Bioinformática. Regulação Génica. Proteínas Reguladoras. Regiões Reguladoras (RR) Pesquisa de Motivos

Tamanho: px
Começar a partir da página:

Download "Bioinformática. Regulação Génica. Proteínas Reguladoras. Regiões Reguladoras (RR) Pesquisa de Motivos"

Transcrição

1 Regulação énica Bioinformática Pesquisa de Motivos Uma experiência com microarrays mostrou que quando o X é knocked out, também não se expressam outros 20 s omo é que um só pode ter um efeito tão drástico? 1 2 Proteínas Reguladoras O ene X codifica para uma proteína reguladora - faor de transcrição (F) Os 20 s que não se expressam são s que são regulados por este F Um só F pode regular múltiplos s Regiões Reguladoras (RR) ada possui uma RR tipicamente entre bp a montante do local de início da transcrição Nas RR existem os ranscription Faor Binding Sites (FBS), também designados por motivos, específicos para um determinado faor de transcrição Os Fs influenciam a expressão génica ao ligarem-se a um local específico na respeiva região regulatória FBS 3 4 1

2 ranscription Faor Binding Sites - FBS Identificação de Motivos: Importância Os FBS podem localizar-se num qualquer local dentro da RR Os FBS podem variar ligeiramente entre diferentes RRs pois bases não essenciais estão sujeitas a mutação Os s são expressos ou reprimidos através da interacção com proteínas reguladoras Estas proteínas ligam-se a montante às regiões reguladoras dos s de modo a atrair ou bloquear a acção da RN polimerase s proteínas reguladoras ligam-se a uma pequena sequência de DN MOIVO (ranscription Faor Binding Site - FBS) Encontrar estes motivos em regiões reguladoras de múltiplos s sugere uma relação reguladora entre estes s 5 6 ranscription Faors and Motifs Desafio Encontrar um motivo numa amostra com 20 sequências random (e.g. 600 bp) cada sequência contém um padrão de tamanho 15 em cada padrão aparecem 4 alterações 7 8 2

3 3 9 mostra Random accgtatggcaggcgtacacaagataaacgtatgaagtacg accgtatggcaggcgtacacaagataaacgtatgaagtacg accgtatggcaggcgtacacaagataaacgtatgaagtacg accgtatggcaggcgtacacaagataaacgtatgaagtacg tagggcataaggtaca tagggcataaggtaca tagggcataaggtaca tagggcataaggtaca tgagtatccgggatgacgggaacaatagtgcccgatgaatatgtagga tgagtatccgggatgacgggaacaatagtgcccgatgaatatgtagga tgagtatccgggatgacgggaacaatagtgcccgatgaatatgtagga tgagtatccgggatgacgggaacaatagtgcccgatgaatatgtagga ggagaaggatgaccgtaagtgccacgcaatcgcgaaccaacgcggacccaaagg ggagaaggatgaccgtaagtgccacgcaatcgcgaaccaacgcggacccaaagg ggagaaggatgaccgtaagtgccacgcaatcgcgaaccaacgcggacccaaagg ggagaaggatgaccgtaagtgt ggcc ggcc ggcc ggcccacagtccacatag cacagtccacatag cacagtccacatag cacagtccacatag gtcaatcatgcgtgaatggataagagggcatagaccgcggcgcacccaaa gtcaatcatgcgtgaatggataagagggcatagaccgcggcgcacccaaa gtcaatcatgcgtgaatggataagagggcatagaccgcggcgcacccaaa gtcaatcatgcgtgaatggataagagggcatagaccgcggcgcacccaaa cggggcccgagaggcccccgtagatggaaacaaatgagagagaatc cggggcccgagaggcccccgtagatggaaacaaatgagagagaatc cggggcccgagaggcccccgtagatggaaacaaatgagagagaatc cggggcccgagaggcccccgtagatggaaacaaatgagagagaatc ggtcgaaaatgggggcacatacaagaggagtcccatcagaat ggtcgaaaatgggggcacatacaagaggagtcccatcagaat ggtcgaaaatgggggcacatacaagaggagtcccatcagaat ggtcgaaaatgggggcacatacaagaggagtcccatcagaat caacgtat caacgtat caacgtat caacgtatgccga gccga gccga gccga gggtagatagca gggtagatagca gggtagatagca gggtagatagca 10 Implantação do motivo ggcgtacacaagataaacgtatgaagtacg ggcgtacacaagataaacgtatgaagtacg ggcgtacacaagataaacgtatgaagtacg ggcgtacacaagataaacgtatgaagtacg ta ta ta ta a tgagtatccgggatgac tgagtatccgggatgac tgagtatccgggatgac tgagtatccgggatgac tgcccgatgaatatgtagga tgcccgatgaatatgtagga tgcccgatgaatatgtagga tgcccgatgaatatgtagga ggagaaggatg ggagaaggatg ggagaaggatg ggagaaggatg catag catag catag catag gtcaatcatgcgtgaatggat gtcaatcatgcgtgaatggat gtcaatcatgcgtgaatggat gtcaatcatgcgtgaatggat gaccgcggcgcacccaaa gaccgcggcgcacccaaa gaccgcggcgcacccaaa gaccgcggcgcacccaaa cggggcccgagaggcccccgt cggggcccgagaggcccccgt cggggcccgagaggcccccgt cggggcccgagaggcccccgt caaatgagagagaatc caaatgagagagaatc caaatgagagagaatc caaatgagagagaatc ggggcacatacaagaggagtcccatcagaat ggggcacatacaagaggagtcccatcagaat ggggcacatacaagaggagtcccatcagaat ggggcacatacaagaggagtcccatcagaat a 11 Onde está o motivo implantado? aaaaaaaagggggggggcgtacacaagataaacgtatgaagtacg aaaaaaaagggggggggcgtacacaagataaacgtatgaagtacg aaaaaaaagggggggggcgtacacaagataaacgtatgaagtacg aaaaaaaagggggggggcgtacacaagataaacgtatgaagtacg taaaaaaaaaggggggga taaaaaaaaaggggggga taaaaaaaaaggggggga taaaaaaaaaggggggga tgagtatccgggatgacaaaaaaaagggggggtgcccgatgaatatgtagga tgagtatccgggatgacaaaaaaaagggggggtgcccgatgaatatgtagga tgagtatccgggatgacaaaaaaaagggggggtgcccgatgaatatgtagga tgagtatccgggatgacaaaaaaaagggggggtgcccgatgaatatgtagga ggagaaggatgaaaaaaaagggggggtccacgcaatcgcgaaccaacgcggacccaaagg ggagaaggatgaaaaaaaagggggggtccacgcaatcgcgaaccaacgcggacccaaagg ggagaaggatgaaaaaaaagggggggtccacgcaatcgcgaaccaacgcggacccaaagg ggagaaggatgaaaaaaaaggggggg aaaa aaaa aaaa aaaaaaaagggggggcatag aaaagggggggcatag aaaagggggggcatag aaaagggggggcatag gtcaatcatgcgtgaatggataaaaaaaaggggggggaccgcggcgcacccaaa gtcaatcatgcgtgaatggataaaaaaaaggggggggaccgcggcgcacccaaa gtcaatcatgcgtgaatggataaaaaaaaggggggggaccgcggcgcacccaaa gtcaatcatgcgtgaatggataaaaaaaaggggggggaccgcggcgcacccaaa cggggcccgagaggcccccgtaaaaaaaagggggggcaaatgagagagaatc cggggcccgagaggcccccgtaaaaaaaagggggggcaaatgagagagaatc cggggcccgagaggcccccgtaaaaaaaagggggggcaaatgagagagaatc cggggcccgagaggcccccgtaaaaaaaagggggggcaaatgagagagaatc aaaaaaaagggggggggggcacatacaagaggagtcccatcagaat aaaaaaaagggggggggggcacatacaagaggagtcccatcagaat aaaaaaaagggggggggggcacatacaagaggagtcccatcagaat aaaaaaaagggggggggggcacatacaagaggagtcccatcagaat aaaaaaaagg aaaaaaaagg aaaaaaaagg aaaaaaaaggggggg ggggg ggggg ggggg aaaaaaaaggggggga aaaaaaaaggggggga aaaaaaaaggggggga aaaaaaaaggggggga 12 Implantar o motivo com quatro mutações g g ggcgtacacaagataaacgtatgaagtacg ggcgtacacaagataaacgtatgaagtacg ggcgtacacaagataaacgtatgaagtacg ggcgtacacaagataaacgtatgaagtacg ta ta ta tac t c c a tgagtatccgggatgac tgagtatccgggatgac tgagtatccgggatgac tgagtatccgggatgac t t at tgcccgatgaatatgtagga tgcccgatgaatatgtagga tgcccgatgaatatgtagga tgcccgatgaatatgtagga ggagaaggatg ggagaaggatg ggagaaggatg ggagaaggatgc a a a a t t aa aa aa aa catag catag catag catag gtcaatcatgcgtgaatggat gtcaatcatgcgtgaatggat gtcaatcatgcgtgaatggat gtcaatcatgcgtgaatggat c t gaccgcggcgcacccaaa gaccgcggcgcacccaaa gaccgcggcgcacccaaa gaccgcggcgcacccaaa cggggcccgagaggcccccgt cggggcccgagaggcccccgt cggggcccgagaggcccccgt cggggcccgagaggcccccg c a ccaaatgagagagaatc caaatgagagagaatc caaatgagagagaatc caaatgagagagaatc t acc cc cc ccggggcacatacaagaggagtcccatcagaat ggggcacatacaagaggagtcccatcagaat ggggcacatacaagaggagtcccatcagaat ggggcacatacaagaggagtcccatcagaat ac ac a

4 Onde está o motivo??? Porque é difícil encontrar os motivos com as mutações? agaagaaagggggggcgtacacaagataaacgtatgaagtacg tacaataaaacggcggga tacaataaaacggcggga tgagtatccgggatgacaaaataatggagtggtgcccgatgaatatgtagga ggagaaggatgcaaaaaaagggag ataataaaggaagggcatag taaaggaagggcatag gtcaatcatgcgtgaatggataacaataaggggggaccgcggcgcacccaaa cggggcccgagaggcccccgtataaacaaggagggccaaatgagagagaatc aaaaaatagggagccggggcacatacaagaggagtcccatcagaat aaaaaaggagcgg agcgg aaaaaaggagcgga aaaaaaggagcgga g g ggcgtacacaagataaacgtatgaagtacg ta tac t c c a tgagtatccgggatgac t t at tgcccgatgaatatgtagga ggagaaggatgc a a t t aa aa catag gtcaatcatgcgtgaatggat c t gaccgcggcgcacccaaa cggggcccgagaggcccccg c a ccaaatgagagagaatc caaatgagagagaatc t acc ccggggcacatacaagaggagtcccatcagaat ggggcacatacaagaggagtcccatcagaat ac ac 13 g g c t c c 14 Identificação de Motivos: Dificuldades Motivos e Locais de Início da ranscrição s sequências dos motivos não são conhecidas Não se conhece a sua localização em relação ao início do Os motivos podem diferir de um para o seguinte omo reconhecer um verdadeiro motivo?

5 Representação de padrões Sequência consenso Uma sequência consenso é uma maneira de representar os resultados de um alinhamento múltiplo, onde as sequências relacionadas são comparadas umas com as outras e são encontrados motivos funcionais. sequência consenso mostra quais os resíduos que são conservados e quais os que são variáveis. onsidere o seguinte exemplo de DN: []N{} significa que se encontra sempre um na 1ª posição. [] designa a presença de um ou N representa uma qualquer base {} designa uma qualquer base excepto. Y represnta uma qualquer pirimidina e R uma qualquer purina omplementar Symbol Description Bioinformática Bases / Biologia represented omputacional adenosine cytidine guanine Sequência consenso K M Y R V H D B U W S M K R Y B D H V thymidine uridine weak strong amino keto purine pyrimidine not not not not U Uma sequência consenso pode ser uma curta sequência de nucleótidos que se encontra repetida várias vezes no genoma e pensa-se que possa ter a mesma função em diferentes locais. Muitos F reconhecem sequências consenso particulares que existem nos promotores dos s que regulam. s enzimas de restricção possuem geralmente sequências consenso palindrómicas correspondentes ao local onde cortam o DN. Os elementos transponíveis também auam da mesma maneira ao identificarem sequências alvo para a transposição. Os locais de splicing (sequências que flaqueiam as zonas entre exões e intrões) podem também ser consideradas sequências consenso. N N any base (not a gap)

6 Sequência consenso Uma sequência consenso define uma sequência provável e é obtida pelo alinhamento de todos os exemplos conhecidos de um determinado local de reconhecimento. Pode ser definida como a sequência ideal que representa a base predominante em cada posição. Os exemplos conhecidos não devem diferir demasiado do consenso Sequência consenso onclusão O consenso pode ser considerado um motivo ancestral a partir do qual por mutações sucessivas apareceram outros motivos distância entre um motivo real e a sequência consenso deve ser menor que a distância que existe entre dois motivos Representação de padrões Representação ráfica: Logo de Motivos Box - onsenso: Das 291 sequências analizadas somente 14 possuem a sequência consenso Os motivos podem sofrer mutações em bases não importantes Os 5 motivos em 5 s diferentes possuem mutações nas posições 3 e 5 onsenso Este tipo de representação logos de motivos ilustra de um modo gráfico as regiões conservadas e variáveis de um motivo

7 Origem da visualização gráfica - LOO omo é que duas coisas podem ser simultaneamente diferentes e iguais? O consenso é o mesmo mas a enfâse é diferente s bases nos locais dador e aceitador aparecem com diferentes frequências o que não era deteado pela sequência concensus Os locais de ligação em humanos para a junção entre dador e aceitador no splicing têm o mesmo concenso numa zona de cada lado da junção. Em cada junção há mais informação no lado do intrão omo é que dois locais possuem a mesma sequência concenso, mas no entanto são diferentes? Para poder visualizar melhor esta informação LOOS - visualização gráfica rau de conservação amanho das letras: proporção relativa das bases Bases mais frequentes no topo Sequências do promotor de E. coli Regiões abertas pela polimerase Sequence logo for Rep binding sites. Error bars indicate standard deviations of the entire stack height. Source: dapted from (Schneider, 2001). Desvio Padrão 27 Início da transcrição 28 7

8 Logos: Mais aplicações Permite detear padrões repetitivos ao longo da sequência 29 (hp://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html) 30 Locais de ligação a proteínas 12 sequências de DN das regiões control PL e PR em baeriófagos lambda. Estes encontram-se ligados pelas protreínas ci e cro. ada sequência par é a complementar da anterior impar. sinusoide indica que se encontra uma pequena depressão no centro simétrico em relação a cada proteína. 31 Logos de Sequências Qualquer grupo de sequências de DN, RN ou proteínas alinhadas pode ser representado por esta técnica Os Logos de sequências concentram a seguinte informação num único gráfico: 1. O concenso geral da sequência 2. ordem porque predominam os resíduos em cada posição 3. s frequências relativas de cada residuo em cada posição 4. quantidade de informação presente em cada posição na sequência medida em bits (100% =2 bits) 5. Um local de iniciação, um local de corte ou outra localização importante 32 8

9 Logos de Sequências onclusão É uma representação gráfica de um conjunto de alinhamentos. Um logo mostra a frequência com que as bases aparecem em cada posição através da altura das letras. Simultaneamente mostra o nível de conservação como a altura total de um grupo de letras medido em bits de informação. s frequências muito baixas não se perdem no produto final pois estarão representadas numa sequência consenso. escala vertical é em bits com um máximo de 2 bits possíveis para cada posição orresponde a uma única base nessa posição. Sequências geradas ao acaso Desvio Padrão Os logos são uma imagem média de um conjunto de locais de ligação os logos podem mostrar várias letras no mesmo lugar. 33 Sequência consenso 34 Várias assinaturas proteicas Várias assinaturas proteicas Este motivo é caraerizado por 2 cisteínas e 2 histidinas às quais se liga o ião zinco ssinatura com 4 cisteínas e uma prolina. s 4 cisteínas ligam-se a um complexo de 4 átomos e Ferro e 4 átomos de enxofre

10 Programas para busca de Motivos ONSENSUS Hertz, Stromo (1989) ibbsdn Lawrence et al (1993) MEME Bailey, Elkan (1995) MULIPROFILER Keich, Pevzner (2002) MIR Eskin, Pevzner (2002) Paern Branching Price, Pevzner (2003) RandomProjeions Buhler, ompa (2002) 37 10

BIOLOGIA Prof. André Fozzy

BIOLOGIA Prof. André Fozzy BIOLOI Prof. ndré Fozzy RN E SÍNTESE PROTEIC Biologia Prof. ndré Fozzy Regiões Codificadoras e Não-Codificadoras do DN O DN é formado por 2 regiões: Intergênicas ênicas Intergênicas ênicas Região ênica

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

TRANSCRICAO E PROCESSAMENTO DE RNA

TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA?

DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

O que são domínios protéicos

O que são domínios protéicos Domínios protéicos O que são domínios protéicos Domínios protéicos é uma parte da cadeia polipeptídica que pode de enovelar independentemente para formar uma estrutura compacta e estável A existência de

Leia mais

Organização do Material Genético nos Procariontes e Eucariontes

Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Organização do Material Genético nos Procariontes e Eucariontes Procariontes Eucariontes Localização Organização Forma Disperso no citoplasma

Leia mais

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA

COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi Como a vida funciona? O processo de Transcrição Prof. Dr. Francisco Prosdocimi Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos Transcrição

Leia mais

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa SUMÁRIO ENÉI MOLEULR Daniel Macedo de Melo Jorge danielmacedo.jorge@gmail.com História da enética Molecular; Organização e estrutura dos genomas; DN e RN Dogma entral Replicação ranscrição radução enes

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Bioinformática. João Varela jvarela@ualg.pt. Aula T4 CURSOS EM BIOLOGIA, BIOQUÍMICA, BIOTECNOLOGIA, CIÊNCIAS BIOMÉDICAS E ENGENHARIA BIOLÓGICA

Bioinformática. João Varela jvarela@ualg.pt. Aula T4 CURSOS EM BIOLOGIA, BIOQUÍMICA, BIOTECNOLOGIA, CIÊNCIAS BIOMÉDICAS E ENGENHARIA BIOLÓGICA Bioinformática CURSOS EM BIOLOGIA, BIOQUÍMICA, BIOTECNOLOGIA, CIÊNCIAS BIOMÉDICAS E ENGENHARIA BIOLÓGICA João Varela jvarela@ualg.pt Aula T4 Esquema de anotação Annothaton 1. Determinar a localização das

Leia mais

Metabolismo de RNA: Transcrição procarioto/eucarioto

Metabolismo de RNA: Transcrição procarioto/eucarioto Metabolismo de RNA: Transcrição procarioto/eucarioto Controle do nível de proteínas DNA inibição RNA degradação inibição Proteína degradação Tipos de RNA produzidos em uma célula Abundancia dos diferentes

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

Controle da expressão gênica

Controle da expressão gênica Programa de Biologia Celular V Curso de Verão Controle da expressão gênica Renata Ramalho Oliveira roliveira@inca.gov.br Desenvolvimento e fenótipos explicados pela modulação da expressão gênica Lehninger.

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!!

Miguel Rocha Dep. Informática - Universidade do Minho. BIOINFORMÁTICA: passado, presente e futuro!! Miguel Rocha Dep. Informática - Universidade do Minho BIOINFORMÁTICA: passado, presente e futuro!! Bragança, 11 de Maio de 2006 Porquê a Bioinformática?! Novas tecnologias experimentais da Biologia Molecular

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg.

Bioinformática. Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica. João Varela jvarela@ualg. Bioinformática Licenciaturas em Biologia, Bioquímica, Biotecnologia, Ciências Biomédicas, Engenharia Biológica João Varela jvarela@ualg.pt Docentes Paulo Martel (alinhamentos, pesquisas de sequências em

Leia mais

Explorando bancos de dados genômicos e introdução à bioinformática. Guilherme Targino Valente Marcos Tadeu Geraldo. Bioinformática

Explorando bancos de dados genômicos e introdução à bioinformática. Guilherme Targino Valente Marcos Tadeu Geraldo. Bioinformática Explorando bancos de dados genômicos e introdução à bioinformática Guilherme Targino Valente Marcos Tadeu Geraldo 22/07/2011 Bioinformática É a aplicação de estatística e ciência da computação no campo

Leia mais

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c)

Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) Colónias satélite: ao fim de 2 dias (a e b) e de 4 (c) 1 Regulação da expressão de genes 2 A decisão em iniciar a transcrição de um gene que codifica uma proteína em particular é o principal mecanismo

Leia mais

34 CIÊNCIA HOJE vol. 29 nº 171

34 CIÊNCIA HOJE vol. 29 nº 171 É sabido que o DNA contém as informações necessárias para o funcionamento dos organismos. Esse manual de instruções, porém, precisa ser interpretado pelas células, através de um mecanismo que envolve diversas

Leia mais

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA

BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

PCR Real-time thermal cycler Standard thermal cycler

PCR Real-time thermal cycler Standard thermal cycler PCR Real-time thermal cycler Standard thermal cycler Tópicos (1) Estratégias gerais de estudo de sequências de DNA específicas em populações de DNA complexas Requisitos da reacção de polimerização em cadeia

Leia mais

Epigenética e Memória Celular

Epigenética e Memória Celular Epigenética e Memória Celular Por Marcelo Fantappié Fonte www.revistacarbono.com A epigenética é definida como modificações do genoma que são herdadas pelas próximas gerações, mas que não alteram a sequência

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

O processo da Expressão Gênica

O processo da Expressão Gênica Coordenadoria de Educação e Difusão de Ciências Rua 9 de Julho, 1205 - São Carlos - São Paulo e-mail: cbme@if.sc.usp.br- Telefone: (16) 3373-9159 http://cbme.ifsc.usp.br http://cbme.usp.br O processo da

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

objetivos Complexidade dos genomas II AULA Pré-requisitos

objetivos Complexidade dos genomas II AULA Pré-requisitos Complexidade dos genomas II AULA 31 objetivos Ao final desta aula, você deverá ser capaz de: Explicar os fatores envolvidos com a complexidade dos genomas de eucariotos. Descrever as principais características

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Cap.2.1. Alterações do Material Genético Mutações UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação Problemática

Leia mais

MAPA DO CROMOSSOMA DE E.coli

MAPA DO CROMOSSOMA DE E.coli REPLICAÇÃO DE DNA MAPA DO CROMOSSOMA DE E.coli TERMINOLOGIA Regras básicas para a designação de genes e proteínas: Genes bacterianos 3 letras minúsculas em itálico que reflectem a sua função aparente Ex:

Leia mais

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA

ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel phrg@ufu.br Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel phrg@ufu.br Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR

UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR UNIVERSIDADE FEDERAL DE ALAGOAS INSTITUTO DE CIÊNCIAS BIOLÓGICAS E DA SAÚDE SETOR DE BIOLOGIA CELULAR E MOLECULAR DISCIPLINA: BIOLOGIA CELULAR E MOLECULAR ESTUDO DIRIGIDO FLUXO DA INFORMAÇÃO GÊNICA págs:

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br

Evolução Biológica e Algoritmos Genéticos. Fábio Lima Custódio flc@lncc.br Evolução Biológica e Algoritmos Genéticos Fábio Lima Custódio flc@lncc.br Sumário Conceitos gerais O que é evolução? Forças Evolutivas Mutação Deriva Gênica Fluxo gênico Seleção Natural A teoria evolutiva

Leia mais

Biologia-Geologia 11ºano Novembro de 2006. Científico-Humanísticos Curso Ciências e Tecnologias. A hemoglobina. Texto adaptado

Biologia-Geologia 11ºano Novembro de 2006. Científico-Humanísticos Curso Ciências e Tecnologias. A hemoglobina. Texto adaptado Biologia-Geologia 11ºano Novembro de 2006 Científico-Humanísticos Curso Ciências e Tecnologias A hemoglobina Cada molécula de hemoglobina consiste em dois pares separados de globinas alfa e beta (cadeias

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

MUTAÇÃO E REPARO DO DNA

MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA MUTAÇÃO E REPARO DO DNA Danos ao DNA (tipos, locais e frequência) Dano ao DNA -> mutação -> doença Mutação em regiões controladoras e codificantes Mecanismos de Reparo Fita simples

Leia mais

Anotação de Genomas. Fabiana G. S. Pinto

Anotação de Genomas. Fabiana G. S. Pinto Anotação de Genomas Fabiana G. S. Pinto Obtenção de Seqüências geradas pelo MegaBace 1000 Dados brutos (medidas analógicas) de saída do seqüênciamento Base calling BIOINFORMÁTICA * PHRED: - Transforma

Leia mais

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT

Técnicas de análise de proteínas. Estrutura secundária da enzima COMT Técnicas de análise de proteínas Estrutura secundária da enzima COMT Fundamento e aplicação das técnicas de análise de proteínas Electroforese em gel de poliacrilamida (SDS-PAGE) Hibridação Western Electroforese

Leia mais

DNA, RNA e PROTEÍNAS

DNA, RNA e PROTEÍNAS DNA, RNA e PROTEÍNAS DNA PROTEÍNA Carla Costa Faculdade de Medicina da Universidade do Porto Serviço e Laboratório de Biologia Celular e Molecular OBSERVAÇÃO A descoberta do DNA foi crucial para o entendimento

Leia mais

Capítulo 9. Versão 0.6. Domínios, motivos proteicos e evolução por rearranjo de éxons. 1.- Domínios proteicos

Capítulo 9. Versão 0.6. Domínios, motivos proteicos e evolução por rearranjo de éxons. 1.- Domínios proteicos Capítulo 9 Versão 0.6 Domínios, motivos proteicos e evolução por rearranjo de éxons 1.- Domínios proteicos Domínios de proteínas são unidades estruturais, funcionais e evolutivas das proteínas. Um domínio

Leia mais

Ficha de Apoio Teórico: Replicação do DNA

Ficha de Apoio Teórico: Replicação do DNA Escola Secundária c/ 3º Ciclo João Gonçalves Zarco Ano Lectivo 2008/2009 Biologia/Geologia (ano 2) Ficha de Apoio Teórico: Replicação do DNA Introdução Uma das características mais pertinentes de todos

Leia mais

ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO

ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO ORGANIZAÇÃO SUPRAMOLECULAR DO MATERIAL GENÉTICO ORGANIZAÇÃO DO MATERIAL GENÉTICO CELULAR Massa compacta, ocupando um volume limitado As suas variadas actividades, tal como replicação e transcrição, têm

Leia mais

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma

Curso - Psicologia. Disciplina: Genética Humana e Evolução. Resumo Aula 2- Organização do Genoma Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 2- Organização do Genoma Estrutura dos Ácidos Nucleicos- Nucleotídeos Cinco tipos: Adenina, Guanina, Citosina, Timina e Uracila.

Leia mais

17/10/2012. Bases Instrumentais de bioinformática aplicada à Epidemiologia Molecular das doenças transmissíveis. Fábio Gregori. O que é?

17/10/2012. Bases Instrumentais de bioinformática aplicada à Epidemiologia Molecular das doenças transmissíveis. Fábio Gregori. O que é? Bases Instrumentais de bioinformática aplicada à Epidemiologia Molecular das doenças transmissíveis Fábio Gregori O que é? Vantagens e desvantagens Ser mais completo,... Versões (Windows [32 bit], DOS,

Leia mais

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA

TEMA DA AULA. Fluxo da informação genética: I Replicação do DNA, II Transcrição do DNA, III - Tradução do DNA. Localização do DNA FACULDADE DE TECNLGIA E CIÊNCIAS Curso: Nutrição Disciplina: Biologia Geral e Histologia Código: SP 449 CH: 80 h Docente: Jussara Silveira TEMA DA AULA Fluxo da informação genética: I eplicação do, II

Leia mais

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO?

Mutações FICHA INFORMATIVA Nº10: MUTAÇÕES O QUE SÃO? Mutações O QUE SÃO? As mutações são alterações no material genético, que podem ocorrer naturalmente no percurso da síntese proteica mutações espontâneas ou por acção de agentes externos (agentes mutagénicos)

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Fluxo da informação gênica transcrição em eucariotos

Fluxo da informação gênica transcrição em eucariotos Fluxo da informação gênica transcrição em eucariotos AULA 21 objetivos Ao final desta aula, você deverá ser capaz de: Estudar o mecanismo de transcrição em eucariotos. Entender a formação do RNA mensageiro

Leia mais

Bioinformática. Trabalho prático enunciado complementar. Notas complementares ao 1º enunciado

Bioinformática. Trabalho prático enunciado complementar. Notas complementares ao 1º enunciado Bioinformática Trabalho prático enunciado complementar Neste texto, enunciam- se algumas considerações adicionais ao 1º enunciado e uma lista de possíveis tarefas que complementam o enunciado original

Leia mais

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética

V e t e r i n a r i a n D o c s www.veterinariandocs.com.br. Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

Analise filogenética baseada em alinhamento de domínios

Analise filogenética baseada em alinhamento de domínios Analise filogenética baseada em alinhamento de domínios Moléculas biológicas e evolução Como já foi comentado anteriormente sabemos que o DNA de qualquer espécie de ser vivo sofre mutações ao longo do

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA 1- As acetabularias (fotografia à esquerda) são algas verdes marinhas, com 2 a 3 cm de altura, constituídas por uma base ou pé, onde está o núcleo, e um caulículo, na extremidade do qual se diferencia

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

Bacteria Archaea Eukarya

Bacteria Archaea Eukarya PROVA PARA AVALIAÇÃO DE CAPACIDADE PARA FREQUÊNCIA DO ENSINO SUPERIOR DOS MAIORES DE 23 ANOS 2014/2015 Instituto Superior de Engenharia Licenciatura em Tecnologia e Segurança Alimentar Componente específica

Leia mais

Introdução ao SRS Sequence Retrieval System. Marcelo Falsarella Carazzolle

Introdução ao SRS Sequence Retrieval System. Marcelo Falsarella Carazzolle Introdução ao SRS Sequence Retrieval System Marcelo Falsarella Carazzolle Resumo Motivação Introdução Bancos de Dados Ferramentas de bioinformática SRS Exemplos Motivação Existem muitos bancos de dados

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade

RNA: extrema. plasticidade... funcional. Estrutura do RNA: extrema plasticidade. Estrutura do RNA: um mundo de. diferenças. & extrema plasticidade Estrutura do RNA: um mundo de diferenças & extrema plasticidade Estrutura do RNA: extrema plasticidade RNA: extrema plasticidade... funcional RNA: funções múltiplas rrna, mrna, trna, RNAs de funções especiais

Leia mais

Novas Tecnologias de Sequenciamento

Novas Tecnologias de Sequenciamento Novas Tecnologias de Sequenciamento Tecnologias de sequenciamento Sanger (Capilaridade) Uma das inovações tecnológicas de maior influência na pesquisa biológica, desde que foi lançada em 1977 Abordagem

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

Controle da expressão gênica. Prof. Dr. José Luis da C. Silva

Controle da expressão gênica. Prof. Dr. José Luis da C. Silva Controle da expressão gênica Prof. Dr. José Luis da C. Silva Controle da Expressão gênica Procariotos Princípios da regulação gênica Organismos procariontes e eucariontes são sensíveis à pequenas variações

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

NATUREZA E ESTRUTURA DO MATERIAL GENÉTICO

NATUREZA E ESTRUTURA DO MATERIAL GENÉTICO NATUREZA E ESTRUTURA DO MATERIAL GENÉTICO ÁCIDOS NUCLEICOS INTERVENÇÃO EM MUITAS REACÇÕES IMPORTANTES TRANSPORTE DA INFORMAÇÃO GENÉTICA DUPLICAÇÃO FIEL TRANSCRIÇÃO SELECTIVA VARIABILIDADE REPLICAÇÃO DNA

Leia mais

Análise descritiva de Dados. a) Média: (ou média aritmética) é representada por x e é dada soma das observações, divida pelo número de observações.

Análise descritiva de Dados. a) Média: (ou média aritmética) é representada por x e é dada soma das observações, divida pelo número de observações. Análise descritiva de Dados 4. Medidas resumos para variáveis quantitativas 4.1. Medidas de Posição: Considere uma amostra com n observações: x 1, x,..., x n. a) Média: (ou média aritmética) é representada

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo)

Análise da Prova - Perito Criminal Federal (Biomédico/Biólogo) Questão Tema(s) predominante(s) Itens do Edital 51 Diferenças entre as metodologias de RFLP e PCR 5.4.2 Regiões repetitivas e polimorfismos. 6.2 Técnica de PCR. 6.3 Técnicas de identificação usando o DNA.

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

UNIVERSIDADE FEDERAL DE VIÇOSA BIOINFORMÁTICA ESTRUTURAL: PREDIÇÃO DE ESTRUTURA 3D DE PROTEÍNAS

UNIVERSIDADE FEDERAL DE VIÇOSA BIOINFORMÁTICA ESTRUTURAL: PREDIÇÃO DE ESTRUTURA 3D DE PROTEÍNAS UNIVERSIDADE FEDERAL DE VIÇOSA BIOINFORMÁTICA ESTRUTURAL: PREDIÇÃO DE ESTRUTURA 3D DE PROTEÍNAS 2 BIOINFORMÁTICA ESTRUTURAL Área da bioinformática que se aplica ao estudo da estrutura das moléculas Desafio

Leia mais

EPIGENÉTICA E NUTRIÇÃO MATERNA. Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas

EPIGENÉTICA E NUTRIÇÃO MATERNA. Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas EPIGENÉTICA E NUTRIÇÃO MATERNA Augusto Schneider Faculdade de Nutrição Universidade Federal de Pelotas EPIGENÉTICA Estudo da variação herdável que ocorre sem mudança na sequência do DNA Mudanças de longo

Leia mais

http://www.de.ufpb.br/~luiz/

http://www.de.ufpb.br/~luiz/ UNIVERSIDADE FEDERAL DA PARAÍBA MEDIDAS DESCRITIVAS Departamento de Estatística Luiz Medeiros http://www.de.ufpb.br/~luiz/ Vimos que é possível sintetizar os dados sob a forma de distribuições de frequências

Leia mais

MUTAÇÕES TIPOS DE MUTAÇÃO GÊNICA

MUTAÇÕES TIPOS DE MUTAÇÃO GÊNICA MUTAÇÕES Eduardo Dias Embora um dos mais importantes requisitos do material genético seja a sua estabilidade, a capacidade de mudança também é necessária. As mutações gênicas são importantes para a evolução

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação

COLÉGIO XIX DE MARÇO excelência em educação OLÉIO XIX DE MRÇO excelência em educação 1ª PROV DE REPERÇÃO DE BIOLOI luno: Nº Série: 2º Turma: Data: Nota: Professor: Regina Volpato Valor da Prova: 40 pontos Orientações gerais: 1) Número de questões

Leia mais

O processo fisiológico que está representado no gráfico é

O processo fisiológico que está representado no gráfico é Questão 01) Analise o gráfico a seguir. Disponível em: . Acesso em: 22 set. 2014. O processo fisiológico que está representado no gráfico é a) o efeito do aumento

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais

DNA E SÍNTESE PROTEICA

DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de

ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO. Transmissão das características hereditárias DNA + RNA controle da produção de ÁCIDOS NUCLÉICOS E CÓDIGO GENÉTICO Os genes são formados por DNA; Transmissão das características hereditárias DNA + RNA controle da produção de proteínas da célula; 2 1.A estrutura dos ácidos nucléicos

Leia mais

Introdução à genética quantitativa usando os recursos do R

Introdução à genética quantitativa usando os recursos do R Introdução à genética quantitativa usando os recursos do R Marisa R. Cantarino 1 Julia M. P. Soler (orientadora) 2 1 Introdução Um dos principais desafios da pesquisa genética atualmente é estabelecer

Leia mais

Cap. 4: Componentes orgânicos celulares As moléculas multifuncionais. Equipe de Biologia

Cap. 4: Componentes orgânicos celulares As moléculas multifuncionais. Equipe de Biologia ap. 4: omponentes orgânicos celulares As moléculas multifuncionais Equipe de Biologia De que são formados os seres vivos? Substâncias orgânicas arboidratos Lipídios Proteínas Vitaminas Ácidos nucleicos

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_1º Teste 25/10/2010

BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_1º Teste 25/10/2010 BIOQUÍMICA E BIOLOGIA MOLECULAR 1º S_2010_2011_1º Teste 25/10/2010 (Duração: 1,5 h) Nome do Aluno: Nº: Curso: Cada uma das questões de escolha múltipla (1 à 40) tem a cotação de 0,5 valores. Será descontado

Leia mais

Aula 1. Controle da expressão gênica em procariotos. Módulo III Avançado. 1. Introdução. Biologia Molecular Básica

Aula 1. Controle da expressão gênica em procariotos. Módulo III Avançado. 1. Introdução. Biologia Molecular Básica Biologia Molecular Básica Módulo III Avançado Aula 1 Staphylococcus aureus Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais