativo, o valor 0 indica que essa informação não está presente. 10. SEQ: Sequência do segmento. Pode ser * se o valor não tiver sido armazenado. Um = denota uma base idêntica à da referência. 11. QUAL: Qualidade das bases de SEQ em formato Sanger FastQ. Após os campos obrigatórios, pode haver campos opcionais. Esses campos têm o formato T AG : T Y P E : V ALUE, onde tag é uma sequência de 2 caracteres que inidcam o campo, TYPE indica o tipo de dado e VALUE é o valor do campo, para a documentação completa veja a especificação do formato SAM[8]. Na figura 3.1 vemos alguns alinhamentos e as entradas equivalentes em formato SAM. O primeiro read, r001, tem as seguintes flags 163(= ) = A+M +R M +L, portanto está corretamente mapeado (A), é o segundo membro de um par (M +L) e o seu par mapeia na posição 37 na fita oposta (flag R M ). O read r002 posui três soft-clipped bases, a coordenada mostrada no arquivo SAM é da primeira base alinhada. A string CIGAR deste alinhamento contém um P (padding) que corretamente alinha a sequência inserida. A informação de padding pode ser omitida se o alinhador não suportar alinhamento múltiplo de sequências. As últimas 6 bases do read r003 mapeiam na posição 9, e as 5 primeiras mapeiam na posição 29 da fita reversa. O hard clipping (H) indica bases que não estão presentes na referência. A tag opcional NM indica o número de mismatches no alinhamento. O read r004 alinha sobre um intron, fato indicado pelo caracter N. 25

26 Figura 3.1: Exemplos de alinhamentos e os respectivos registros em formato SAM[18] BAM File O arquivo BAM tem exatamente a mesma estrutura do arquivo SAM, porém as informações estão codificadas em formato binário para economizar espaço em disco e na memória. Além disso, o formato BAM possui uma compactação em blocos chamada BGZF, que permite o acesso aleatório ao arquivo mesmo ele estando compactado. Por ter esssa estrutura de blocos, o arquivo BAM pode ser carregado parcialmente, o que permite a visualização de arquivos BAM muito grandes, sem exceder a capacidade da memória RAM. Para fazer esse carregamento, o visualizador utiliza um arquivo auxiliar que indexa os blocos do arquivo BAM em relação às coordenadas genômicas. Esse arquivo tem o mesmo nome do arquivo BAM, mas com a extensão.bai, de BAM index. Ele também tem que estar no mesmo diretório que o arquivo BAM Samtools Junto com o formato SAM/BAM foi criada a ferramenta samtools para manipular esses arquivos. Ele está disponível no site:http://samtools.sourceforge.net/. Para baixar o código fonte do programa, vá para a URL: Após baixar o código fonte compile, com o comando make, será gerado um executável chamado samtools o qual você pode copiar para o diretório que quiser, como por exemplo /usr/local. A estrutura geral de execução do samtools está abaixo, command é um dos comandos reconhecidos pelo samtools e <arg>* são as opções para cada um dos comandos. samtools <command> <arg>* A seguir, uma lista de receitas úteis para manipular arquivos SAM/BAM: Converter entre SAM e BAM: Para fazer a conversão entre a versão binária e texto utiliza-se o comando view: BAM para SAM: samtools view <input.bam> > <output.sam> SAM para BAM: samtools view -S -b <input.sam> > <output.bam> Visualizar o header de um arquivo BAM: Para extrair somente o header de um arquivo BAM, use: samtols view -H <arquivo.bam> Ordenar e indexar um arquivo BAM: Para visualizar e também para realizar diversas análises é preciso ordenar os alinhamentos de acordo com a posição genômica. Para isso utiliza-se o seguinte comando: 26

27 samtools sort <arquivo.bam> <novo.nome> Onde <novo.nome> é o prefixo do nome do novo arquivo que vai ser gerado com os reads ordenados. Esse nome não pode ser o mesmo do arquivo original e não precisa colocar a extensão.bam. Ela é adicionada automaticamente, e se você colocá-la no final vai ter um arquivo com extensão.bam.bam, o que não é muito elegante. Caso o arquivo bam não caiba na memória disponível (que é controlada pela opção -m), será gerado um arquivo temporário com o <novo.nome>.x.bam. No final do processo esses arquivos vão ser combinados e um arquivo chamado <nome.nome>.bam é gerado. O valor default de -m é (500Mb). Se o computador tiver mais memória disponível e o arquivo BAM for bastante grande, é interessante aumentar esse valor de forma a agilizar o processo de ordenação do arquivo bam. Portanto, em um computador com 8Gb de RAM pode-se utilizar algo como: samtools sort -m <arquivo.bam> <novo.nome> Por fim, para indexar o arquivo ordenado, utiliza-se samtools index <novo.nome.bam> Que vai gerar o arquivo <novo.nome.bai. Existe um problema no samtools, o comando sort não altera a tag SO, que indica se o arquivo está ordenado ou não. Desse modo se o arquivo original tiver SO:unsorted, o arquivo gerado ordena também vai conter SO:unsorted. Alguns programas estão conscientes desse problemas e lidam com ele, porém caso seja necessário corrigir essa tag é preciso utilizar o comando reheader do samtools (veja detalhes sobre esse comando mais abaixo). Gerar um relatório sobre o mapeamento: Para conseguir um relatório dos reads mapeados em arquivo BAM, utiliza-se o comando flagstat da seguinte maneira: samtools flagstat <input.bam> Se for aplicado em um BAM file gerado pelo PGM vai gerar um resultado como este: in total (QC-passed reads + QC-failed reads) duplicates mapped (81.67%:-nan%) paired in sequencing read read properly paired (-nan%:-nan%) with itself and mate mapped singletons (-nan%:-nan%) with mate mapped to a different chr with mate mapped to a different chr (mapq>=5) Os valores são classificados como QC-passed reads e QC-failed reads de acordo com o valor da flag Q(512) do campo FLAGS. Todos os valores estão divididos nessas duas categorias. Esse exemplo não tem nenhum read marcado com QC-failed e portanto os valores no segundo grupo são todos zero. A maioria dos valores nesse relatório diz respeito a bibliotecas de reads pareados, e como essa era uma biblioteca de fragmentos, então o valor mais importante é o número e à porcentagem de reads mapeados, no caso , 81,67% do total de reads. Abaixo vemos o resultado do flagstat em um arquivo de reads mate-pair do SOLiD: 27

28 in total (QC-passed reads + QC-failed reads) duplicates mapped (81.57%:nan%) paired in sequencing read read properly paired (40.92%:nan%) with itself and mate mapped singletons (18.43%:nan%) with mate mapped to a different chr with mate mapped to a different chr (mapq>=5) Combinar diversos arquivos BAM em um novo arquivo: Para combinar diversos arquivos bam em um novo arquivo utiliza-se: samtools merge <out.bam> <input1.bam> <input2.bam>... Porém, essa opção vai simplesmente copiar o header do arquivo <input1.bam> e combinar os alinhamentos de todos os arquivos, mas isso pode fazer com que fiquem inconsistentes entre o header e os alinhamentos. Por isso, é necessário criar um novo header, com as informações corretas, e utilizar o comando: samtools merge -rh <novo.header.txt> <out.bam> <input1.bam> <input2.bam>... Onde <novo.header.txt> é o header gerado pelo usuário. Alternativamente, o usuário pode utilizar o comando MergeSamFiles do pacote Picard (seção 3.1.4), que atualiza o header ao fazer o merge. Substituir o header de um arquivo BAM: Para substituir o header de um arquivo BAM, crie um novo header em um arquivo texto e utilize o seguinte comando: samtools reheader <novo.header.txt> <arquivo.bam> > <novo.arquivo.bam> Por exemplo, se quiser modificar a tag SO de unsorted para coordinate, utilize os seguintes comandos: samtools view -H <arquivo.bam> sed s/so:unsorted/so:coordinate/ > header.txt samtools rehader header.txt <arquivo.bam> > <fixed.bam> Picard Picard é um conjunto de programas para manipular arquivos SAM/BAM escritos em Java e é um excelente complemento ao samtools. A página do projeto é e um arquivo.tar.gz, com os pacotes jar já compilados pode ser baixado em: O pacote está estruturado como uma série de arquivos jar, sendo que cada jar é um comando. A estrutura geral para executar um comando é a seguinte: java -jar <path de instalação>/<comando>.jar <args*> Cada ferramenta tem um conjunto próprio de argumentos, porém, alguns argumentos que são comuns à todas as ferramentas podem ser visualizados na tabela 3.4. Abaixo temos alguns comandos úteis do Picard, neles o path de instalação está omitido para deixar mais limpa a linha de comando. 28

29 Argumento MAX_RECORD_IN_RAM TMP_DIR CREATE_INDEX Descrição Número máximo de registros à serem mantidos na memória. Aumentando esse valor reduze-se o número de operações intermediárias de disco. Default: Diretório temporário Cria arquivo de índice.bai. Tabela 3.4: Argumentos comuns a todos os comandos do Picard. 1. Ordenar um arquivo BAM: O Picard possui um comando similar ao samtools sort, que é o SortSam.jar: java -jar SortSam.jar I=<entrada.bam> O=<sorted.bam> SO=coordinate CREATE_INDEX=true A grande vantagem do SortSam.jar em relação ao samtools sort é que esse comando atualiza de maneira apropriada o header do arquivo, trocando a tag SO para coordinate. Para ordenar arquivos muito grandes é interessante aumentar o valor de MAX_RECORD_IN_RAM. Em uma máquina com uma boa quantidade de RAM pode-se aumentar esse valor em 10, como por exemplo: java -jar SortSam.jar I=<entrada.bam> O=<sorted.bam> SO=coordinate CREATE_INDEX=true MAX_RECORD_IN_RAM= Fazer o merge de diversos arquivos BAM: O Picard também possui uma alternativa ao comando samtools merge java -jar MergeSamFiles.jar O=<resultado.bam> I=<input1.bam> I=<input2.bam>... MSD=true AS=true USE_THREADING=true CREATE_INDEX=true Assim com o SortSam.jar, o MergeSamFiles.jar trata melhor o header do arquivo gerado do que o comando equivalente do samtools. Por default ele gera corretamente as no header, e com a opção MERGE_SEQUENCE_DICTIONARIES, ele também gera as corretas. A opção AS significa Assume Sorted e existe para lidar com o fato do samtools não atualizar o header do arquivo gerado, e portanto indicar como unsorted um arquivo ordenado. A opção USE_THREADING faz com que o programa utilize duas threads 4. Quando se deseja combinar diversos arquivos BAM juntos, é um pouco tedioso colocar uma argumento I=<file.bam> para cada arquivo. É possível combinar o MergeSamFiles com o comando find do unix para combinar todos os arquivos BAM em um mesmo diretório. java -jar /share/apps/picard/mergesamfiles.jar O=<out.bam> USE_THREADING=true MSD=true find -name \*.bam -printf "I=%p\n" 4 Linhas de execução do programa. Em um sistema com mais de um processador/core essa opção aumenta a performance do programa, podendo reduzir o tempo de processamento em 20% 29

30 3. Identificar Read Duplicados: Durante o preparo de biblioteca pode ocorrer a duplicação de um fragmento, o que causa um viés artificial da região que originou o fragmento. Por isso, é recomendado que reads suspeitos de serem duplicatas sejam marcados e ignorados nas análises subsequentes. O MarkDuplicates.jar procura reads nos quais as posições mais 5 do alinhamento e a orientação sejam iguais. O read com a melhor qualidade não é alterado e todos os outros são marcados como duplicados. Para bibliotecas de mate-pair e pair-end ocorre o mesmo, porém as cordenadas e a orientação dos dois pares de reads devem coincidir[9]. Uma vantagem do MarkDuplicates.jar é que ele consegue encontrar duplicatas mesmo se os reads do par não mapearem no mesmo cromossomo. Para executar o comando utilize: java -jar MarkDuplicates.jar I=<input.bam> O=<input.dups.bam> M=<input.dups_report.txt> AS=true CREATE_INDEX=true 3.2 Mapeando os reads com o TMAP O Ion Torrent possui um mapeador otimizado para o padrão de erros dos dados gerados pelo sequenciador. Chamado de TMAP, ele foi criado por Nils Homer. O TMAP é otimizado para os reads de tamanho variável e também para lidar com erros de homopolímeros gerados pelo Ion Torrent. Para isso, ele implementa quatro algoritmos de mapeamento que podem ser utilizados individualmente ou combinados. A lista de algoritmos está na tabela 3.5. Na figura 3.2 temos uma comparação da sensitividade (porcentagem de reads mepados) dos algoritmos do TMAP para o dataset de E. Coli O104H4 5. Por comparação foi também colocada a performance bowtie2 e vemos que este tem uma performance um pouco superior ao map1, porém inferior a todos os outros algoritmos (pelo menos para esse dataset). Vê-se que o desempenho de map3 e map4 foi bem superior aos outros dois algoritmos, o que gera o questionamento do porquê deles terem sido incluídos. Na figura 3.3, temos os tempos de processamento dos mesmos dados da figura anterior. Podemos notar que o map1, apesar de menos eficiente em relação à porcentagem de reads mapeados, é mais rápido do que map3 e map4. Para equilibrar sensitividade e performance, temos o comando mapall. Ele aplica cada algoritmo de mapeamento em estágios definidos pelo usuário. Dessa forma somente os reads que não mapearem em um estágio são passados para o estágio seguinte. Portanto, uma abordagem eficiênte é colocar o map1 no primeiro estágio, para fazer rapidamente o mapeamento dos reads fáceis, e em seguida usar o map3 e o map4 para mapear o resto dos reads. O código fonte do TMAP está disponível no site github: https://github.com/iontorrent/tmap Para ter uma melhor performance o TMAP pode opcionalmente utilizar o TCMalloc da gperftools que está disponível em: Algoritmo Referência map1 BWA Short Li and Durbin [15] map2 BWA Long Li and Durbin [16] map3 SSAHA Ning [25] map4 SMEM Li [14] Tabela 3.5: Algoritmos do TMAP Criando o índice O primeiro passo para usar o TMAP é gerar o índice do genoma de referência. Para isso, utiliza-se o comando index da seguinte forma: 5 Disponível na Ion Community 30

31 map % bowtie2 map1 map2 map3 map4 Figura 3.2: Sensitividade dos algortmos do tmap e do bowtie2 (Amostra de E. Coli O104H4) tmap index -f <referecen.fasta> Caso haja bases ambíguas na referência, será mostrada uma mensagem de aviso e as bases ambíguas serão trocadas, dentre as bases possíves, pela de menor valor lexicográfico. Por exemplo, a base Y, que representa C ou T, será trocada por C, a base N que representa qualquer base será trocada por A, e assim por diante. A indexação do genoma humano pode demorar 4 horas em um computador atual. O resultado será diversos arquivos com os índices Mapeando os reads O comando para aplicar um dos algoritmos é: tmap <mapn> -f <reference> -r <reads> Onde mapn é map1, map2, map3 ou map4, <reference> é nome de um arquivo fasta que já tenha sido indexado e <reads> é o arquivo dos reads, que pode estar em formato, fasta, fastq ou SFF. Como resultado o tmap gera um arquivo SAM na saída padrão. Caso se utilize um arquivo SFF, é possível propagar a informação dos flows para o aquivo SAM por meio da opção -Y. Também é possível utilizar diversas threads com a opção -n <num threads>. A opção -o X controla o formato de saída do programa, -o 0 é o default e gera uma saída texto em formato SAM, -o 1 gera um resultado binário em formato BAM, e por fim -o 2 gera um arquivo BAM não comprimido, uma opção útil se o resultado for tmap vai ser enviado para um outro comando para mais processamentos, como por exemplo no comando abaixo, que combina o tmap com o samtools sort: tmap <mapn> -f <reference> -r <reads> -o 2 samtools sort -n <memoria> - <output> Normalmente, os algoritmos individuais não são utilizados, mas sim o comando mapall. Com esse comando você pode combinar os algoritmos em estágios adicionando argumentos no formato stagem mapx* que define quais algoritmos serão utilizados em cada estágio. É possível definir diversos estágios de modo que, se um read não mapear em um determinado estágio, ele é passado para o estágio seguinte. Uma estratégia é colocar o map1 no primeiro estágio, porque ele é mais rápido, e o map3 e o map4 no segundo estágio. Para isso, utilizamos o seguinte comando: 31

32 map time (s) map1 map2 map3 map4 Figura 3.3: Performance dos algoritmos do tmap (Amostra de E. Coli O104H4) tmap mapall -f <reference> -r <reads> stage1 map1 stage2 map3 map4 Também é possível controlar as informações da através da opção -R. Isso é importante porque outros programas validam essa tag ao abrir o arquivo BAM. E além disso é bom adicionar metadata sobre a amostra para facilitar a organização dos arquivos. Algumas tags que podem ser utilizadas são: ID Identificador único do read group SM cancer Nome da amostra (sample) LB hg19 Nome da biblioteca CN USP Nome do centro de sequenciamento PU PGM/318 A utilização varia entre plataformas. No PGM tem sido usado para identificar o tipo de chip utilizado. PL IONTORRENT Nome da plataforma de sequenciamento (esses valores são tabelados pelo formato SAM) Combinando todas as informações apresentadas, uma sugestão para rodar o TMAP é a seguinte: tmap mapall -n <num threads> Y -f <reference> -r <reads.sff> -R LB:<LB> -R CN:<CN> -R PU:PGM/<chip> -R ID:<ID> -R SM:<SM> -R PL:IONTORRENT stage1 map1 stage2 map2 map3 -o 2 samtools sort - <output> Exemplo: Mapeando os reads de E. coli com o TMAP 1. Faça o download do arquivo SFF com os reads no site da Ion Community: hosted.jivesoftware.com/docs/doc Descompacte o arquivo zip com os reads. 32

33 3. Faça o download da referência no site do NCBI:http://www.ncbi.nlm.nih.gov/nuccore/NC_ em formato fasta e renomeie o arquivo dh10b.fasta 4. Indexe a referência: tmap index -f dh10b.fasta 5. Utilize o TMAP para mapear os reads na referência. Para mapear uma amostra utilize: tmap mapall -Y -f dh10b.fasta -r 64.sff -R LB:O104H4 -R CN:uni-munster -R PU:PGM/314 -R ID:64 -R SM:ecoli -R PL:IONTORRENT stage1 map1 stage2 map2 map3 -o 2 samtools sort - 64 Para mapear todas as amostras você pode utilizar o comando for do bash: for file in *.sff; do base= basename $file.sff ; tmap mapall -Y -f dh10b.fasta -r $file -R LB:O104H4 -R CN:uni-munster -R PU:PGM/314 -R ID:$base -R SM:ecoli -R PL:IONTORRENT stage1 map1 stage2 map2 map3 -o 2 samtools sort - $base ; done 6. Marque os reads duplicados: utilize o comando MarkDuplicates.jar do picard para identificar os reads duplicados: java -jar MarkDuplicates.jar I=64.bam O=64.dups.bam M=64.dups.txt AS=true Ou utilize o for para processar todos os arquivos bam: for file in *.bam; do base= basename $file.bam ; java -jar MarkDuplicates.jar I=$file O=$base.dups.bam M=$base.dups.txt AS=true done 7. Faça o merge dos arquivos bam utilizando o MergeSamFiles.jar do Picard: java -jar MergeSamFiles.jar O=O104H4.bam ls *.dups.bam sed s/^/i=/ USE_THREADING=TRUE SO=coordinate MSD=true 8. Verifique os parâmtros do resultado utilizando o comando flagstat do samtools: samtools flagstat O104H4.bam Mapeando dados de Long Mate Pair O TMAP também suporta o mapeamento de reads pareados. A principal diferença quando se utiliza o mapeamento pareado ao invés do normal é que no primeiro caso o mapeador vai fazer o pareamento dos reads, ou seja, ela vai indicar para cada read a posição do seu respectivo par (colunas RNEXT e PNEXT do arquivo BAM). Para fazer o mapeamento é preciso primeiro separar as tags do mate-pair utilizando o seq_crumbs (veja seção 2.2.1). O comando para fazer a extração é: 33

34 sff_extract <entrada.sff> split_matepairs -l ION_TORRENT pair_matcher -p <orphan.fastq> deinterleave_pairs -o <out.1.fastq> <out.2.fastq> Para fazer o mapeamento utilze o seguinte comando: tmap mapall -Q 1 -f <ref.fasta> -r <out.1.fastq> -r <out.2.fastq> -o 2 stage1 map1 stage2 map3 map4 > <out.bam> É importante colocar a opção -Q 1 para indicar que os dados são de mate-pair e colocar a opção -r duas vezes, uma para cada arquivo dos pares. 3.3 Bowtie O bowtie[11] é um mapeador bastante popular criado para mapear short reads. Ele é especialmente eficiente para reads com 50bp ou menos. O bowtie suporta dados tanto em base quanto color space. A versão mais nova, bowtie 2[12], suporta alinhamentos com gaps e por isso é mais adequado para reads com 100bp ou mais. Infelizmente ele não suporta mais color-space. Em termos de algoritmo, o bowtie 2 é muito similar ao TMAP, dividindo o mapeamento em uma primeira etapa de alinhamento sem gaps seguida de uma etapa de alinhamento Smith-Waterman. Diversos softwares utilizam o bowtie como mapeador, em especial o pipeline de análise de RNA-Seq Tophat[32] e o pipeline na nuvem de ressequenciamento Crossbow[13] Utilizando o Bowtie 2 O bowtie2 está disponível na seguinte URL: É possível baixar tanto os binários para Mac ou Linux quanto o código fonte do programa. Após descompactar o pacote, adicione o diretório do bowtie2 ao path ou faça um link dos binários contidos nele para um /usr/local/bin ou outro diretório que já esteja no path. O uso do bowtie2 é muito similar ao tmap, até porque ambos se baseiam nos mesmos princípios. Inicialmente, é necessário indexar a referência utilizando o comando bowtie2-index da seguinte forma: bowtie2-build -f <ref.fasta> <prefix> Onde <prefix> é o prefixo do nome dos arquivos de índice que vão ser gerados. Esse nome vai ser depois utilizado para referenciar os índices. Para mapear um arquivo fastq utiliza-se: bowtie2 -p <threads> <prefix> <reads.fastq> Onde <threads> é o número de threads a utilizar, <prefix> é o prefixo usado na criação do índice e <reads.fastq> é o arquivo com os reads à mapear. Diferentemente do TMAP, o bowtie2 só suporta reads em formato fasta ou fastq, não em SFF. Para gerar diretamente os alinhamentos em formato BAM, combina-se o bowtie com o samtools: bowtie2 -p <threads> <prefix> <reads.fastq> samtools view -Sbh - samtools sort -m <memory> - <output> Onde <memory> é a quantidade de memória utilizada na ordenação dos reads e <output> é o nome do arquivo de saída sem a extenção.bam. 34

35 3.3.2 Utilizando o Bowtie 2 com o Ion Torrent Vamos agora mapear os mesmos dados utilizados com o TMAP (seção 3.2) com o Bowtie 2. Assim como no caso do TMAP, a primeira etapa é indexar o genoma de referência. Para isso, utilize o seguinte comando: bowtie2-build dh10b.fasta dh10b Como o bowtie não suporta o formato sff, é preciso fazer a conversão para fastq. Para isso, utilize um do programas descritos na seção 2.2, como por exemplo o sff_extract: sff_exract -c 64.sff Ou então empregue o comando for para converter todos os arquivos: for i in *.sff; do sff_extract -c $i done Em seguida, vamos usar o bowtie para fazer o mapeamento: for i in data/*.fastq; do b= basename $i.fastq bowtie2 -p 8 -q dh10b $i samtools view -Suh - samtools sort - $b.bowtie2 done 3.4 Visualizando arquivos BAM com o IGV A ferramenta mais popular para visualizar arquivos BAM é o IGV do Broad Institute. O IGV é um programa em java disponível para Linux, Mac OS e Windows. É possível baixar o programa como um stand-alone, assim como via Java Web Start. Ele está disponível no seguinte link: É possível iniciar o IGV utilizando a tecnologia de WebStart, que cuida automaticamente do download do aplicativo e o inicia no computador do usuário. Na página serão mostrados quatro ícones para iniciar o IGV, o que muda entre eles é a configuração de memória. Escolha a opção de acordo com a quantidade de memória disponível no seu computador, o tipo de sistema operacional e se você está rodando no modo de 32 ou 64 bits. Alternativamente você pode ir até a seção Binary Distribution para baixar o arquivo zip com o programa. Após baixa-lo, basta executar o programa igv.bat no Windows e o igv.sh no Linux ou Mac OS. Vamos demonstrar o IGV utilizando um dataset do Comprehensive Cancer Panel, disponível em: Baixe o arquivo FLO-528.bam.gz, em seguida descompacte-o e crie o índice.bai: gunzip FLO-528.bam samtools index FLO-528.bam No IGV, vá para o menu File, escolha Load from File... e selecione o arquivo FLO-528.bam. Inicialmente o IGV não vai mostrar nenhuma informação porque o nível de zoom está muito alto. Para visualizar os alinhamentos é necessário selecionar uma das regiões capturadas pelo ampliseq. Para isso, vá na caixa de texto na toolbox superior e coloque o nome do gene MTRR. Como o IGV tem a anotação do genoma humano, ele vai focalizar a janela principal na região onde se encontra o gene MTRR, no caso entre as coordenadas 7,865,776 e 7,901,794 do cromossomo 5 como pode ser visto na caixa de texto, que mudou de MTRR para as coordenadas da região mostrada. Na figura 3.5 vemos o um screenshot do IGV mostrando a região selecionada. A parte principal da tela está dividida em duas regiões: No topo, temos a barra de navegação que mostra o cariótipo do cromossomo que está sendo exibida e a região que está sendo mostrada, que é indicada por uma pequena 35

36 barra vermelha no cariótipo. Logo abaixo temos uma escala com as coordenadas da região. No resto da tela são mostrados os arquivos carregados. No caso, temos o arquivo bam com os alinhamentos e na parte de baixo temos a anotação do genoma. É possível adicionar outras seções na visualização, basta abrir novos arquivos e a tela será subdividida verticalmente para acomodar as novas visualizações. A visualização do arquivo bam está dividade em duas regiões. No topo temos um gráfico que mostra a cobertura, ou seja, o número de reads cobrindo cada base do genoma. Na parte de baixo temos o alinhamento de cada read. No nível e zoom do gene inteiro podemos ver poucos detalhes dos alinhamentos, mas pelo gráfico de cobertura já é possível verificar a eficiência do processo de captura. Vemos que as leituras estão nas regiões do exons, o que é exatamente o objetivo do processo de captura. Figura 3.4: IGV mostrando os alinhamentos do reads na região do gene MTRR É possível mudar o nível de zoom através dos botões - e + no canto superior direito da tela. Também é possível aumentar o nível de zoom com um click duplo em um ponto de interesse. Com o click duplo será feito o zoom e a tela será centralizada no ponto de click. Por fim, é possível mudar o zoom e a posição digitando novas coordenadas na caixa de texto. Pode-se aumentar o zoom até ser possível os núcleotídeos do genoma. Na figura 3.5 vemos o zoom de um dos exons do gene MTRR. Nesse nível de zoom podemos ver cada um dos reads alinhados na região, representados pelas caixas cinzas. A seta na ponta do read indica o sentido do alinhamento. Todas as posições em cinza indicam que a base no read é igual à da referência, qualquer troca é indicada como um retângulo colorido, já inserções são indicadas como um I azul e deleções são indicadas como uma quebra com um traço preto no read. Podemos obter mais informações sobre cada read e cada posição basta deixar o ponteiro do mouse parado em uma posição e uma popup box irá aparecer (fig 3.6. Também é possível colocar o mouse sobre a cobertura e o IGV irá informar a quantidade de reads na posição indicada, assim como a quantidade de cada base, deleções e inserções. Clicando na região com o nome do arquivo é possível mudar a visualização do painel com os alinhamentos. Mudar a visualização de Expanded para Collapsed permite ter uma visão mais geral dos alinhamentos, com menos foco em cada alinhamento individual. Na figura 3.7 vemos que o exon em questão está coberto por reads vindos de dois amplicons diferentes com um pequeno overlap no meio. Vemos também mais claramente duas trocas nucleotídicas. É possível também mudar a visualização dos genes, só que o padrão é tê-los em Collapsed, o que é díficil de visualizar se o gene tiver diversas isoformas diferentes ou se houver genes com overlap em fitas opostas. Nesses casos recomenda-se mudar a visualização dos genes para Expanded. 36

37 Figura 3.5: IGV mostrando os alinhamentos dos reads na região do gene MTRR Importanto o genoma de referência Na seção anterior trabalhamos com dados de humano mapeados contra a versão hg19 do genoma, que é um dos genomas distribuídos pelo Broad Institute para utilizar com o IGV. Porém, frequentemente temos que trabalhar com outro genomas não disponibilizados ou até mesmo com genomas novos, criados pelo próprio grupo de pesquisa. Nesses casos é preciso importar o genoma antes de poder visualizar qualquer alinhamento. Para fazer essa operação escolha o item Import Genome... no meu File. Será aberta uma caixa de diálogos com os seguintes items: Unique Identier Um ID para o genoma, deve ser único para todos os genomas registrados no programa, por exemplo human_hg19. Descriptive Name Um nome descritivo, que vai aparecer na lista de genomas do menu pull down. FASTA File Arquivo fasta com o genoma. opcional Cytoband file Arquivo com as informações. Ele permite gerar a ilustração das citobandas na área superior do IGV. opcional Gene file Arquivo com a anotação do genoma em formato BED ou GFF. opcional Alias file Um arquivo com duas colunas que determina uma relação entre os nomes das sequências (cromossomos, contigs etc.) do genoma e da anotação, por exemplo, podemos ter um genoma cuja sequência se chame chr9, mas no arquivo de genes está somente 9 6. Após preencher todos os campos o IGV irá perguntar onde salvar o arquvo.genome que será criado com todas as informação necessárias para a visualização. Esse é um arquivo binário que deve ser mantido para futuros usos do genoma criado. A criação do genoma só precisa ser feita uma vez. Após criado, ele passa a fazer parte do menu de genomas disponíveis da instalação local do IGV. 6 Uma exceção para essa regra são os nomes no formato NCBI, se por exemplo a sequência do genoma tiver a forma gi ref NC_ , mas na anotação estiver a forma curta NC_ , o IGV fará a associão entre as duas automaticamente. 37

38 Figura 3.6: Popup boxes do IGV. A) Popup que aparece quando se deixa o cursor sobre um dos reads. B) popup mostrado quando se deixa o cursor sobre o gráfico de cobertura. Figura 3.7: IGV com os alinhamentos no modo colapsado. Destaque para duas posições com trocas de nucleotídeos. 38

39 Capítulo 4 Arquivos de Anotação de Genomas A sequência linear de bases que formam o genoma é somente o primeiro nível de informação genética. Codificados nela estão os genes e os elementos de regulação de expressão gênica. Para identificar a posição desses elementos, utiliam-se arquivos de anotação, que em geral nada mais são do que arquivos texto que associam coordenadas genômicas com características ou features. A seguir vamos descrever alguns formatos de arquivos de anotação. 4.1 BED Formats O formato BED foi criado pela UCSC para descrever anotações em um genoma. Ele é um formato muito associado ao UCSC Browser e possui diversos campos que descrevem a representação gráfica da anotação pelo visualizador. Ele é um formato texto, com colunas separadas por caracteres TAB que representa intervalos no genoma associados à anotação ou feature[7]. Existem três variações do formato BED, a versão padrão, a versão beddetail e a versão bedgraph, além de uma versão binária chamada de bigbed. Em comum, todos os formatos têm as seguintes colunas: 1. chrom: Nome do cromossomo ou scaffold. 2. chromstart: Posição incial da anotação (iniciando em 0) 3. chromend: Posição final da anotação. Além das linhas descrevendo as features, um arquivo bed pode ter um cabeçalho que começa com a palavra track e descreve outros atributos utilizados na representação gráfica das regiões. No formato beddetail se adicionam mais duas colunas, tendo assim a seguinte estrutura: 1. chrom: Nome do cromossomo ou scaffold. 2. chromstart: Posição incial da anotação (iniciando em 0) 3. chromend: Posição final da anotação. 4. Nome: Nome da região 5. Description: Descrição da região O formato beddetail é utilizado pelo Ampliseq Designer para informar as regiões cobertas pelo painel. Na figura 4.1, vemos um exemplo de beddetail file gerado pelo programa. 39

40 track name=" _ccp_designed" description="amplicon_insert_ _ccp" type=beddetail chr AMPL TNFRSF14 chr AMPL TNFRSF14 chr AMPL TNFRSF chr AMPL PLEKHG5 chr AMPL PLEKHG5 chr AMPL PLEKHG Figura 4.1: Exemplo de arquivo beddetail 4.2 Formatos GFF e GTF O GFF é outro formato texto utilizado para representar anotações. O formato passou por diversas revisões, sendo a mais recente o GFF3. Originalmente, GFF significava Gene Finding Format, mas foi rebatizado para Generic Feature Format para representar o aumento de escopo do formato. Além do GFF3, também é comumente utilizado o formato GTF (também chamado de GFF2.5). O formato GFF é mantido pelo projeto Sequency Ontology[31]. A estrutura do GFF é bastante similar ao do formato BED mas com alguns campos que refletem a sua origen ligada a programas de gene finfing: 1. SeqId: Identificação do cromossomo ou sequência da qual a anotação faz parte. 2. Source: Programa ou algorítmo que gerou a anotação. 3. type: Descreve a natureza biológica da anotação, como gene ou exon. Tem que ser um termo do SOFA 1 ou um código do Sequence Ontology[4]. 4. start: Posição inicial da anotação em relação à sequência identificada na primeira coluna. O sistema de coordenadas começa em end: Final da anotação, tem de ser um valor igual ou maior que start. 6. score: Nas versões iniciais, esse campo não estava bem definido. Atualmente se recomenda que se utilize o p-value para predição de genes ou o e-value para mapeamento. 7. strand: Fita da anotação, + para a fita positiva e para a fita negativa. 8. phase: Para anotações como CDS, essa coluna indica o início da anotação em relação ao frame de leitura. O valor de 0 indica que o próximo códon começa na primeira base, 1 que é preciso pular uma base e assim por diante até attributes: Lista de pares tag=valor. Os pares são separados por ;. A lista de tags que podem ser utilizadas é aberta, mas algumas têm semântica predefinida. A lista das tags predefinidas para a coluna atributos está na página do formato, vale resaltar algumas: ID: Identificador da anotação, tem que ser único no arquivo. Parent: ID da anotação pai. Com as tags ID e Parente é possível definir qualquer estrutura hierárquica no genoma, como por exemplo a relação gene transcrito exon. Abaixo temos um exemplo de anotações em GFF: 1 Sequence Ontology Feature Annotatio 40

41 ctg123 example mrna ID=t_012143;gene_name=EDEN ctg123 example exon Parent=t_ ctg123 example exon Parent=t_ ctg123 example exon Parent=t_ ctg123 example exon Parent=t_ ctg123 example exon Parent=t_ ctg123 example CDS Parent=t_ ctg123 example CDS Parent=t_ ctg123 example CDS Parent=t_ Uma outra abordagem para representação de genes e transcritos é o formato GTF. Este formato é quase idêntico ao GFF3, só mudando a coluna attributes. Em vez de utilzar o formato tag=valor, ele utiliza tag "valor", e em vez de usar uma estrutura genérica de pai e filho entre as anotações, ele exige os seguintes atributos: gene_id: ID do gene associado à esta anotação transcript_id: ID do transcrito Utilizando um mesmo valor de gene_id e variando o trascript_id é possível representar as informações de splicing alternativo. Essa é uma solução bem menos flexível do que a do GFF3. Abaixo um exemplo de anotação em formato GTF: 381 Twinscan CDS gene_id "001"; transcript_id "001.1"; 381 Twinscan CDS gene_id "001"; transcript_id "001.1"; 381 Twinscan CDS gene_id "001"; transcript_id "001.1"; 381 Twinscan start_codon gene_id "001"; transcript_id "001.1"; 381 Twinscan stop_codon gene_id "001"; transcript_id "001.1"; É possível converter de GTF para GFF utilizando o comando gffread que faz parte do cufflinks 2 : gffread <in.gtf> -o <out.gff> E também de GFF pra GTF: gffread -T <in.gff> -o <out.gtf> 4.3 Gerando arquivos de anotação Pode-se obter os arquivos de anotações de genomas bem estudados, pode-se usar os serviços dos bancos de dados de anotações, como o UCSC ou o Ensembl. Caso o genoma de interesse não esteja nessas bases de dados, é possível encontrar informações de anotações, normalmente feitas automaticamente por um programa, na página do projeto de montagem do genoma Obtendo anotações do UCSC Browser O UCSC Browser possui um serviço chamado Table Browser[10] que permite exportar as informações de sua base de dados para diversos formatos, entre eles o bed e o GTF. Essa ferramenta está disponível em: Na figura 4.2 vemos tela de seleção de informações do site. Na primeira linha de combo boxes escolhe-se o genoma de interesse e a versão deste, por default será mostrado o genoma humano na versão hg19. Abaixo pode-se escolhe o grupo e a track de anotações, no caso vamos deixar no grupo Genes and Gene Prediction e na track UCSC Genes. Por fim, podemos escolher qual tabela que queremos exportar. No caso vamos escolher a tabela knowngene. Existem diversas opções de filtragem e é até possível fazer operações de bancos de dados com as anotações, mas o que nos interessa é o seletor 2 41

42 Figura 4.2: UCSC Table Browser site Output Format (ver figura 4.2) que permite escolher, entre outros formatos, GTF e BED. Logo abaixo é possível esolher um nome para o arquivo que vai ser gerado e também escolher para que o arquivo seja enviado já comprimido com o programa gzip, reduzindo assim o tamanho do download. Por fim, clica-se em Get Output para fazer o download das anotações. Figura 4.3: Escolha de regiões ao exportar arquivo BED Caso se escolha gerar um arquivo em formato BED, será mostrada uma outra tela que permite escolher as regiões do gene que serão incluídas no arquivo gerado (ver figura 4.3). São oferecidas as seguintes opções: Whole Gene Upstream by X bases Exons plus X bases at each end 42

43 Introns plus X bases at each end 5 UTR Exons Coding Exons 3 UTR Exons Downstream by X Na figure 4.4 podemos ver graficamente os diferentes tipos de arquivos BED gerados. 4.4 Manipulando arquivos BED Uma ferramenta muito útil para manipular arquivos de anotação é o bedtools. Apesar do nome, a ferramente suporta tanto formato BED quanto GFF, GTF, VCF, SAM e BAM. O código está disponível em: https://code.google.com/p/bedtools/ Extrair sequências da regiões Para extrair a sequência das regiões indicadas pelo arquivo bed utiliza o comando getfasta do bedtools: bedtools getfasta -fi <genome.fasta> -bed <file.bed> -fo <regions.fasta> 43

44 44 Figura 4.4: Diferença entre os tipos de arquivos BED gerados pelo UCSC Table Browser.

45 Capítulo 5 Detecção de Variâncias Em um projeto de sequenciamento, o passo natural seguinte ao mapeamento é a detecção de diferenças entre o genoma sequenciado e o genoma de referência. Com uma biblioteca de fragmentos é possível detectar Single Nucleotide Polymorphism, normalmente chamados de SNPs (se pronuncia esnipe ), e pequenas inserções/deleções (usualmente chamados de indels). Com uma biblioteca de mate-pair, também é possível detectar variações estruturais como grandes indels e inversões. Neste capítulo vamos abordar somente a detecção de SNPs e de small-indels. 5.1 VCF Files O formato VCF (Variant Call Format), assim como o formato BAM, foi criado pelo 1000 Genomes Project para representar as variações detectadas[26]. O arquivo VCF é um arquivo texto. No topo do arquivo, há um cabeçalho, indicado pelas linhas que começam com #. Depois do cabeçalho, uma lista de VCF Records, um por linha. Cada campo do registro é colocado em uma coluna, a lista das colunas está abaixo: 1. CHROM: Cromossomo ou contig da variante. 2. POS: Posição da variante iniciando a contagem por REF: Bases da referência. 4. ALT: Bases alternativas. Se houver mais de uma alternativa, elas serão listadas separadas por vírgulas. 5. QUAL: Score da variante em escala phred. 6. FILTER: Se a variante passou pelos controles de qualidade: PASS; caso contrário uma lista de códigos separos por vírgulas descrevendo por que ela foi rejeitada. 7. INFO: Lista de valores separados por dois pontos com estatísticas sobre as variantes. Os valores estão na forma <chave>=<valor>, onde chave é uma string curta que identifica o valor. Abaixo, temos uma lista de chaves definidas pelo padrão. Todas elas são opcionais e os usuários podem também adicionar chaves extras. No entanto as chaves abaixo são reservadas: AA: Alelo Ancestral AC: Contagem por alelos AF: Frequência de cada alelo AN: Número total de alelos BQ: RMS 1 da qualidade para essa posição CIGAR: Cigar String descrevendo como um alelo alternativo se alinha no alelo de referência 1 Root Mean Square: i x2 i 45

46 DB: Membro do dbsnp DP: Cobertura para todas as amostras END: Posição final da variante descrita nesse registro H2: Membro do hapmap2 H3: Membro do hapmap3 MQ: RMS do mapping quality MQ0: Número de reads com MQ = 0 NS: Número de samples SB: Strand Bias nessa posição SOMATIC: Indica que essa variante é somática VALIDATED: Validado por outro experimento 1000G: Membro do 1000 Genomes Um exemplo com as 8 primeiras colunas de um arquivo VCF está na tabela 5.1. Depois da 8 a coluna podemos encontrar informações de genótipo. Primeiro temos uma coluna chamada FORMAT, a qual define uma lista com tipos de dados (separados por dois pontos). Em seguida temos uma coluna para cada amostra com os valores definidos por FORMAT, e no cabeçalho está o nome de cada amostra. Vemos um exemplo na tabela 5.2. Neste, caso temos a informação de genótipos para duas amostras, NA e NA #CHROM POS ID REF ALT QUAL FILTER INFO rs G A 29 PASS NS=3;DP=14;AF= T A 3 q10 NS=3;DP=11;AF= T. 47 PASS NS=3;DP=13;AA=T microsat1 GTC G,GTCT 50 PASS NS=3;DP=9;AA=G Tabela 5.1: Exemplo de lista de variantes em arquivo VCF (parte obrigatória). FORMAT NA00001 NA00002 GT:GQ:DP:HQ 0 0:48:1:51,51 1 0:48:8:51,51 GT:GQ:DP:HQ 0 0:49:3:58,50 0 1:3:5:65,3 GT:GQ:DP:HQ 0 0:54:7:56,60 0 0:48:4:51,51 GT:GQ:DP 0/1:35:4 0/2:17:2 Tabela 5.2: Exemplo de lista de variantes em arquivo VCF (definição de genótipos). Assim como para o campo INFO, existem diversas chaves predefinidas para o genótipo. Abaixo temos a lista definida pelo padrão: GT: Genótipo, codificado como valores de alelo separados por / ou. O alelo da referência é indicado por 0, o primeiro alelo em ALT é indicado por 1, o segundo por 2, e assim por diante. Para um genoma diplóide esse campo pode ser 0/1, 1 0, 1/2 e assim por diante. Para um genoma monoplóide, somente um valor deve ser dado, e para um genoma triplóide podemos ter algo como A diferença dos separadores é que / indica genótipos fora de fase e indica genópicos em fase. FT: A mesma coisa que o campo FILTER, porém individual para a amostra. GL: log 10 da verossimillhança para possível genótipo. Se A for o alelo de referência e B o alelo alternativo, a ordem dos genótipos é AA,AB e BB (a fórmula geral para a ordem dos genótipos está explicada no apêndice 7.1). GLE: Verossimilhança do genótipo usado quando existe incerteza de copy mumber. 46

47 PL: Valores de GL em scala phred. GP: Probabilidade à posteriori dos genótipos em escala phred. CQ: Probabilidade condicional do genótipo estar errado, dado que o locus é variante (em escala phred): 10 log 10 p(genótipo está errado locus é variante) (5.1) HQ: qualidade dos halótipos, dois valores separados por vírgula em escala phred. PS: Phase Set, definido como o conjunto de genótipos em fase que este genótipo pertence. PQ: Qualidade da atribuição de fase do genótipo, em escala phred. EC: Lista separada por vírgulas do valor esperado da contagem de cada alelo alternativo listado na coluna ALT. MQ: RMS do mapping quality, similar à encontrada na coluna INFO. Além dos registros VCF, o arquivo contém um header. Esse header é bastante útil porque adiciona uma descrição texto para vários campos contidos no arquivo. Para os campos padrão pode-se consultar a especificação do padrão, mas para campos específicos de algum programa a descrição no arquivo é bastante útil. Em especial as linhas INFO e FORMAT descrevem as chaves das colunas INFO e FORMAT no arquivo. Abaixo temos um exemplo de VCF header: ##fileformat=vcfv4.1 ##filedate= ##source=myimputationprogramv3.1 ##reference=file:///seq/references/1000genomespilot-ncbi36.fasta ##contig=<id=20,length= ,assembly=b36, md5=f126cdf8a6e0c7f379d618ff66beb2da,species="homo sapiens",taxonomy=x> ##phasing=partial ##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data"> ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth"> ##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency"> ##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele"> ##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP membership, build 129"> ##INFO=<ID=H2,Number=0,Type=Flag,Description="HapMap2 membership"> ##FILTER=<ID=q10,Description="Quality below 10"> ##FILTER=<ID=s50,Description="Less than 50% of samples have data"> ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality"> ##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth"> ##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality"> Manipulando arquivos VCF Como o arquivo VCF é uma tabela com colunas separadas por tabulação, pode facilmente ser lido (no caso de um arquivo de tamanho razoável) em um planilha eletrônica como o Excel ou Open Office Calc. Também pode ser facilmente manipulado utilizando scripts e utilitários do unix Indexando as variantes Para visualizar o arquivo vcf no IGV é necessário comprimi-lo e indexá-lo primeiro. Para isso utilizamse duas ferramenta criadas pelo grupo do samtools: o bgzip e o tabix, ambos disponíveis no seguinte endereço: O bgzip é um compactador de blocos 2 e o que ele faz é aplicar o algoritmo de compressão em blocos do arquivo de entrada. Já o tabix cria um índice que permite que o visualizador carregue na memória somente as variantes associadas à região que está sendo mostrada na tela. Para utilizá-los no arquivo VCF: 2 Esse é o mesmo formato de compactação utilizado pelo arquivo BAM 47

48 bgzip <var.vcf> tabix -p vcf var.vcf.bgz 5.2 Utilizando o samtools para detectar SNPs O samtools é uma ferramenta geral para a manipulação de arquivos BAM e já foi abordada na seção Ele também permite fazer análises simples de SNPs através do comando mpileup. Nessa seção vamos mostar como usar o samtools gerar um arquivo em formato BCF 3 e depois fazer a chamda de SNPs. Para mais detalhes sobre o formato pileup, veja o apêndice 7.2. Para gerar o arquivo BCF, usa-se 4 : samtools mpileup -d <max cov> -f <ref.fasta> -g <align.bam> > <out.bcf> Esse resultado não é uma lista de SNPs, mas sim um BCF intermediário que será utilizado para fazer a chamada. É possível visualizar esse arquivo com o seguinte comando: bcftool view <out.bcf> less A descrição dos campos do arquivo intermediário está no apêndice 7.3. Finalmente para aplicar o modelo estatístico e fazer a chamada de SNPs utilizamos o bcftools da seguinte maneira: bcftools view -D<cobertura> -c -v -b <out.bcf> > <var.raw.bcf> A opção -c pede para o bcftools fazer a chamada de SNPs, a opção -v pede para o programa gerar somente os sítios com variantes e a opção -b pede para gerar o resutado em formato BCF. Se você utilizar a opção -g em vez de -c também é gerada a informação de genótipos. O algoritmo do bcftools não é muito restritivo, por isso é recomendável filtrar a lista de SNPs. Junto com o samtools vem o script vcfutils.pl que tem uma opção varfilter para fazer isso: bcftools view -c -v <var.raw.bcf> vcfutils.pl varfilter > <vars.vcf> É possível mudar valores dos parâmetros de filtragem através dessas opções: Opção Descrição Default -Q minimum RMS mapping quality for SNPs 10 -d minimum read depth 2 -D maximum read depth a minimum number of alternate bases 2 -w SNP within INT bp around a gap to be filtered 3 -W window size for filtering adjacent gaps 10-1 min P-value for strand bias (given PV4) min P-value for baseq bias 1e min P-value for mapq bias 0-4 min P-value for end distance bias e min P-value for HWE (plus F<0) Gerando um arquivo consenso Muitas vezes deseja-se um arquivo fasta com o consenso das regiões cobertas, para isso é possível utilizar o vcfutils.pl da sequinte maneira: samtools mpileup -uf <ref.fa> <aln.bam> bcftools view -cg - vcfutils.pl vcf2fq > consensus.fastq O resultado é um arquivo fastq, para convertê-lo para fasta utiliza-se o comando seqtk 5 : seqtk fq2fa consensus.fastq > consensus.fasta 3 Binary VCF 4 Para gerar um arquivo BCF não comprimido, troca-se o -g por -u. 5 ver seção

49 5.3 Utilizando o GATK O GATK, Genome Analysis Toolkit é um software desenvolvido pelo Broad Institute para análise de dados de nova geração, com ênfase na análise de variantes e genotipagem. Ele está disponível em: O programa tem uma estrutura modular, sendo dividio em diversas análises, todas empacotadas junto com o framework em um arquivo jar. Para ter a lista de análises utiliza-se o comando: java -jar GenomeAnalysisTK.jar Para executar uma análise específica: java -jar GenomeAnalysisTK.jar -T <analysis> <args*> Na proxima seção vamos mostrar a utilização do GATK para fazer uma chamada de variantes em dataset de ampliseq Chamando Variantes no GATK Para demonstar a chamada de variantes com o GATK vamos utilizar um dataset do comprehensive cancer panel. As estapas da análise são as seguintes: 1. Fazer o download dos arquivos FLO-528.bam.gz e CCP.bed.gz em: Tendo os arquivos, é necessário decompactá-los e indexar o arquivo bam com os seguintes comandos: gunzip FLO-528.bam.gz gunzip CCP.bed.gz samtools index FLO-528.bam 2. Recriar o genoma de referência utilizado no mapeamento. A sequências dos cromossomos está disponível no UCSC: Porém, a sequência mitocondrial utilizada está no Genbank: É preciso baixá-la em formato fasta e salvar com o nome de chrm.fa. Depois, é preciso editar esse arquivo, mudando o header para: >chrm Em seguida, é preciso descompactar os cromossos e concatená-los junto com o genoma mitocondrial em um único arquivo: tar zxvf chromfa.tar.gz cat chr[1-9].fa chr[12][0-9].fa chrx.fa chry.fa chrm.fa > hg19.fasta Por fim, é preciso indexar o arquivo fasta utilizando o samtools: samtools faidx hg19.fasta E criar o dicionário de sequências do arquivo com o o Picard: java -jar CreateSequenceDictionary.jar R=hg19.fasta O=hg19.dict 49

50 3. Fazer a chamada de variantes: java -jar GenomeAnalysisTK.jar -T UnifiedGenotyper -I FLO-528.bam -R hg19.fasta -L CCP.bed -o SNP1.vcf O resultado é o arquivo SNP1.vcf, com a lista de SNP encontrados Anotando as variantes com o dbsnp Uma das primeiras análises a ser feite com uma lista de variantes é comparar elas com a base de SNPs comnhecidas do NCBI, o dnsnp. Para isso, é necessário baixar o arquivo vcf com o dbsnp: ftp://ftp.ncbi.nih.gov/snp/organisms/human_9606/vcf/00-all.vcf.gz A princípio, seria muito fácil utilizar esse arquivo para anotar o arquivo de variantes gerado pelo variant caller. O problema é a diferença nos nomes dos cromossomos, o dbsnp utiliza 1, 2, 3 etc nos nomes dos cromossomos e a referência que utilizamos para fazer a chamada utiliza o padrão da UCSC: chr1, chr2 etc. Para resolver essas discrepâncias podemos utilizar um script que mude os nomes dos cromossomos no dbsnp. O script está disponível no apêndice 7.4. Para fazer a conversão: gzcat 00-All.vcf.gz addchr.pl > dbsnp-chr.vcf O passo seguinte é indexar o arquivo vcf gerado. A melhor alternativa para isso é utilizar o igvtools: igvtools index dbsnp-chr.vcf Por fim faz-se a anotação: gatk -T VariantAnnotator -R hg19.fasta -D dbsnp-chr.vcf -V FLO-528.vcf -o FLO-528.ann.vcf O resultado vai ser um novo arquivo vcf chamado FLO-528.ann.vcf, com o rsid dos SNPs conhecidos no campo ID. 5.4 Utilizando Ion Varriant Caller É possível baixar o plugin Torrent Suite Variant Caller (TSVC) na Ion Community e utilizá-lo para fazer a chamada de variantes em um outro computador. A versão 2.2 do plugin está disponível em: Deve-se baixar o Offiline Installer, que nada mais é do que um arquivo zip chamado: variantcaller zip Descompacte esse arquivo no mesmo diretório dos dados 6 : unzip -x variantcaller zip Vai ser criado um diretório chamado variantcaller com o programa. chamada de variantes é o seguinte: O comando para fazer a mkdir FLO-528-tsvc ;./variantcaller/variantcaller.py -r./variantcaller/ -p./variantcaller/paramfiles/ampliseq.somatic.json -b CCP.bed FLO-528-tsvc hg19.fasta FLO-528.sorted.bam 6 É possível instalar em qualquer diretório que se queira, basta depois mudar a linha de comando para refletir essa mudança. 50

51 É necessário criar o diretório onde os resultados vão ser escritos, o programa não faz isso sozinho, por isso a primeira linha. É preciso também passar o diretório onde o TSVC está instalado com a opção -r. Em seguida, informa-se qual o arquivo com os parâmetros para a chamada de variantes, no caso escolhemos o arquivo ampliseq.somatic.json, o nome do arquivo é a combinação do tipo de biblioteca com o nível de estringência desejado, no caso uma biblioteca de ampliseq com a estringência para variantes somáticas, ou de baixa frequência. Os arquivos de parâmetros disponíveis estão na tabela 5.3. O parâmetro -p informa o arquivo.bed com as regiões que foram capturadas. Por fim, temos os seguintes argumentos: diretório de saída, genoma de referência e arquivo.bam. Os arquivos com os resultados vão ser: FLO-528-tsvc/SNP_variants.vcf: Somente os SNPs chamados. FLO-528-tsvc/indel_variants.vcf: Somente os indels chamados. FLO-528-tsvc/TSVC_variants.vcf: Ambos os arquivos combinados. Tipo de biblioteca ampliseq ampliseq targetseq targetseq fullgenome fullgenome Estringência Germ Line Somatic Germ Line Somatic Germ Line Somatic Tabela 5.3: Lista de parâmetros para Torrent Suite Variant Caller (TSVC) 5.5 Anotando os SNP s com o snpeff O snpeff é uma ferramenta muito útil para comparar um arquivo VCF com as anotações de um genoma. Ele está disponível em: Após baixá-lo o primeiro passo é baixar o arquivo binário com as anotações do genoma desejado. O arquivo snpeff.config contém a lista dos genomas disponíveis. Para baixar as anotações do hg19: java -jar snpeff.jar -c snpeff.config download hg19 Os arquivos vão ser gravados no diretório ~/snpeff/data/hg19. A localização desses dados pode ser mudada editando o arquivo de configuração snpeff.config. Para anotar um arquivo VCF utiliza-se: java -jar snpeff.jar eff -c snpeff.config hg19 SNP_variants.vcf > SNP_variants.snpeff.vcf O resultado vai ser um novo arquivo VCF com uma tag EFF no campo INFO, descrevendo o efeito do SNP. Essa tag contém uma lista de registros com a seguinte estrutura: Effect ( Effefct_Impact Codon_Change Amino_Acid_change Gene_Name Gene_BioType Coding Transcript Rank [ ERRORS WARNINGS ] ) Abaixo vemos um exemplo de um registro: NON_SYNONYMOUS_CODING(MODERATE MISSENSE Aag/Gag K1222E 2240 PDE4DIP CODING NM_ ) 51

52 Ele mostra um mutação não sinônimo no transcrito MN_ do gene K122E. A descrição de cada um dos campos é: 1. Effect: Efeito da variantes. A lista dos efeitos que o programa detecta está na tabela Effect impact: Impacto do efeito. Pode ter os seguintes valores: High, Moderate, Low, Modifier. 3. Functional class: Classe funcional: NONE, SILENT, MISSENSE, NONSENSE. 4. Codon_Change: Mudança de códon, no formato: codon original/novo codon. 5. Amino_Acid_change: Mudança de aminoácido, no formato: AA antigo posição novo AA (ex: E30K ) 6. Amino_Acid_length: Tamanho da proteína em aminoácidos (tamanho do transcrito dividido por 3). 7. Gene_name: Nome do gene. 8. Gene_bioType: biotype do gene, se disponível. Segue as convenções do ENSEMBL. Por exemplo: protein_coding. 9. Gene_Coding: Pode ser CODING ou NON_CODING. Caso o gene esteja marcado como codante de proteína ou não. 10. Trancript: ID do transcrito (usualmente ENSEMBL IDs) 11. Exon/Intron Rank: Posição do Exon ou do Intron (ex: 1 para o primeiro exon, 2 para o segundo etc) 12. Genotype: Número do genótipo desse efeito (ex: 2 se o efeito corresponde ao segundo ALT) 13. Warnings / Errors: Qualquer aviso ou erro (não é mostrado se estiver vazio). Efeito INTERGENIC UPSTREAM UTR_5_PRIME UTR_5_DELETED START_GAINED SPLICE_SITE_ACCEPTOR SPLICE_SITE_DONOR Descrição A variante está na região intergênica Região Upstream do gene (por default até 5k bases) Variante na região 5 UTR A variante deleta um exon que está na região 5 UTR. A variante na região 5 UTR produz um sequência de 3 bases que pode ser um START códon. A variante está em um splice acceptor site (definido como as duas bases antes do início do exon, exceto para o primeiro exon). A variante está em um Splice donor site (definido como as duas bases depois do exon, exceto para o último exon). START_LOST Variante converte um start codon em um non-start codon. Ex: atg/agg, M/R) SYNONYMOUS_START Variante converte um start codon em outro start codon. Ex: Ttg/Ctg, L/L (TTG and CTG can be START codons) CDS A variante está em um CDS. GENE A variante está em um gene. TRANSCRIPT A variante está em um transcrito. EXON A variante está em um exon. EXON_DELETED Uma deleção que remove um exon. NON_SYNONYMOUS_CODING A variante faz o códon gerar um amino ácido diferente. Ex: Tgg/Cgg, W/R SYNONYMOUS_CODING A variante mudao o códon, mas não o amino ácido. Ex: Ttg/Ctg, L/L FRAME_SHIFT Uma inserção ou deleção que gera um frame shift, por exemplo um indel que não seja múltiplo de 3. 52

53 CODON_CHANGE Um ou mais códons são modificados. Por exemplo, um MNP 7 de tamanho múltiplo de 3. CODON_INSERTION Um ou mais códons inseridos, por exemplo uma inserção múltipla de 3 na fronteira de um códon. CODON_CHANGE_PLUS_CODON_INSERTION Um códon foi modificado e um ou mais foram inseridos. Ex: uma inserção múltipla de 3, mas não na fronteira do códon. CODON_DELETION Um ou vários códons foram deletados. Ex: Uma deleção múltipla de três na fronteira do códon. CODON_CHANGE_PLUS_CODON_DELETION Um códon foi modificado e um ou mais foram deletados. Ex: Uma deleção múltipla de três, mas não na fronteira do códon. STOP_GAINED Variante gera um STOP codon. Ex: Cag/Tag, Q/* SYNONYMOUS_STOP Variante modifica um STOP codon em outro STOP codon. Ex: taa/tag, */* STOP_LOST Variante muta um STOP codon em um não STOP codon. Ex: Tga/Cga, */R INTRON A variante atinge um intron. Tecnicamente, ele não atinge um exon no transcrito. UTR_3_PRIME A variante atinge a região 3 UTR. UTR_3_DELETED A variante apaga um exon que está na região 3 UTR do transcrito. DOWNSTREAM Downstream do gene (por default até 5K bases). INTRON_CONSERVED A variante está em uma região intrônica altamente conservada. INTERGENIC_CONSERVED A variante está em uma região intergênica altamente conservada. INTRAGENIC A variante atinge um gene, mas nenhum transcrito nesse gene. RARE_AMINO_ACID A variante atinge um aminoácido raro, portanto tem grandes chances de produzir uma perda de função. NON_SYNONYMOUS_START Variante muta um start codon em outro start start codon (o novo códon produz um AA diferente). Ex: Atg/Ctg, M/L (ATG e CTG podem ser START codons) Tabela 5.4: Lista de efeitos preditos pelo snpeff 7 Multiple nucleotide polimorphism 53

54 54

55 Capítulo 6 Montagem denovo Nos capítulos anteriores foram discutidas técnicas de análise que envolvem o mapeamento das sequências obtidas em um genoma de referência, porém, quando não se tem o genoma de referência do organismo estudado é preciso gerar, ou montar, esse genoma de novo, ou seja, pela primeira vez. Ao contrário do mapeamento em que os algoritmos estão muito bem estabelecidos, a área de montagem de genomas é muito mais experimental e ainda um campo muito ativo de pesquisa[3, 30]. Neste capítulo vamos mostrar como usar o montador Mira[2] para montar genomas bacterianos com dados do Ion Torrent PGM. 6.1 Montando o genoma com o Mira O Mira está disponível no sourceforge. Atualmente existem duas versões disponíveis, a 3.4 estável e a 3.9 em desenvolvimento. Normalmente, é melhor utilizar sempre a versão estável, porém um dos focos da versão em desenvolvimento é o suporte ao ion torrent, motivo pelo qual vamos abordar as duas versões. Ambas as versões estão disponíveis em seus respectivos diretórios em: É possível baixar o código fonte e também versões precompiladas para Linux. Também é necessário baixar o programa sff_extract (ver 2.2.1). Para fazer a montagem, vamos utilizar o dataset disponível em: Nessa página, estão disponíveis os arquivos SFF de três corridas do PGM, uma de fragmentos e duas de mate-pair. Também está disponível o genoma de referência, para podermos comparar a montagem, e o arquivo com a sequência dos linkers, que precisamos para extrair os dados de mate-pair. Para a demonstração, baixe os seguintes arquivos: C11-127_40X.sff.zip Corrida de fragmentos (subsampled) FRA-257_40X.sff.zip Corrida de mate pair de 3.5kbp (subsampled) C28-140_40X.sff.zip Corrida de mate pair de 8.9kbp (subsampled) MG1655.fasta.gz Genoma de referência LMP_Linkers.fasta.gz Sequência dos linkers No caso, sugere-se utilizar as versões que foram subsampled para que a cobertura fosse somente 40 vezes o tamanho do genoma. Nota-se que utilizar uma coberutra muito alta geralmente piora a qualidade de montagem, pois os erros se acumulam e geram muitos pequenos contigs. A primera etapa é transformar o arquivo sff em fastq, mas para isso é preciso utilizar o programa sff_extract. Deve-se utilizar esse programa e não os outros citados na seção porque ele gera também um arquivo XML com as informações de clipagem das sequências. Um ponto muito importante é seguir a convenção de nomes do Mira, o arquivo de sequências tem que ter o seguinte nome: <proj>_in.<platform>.fastq Já o arquivo XML tem que ter este nome: <proj>_traceinfo_in.<platform>.xml 55

56 No caso do Ion Torrent <platform> tem que ser iontor e <proj> é o nome escolhido para o projeto. O comando para fazer a conversão tem a seguinte estrutura: sff_extract -s <proj>_in.iontor.fastq -x <proj>_traceinfo_in.iontor.xml <arquivo.sff*> A fórmula geral para executar o mira é a seguinte: mira --project=frag --job=denovo,genome,accurate,iontor Na opção --project utilizamos o mesmo nome dos arquivos, e com isso o Mira vai utilizar os arquivos corretos. Na opção --job descrevemos o job de montageme as opções são: denovo ou mapping, genome ou est, accurate ou draft e a lista de tecnologias à serem utilizadas. Além dessas, é possível adicionar uma série de outras opções que fazem o ajuste do algoritmo e do comportamento do programa, alguns exemplos são: -GE:not=x Ajusta o número de threads do programa para x. O Mira utiliza 2 threads por default. Aumentar esse valor agiliza o processo, mas somente em uma das -OUT:ora=1 etapas, o algoritmo SKIM. Pede para o Mira gerar um arquivo.ace como saída da montagem. Esse arquivo pode depois ser utilizado para visualizar a posição dos reads nos contigs. Os resultados vão estar em um diretório chamado <project>_assembly, e dentro deste vão estar os seguintes diretórios: <project>_d_info Diretório com informações sobre a montagem. Normalmente, o primeiro arquivo à se verificar após o término do programa é o <project>_info_assembly.txt, que contém as estatísticas mais relevantes sobre a montagem. <project>_d_results Diretório com os arquivos da montagem, contém os seguintes arquivos: <project>_out.unpadded.fasta (e.qual) Arquivo com os contigs montados e respectivo arquivo de qualidade. <project>_out.padded.fasta (e.qual) Versão do arquivo anterior com * adicionados em posições nas quais exista uma pequena evidência de bases adicionais. <project>_out.maf Montagem no formato nativo do Mira. <project>_out.caf Montagem no formato CAF, criado pelo Sanger 1. <project>_out.ace Arquivo.ace compatível com diversos visualizadores de montagem. Gerado pela opção -OUT:ora=1. Também pode ser gerado com o comando convert_project do próprio mira. <project>_d_chkpt Checkpoint do montador, pode ser apagado após o término da montagem. <project>_d_tmp Diretório com arquivos temporários, também pode ser apagado. Na proximas seções vamos detalhar como utilizar o Mira em diferentes situações Montando uma biblioteca de fragmentos utilizando o Mira 3.4 Vamos primeiro demonstrar como fazer a montagem utilizando somente um arquivo de fragmentos. Iniciando pela geração do arquivo fastq: sff_extract -s frag_in.iontor.fastq -x frag_traceinfo_in.iontor.xml C11-127_40X.sff 1 56

57 Note que o nome do projeto é frag. Em seguida, execute o Mira com o seguinte comando: mira --project=frag --job=denovo,genome,accurate,iontor -GE:not=4 -OUT:ora=1 IONTOR_SETTINGS -AS:mrpc=100 Em relação ao comando apresentado na seção anterior, adicionamos as opções específicas de cada plataforma, para isso colocamos IONTOR_SETTINGS seguido das opções para o Ion Torrent, no caso -AS:mrpc=100 que diz para filtrar todos os contigs com menos de 100 reads Montando uma biblioteca de mate-pair utilizando o Mira 3.4 tag 1 IA tag 2 Figura 6.1: Estrutura do read de mate-pair do Ion Torrent Na figura 6.1 vemos a estrutura do read gerado pela técnica de mate-pair no Ion Torrent. Pela construção temos a tag 1 seguida pelo adaptador interno (IA) e a tag 2. O sentido de leitura está indicado pela seta. Por conta dessa estrutura é preciso separar as tags utilizando a sequência do adaptador interno, o que é feito na conversão de sff para fastq. O sff_extract utiliza o mapeador SSAHA2 para mapear o IA e gerar as tags. Portanto, é preciso instalar o SSAHA2, que está disponivel em: É preciso colocar os programas SSAHA2 no path e em seguida utiliza-se o seguinte comando para gerar os arquivos: sff_extract -l LMP_Linkers.fasta -s lmp35_in.iontor.fastq -x lmp35_traceinfo_in.iontor.xml FRA-257_40X.sff A opção -l fornece um arquivo com a sequência do IA e do seu reverso complementar, no caso, para o Ion Torrent as sequências são: >IA CTGCTGTACCGTACATCCGCCTTGGCCGTACAGCAG >IA_revcom CTGCTGTACGGCCAAGGCGGATGTACGGTACAGCAG mira --project=frag --job=denovo,genome,accurate,iontor -GE:not=4 -OUT:ora=1 IONTOR_SETTINGS -AS:mrpc=100 -GE:tismin=3000 -GE:tismax= Fazendo uma montagem mista com o Mira 3.4 Agora vamos montar a biblioteca de fragmentos junto com as duas bibliotecas de mate-pair. Para isso vamos iniciar o processo extraindo os reads de fragmentos: sff_extract -s mix_in.iontor.fastq -x mix_traceinfo_in.iontor.xml C11-127_40X.sff 57

58 Em seguida, vamos extrair os dados de primeira biblioteca de mate-pair, devemos prestar muita atença à opção -a, que pede para que os novos reads extraídos sejam anexados ao arquivo criado na etapa anterior. sff_extract -a -l LMP_Linkers.fasta -s mix_in.iontor.fastq -x mix_traceinfo_in.iontor.xml -i "insert_size:3500,insert_stdev:500" FRA-257_40X.sff Outro ponto importante é a opção -i, que adiciona as informações do inserto ao arquivo XML, no caso nós adicionamos o tamanho do inserto e o desvio padrão deste, respectivamente, 3500 e 500 bp. Repetimos o mesmo processo com a segunda biblioteca de mate-pair, no caso alterando o tamanho do inserto para 8900 bp. sff_extract -a -l LMP_Linkers.fasta -s mix_in.iontor.fastq -x mix_traceinfo_in.iontor.xml -i "insert_size:8900,insert_stdev:500" C28-140_40X.sff Por fim, executamos a montagem com o mesmo comando do mira: mira --project=frag --job=denovo,genome,accurate,iontor -GE:not=4 -OUT:ora=1 IONTOR_SETTINGS -AS:mrpc=100 Note que não informamos o tamanho do inserto pois essa informação já está embutida no arquivo xml. O resultado de todas as configurações de montagem para o Mira 3.4 está na tabela 6.1. frag LMP 3.5 LMP 8.9 todos Contigs Grandes Número de contigs 76 1,617 2, Consenso 4,606,198 4,878,703 4,156,500 4,936,678 Cobertura (%): 98% 104% 89% 105% Maior Contig 358,908 7,696 26, ,460 N50 119,555 3,928 1, ,387 N90 41,691 1, ,608 N95 31,604 1, ,861 Todos Número de contigs 76 1,716 5,987 2,753 Consenso 4,606,198 4,915,162 5,133,612 6,509,621 Maior Contig 358,908 7,696 26, ,460 N50 119,555 3,923 1, ,091 N90 41,691 1, N95 31,604 1, Leituras Utilizadas 1,085,429 2,235,506 4,384,827 2,906,577 Tabela 6.1: Resultados das montagens do Mira Fazendo uma montagem mista com o Mira 3.9 Apesar de ainda estar em desenvolvimento, a versão do Mira 3.9 oferece um melhor suporte a dados do Ion Torrent além de um novo formato de arquivo de configuração para as corridas, que facilita muito a execução de corridas que combinam diferentes bibliotecas. 58

59 Para montar o dataset de fragmentos utiliza-se o seguinte arquivo, chamado frag.manifest. Exemplo: project = frag job = genome,denovo,accurate parameters = -GE:not=4 IONTOR_SETTINGS -AS:mrpc=100 readgroup = fragment technology = iontor data = frag_in.iontor.fastq frag_traceinfo_in.iontor.xml Note que os parâmetros estão definidos no topo do arquivo, mas o nome dos arquivos estão definidos na seção readgroup em vez de serem determinados pela convenção de nomes. Mantivemos os mesmos nomes de arquivos dos exemplos do mira 3.4, mas poderíamos tê-los chamado de qualquer outro nome que quiséssemos. Para executar a montagem digita-se o comando: mira frag.manifest O uso do arquivo de configuração se torna mais útil quando temos mais de um readgroup: project = mix job = genome,denovo,accurate parameters = -GE:not=4 IONTOR_SETTINGS -AS:mrpc=100 readgroup = frag data = C11-127_40X.fastq C11-127_40X.xml technology = iontor readgroup = lmp89 data = C28-140_40X.fastq C28-140_40X.xml technology = iontor templatesize = segmentplacement = ---> ---> readgroup = lmp35 data = FRA-257_40X.fastq FRA-257_40X.xml technology = iontor templatesize = segmentplacement = ---> ---> Note que definimos 3 readgroups, um para cada tipo de biblioteca. Definimos também o intevalo válido para o tamanho do inserto das bibliotecas de mate-pair, assim como a sua orientação. Veja que dessa vez utilizamos uma convenção de nomes completamente diferente, algo que não seria possível no mira 3.4. Na tabela 6.2 podemos ver os resultados da montagem de diferentes combinações de bibliotecas. Number of contigs: Total consensus: Largest contig: N50 contig size: N90 contig size: N95 contig size: Interpretando os resultados Na tabela 6.1 vemos os resultados da montagem para as diferentes bibliotecas e também a montagem mista que utiliza todas elas. As estatísticas estão divididas em duas seções: Contigs Grandes e Todos. A primeira mostra as estatísticas somente dos contigs com mais de 500 bp e que satisfazem certos critérios de cobertura, já a segunda seção mostra as estatísticas de todos os contigs gerados, independentemente do tamanho e da cobertura 2. Para avaliar a montagem podemos começar olhando para o Total Consensus, para verificar se o valor está de acordo com o tamanho esperado do genoma. Em seguida, verifica-se o 2 Com exceção dos contigs filtrados pelos critérios estabelecidos no momento da montagem 59

60 frag lmp35 lmp35 + frag lmp89 lmp89 + frag Contigs Grandes Número de Contigs Consenso 4,633,751 4,573,815 4,632,400 4,562, ,730 Cobertura (%) 99,9% 98,6% 99,8% 98,3% 99,8% Maior contig 231, , ,852 99, ,324 N50 93,793 40, ,781 30, ,223 N90 35,799 11,397 46,501 5,929 55,558 N95 26,409 7,035 36,041 3,710 45,094 Todos Número de Contigs Consenso 4,633,751 4,585,603 4,770,620 4,586,296 4,714,793 Cobertura (%) 99,9% 98,8% 102,8% 98,8% 101,6% Maior Contig 231, , ,852 99, ,324 N50 93,793 40, ,289 30, ,146 N90 35,799 11,378 40,957 5,811 51,490 N95 26,409 6,703 32,292 3,502 41,464 Leituras utilizadas 1,022,516 2,302,069 3,246,379 2,319,887 3,300,475 Tabela 6.2: Resultados da montagem do Mira 3.9 número total de contigs. Quanto maior esse número, mais fragmentada está a montagem e mais gaps ela apresenta. Outra estatística muito importante são os Nxx: N50, N90 etc. O N50 representa o tamanho do contig tal qual 50% do Total Consensus está representado por contigs iguais ou de mesmo tamanho. De maneira similar se define o N90, o N95 ou qualquer outro que se queira. Na figura 6.2 vemos o gráfico da soma dos tamanhos dos contigs: do maior para o menor, estão indicados os pontos em que a soma do tamanho representa 50%, 90% e 95% da soma total, e os respectivos valores de N50, N90 e N95. O N50 é normalmente reportado nas publicações que tratam de montagem de genomas porque ele é um compromisso entre a capacidade do montador de gerar grandes contigs mas também em não fragmentar muito o genoma. Analisando os dados da tabela 6.2, vemos que a combinação de uma biblioteca de mate-pair com uma de fragmentos gera contigs maiores (o N50 aumenta aproximadamente 5 ), e um número menor de contigs grandes. Por outro lado, se olharmos para os dotplots gerados para todos esses datasets (6.3), vemos que o número de contigs que se alinham fora da diagonal aumenta, o que indica um maior número de misassemblies Comparando a montagem com uma referência Quando se faz a montagem de um genoma conhecido, é possível avaliar a qualidade de montagem alinhando os contigs contra esse genoma. Uma ferramenta para fazer isso é o MUMmer, disponível em: Utiliza-se para fazer o alinhamento o comando nucmer, que é um alinhador muito rápido para um pequeno conjunto de sequências: nucmer -maxmatch -c 100 -p <name> ref.fasta conrigs.fasta Esse comando vai gerar um arquivo chamado <name>.delta que contém todos, alinhamentos entre os contigs e a referência codificados em um formato compacto, propício para o processamento por software. Ou seja, não é um formato para ser visualizado diretamente por pessoas. As opção -maxmatch pede para o programa tentar todas as ancôras de alinhamento, mesmo se elas não forem únicas, e a opção -c 100 pede para remover alinhamentos muito curtos, com menos de 100bps. Em seguida, utiliza-se o comando delta-filter para filtrar os alinhamentos e tornar a visualização mais simples: delta-filter -r <name>.delta > <name>.delta.r 60

61 Cumulative Length (%) N50=119,186 bp Assembly Statistics N95=30,290 bp N90=36,060 bp Contig Number 4,750,000 4,500,000 4,250,000 4,000,000 3,750,000 3,500,000 3,250,000 3,000,000 2,750,000 2,500,000 2,250,000 2,000,000 1,750,000 1,500,000 1,250,000 1,000, , , ,000 0 Cumulative Length Figura 6.2: Gráfico da soma do tamanho dos contigs para o dataset de fragmentos. A opção -r diz para o programa escolher o melhor alinhamento em relação à referência. É possível também filtrar pelo tamanho do alinhamento, com a opção -l. Por exemplo, -l 1000 vai mostrar somente os alinhamentos 1kbp ou mais. Por fim utilize o comando mummerplot para gerar o gráfico de comparação dos contigs contra a referência: mummerplot -large -layout -p <name> <name>.delta.r O mummerplot utiliza o gnuplot para gerar os gráficos, por isso é necessário que esse programa esteja instalado. Também é possível gerar um arquivo de imagem com a opção --png ou um Postscript com --ps. Podemos ver o resultado do mmumerplot na figura Visualizando a montagem no Tablet É possível visualizar a montagem dos contigs, ou seja, a posição de cada read nos contigs, utilizando o programa Tablet[22], que está disponível em: Esse programa possui instalador gráfico e suporta alguns formatos de alinhamento, entre eles o formato ACE que pode ser gerado pelo Mira com a opção -OUT:ora=1. Caso o Mira não tenha rodado com essa opção, é fácil converter o arquivo.maf em.ace com o comando: convert_project -f maf -t ace <input>.maf <output> Tendo o arquivo.ace basta clicar em Open Assembly e escolhê-lo na janela de diálogo. No painel da esquerda está a lista de contigs. Quando se clica em um deles o painel central mostra os alinhamentos (ver figura 6.5). 61

62 + Frag Frag 3.5 kbp 8.9 kbp Figura 6.3: Dotplot de todas as bibliotecas montadas com o mira 3.9. Na primeira coluna vemos o dotplot das bibliotecas de fragmentos, LMP 3.5kbp e LMP 8.9 kbp, e na segunda coluna vemos a combinação desses bibliotecas junto com a de fragmentos. 62

63 Figura 6.4: Dotplot da montagem do dataset de fragmentos deita pelo mummerplot. Figura 6.5: Visualizador de montagem Tablet 63

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Novas Tecnologias de Sequenciamento

Novas Tecnologias de Sequenciamento Novas Tecnologias de Sequenciamento Tecnologias de sequenciamento Sanger (Capilaridade) Uma das inovações tecnológicas de maior influência na pesquisa biológica, desde que foi lançada em 1977 Abordagem

Leia mais

The next generation sequencing

The next generation sequencing The next generation sequencing Cesar Martins (cmartins@ibb.unesp.br) Departamento de Morfologia Instituto de Biociências, UNESP Universidade Estadual Paulista Botucatu, SP 1 Métodos Atuais Sequenciamento

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14

Sequenciamento de genomas procariotos utilizando tecnologia de nova geração. Introdução ao sequenciamento de nova geração 4/11/14 4/11/14 Aula 2 Sequenciamento de genomas procariotos utilizando tecnologia de nova geração Introdução ao sequenciamento de nova geração Ana Marcia de Sá Guimarães, Méd Vet, MSc, PhD Aula 2 Tópicos 1. Sequenciamento

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br

ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Universidade Tiradentes Mestrado em Biotecnologia Industrial Seqüenciamento de DNA ls_pinto@hotmail.com Sibele Borsuk sibele@ufpel.tche.br Sequenciamento de DNA em MegaBACE DNA Analysis Systems TGTGAACACACGTGTGGATTGG...

Leia mais

Centro de Computação - Unicamp Gerência de Atendimento ao Cliente (e-mail:apoio@turing.unicamp.br) Sumário

Centro de Computação - Unicamp Gerência de Atendimento ao Cliente (e-mail:apoio@turing.unicamp.br) Sumário Sumário Conceitos Microsoft Access 97... 01 Inicialização do Access... 02 Convertendo um Banco de Dados... 03 Criando uma Tabela... 06 Estrutura da Tabela... 07 Propriedades do Campo... 08 Chave Primária...

Leia mais

INF 1771 Inteligência Artificial

INF 1771 Inteligência Artificial Edirlei Soares de Lima INF 1771 Inteligência Artificial Aula 04 Algoritmos Genéticos Introdução Algoritmos genéticos são bons para abordar espaços de buscas muito grandes e navegálos

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!!

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!! Miguel Rocha Dep. Informática - Universidade do Minho BIOINFORMÁTICA: passado, presente e futuro!! Bragança, 11 de Maio de 2006 Porquê a Bioinformática?! Novas tecnologias experimentais da Biologia Molecular

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Genômica. O que chamou mais atenção no filme?

Genômica. O que chamou mais atenção no filme? Genômica O que chamou mais atenção no filme? Tempo para sequenciamento do genoma Predição do fenótipo com base no genótipo Como este conhecimento pode ser usado para gerar novas tecnologias? Sequenciamento

Leia mais

CONHECIMENTOS ESPECÍFICOS

CONHECIMENTOS ESPECÍFICOS Acerca da bioinformática em geral, julgue os itens subsequentes. 41 A bioinformática pode ser definida como uma área multidisciplinar que envolve principalmente a Biologia, a Ciência da Computação, a Matemática

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

4 Conversor EDTV Raw. 4.1 Arquitetura

4 Conversor EDTV Raw. 4.1 Arquitetura 4 Conversor EDTV Raw O conversor EDTV Raw é o programa que lê um documento escrito no perfil NCL EDTV e gera um documento Raw equivalente, i.e. que define a mesma apresentação. Este capítulo, apresenta

Leia mais

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Bioinformática Histórico e conceitos básicos

Bioinformática Histórico e conceitos básicos Bioinformática Histórico e conceitos básicos Raimundo Lima da S. Júnior M.Sc. Departamento de Biologia Núcleo de Pesquisas Replicon PUC-GO Silva Jr., RL Casamento entre a ciência da computação e a biologia

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal

Uso do calcário no solo Desenvolvimento de pesticidas e fertilizantes. Máquinas a vapor substituindo a força animal Fepagro em foco Samuel Mazzinghy Alvarenga Histórico recente da Agropecuária Era científica: a partir de ~ 1.700 Rotação de culturas e métodos de cultivo intensivo Drenagem Utilização de arado, máquinas

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 4 - Recursos Computacionais: Programas e Sites Relacionados

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Biologia Avançada Jatropha curcas L.

Biologia Avançada Jatropha curcas L. 1 Pesquisadores: Hugo Bruno C. Molinari Betania F. Quirino Biologia Avançada Jatropha curcas L. Maior banco de informações moleculares em todo o mundo Gerar ferramentas para subsidiar programa de Melhoramento

Leia mais

CAPÍTULO 7 NÍVEL DE LINGUAGEM DE MONTAGEM

CAPÍTULO 7 NÍVEL DE LINGUAGEM DE MONTAGEM CAPÍTULO 7 NÍVEL DE LINGUAGEM DE MONTAGEM 71 Introdução Difere dos níveis inferiores por ser implementado por tradução A tradução é usada quando um processador está disponível para uma mensagem fonte mas

Leia mais

Notas da Aula 15 - Fundamentos de Sistemas Operacionais

Notas da Aula 15 - Fundamentos de Sistemas Operacionais Notas da Aula 15 - Fundamentos de Sistemas Operacionais 1. Software de Entrada e Saída: Visão Geral Uma das tarefas do Sistema Operacional é simplificar o acesso aos dispositivos de hardware pelos processos

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

Especificação do Trabalho Prático

Especificação do Trabalho Prático Especificação do Trabalho Prático O trabalho prático da disciplina consiste em desenvolver um programa utilizando a linguagem de programação C. A seguir, encontram-se a descrição do problema, a forma de

Leia mais

UNIVERSIDADE FEDERAL DE SANTA CATARINA EEL5105 Circuitos e Técnicas Digitais Prof. Eduardo L. O. Batista

UNIVERSIDADE FEDERAL DE SANTA CATARINA EEL5105 Circuitos e Técnicas Digitais Prof. Eduardo L. O. Batista UNIVERSIDADE FEDERAL DE SANTA CATARINA EEL5105 Circuitos e Técnicas Digitais Prof. Eduardo L. O. Batista EXPERIMENTO 1 INTRODUÇÃO AO LABORATÓRIO A. Introdução O Quartus II é um software utilizado para

Leia mais

Vamos iniciar a nossa exploração do HTTP baixando um arquivo em HTML simples - bastante pequeno, que não contém objetos incluídos.

Vamos iniciar a nossa exploração do HTTP baixando um arquivo em HTML simples - bastante pequeno, que não contém objetos incluídos. Wireshark Lab: HTTP Versão 1.1 2005 KUROSE, J.F & ROSS, K. W. Todos os direitos reservados 2008 BATISTA, O. M. N. Tradução e adaptação para Wireshark. Tendo molhado os nossos pés com o Wireshark no laboratório

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Área de Administração

Área de Administração Área de Administração versão 1.1 Partir de 2012/01/14 aplica-se para a versão phpcontact 1.2.x www.phpcontact.net Geral A área de administração é utilizado para uma fácil configuração do software elaboraçao

Leia mais

Programação I. Departamento de Engenharia Rural Centro de Ciências Agrárias

Programação I. Departamento de Engenharia Rural Centro de Ciências Agrárias Departamento de Engenharia Rural Centro de Ciências Agrárias Programação I Prof. Bruno Vilela Oliveira bruno@cca.ufes.br http://www.brunovilela.webnode.com.br Programas e Linguagens Para executar uma tarefa

Leia mais

INDICE 3.APLICAÇÕES QUE PODEM SER DESENVOLVIDAS COM O USO DO SAXES

INDICE 3.APLICAÇÕES QUE PODEM SER DESENVOLVIDAS COM O USO DO SAXES w w w. i d e a l o g i c. c o m. b r INDICE 1.APRESENTAÇÃO 2.ESPECIFICAÇÃO DOS RECURSOS DO SOFTWARE SAXES 2.1. Funcionalidades comuns a outras ferramentas similares 2.2. Funcionalidades próprias do software

Leia mais

Tutorial: Abrindo Vídeos e Medindo Comprimentos no ImageJ

Tutorial: Abrindo Vídeos e Medindo Comprimentos no ImageJ 1 1. Introdução Tutorial: Abrindo Vídeos e Medindo Comprimentos no ImageJ O ImageJ é um software livre (freeware) que pode ser obtido gratuitamente no site http://rsb.info.nih.gov/ij/. Esse software é

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

DIFERENCIAÇÃO. João Bosco M. Sobral

DIFERENCIAÇÃO. João Bosco M. Sobral DIFERENCIAÇÃO É a comparação de um programa, biblioteca ou outro arquivo, antes e depois de uma ação. Usada com frequência durante a pesquisa de segurança. Pode ser feita em níveis de disco, arquivo e

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Hereditariedade. Leis da hereditariedade GENÉTICA

Hereditariedade. Leis da hereditariedade GENÉTICA Hereditariedade Definição: É a transferência de informações sobre as características próprias de um ser vivo para outro, de geração para geração, por meio dos gametas ou por transferência direta deácidos

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Fundamentos em Informática (Sistemas de Numeração e Representação de Dados)

Fundamentos em Informática (Sistemas de Numeração e Representação de Dados) 1 UNIVERSIDADE DO CONTESTADO / UnC CAMPUS CONCÓRDIA/SC CURSO DE SISTEMAS DE INFORMAÇÃO Fundamentos em Informática (Sistemas de Numeração e Representação de Dados) (Apostila da disciplina elaborada pelo

Leia mais

Lógica de Programação

Lógica de Programação Lógica de Programação Unidade 4 Ambiente de desenvolvimento Java QI ESCOLAS E FACULDADES Curso Técnico em Informática SUMÁRIO A LINGUAGEM JAVA... 3 JVM, JRE, JDK... 3 BYTECODE... 3 PREPARANDO O AMBIENTE

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Instituto de Tecnologia de Massachusetts Departamento de Engenharia Elétrica e Ciência da Computação. Tarefa 6 Modelamento da Línguagem

Instituto de Tecnologia de Massachusetts Departamento de Engenharia Elétrica e Ciência da Computação. Tarefa 6 Modelamento da Línguagem Instituto de Tecnologia de Massachusetts Departamento de Engenharia Elétrica e Ciência da Computação 6.345 Reconhecimento Automático da Voz Primavera, 2003 Publicado: 14/03/03 Devolução: 02/04/03 Tarefa

Leia mais

Capítulo III Circuitos Digitais Combinacionais

Capítulo III Circuitos Digitais Combinacionais Capítulo III Circuitos Digitais Combinacionais 1 Introdução Vimos no Capítulo II que uma desejada função lógica pode ser implementada mediante a combinação de portas lógicas. Esta combinação de portas

Leia mais

Documento de Instalação e Configuração do InfoGrid

Documento de Instalação e Configuração do InfoGrid Documento de Instalação e Configuração do InfoGrid Tecgraf/PUC Rio infogrid@tecgraf.puc rio.br 1.Introdução O objetivo deste documento é podermos registrar em um único local todas as informações necessárias

Leia mais

Nota de aplicação: Desenvolvimento de Páginas no PO9900 - WebGate

Nota de aplicação: Desenvolvimento de Páginas no PO9900 - WebGate Nota de aplicação NAP080 Desenvolvimento de Páginas no PO9900 - WebGate Altus Sistemas de Informática S.A. Página: 1 Sumário 1. Introdução...3 1.1 Páginas do WebGate... 3 2. Árvore de Navegação...3 3.

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

7.012 Conjunto de Problemas 5

7.012 Conjunto de Problemas 5 Nome Seção 7.012 Conjunto de Problemas 5 Pergunta 1 Enquanto estudava um problema de infertilidade, você tentou isolar um gene hipotético de coelho que seria responsável pela prolífica reprodução desses

Leia mais

3 ALGORITMOS GENÉTICOS : CONCEITOS BÁSICOS E EXTENSÕES VINCULADAS AO PROBLEMA DE MINIMIZAÇÃO DE PERDAS

3 ALGORITMOS GENÉTICOS : CONCEITOS BÁSICOS E EXTENSÕES VINCULADAS AO PROBLEMA DE MINIMIZAÇÃO DE PERDAS 3 ALGORITMOS GENÉTICOS : CONCEITOS BÁSICOS E EXTENSÕES VINCULADAS AO PROBLEMA DE MINIMIZAÇÃO DE PERDAS 3.1 - Conceitos Básicos Entendemos como algoritmo um conjunto predeterminado e bem definido de regras

Leia mais

Faculdades Senac Pelotas

Faculdades Senac Pelotas Faculdades Senac Pelotas Curso Superior de Tecnologia em Redes de Computadores Introdução a informática Alunos Daniel Ferreira, Ícaro T. Vieira, Licurgo Nunes Atividade 4 Tipos de Arquivos Sumário 1 Tipos

Leia mais

DNA: Passado, Presente e Futuro

DNA: Passado, Presente e Futuro DNA: Passado, Presente e Futuro O passado O modelo do DNA que hoje nos é tão familiar foi divulgado em abril de 1953 na revista científica Nature pelos cientistas James Watson e Francis Crick. Eles afirmaram

Leia mais

Aula 04. Código BCD, Códigos Alfa-numéricos e Sistemas de Detecção de Erros

Aula 04. Código BCD, Códigos Alfa-numéricos e Sistemas de Detecção de Erros Aula 04 Código BCD, Códigos Alfa-numéricos e Sistemas de Detecção de Erros Prof. Otávio Gomes otavio.gomes@ifmg.edu.br sites.google.com/a/ifmg.edu.br/otavio-gomes/ 1 Bytes A maioria dos microcomputadores

Leia mais

Seqüenciamento (continuação )

Seqüenciamento (continuação ) Seqüenciamento (continuação ) Embrapa Recursos Genéticos e Biotecnologia Novas metodologias promissoras (2001) Seqüenciamento por hibridização Khrapko et al. (1989). FEBS Lett. 256: 118-122 http://dx.doi.org/10.1016/0014-5793(89)81730-2

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Introdução à Programação de Computadores

Introdução à Programação de Computadores 1. Objetivos Introdução à Programação de Computadores Nesta seção, vamos discutir os componentes básicos de um computador, tanto em relação a hardware como a software. Também veremos uma pequena introdução

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Complemento II Noções Introdutória em Redes Neurais

Complemento II Noções Introdutória em Redes Neurais Complemento II Noções Introdutória em Redes Neurais Esse documento é parte integrante do material fornecido pela WEB para a 2ª edição do livro Data Mining: Conceitos, técnicas, algoritmos, orientações

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

Sistema de Numeração e Conversão entre Sistemas. Prof. Rômulo Calado Pantaleão Camara. Carga Horária: 60h

Sistema de Numeração e Conversão entre Sistemas. Prof. Rômulo Calado Pantaleão Camara. Carga Horária: 60h Sistema de Numeração e Conversão entre Sistemas. Prof. Rômulo Calado Pantaleão Camara Carga Horária: 60h Representação da Informação Um dispositivo eletrônico, armazena e movimenta as informações internamente

Leia mais

Marco André Ferreira Reis Desenvolvimento de um sistema integrado para o tratamento de dados de sequenciação de próxima geração

Marco André Ferreira Reis Desenvolvimento de um sistema integrado para o tratamento de dados de sequenciação de próxima geração Universidade do Minho Escola de Engenharia Marco André Ferreira Reis Desenvolvimento de um sistema integrado para o tratamento de dados de sequenciação de próxima geração Outubro de 2013 Universidade do

Leia mais

STATGEN Plataforma web para análise de dados genéticos.

STATGEN Plataforma web para análise de dados genéticos. STATGEN Plataforma web para análise de dados genéticos. Diogo Gonçalves Neder 1 1 Introdução O melhoramento de plantas visa principalmente identificar combinações genotípicas com performance superior quando

Leia mais

Excel 2010 Modulo II

Excel 2010 Modulo II Excel 2010 Modulo II Sumário Nomeando intervalos de células... 1 Classificação e filtro de dados... 3 Subtotais... 6 Validação e auditoria de dados... 8 Validação e auditoria de dados... 9 Cenários...

Leia mais

Introdução ao Scilab

Introdução ao Scilab Programação de Computadores 1 Capítulo 1 Introdução ao Scilab José Romildo Malaquias Departamento de Computação Universidade Federal de Ouro Preto 2014.2 1/35 1 MATLAB e Scilab 2 O ambiente Scilab 2/35

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Prof. Msc. Paulo Muniz de Ávila

Prof. Msc. Paulo Muniz de Ávila Prof. Msc. Paulo Muniz de Ávila O que é Data Mining? Mineração de dados (descoberta de conhecimento em bases de dados): Extração de informação interessante (não-trivial, implícita, previamente desconhecida

Leia mais

Energia conservada em uma mola. Introdução. Materiais Necessários

Energia conservada em uma mola. Introdução. Materiais Necessários Intro 01 Introdução A energia é algo intangível e, portanto, as medidas de energia envolvem, necessariamente, processos de medidas indiretas. Em outras palavras, para medir energia, medimos outras grandezas

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Disparando o interpretador

Disparando o interpretador Capítulo 2: Usando o interpretador Python Disparando o interpretador O interpretador é frequentemente instalado como /usr/local/bin/python nas máquinas onde está disponível; adicionando /usr/local/bin

Leia mais

Anotação de Genomas. Fabiana G. S. Pinto

Anotação de Genomas. Fabiana G. S. Pinto Anotação de Genomas Fabiana G. S. Pinto Obtenção de Seqüências geradas pelo MegaBace 1000 Dados brutos (medidas analógicas) de saída do seqüênciamento Base calling BIOINFORMÁTICA * PHRED: - Transforma

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

PARANÁ GOVERNO DO ESTADO

PARANÁ GOVERNO DO ESTADO PARANÁ GOVERNO DO ESTADO COLÉGIO ESTADUAL DE PARANAVAÍ ENSINO FUNDAMENTAL, MÉDIO, NORMAL E PROFISSIONAL CURSO TÉCNICO EM INFORMÁTICA DISCIPLINA: INTERNET E PROGRAMAÇÃO WEB 1º MÓDULO SUBSEQUENTE MECANISMOS

Leia mais

Extensão ez Open Document Format (ezodf) Documentação. versão 2.0. experts em Gestão de Conteúdo

Extensão ez Open Document Format (ezodf) Documentação. versão 2.0. experts em Gestão de Conteúdo Extensão ez Open Document Format (ezodf) Documentação versão 2.0 Conteúdo 1. Introdução... 3 2 1.1 Público alvo... 3 1.2 Convenções... 3 1.3 Mais recursos... 3 1.4 Entrando em contato com a ez... 4 1.5

Leia mais

MANUAL DO ADMINISTRADOR DO MÓDULO

MANUAL DO ADMINISTRADOR DO MÓDULO MANUAL DO ADMINISTRADOR DO MÓDULO ÍNDICE Relatórios Dinâmicos... 3 Requisitos de Sistema... 4 Estrutura de Dados... 5 Operadores... 6 Tabelas... 7 Tabelas x Campos... 9 Temas... 13 Hierarquia Relacionamento...

Leia mais

1. CAPÍTULO COMPUTADORES

1. CAPÍTULO COMPUTADORES 1. CAPÍTULO COMPUTADORES 1.1. Computadores Denomina-se computador uma máquina capaz de executar variados tipos de tratamento automático de informações ou processamento de dados. Os primeiros eram capazes

Leia mais

1 - Processamento de dados

1 - Processamento de dados Conceitos básicos sobre organização de computadores 2 1 - Processamento de dados O que é processamento? O que é dado? Dado é informação? Processamento é a manipulação das informações coletadas (dados).

Leia mais

Fabio Bento fbento@ifes.edu.br

Fabio Bento fbento@ifes.edu.br Fabio Bento fbento@ifes.edu.br Eletrônica Digital Sistemas de Numeração e Códigos 1. Conversões de Binário para Decimal 2. Conversões de Decimal para Binário 3. Sistema de Numeração Hexadecimal 4. Código

Leia mais

Material desenvolvido por Melissa Lima da Fonseca. melissa.mlf@gmail.com.br - (031) 9401-4041. www.melissalima.com.br Página 1

Material desenvolvido por Melissa Lima da Fonseca. melissa.mlf@gmail.com.br - (031) 9401-4041. www.melissalima.com.br Página 1 EXCEL BÁSICO Material desenvolvido por Melissa Lima da Fonseca melissa.mlf@gmail.com.br - (031) 9401-4041 www.melissalima.com.br Página 1 Índice Introdução ao Excel... 3 Conceitos Básicos do Excel... 6

Leia mais

Grupo Tchê Química Análise de Moléculas de DNA

Grupo Tchê Química Análise de Moléculas de DNA Grupo Tchê Química Análise de Moléculas de DNA EDUARDO GOLDANI, ROCHELE FERNANDES ÍNDICE Introdução 03 Fundamentação teórica 05 Como as moléculas de DNA são analisadas 08 Fotos de eletroforese em gel 12

Leia mais

Gerenciamento de configuração. Gerenciamento de Configuração. Gerenciamento de configuração. Gerenciamento de configuração. Famílias de sistemas

Gerenciamento de configuração. Gerenciamento de Configuração. Gerenciamento de configuração. Gerenciamento de configuração. Famílias de sistemas Gerenciamento de Gerenciamento de Configuração Novas versões de sistemas de software são criadas quando eles: Mudam para máquinas/os diferentes; Oferecem funcionalidade diferente; São configurados para

Leia mais

Curso: Técnico de Informática Disciplina: Redes de Computadores. 1- Apresentação Binária

Curso: Técnico de Informática Disciplina: Redes de Computadores. 1- Apresentação Binária 1- Apresentação Binária Os computadores funcionam e armazenam dados mediante a utilização de chaves eletrônicas que são LIGADAS ou DESLIGADAS. Os computadores só entendem e utilizam dados existentes neste

Leia mais

COMPILADORES E INTERPRETADORES

COMPILADORES E INTERPRETADORES Aula 16 Arquitetura de Computadores 12/11/2007 Universidade do Contestado UnC/Mafra Curso Sistemas de Informação Prof. Carlos Guerber COMPILADORES E INTERPRETADORES Um compilador transforma o código fonte

Leia mais