Mensal. Saúde. Nacional TENHO O COLESTEROL ALTO OS MEUS FILHOS VÃO HERDÁ LO

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "Mensal. Saúde. Nacional TENHO O COLESTEROL ALTO OS MEUS FILHOS VÃO HERDÁ LO"

Transcrição

1 TENHO O COLESTEROL ALTO OS MEUS FILHOS VÃO HERDÁ LO A hipercolesterolemia familiar é uma doença genética que se manifesta desde a nascença e que está associada a um maior risco cardiovascular Em Portugal ainda não há números concretos mas estima se que 20 mil pessoas sofram desta doença sendo que a maioria não sabe que a tem e que possui 50 por cento de probabilidades de a transmitir à sua descendência Mas nem tudo está perdido Mesmo que esse seja o seu caso pode minorar o seu efeito POR Rita Caetano

2

3 ENFARTE ACIDENTE VASCULAR CEREBRAL AVC EOUTROS PROBLEMAS CARDÍACOS INESPERADOS AOS 30 ANOS crianças cujas análises do colesterol dão valores acima de 300 Erros nas análises Azar Uma em cada 500 pessoas herdou dos seus progenitores a hipercolesterolemia sem que para isso tenha cometido excessos alimentares Trata se na maioria dos casos de uma mutação no gene que codifica a proteína que regula o colesterol e quem tem esta mutação pode transmiti la a metade da sua descendência Quando esta doença não é diagnosticada a tempo a esperança de vida reduz se entre 20 a 30 anos segundo os especialistas A patologia avança de torma silenciosa com o aumento das concentrações plamásticas de colesterol que dão origem à aterosdorose prematura e consequente doença cardiovascular Estivemos à conversa com Mafalda Bourbon investigadora do Instituto de Dr Ricardo Jorge e responsável pelo único estudoa doença em Portugal para saber mais sobre esta patologia que ainda está sub diagnosticada no nosso país DIAGNÓSTICO PRECOCE É ESSENCIAL Durante muito tempo sem as ferramentas de diagnóstico exactas nenhum médico podia afirmar que o colesterol alto poderia derivar de um problema genético Hoje sabemos que isso é possível «A hipercolesterolemia familiar pode ser herdada do pai ouda mãe ou de ambos e manifesta se por valores de colesterol acima dos 290 mg dl no sangue desde o nascimento quando o valor máximo recomendado pela Sociedade Europeia de Cardiologia é de mg dl diagnóstico confirma se quando na família há mais casos de colesterol elevado e de doença cardiovascular prematura» explica Mafalda Bourbon «Para identificarmos correctamente a doença temos de fazer um estudo familiar para procurarmos a mutação genética e ter a certeza 190 sobre que esta e patogénica e que e a causa dos tais valores elevados de colesterol» acrescenta A maioria das pessoas com hipercolesterolemia familiar não estão tratadas nem sequer diagnosticadas e o diagnóstico precoce é fundamental para por em marcha medidas de tratamento e controlo e assim prevenir o aparecimento prematuro da doença cardiovascular «O risco de ter problemas cardiovasculares é muito maior nos doentes com colesterol genético do que naqueles que têm colesterol elevado a partir de uma determinada idade pois quando se descobre aos 30 anos que se tem hipercolesterolemia familiar significa quejá se está a acumular colesterol nas artérias 30 Este anos ou seja desde que nasceu» exemplifica Matalda Bourbon DOENÇA SILENCIOSA O grande problema coloca se no tacto desta ser uma doença silenciosa ou seja quando as queixas surgem já são na forma de uma doença cardiovascular que pode ser fatal «Daí que seja muito importante que os médicos estejam atentos a esta possibilidade e que o diagnóstico seja realizado precocemente para que o aconselhamento sobre mudança de estilos de vida e o tratamento se am iniciados cada

4 vez mais cedo» realça a investigadora do ÍNSA «E já se nota uma preocupação dos pediatras em identificar as crianças que podem estar neste grupo» continua Para a investigadora seguir a terapêutica associada a um estilo de vida saudável regradamente para o resto da vida é essencial para que estes doentes possam reduzir o risco cardiovascular «Quando não é tratada a hipercolesterolemia familiar reduz a esperança média de vida Está provado que um doente não tratado entre os 20 e os 40 anos tem um risco 100 vezes superior de ter uma doença cardiovascular prematura» sublinha Mafalda Bourbon Mas a boa notícia é que vários estudos demonstram que quando se consegue manter o colesterol abaixo dos 190 mg dl o risco de ter uma doença cardiovascular de um doente com bipercolesterolemia familiar 6 igual ao de uma pessoa que não padeça da doença «Esta é uma das poucas doenças genéticas que pode ser perfeitamente controlável e que nessa condição permite à pessoa ter uma esperança e qualidade de vida exactamente igual à de quem é saudável» afirma a investigadora COMO ACTUA NO NOSSO ORGANISMO Mas porque é que esta doença surge Explicado de uma forma simples a hipercolesterolemia familiar é causada por um defeito genético no gene receptor das LDL no cromossoma 19 que faz com que o corpo seja incapaz de eliminar o chamado mau colesterol LDL da corrente

5 são sanguínea Isto provoca níveis de LDL permanentemente elevados no sangue elevando a probabilidade de aterosclerose numa idade jovem Em termos mais técnicos o fígado tem à sua superfície uma proteína denominada receptor das LDL que é responsável por captar as moléculas de LDL retirando as assim da circulação sanguínea Quando o receptor tem um defeito genético não capta as moléculas do colesterol que permanecem assim no sangue o que favorece o seu depósito nas artérias Como é obvio antes de tratá la há que diagnosticá la A descoberta da sequência do genoma humano é um marco na história da humanidade O desenvolvimento tecnológico e o conhecimento dos genes humanos permite actualmente analisar mais de 30 mil genes numa única análise e permite assim estudar os genes que estão implicados em determinada doença «O teste é muito simples basta retirar uma amostra de sangue tal como numa análise clínica a partir da qual será feita uma extracção do ADN e o estudo bioquímico» refere a investigadora Actualmente este teste genético realiza se no âmbito de um projecto de investigação do Grupo de Investigação Cardiovascular do departamento de Promoção da e Doenças Crónicas do Instituto de Dr Ricardo orge INSA sempre que os doentes sejam referenciados pelos médicos como possíveis portadores da patologia No entanto dentro de pouco tempo poderá ser realizado sob pedido de qualquer médico como outros diagnósticos genéticos efectuados no INSA Uma vez detectada a doença o médico deve valorizar o tratamento «Convém lembrar que uma doença genética nunca pode ser tratada apenas com a mudança dos hábitos de vida Embora seja importante adoptar um estilo de vida saudável é necessário recorrer aos medicamentos as estatinas as mais usadas e é essencial uma vigilância constante do doente» remata Mafalda Bourbon

6

SEJA COMPETITIVO, PROMOVENDO A QUALIDADE DE VIDA NO TRABALHO ACÇÕES DE SENSIBILIZAÇÃO

SEJA COMPETITIVO, PROMOVENDO A QUALIDADE DE VIDA NO TRABALHO ACÇÕES DE SENSIBILIZAÇÃO www.medialcare.pt SEJA COMPETITIVO, PROMOVENDO A QUALIDADE DE VIDA NO TRABALHO ACÇÕES DE SENSIBILIZAÇÃO 1 ALIMENTAÇÃO SAUDÁVEL Com a colaboração de uma especialista em Nutrição, propomos apresentar a temática

Leia mais

Doenças Cardiovasculares

Doenças Cardiovasculares Doenças Cardiovasculares doenças cardiovasculares 1 ÍNDICE O que são as doenças cardiovasculares? 1 Sabe como prevenir as doenças cardiovasculares? 2 Factores modificáveis 4 Açúcar elevado no sangue 4

Leia mais

Dia Mundial da Diabetes - 14 Novembro de 2012 Controle a diabetes antes que a diabetes o controle a si

Dia Mundial da Diabetes - 14 Novembro de 2012 Controle a diabetes antes que a diabetes o controle a si Dia Mundial da Diabetes - 14 Novembro de 2012 Controle a diabetes antes que a diabetes o controle a si A função da insulina é fazer com o que o açúcar entre nas células do nosso corpo, para depois poder

Leia mais

A diabetes é muito comum? Responsabilidade pessoal A história da diabetes

A diabetes é muito comum? Responsabilidade pessoal A história da diabetes Introdução A diabetes é muito comum? Se acabou de descobrir que tem diabetes, isso não significa que esteja doente ou que se tenha transformado num inválido. Há milhares de pessoas com diabetes, levando

Leia mais

Património Genético. Genética - estuda a transmissão de características de uma geração para a outra

Património Genético. Genética - estuda a transmissão de características de uma geração para a outra Património Genético Genética - estuda a transmissão de características de uma geração para a outra E o que acontece quando os pais se cruzam com outros de caracteres opostos? Por que pais altos geram

Leia mais

A hipertensão arterial é comum?

A hipertensão arterial é comum? Introdução A hipertensão arterial é comum? Se tem mais de 30 anos e não se lembra da última vez em que verificou a sua tensão arterial, pode pertencer aos dois milhões de pessoas neste país com hipertensão

Leia mais

Colesterol 3. Que tipos de colesterol existem? 3. Que factores afectam os níveis de colesterol? 4. Quando está o colesterol demasiado elevado?

Colesterol 3. Que tipos de colesterol existem? 3. Que factores afectam os níveis de colesterol? 4. Quando está o colesterol demasiado elevado? Colesterol Colesterol 3 Que tipos de colesterol existem? 3 Que factores afectam os níveis de colesterol? 4 Quando está o colesterol demasiado elevado? 4 Como reduzir o colesterol e o risco de doença cardiovascular?

Leia mais

MELHORE A SUA VIDA CUIDE DO SEU CORAÇÃO!

MELHORE A SUA VIDA CUIDE DO SEU CORAÇÃO! MAIO, MÊS DO CORAÇÃO MELHORE A SUA VIDA CUIDE DO SEU CORAÇÃO! 12 A 31 DE MAIO DE 2008 EXPOSIÇÃO ELABORADA PELA EQUIPA DO SERVIÇO DE CARDIOLOGIA, COORDENADA PELA ENFERMEIRA MARIA JOÃO PINHEIRO. B A R R

Leia mais

Colesterol O que é Isso? Trabalhamos pela vida

Colesterol O que é Isso? Trabalhamos pela vida Colesterol O que é Isso? X O que é o Colesterol? Colesterol é uma gordura encontrada apenas nos animais Importante para a vida: Estrutura do corpo humano (células) Crescimento Reprodução Produção de vit

Leia mais

O QUE SABE SOBRE A DIABETES?

O QUE SABE SOBRE A DIABETES? O QUE SABE SOBRE A DIABETES? 11 A 26 DE NOVEMBRO DE 2008 EXPOSIÇÃO PROMOVIDA PELO SERVIÇO DE MEDICINA INTERNA DO HOSPITAL DE NOSSA SENHORA DO ROSÁRIO, EPE DIABETES MELLITUS É uma doença grave? Estou em

Leia mais

Transcrição Automática de Música

Transcrição Automática de Música Transcrição Automática de Música Ricardo Rosa e Miguel Eliseu Escola Superior de Tecnologia e Gestão do Instituto Politécnico de Leiria Departamento de Engenharia Informática A transcrição automática de

Leia mais

Teste Preditivo para Cancros Hereditários

Teste Preditivo para Cancros Hereditários 16 Coimbra: Serviço de Genética Médica Hospital Pediátrico de Coimbra, CHC Tel.: (+351).239.480.638 Fax: (+351). 239.717.216 Email: genetica@chc.min-saude.pt www.chc.min-saude.pt/servicos/genetica Teste

Leia mais

Estudo PARTNER. Foi convidado a participar neste estudo porque tem uma relação em que é o parceiro VIH positivo.

Estudo PARTNER. Foi convidado a participar neste estudo porque tem uma relação em que é o parceiro VIH positivo. Informação ao participante e consentimento informado para o parceiro VIH positivo Estudo PARTNER O estudo PARTNER é um estudo levado a cabo com casais em que: (i) um parceiro é VIH positivo e o outro é

Leia mais

das Doenças Cérebro Cardiovasculares

das Doenças Cérebro Cardiovasculares Programa Regional de Prevenção e Controlo das Doenças Cérebro Cardiovasculares Índice Siglas e Acrónimos... 2 1. Contextualização... 3 2. População Alvo... 3 3. Objectivos... 4 4. Indicadores para Avaliação

Leia mais

4. COMO É FEITO O DIAGNÓSTICO MIELOIDE CRÔNICA (LMC)? E MONITORAMENTO DE LMC? É uma doença relativamente rara, que ocorre

4. COMO É FEITO O DIAGNÓSTICO MIELOIDE CRÔNICA (LMC)? E MONITORAMENTO DE LMC? É uma doença relativamente rara, que ocorre ÍNDICE 1. O que é Leucemia Mieloide Crônica (LMC)?... pág 4 2. Quais são os sinais e sintomas?... pág 4 3. Como a LMC evolui?... pág 5 4. Quais são os tratamentos disponíveis para a LMC?... pág 5 5. Como

Leia mais

FOLHETO INFORMATIVO: INFORMAÇÃO PARA O UTILIZADOR. Livazo 1 mg, 2 mg e 4 mg comprimidos revestidos por película Pitavastatina

FOLHETO INFORMATIVO: INFORMAÇÃO PARA O UTILIZADOR. Livazo 1 mg, 2 mg e 4 mg comprimidos revestidos por película Pitavastatina FOLHETO INFORMATIVO: INFORMAÇÃO PARA O UTILIZADOR Livazo 1 mg, 2 mg e 4 mg comprimidos revestidos por película Pitavastatina Leia atentamente este folheto antes de tomar Livazo. Conserve este folheto.

Leia mais

Observação em Promoção da Saúde e Doenças Crónicas

Observação em Promoção da Saúde e Doenças Crónicas Observação em Promoção da Saúde e Doenças Crónicas Dia do INSA A Observação de Saúde, função colaborativa -atribuições, actividades e perspectivas futuras Porto, 27 Setembro 2010 Departamento de Promoção

Leia mais

PREVENÇÃO DAS DOENÇAS CRÔNICAS NÃO TRANSMISSÍVEIS PREVENIR É PRECISO MANUAL DE ORIENTAÇÕES AOS SERVIDORES VIGIAS DA PREFEITURA DE MONTES CLAROS

PREVENÇÃO DAS DOENÇAS CRÔNICAS NÃO TRANSMISSÍVEIS PREVENIR É PRECISO MANUAL DE ORIENTAÇÕES AOS SERVIDORES VIGIAS DA PREFEITURA DE MONTES CLAROS PREVENÇÃO DAS DOENÇAS MANUAL DE ORIENTAÇÕES AOS SERVIDORES CRÔNICAS NÃO TRANSMISSÍVEIS VIGIAS DA PREFEITURA DE MONTES CLAROS design ASCOM-PMMC PREVENIR É PRECISO DOENÇAS CRÔNICAS NÃO TRANSMISSÍVEIS No

Leia mais

SUMÁRIO OBESIDADE...4 OBESIDADE EM ADULTOS...5 PREVENÇÃO...6 EM BUSCA DO PESO SAUDÁVEL...7 TRATAMENTO...9 CUIDADOS DIÁRIOS COM A ALIMENTAÇÃO...

SUMÁRIO OBESIDADE...4 OBESIDADE EM ADULTOS...5 PREVENÇÃO...6 EM BUSCA DO PESO SAUDÁVEL...7 TRATAMENTO...9 CUIDADOS DIÁRIOS COM A ALIMENTAÇÃO... 2 SUMÁRIO OBESIDADE...4 OBESIDADE EM ADULTOS...5 PREVENÇÃO...6 EM BUSCA DO PESO SAUDÁVEL...7 TRATAMENTO...9 CUIDADOS DIÁRIOS COM A ALIMENTAÇÃO...12 OUTROS HÁBITOS SAUDÁVEIS...14 ATIVIDADE FÍSICA...14 CUIDADOS

Leia mais

Licenciatura em Comunicação Empresarial

Licenciatura em Comunicação Empresarial Resumo Este artigo tem como objectivo principal fazer uma breve análise da comunicação do pessoal-mix de uma organização, as vantagens de uma boa comunicação entre os mais variados sectores de actividade

Leia mais

Curriculum DeGóis Guia de preenchimento do Curriculum Vitae (Informação mínima necessária)

Curriculum DeGóis Guia de preenchimento do Curriculum Vitae (Informação mínima necessária) Curriculum DeGóis Guia de preenchimento do Curriculum Vitae (Informação mínima necessária) http://curriculum.degois.pt Março de 2012 Versão 1.5 1 Introdução O objectivo deste guia é auxiliar o utilizador

Leia mais

ENTREVISTA "Não se ganha com. a caça ao dividendo"

ENTREVISTA Não se ganha com. a caça ao dividendo ENTREVISTA "Não se ganha com a caça ao dividendo" JORGE BENTO FARINHA, VICE-PRESIDENTE DA PORTO BUSINESS SCHOOL Em Portugal não se ganha dinheiro com a caça ao dividendo Co-autor do livro "Dividendos e

Leia mais

Prova Nacional de Seriação

Prova Nacional de Seriação Prova Sabias que será alterado em breve o modelo de Prova Nacional de Seriação? Sabes se já não vais fazer o exame Harrison? Sabes o que é a NBME? E o novo modelo, conhece-lo? da Prova Aqui ficam as respostas

Leia mais

CAUSAS E CONSEQUÊNCIAS DA OBESIDADE

CAUSAS E CONSEQUÊNCIAS DA OBESIDADE 01 CAUSAS E CONSEQUÊNCIAS DA OBESIDADE A obesidade é uma doença crónica que se caracteriza pelo excesso de gordura corporal e que atinge homens, mulheres e crianças de todas as etnias e idades. A sua prevalência

Leia mais

EPIDEMIOLOGIA DAS DOENÇAS HEREDITÁRIAS DO METABOLISMO (DHM)

EPIDEMIOLOGIA DAS DOENÇAS HEREDITÁRIAS DO METABOLISMO (DHM) EPIDEMIOLOGIA DAS DOENÇAS HEREDITÁRIAS DO METABOLISMO (DHM) A Epidemiologia é a disciplina que estuda os determinantes da doença bem como os fatores envolvidos no seu desenvolvimento, distribuição e disseminação

Leia mais

Hipotireoidismo. O que é Tireóide?

Hipotireoidismo. O que é Tireóide? Texto de apoio ao curso de Especialização Atividade física adaptada e saúde Prof. Dr. Luzimar Teixeira Hipotireoidismo O que é Tireóide? É uma glândula localizada na parte anterior do pescoço, bem abaixo

Leia mais

Pedro R ibeiro Ribeiro e S ilva Silva MAPFRE Seguros

Pedro R ibeiro Ribeiro e S ilva Silva MAPFRE Seguros Pedro Ribeiro e Silva MAPFRE Seguros A avaliação de riscos psicossociais no trabalho na ótica das seguradoras A avaliação dos riscos psicossociais pelas seguradoras pode ser efectuada em duas perspectivas:

Leia mais

SENADO FEDERAL PRESSÃO CONTROLADA SENADOR CLÉSIO ANDRADE

SENADO FEDERAL PRESSÃO CONTROLADA SENADOR CLÉSIO ANDRADE SENADO FEDERAL PRESSÃO CONTROLADA SENADOR CLÉSIO ANDRADE 2 Pressão controlada apresentação Chamada popularmente de pressão alta, a hipertensão é grave por dois motivos: não apresenta sintomas, ou seja,

Leia mais

2. Nesse sistema, ocorre uma relação de protocooperação entre algas e bactérias.

2. Nesse sistema, ocorre uma relação de protocooperação entre algas e bactérias. PROVA DE BIOLOGIA QUESTÃO 01 Entre os vários sistemas de tratamento de esgoto, o mais econômico são as lagoas de oxidação. Essas lagoas são reservatórios especiais de esgoto, que propiciam às bactérias

Leia mais

AVALIAR PARA PRESERVAR O PATRIMÓNIO ARQUIVÍSTICO

AVALIAR PARA PRESERVAR O PATRIMÓNIO ARQUIVÍSTICO AVALIAR PARA PRESERVAR O PATRIMÓNIO ARQUIVÍSTICO Por Maria João Pires de Lima É com grata satisfação que nos encontramos nesta conferência sobre a problemática dos Arquivos Universitários e particularmente

Leia mais

Pesquisa revela que um em cada 11 adultos no mundo tem diabetes

Pesquisa revela que um em cada 11 adultos no mundo tem diabetes Pesquisa revela que um em cada 11 adultos no mundo tem diabetes O Dia Mundial da Saúde é celebrado todo 7 de abril, e neste ano, o tema escolhido pela Organização Mundial da Saúde (OMS) para conscientização

Leia mais

fundação portuguesa de cardiologia Nº. 12 Dr. João Albuquerque e Castro REVISÃO CIENTÍFICA: [CIRURGIA VASCULAR DO CENTRO HOSPITALAR LISBOA CENTRAL]

fundação portuguesa de cardiologia Nº. 12 Dr. João Albuquerque e Castro REVISÃO CIENTÍFICA: [CIRURGIA VASCULAR DO CENTRO HOSPITALAR LISBOA CENTRAL] fundação portuguesa de cardiologia TUDO O QUE DEVE SABER SOBRE ANEURISMAS DA AORTA ABDOMINAL Nº. 12 REVISÃO CIENTÍFICA: Dr. João Albuquerque e Castro [CIRURGIA VASCULAR DO CENTRO HOSPITALAR LISBOA CENTRAL]

Leia mais

Dossier Informativo. Osteoporose. Epidemia silenciosa que afecta 800.000 pessoas em Portugal

Dossier Informativo. Osteoporose. Epidemia silenciosa que afecta 800.000 pessoas em Portugal Dossier Informativo Osteoporose Epidemia silenciosa que afecta 800.000 pessoas em Portugal 2008 1 Índice 1. O que é a osteoporose? Pág. 3 2. Factores de risco Pág. 4 3. Prevenção Pág. 4 4. Diagnóstico

Leia mais

Consulta de Enfermagem para Pessoas com Hipertensão Arterial Sistêmica. Ms. Enf. Sandra R. S. Ferreira

Consulta de Enfermagem para Pessoas com Hipertensão Arterial Sistêmica. Ms. Enf. Sandra R. S. Ferreira Consulta de Enfermagem para Pessoas com Hipertensão Arterial Sistêmica Ms. Enf. Sandra R. S. Ferreira O QUE É HIPERTENSÃO ARTERIAL? Condição clínica multifatorial caracterizada por níveis elevados e sustentados

Leia mais

Áudio. GUIA DO PROFESSOR Síndrome de Down - Parte I

Áudio. GUIA DO PROFESSOR Síndrome de Down - Parte I Síndrome de Down - Parte I Conteúdos: Tempo: Síndrome de Down 5 minutos Objetivos: Auxiliar o aluno na compreensão do que é síndrome de Down Descrição: Produções Relacionadas: Neste programa de Biologia

Leia mais

DOSSIER INFORMATIVO. Descodificar o conceito dos antioxidantes

DOSSIER INFORMATIVO. Descodificar o conceito dos antioxidantes DOSSIER INFORMATIVO Descodificar o conceito dos antioxidantes 1 QUADRO RESUMO aos antioxidantes ajudam o organismo a combater os efeitos nefastos dos radicais livres; aos radicais livres são elementos

Leia mais

O que é um Teste Preditivo?

O que é um Teste Preditivo? 16 Centro de Genética Preditiva e Preventiva (CGPP) IBMC, Univ. Porto Tel.: (+351).22.607.49.94 Fax: (+351).22.600.29.23 Email: cgpp-cons@ibmc.up.pt (consulta); cgpp-lab@ibmc.up.pt (laboratório); www.cgpp.eu

Leia mais

Administração dos riscos cardiovasculares Resumo de diretriz NHG M84 (segunda revisão, janeiro 2012)

Administração dos riscos cardiovasculares Resumo de diretriz NHG M84 (segunda revisão, janeiro 2012) Administração dos riscos cardiovasculares Resumo de diretriz NHG M84 (segunda revisão, janeiro 2012) traduzido do original em holandês por Luiz F.G. Comazzetto 2014 autorização para uso e divulgação sem

Leia mais

Mulheres grávidas ou a amamentar*

Mulheres grávidas ou a amamentar* Doença pelo novo vírus da gripe A(H1N1) Fase Pandémica 6 OMS Mulheres grávidas ou a amamentar* Destaques: A análise dos casos ocorridos, a nível global, confirma que as grávidas constituem um grupo de

Leia mais

Teste seus conhecimentos: Caça-Palavras

Teste seus conhecimentos: Caça-Palavras Teste seus conhecimentos: Caça-Palavras Batizada pelos médicos de diabetes mellitus, a doença ocorre quando há um aumento do açúcar no sangue. Dependendo dos motivos desse disparo, pode ser de dois tipos.

Leia mais

MEDIÇÃO EM QUÍMICA ERROS E ALGARISMOS SIGNIFICATIVOS

MEDIÇÃO EM QUÍMICA ERROS E ALGARISMOS SIGNIFICATIVOS MEDIÇÃO EM QUÍMICA ERROS E ALGARISMOS SIGNIFICATIVOS 2 O que são e Por que se usam algarismos significativos? O valor 1,00 não é igual a 1? Do ponto de vista matemático, sim. Mas sempre que se façam medições

Leia mais

http://ww1.rtp.pt/noticias/index.php?article=322084&visual=26&tema=1

http://ww1.rtp.pt/noticias/index.php?article=322084&visual=26&tema=1 Página Web 1 de 2 http://ww1.rtp.pt/noticias/index.php?article=322084&visual=26&tema=1 24-01-2008 Nacional Sono: "Deitar cedo e cedo erguer" é uma máxima cada vez mais válida para uma vida saudável - investigador

Leia mais

Prevenir Dimensão: Saúde. Imagem: Página (s): Nacional 50000. Âmbito: Tiragem: S/Cor 110 a 116

Prevenir Dimensão: Saúde. Imagem: Página (s): Nacional 50000. Âmbito: Tiragem: S/Cor 110 a 116 Temática: Dimensão: Saúde 1664 Âmbito: Tiragem: Nacional 50000 Imagem: Página (s): S/Cor 110 a 116 O QUE É AFINAL O COLESTEROL Trata se de uma substância necessária ao organismo Como refere a investigadora

Leia mais

ANÁLISE FUNCIONAL DO FITNESS

ANÁLISE FUNCIONAL DO FITNESS ANÁLISE FUNCIONAL DO FITNESS Sobre a Avaliação: O profissional conecta os sensores nos dedos do cliente para que possam captar os sinais do sistema nervoso e enviá-los ao computador, gerando resultados

Leia mais

Recenseamento Geral da População e Habitação 2014

Recenseamento Geral da População e Habitação 2014 Census 2014 Angola Informação Geral:- Recenseamento Geral da População e Habitação 2014 A República de Angola vai efectuar, de 16 a 31 de Maio de 2014, o Recenseamento Geral da População e Habitação, aquela

Leia mais

Livro educativo para doentes com Hipercolesterolemia Familiar (FH) DR. LEIV OSE

Livro educativo para doentes com Hipercolesterolemia Familiar (FH) DR. LEIV OSE Livro educativo para doentes com Hipercolesterolemia Familiar (FH) DR. LEIV OSE ÍNDICE O QUE PODERÁ APRENDER COM ESTE LIVRO? Ficará a conhecer a e Hipercolesterolemia Familiar (FH), causas e potenciais

Leia mais

Objectivos PLANEAR 2/90. O que se pretende comunicar ou expor. Queremos:

Objectivos PLANEAR 2/90. O que se pretende comunicar ou expor. Queremos: Objectivos O que se pretende comunicar ou expor Queremos: De todos os passos deste e-book, começamos pelo maior desafio: ter boas ideias. Estas estão só à espera que alguém as tenha, e até há técnicas

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

INTRODUÇÃO. Diabetes & você

INTRODUÇÃO. Diabetes & você INTRODUÇÃO Diabetes & você Uma das coisas mais importantes na vida de uma pessoa com diabetes é a educação sobre a doença. Conhecer e saber lidar diariamente com o diabetes é fundamental para levar uma

Leia mais

www.printo.it/pediatric-rheumatology/br/intro

www.printo.it/pediatric-rheumatology/br/intro www.printo.it/pediatric-rheumatology/br/intro Artrite de lyme Versão de 2016 1. O QUE É ARTRITE DE LYME 1.1 O que é? A artrite de Lyme é uma das doenças causadas pela bactéria Borrelia burgdorferi (borreliose

Leia mais

Cartilha. pela Saúde da Mulher

Cartilha. pela Saúde da Mulher Cartilha pela Saúde da Mulher Cólica Menstrual Excesso de Gorduras no Sangue A cólica menstrual ou dismenorreia é uma dor abdominal provocada pelas contrações uterinas que ocorrem durante a menstruação.

Leia mais

ADMINISTRAÇÃO REGIONAL DE SAÚDE DO CENTRO, IP: Projecto de intervenção comunitária pão.come

ADMINISTRAÇÃO REGIONAL DE SAÚDE DO CENTRO, IP: Projecto de intervenção comunitária pão.come ADMINISTRAÇÃO REGIONAL DE SAÚDE DO CENTRO, IP: Projecto de intervenção comunitária pão.come ENQUADRAMENTO E FUNDAMENTAÇÃO O projecto pão.come é um projecto de intervenção comunitária que visa a redução

Leia mais

UM NOVO ESTILO DE VIDA A

UM NOVO ESTILO DE VIDA A 1 UM NOVO ESTILO DE VIDA A Dieta de South Beach sempre se propôs a ser mais do que uma dieta. Na verdade, ela foi desenvolvida para ajudar meus pacientes diabéticos e cardíacos a emagrecer e a se prevenir

Leia mais

Método de Amenorréia Lactacional

Método de Amenorréia Lactacional CAPÍTULO 19 Método de Amenorréia Lactacional Pontos Básicos para Profissionais/Serviços de Saúde e Clientes É um método de planejamento familiar baseado na amamentação. Proporciona contracepção para a

Leia mais

Rastreio do Aneurisma Aórtico Abdominal (AAA)

Rastreio do Aneurisma Aórtico Abdominal (AAA) Portuguese translation of Abdominal aortic aneurysm screening: Things you need to know Rastreio do Aneurisma Aórtico Abdominal (AAA) Aquilo que deve saber A quem se destina este folheto? Este folheto destina-se

Leia mais

Hereditariedade ligado ao X

Hereditariedade ligado ao X 12 Porto: Instituto de Genética Médica Tel.: (+351).22.607.03.00 Email: genetica@igm.min-saude.pt www.igm.min-saude.pt Hereditariedade ligado ao X Centro de Genética Preditiva e Preventiva IBMC, Univ.

Leia mais

Decreto - executivo nº 6/96 de 2 de Fevereiro

Decreto - executivo nº 6/96 de 2 de Fevereiro Decreto - executivo nº 6/96 de 2 de Fevereiro O Decreto nº 31/94, de 5 de Agosto, estabelece no ponto 2 do artigo 18º, a obrigatoriedade da criação e organização de Serviços de Segurança e Higiene no Trabalho

Leia mais

Ao Conselho de Administração da SGAL

Ao Conselho de Administração da SGAL Ao Conselho de Administração da SGAL Dirigimo-nos a vossas excelências enquanto proprietários e residentes no empreendimento por vós comercializado Colina São João de Brito, sito na urbanização Alto do

Leia mais

EMPREENDEDORISMO: O CONTEXTO NACIONAL

EMPREENDEDORISMO: O CONTEXTO NACIONAL EMPREENDEDORISMO: O CONTEXTO NACIONAL Entrevista com Eng.º Victor Sá Carneiro N uma época de grandes transformações na economia dos países, em que a temática do Empreendedorismo assume uma grande relevância

Leia mais

Projeto de Resolução n.º 238/XIII/1.ª. Recomenda ao Governo que implemente medidas de prevenção e combate à Diabetes e à Hiperglicemia Intermédia.

Projeto de Resolução n.º 238/XIII/1.ª. Recomenda ao Governo que implemente medidas de prevenção e combate à Diabetes e à Hiperglicemia Intermédia. Projeto de Resolução n.º 238/XIII/1.ª Recomenda ao Governo que implemente medidas de prevenção e combate à Diabetes e à Hiperglicemia Intermédia. O aumento da esperança de vida, conseguido através do desenvolvimento,

Leia mais

Manual de candidatura por via electrónica

Manual de candidatura por via electrónica 2 Concursos de Pessoal Docente regulados pelo Decreto Legislativo Regional n.º /2009/M de de Junho. Ano Escolar 2009/2010 Manual de candidatura por via electrónica É essencial que leia este manual antes

Leia mais

Decreto - executivo nº 6/96 de 2 de Fevereiro

Decreto - executivo nº 6/96 de 2 de Fevereiro Decreto - executivo nº 6/96 de 2 de Fevereiro O Decreto nº 31/94, de 5 de Agosto, estabelece no ponto 2 do artigo 18º, a obrigatoriedade da criação e organização de Serviços de Segurança e Higiene no Trabalho

Leia mais

Alimentação Saudável

Alimentação Saudável ANO LECTIVO 2010/2011 Alimentação Saudável Turma: 8º A Elaborado por: Adriana nº1, Carolina Pereira nº8 e Cátia nº10 Disciplina: Área de Projecto e Formação Cívica Professores: Eurico Caetano e Helena

Leia mais

azul NOVEMBRO azul Saúde também é coisa de homem. Doenças Cardiovasculares (DCV)

azul NOVEMBRO azul Saúde também é coisa de homem. Doenças Cardiovasculares (DCV) Doenças Cardiovasculares (DCV) O que são as Doenças Cardiovasculares? De um modo geral, são o conjunto de doenças que afetam o aparelho cardiovascular, designadamente o coração e os vasos sanguíneos. Quais

Leia mais

EXEMPLO. Ensaio CHIPS. (Control of Hypertension In Pregnancy Study/Estudo do Controle da Hipertensão na Gravidez)

EXEMPLO. Ensaio CHIPS. (Control of Hypertension In Pregnancy Study/Estudo do Controle da Hipertensão na Gravidez) {Colocar no Cabeçalho do Hospital} Ensaio CHIPS (Control of Hypertension In Pregnancy Study/Estudo do Controle da Hipertensão na Gravidez) Introdução (CHECK LIST) TERMO DE CONSENTIMENTO LIVRE E ESCLARECIDO

Leia mais

Hipertensão Arterial no idoso

Hipertensão Arterial no idoso Hipertensão Arterial no idoso Prof. Dr. Sebastião Rodrigues Ferreira-Filho Universidade Federal de Uberlândia, MG, Brasil Departamento de Hipertensão Sociedade Brasileira de Nefrologia Uma história americana:

Leia mais

Tipos de Diabetes e 10 Super Alimentos Para Controlar a Diabetes

Tipos de Diabetes e 10 Super Alimentos Para Controlar a Diabetes Esse Ebook Tem O Objetivo de Ajudar Diabéticos, a Levar Uma Vida Normal Lembrando Que A Diabetes E Uma doença Silenciosa, e Muito Perigosa se Você Ignora-la. Um Outro Ponto Importante e Que A forma de

Leia mais

OBJETIVO VISÃO GERAL SUAS ANOTAÇÕES

OBJETIVO VISÃO GERAL SUAS ANOTAÇÕES OBJETIVO Assegurar a satisfação do cliente no pós-venda, desenvolvendo um relacionamento duradouro entre o vendedor e o cliente, além de conseguir indicações através de um sistema de follow-up (acompanhamento).

Leia mais

Hereditariedade recessiva

Hereditariedade recessiva 12 Hereditariedade recessiva Revisão do texto e tradução de Jorge Sequeiros Agosto 2008 Modificado a partir de folhetos produzidos pelo Guy s and St Thomas Hospital, London; e o London IDEAS Genetic Knowledge

Leia mais

Fevereiro 2011 BEBÉ VIDA INFORMA. 707 20 10 18 geral@bebevida.com www.bebevida.com

Fevereiro 2011 BEBÉ VIDA INFORMA. 707 20 10 18 geral@bebevida.com www.bebevida.com Fevereiro 2011 BEBÉ VIDA INFORMA 1 Células hematopoiéticas do sangue do cordão umbilical podem ajudar na recuperação de AVC s As células estaminais hematopoiéticas do sangue do cordão umbilical podem promover

Leia mais

ÍNDICE. Anexos: I. Formulário de notificação II. Quadro metodológico com vista a facilitar uma estimativa e avaliação consistentes do risco

ÍNDICE. Anexos: I. Formulário de notificação II. Quadro metodológico com vista a facilitar uma estimativa e avaliação consistentes do risco ANEXO ORIENTAÇÕES GERAIS RELATIVAS À NOTIFICAÇÃO DE PRODUTOS DE CONSUMO PERIGOSOS ÀS AUTORIDADES COMPETENTES DOS ESTADOS-MEMBROS POR PARTE DOS PRODUTORES E DOS DISTRIBUIDORES, EM CONFORMIDADE COM O N.º

Leia mais

Curso Profissional de Técnico de Apoio Psicossocial- 2º ano Módulo nº5- Semiologia Psíquica Portefólio de Psicopatologia Ana Carrilho- 11ºB

Curso Profissional de Técnico de Apoio Psicossocial- 2º ano Módulo nº5- Semiologia Psíquica Portefólio de Psicopatologia Ana Carrilho- 11ºB Curso Profissional de Técnico de Apoio Psicossocial- 2º ano Módulo nº5- Semiologia Psíquica Portefólio de Psicopatologia Ana Carrilho- 11ºB É uma doença psiquiátrica que leva as pessoas a acreditarem que

Leia mais

6 INTERMEDIÁRIOS FINANCEIROS

6 INTERMEDIÁRIOS FINANCEIROS 6. INTERMEDIÁRIOS FINANCEIROS 6. Intermediários Financeiros O QUE SÃO INTERMEDIÁRIOS FINANCEIROS? Intermediários financeiros são as empresas prestadoras dos serviços que permitem aos investidores actuar

Leia mais

A VIGILÂNCIA DE DISPOSITIVOS MÉDICOS: Conceitos e Objectivos

A VIGILÂNCIA DE DISPOSITIVOS MÉDICOS: Conceitos e Objectivos A VIGILÂNCIA DE DISPOSITIVOS MÉDICOS: Conceitos e Objectivos Miguel Antunes Departamento de Vigilância de Produtos de Saúde (DGREE-VPS) (miguel.antunes@infarmed.pt) MINISTÉRIO DA SAÚDE INSTITUTO NACIONAL

Leia mais

LOSARTANA POTÁSSICA Hypermarcas S/A Comprimido revestido 50mg e 100mg

LOSARTANA POTÁSSICA Hypermarcas S/A Comprimido revestido 50mg e 100mg LOSARTANA POTÁSSICA Hypermarcas S/A Comprimido revestido 50mg e 100mg I - IDENTIFICAÇÃO DO MEDICAMENTO: LOSARTANA POTÁSSICA Medicamento genérico Lei nº 9.787, de 1999 APRESENTAÇÕES Comprimido revestido

Leia mais

Perguntas Mais Frequentes Sobre

Perguntas Mais Frequentes Sobre Perguntas Mais Frequentes Sobre Neste documento pretende a Coordenação do Programa Nacional de Desfibrilhação Automática Externa (PNDAE) reunir uma selecção das perguntas mais frequentemente colocadas

Leia mais

Regulamento dos cursos de segundo ciclo integrado na FCTUC

Regulamento dos cursos de segundo ciclo integrado na FCTUC Regulamento dos cursos de segundo ciclo integrado na FCTUC Autorizado na reunião da Comissão Coordenadora do Conselho Científico de 2006-10-09, na reunião do Conselho Directivo de 2006-10-13 e na reunião

Leia mais

PARA UMA VIDA MAIS SAUDÁVEL E PRAZEROSA

PARA UMA VIDA MAIS SAUDÁVEL E PRAZEROSA PARA UMA VIDA MAIS SAUDÁVEL E PRAZEROSA Cuidar da saúde deixou de ser uma preocupação para ser assunto de interesse de todos. SAÚDE tem um vínculo com seu público, e traz as últimas novidades para se ter

Leia mais

BREVE INTRODUÇÃO AO SISTEMA DA GESTÃO DE DOCUMENTOS DA CÂMARA MUNICIPAL DE MACAU PROVISÓRIA

BREVE INTRODUÇÃO AO SISTEMA DA GESTÃO DE DOCUMENTOS DA CÂMARA MUNICIPAL DE MACAU PROVISÓRIA Administração n.º 47, vol. X III, 2000-1.º, 263-271 BREVE INTRODUÇÃO AO SISTEMA DA GESTÃO DE DOCUMENTOS DA CÂMARA MUNICIPAL DE MACAU PROVISÓRIA Iong Chi Seng, Lao Chon Pio e Lao Sok Chi* A Câmara Municipal

Leia mais

Comissão Parlamentar de Saúde. Audição da Ordem dos Farmacêuticos

Comissão Parlamentar de Saúde. Audição da Ordem dos Farmacêuticos Comissão Parlamentar de Saúde Audição da Ordem dos Farmacêuticos Sessão de 17 de Janeiro de 2012 Intervenção inicial do Bastonário Carlos Maurício Barbosa Senhora Presidente da Comissão Parlamentar de

Leia mais

MG 18 P Mini-massageador Instruções de utilização

MG 18 P Mini-massageador Instruções de utilização MG 18 P P Mini-massageador Instruções de utilização Beurer GmbH Söflinger Str. 218 89077 Ulm, Germany Tel.: +49 (0)731 / 39 89-144 Fax: +49 (0)731 / 39 89-255 www.beurer.de Mail: kd@beurer.de Portugues

Leia mais

Os Atletas e os Medicamentos Perguntas e Respostas

Os Atletas e os Medicamentos Perguntas e Respostas Os Atletas e os Medicamentos Perguntas e Respostas O que posso fazer para evitar um caso positivo motivado pela utilização de um medicamento? Existem duas formas de obter um medicamento: através de uma

Leia mais

Obesidade Infantil. O que é a obesidade

Obesidade Infantil. O que é a obesidade Obesidade Infantil O que é a obesidade A obesidade é definida pela Organização Mundial da Saúde (OMS) como uma doença em que o excesso de gordura corporal acumulada pode atingir graus capazes de afectar

Leia mais

Motivar os Professores

Motivar os Professores Motivar os Professores Ramiro Marques Conferência Realizada no Dia da Escola Escola Superior de Educação de Santarém 11 de Novembro de 2003 Uma das formas de motivar o jovem professor é: Ouvi-lo com atenção

Leia mais

Assessoria de Comunicação & Marketing Assessoria de Imprensa e Divulgação Científica

Assessoria de Comunicação & Marketing Assessoria de Imprensa e Divulgação Científica Assessoria de Comunicação & Marketing Assessoria de Imprensa e Divulgação Científica Monitoramento das Notícias da Unisul Dia 8 de agosto de 2011 JORNAIS Ciência e Saúde Notisul Online Unisul Tenta Recuperação

Leia mais

PROJECTO DE LEI N.º 154/IX INTEGRAÇÃO DA MEDICINA DENTÁRIA NO SERVIÇO NACIONAL DE SAÚDE. Exposição de motivos

PROJECTO DE LEI N.º 154/IX INTEGRAÇÃO DA MEDICINA DENTÁRIA NO SERVIÇO NACIONAL DE SAÚDE. Exposição de motivos PROJECTO DE LEI N.º 154/IX INTEGRAÇÃO DA MEDICINA DENTÁRIA NO SERVIÇO NACIONAL DE SAÚDE Exposição de motivos A situação da saúde oral em Portugal é alarmante. Portugal está, em todos os dados sobre saúde

Leia mais

O que é O que é. colesterol?

O que é O que é. colesterol? O que é O que é colesterol? 1. O que é colesterol alto e por que ele é ruim? Apesar de a dislipidemia (colesterol alto) ser considerada uma doença extremamente prevalente no Brasil e no mundo, não existem

Leia mais

Reabilitação de revestimentos de pisos correntes com recurso a argamassas

Reabilitação de revestimentos de pisos correntes com recurso a argamassas Reabilitação de revestimentos de pisos correntes com recurso a argamassas A. Jorge Sousa Mestrando IST Portugal a.jorge.sousa@clix.pt Jorge de Brito ICIST/IST Portugal jb@civil.ist.utl.pt Fernando Branco

Leia mais

Folheto informativo: Informação para o doente. Ezetrol 10 mg Comprimidos. Ezetimiba

Folheto informativo: Informação para o doente. Ezetrol 10 mg Comprimidos. Ezetimiba Folheto informativo: Informação para o doente Ezetrol 10 mg Comprimidos Ezetimiba Leia com atenção todo este folheto antes de começar a tomar este medicamento pois contém informação importante para si.

Leia mais

Participar em estudos de investigação científica é contribuir para o conhecimento e melhoria dos serviços de saúde em Portugal

Participar em estudos de investigação científica é contribuir para o conhecimento e melhoria dos serviços de saúde em Portugal FO L H E TO F EC H A D O : FO R M ATO D L ( 2 2 0 x 1 1 0 m m ) FO L H E TO : C A PA Departamento de Epidemiologia Clínica, Medicina Preditiva e Saúde Pública Faculdade de Medicina da Universidade do Porto

Leia mais

EXERCÍCIO E DIABETES

EXERCÍCIO E DIABETES EXERCÍCIO E DIABETES Todos os dias ouvimos falar dos benefícios que os exercícios físicos proporcionam, de um modo geral, à nossa saúde. Pois bem, aproveitando a oportunidade, hoje falaremos sobre a Diabetes,

Leia mais

Gestão visual e Manutenção

Gestão visual e Manutenção 10º Congresso da Manutenção Associação Portuguesa de Manutenção Industrial Figueira da Foz, 19 e 20 de Novembro de 2009 Gestão visual e Manutenção Não é fácil gerir tanta informação 2 Tem a certeza? Os

Leia mais

Patriarca lembra ao Governo papel social da Igreja

Patriarca lembra ao Governo papel social da Igreja Pedido de diálogo Patriarca lembra ao Governo papel social da Igreja As relações entre o Estado e a Igreja Católica já viveram dias piores, mas o patriarca de Lisboa está preocupado pela falta de apoio

Leia mais

Os Recursos Humanos na Distribuição

Os Recursos Humanos na Distribuição Os Recursos Humanos na Distribuição Tudo assenta nas pessoas. Também o sangue vital da Distribuição assenta nas pessoas, empregados ou consumidores, na medida em que uns vendem os produtos e os outros

Leia mais

DEFICIÊNCIA INTELECTUAL OU ATRASO COGNITIVO?

DEFICIÊNCIA INTELECTUAL OU ATRASO COGNITIVO? DEFICIÊNCIA INTELECTUAL OU ATRASO COGNITIVO? 1. O que é Deficiência Intelectual ou Atraso Cognitivo? Deficiência intelectual ou atraso cognitivo é um termo que se usa quando uma pessoa apresenta certas

Leia mais

E L R O R B ETSE SO L O R C FALAS O VAM

E L R O R B ETSE SO L O R C FALAS O VAM SOBRE COLESTEROL VAMOS FALAR COLESTEROL O nome colesterol vem do grego e significa cálculo biliar. Ele foi batizado pelo químico francês Michel Eugene Chevreul, em 1815. Presente nas gorduras animais,

Leia mais

Estoque. Como controlar o estoque

Estoque. Como controlar o estoque Estoque Como controlar o estoque Por que é necessário controlar o estoque? Reduzir custos Se há excesso em estoque A empresa terá custos operacionais para manter o estoque, isto significa capital empatado

Leia mais