3ªsérie 2º período B I O L O G I A QUESTÃO 1 QUESTÃO 3 QUESTÃO 2 2.3

Save this PDF as:
 WORD  PNG  TXT  JPG

Tamanho: px
Começar a partir da página:

Download "3ªsérie 2º período B I O L O G I A QUESTÃO 1 QUESTÃO 3 QUESTÃO 2 2.3"

Transcrição

1 2.3 QUESTÃO 1 Observe estas figuras, em que estão representados alguns aspectos da organização estrutural de um tecido. B I O L O G I A 3ªsérie 2º período Figura I Y X Explique a relação entre o megacariócito e o processo de coagulação sanguínea. (0,3) O macrófago é uma das células do tecido conjuntivo frouxo. Explique a função desta célula no organismo humano. (0,3) Cite três características das hemácias. (0,3) Em qual órgão encontramos a célula-tronco hematopoiética? (0,1) QUESTÃO 3 Analise o esquema abaixo representativo de um arco reflexo. Depois, faça o que é pedido. Z Figura II Considerando as informações dessas figuras e outros conhecimentos sobre o assunto, faça o que é pedido. Nomeie especificamente as células assinaladas com A e com C. (0,2) Observe a figura II, em que está representado um detalhe da região C, assinalada na figura I. Atualmente, a aplicação de BOTOX - toxina produzida pela bactéria Clostridium botulinum, tem sido utilizada para diminuição de rugas de expressão na região superior da face. Geralmente seu efeito dura alguns meses. Considerando a sequência de eventos representados na figura II, cite a provável etapa - X, Y ou Z - de atuação do BOTOX. Justifique sua resposta. (0,1 + 0,3) Qual a importância das células de Schwann para a ocorrência do evento mostrado na figura II? (0,4) QUESTÃO 2 Com base no esquema seguinte e em conhecimentos correlatos, faça o que é pedido. Nomeie as estruturas indicadas pelas letras A, B e C. (0,1 ponto cada) Sabendo que a estrutura B não encosta na estrutura C, explique como se dá a passagem do impulso nervoso daquela para esta. (0,3) O corte na estrutura indicada pela letra C provocaria que alterações no indivíduo, em nível motor e sensorial? (0,4) PÁG. 1

2 QUESTÃO 4 Observe a tabela de códons e os aminoácidos que eles especificam. Considerando as figuras e conhecimentos correlatos responda os itens: Apresente duas diferenças entre o processo de replicação e o processo de transcrição. (0,4) Construa um curto texto interligando os conceitos de gene, fenótipo, tradução gênica, DNA. (0,6) QUESTÃO 6 Observe o esquema a seguir: A sequência a seguir representa um RNA M que participará do processo de tradução gênica. Considere que a tradução ocorra da esquerda para direita. AUGACUGGACUCCGCUGGUGUUACCAGGAGUGA (RNA M) Considerando a tabela de códons, o RNA M dado e conhecimentos correlatos, responda aos itens: Considerando apenas os RNA's envolvidos, determine o número de códons e de anticódons utilizados na tradução deste RNA M? (0,2) Determine a sequência composta pelo primeiro, terceiro, sétimo e décimo primeiro aminoácidos (utilize apenas as abreviações) do polipeptídeo construído a partir desse RNA M. (0,5) Determine o número de pontes de hidrogênio existentes no trecho de DNA utilizado para a síntese do RNA M dado. (0,2) Determine o número de ligações peptídicas existentes no polipeptídeo formado. (0,1) QUESTÃO 5 Observe as figuras a seguir: esar_sezar/bio1_070.jpg Considerando o esquema e conhecimentos correlatos responda aos itens: O que determina a alta especificidade dos anticorpos na resposta imune? (0,4) Determine o tipo de imunização que ocorre no cavalo e na pessoa que recebe o soro. (0,4) Liste duas diferentes proteínas encontradas no sangue humano. (0,2) QUESTÃO 7 Diariamente, nosso organismo é invadido por uma infinidade de partículas estranhas chamadas antígenos, provenientes do ar que respiramos, da água que bebemos e dos alimentos que comemos. Também somos invadidos, sem perceber, por bactérias, vírus, fungos e protozoários, muitos deles causadores de doenças e produtores de toxinas que podem prejudicar seriamente nosso organismo, e até causar a morte. Nosso organismo produz várias substâncias imunológicas, em resposta a antígenos. Considerando o texto e conhecimentos correlatos responda os itens: Como são denominadas essas substâncias de defesa? (0,2) Em qual grupo de substâncias orgânicas essas moléculas de defesa devem ser incluídas? Justifique. (0,1 + 0,3) Estas biomoléculas são encontradas em uma vacina? Justifique. (0,4) QUESTÃO 8 No heredograma, as figuras cheias representam crianças afetados por uma doença genética. Se a doença for condicionada por um par de alelos recessivos localizados em cromossomos autossômicos, as probabilidades de o pai e de a mãe da futura criança serem portadores desse alelo são, respectivamente, (I) e (II). PÁG. 2

3 pai? C mãe Tendo em vista essas informações, faça o que a seguir é pedido. Calcule I (0,3) Calcule II (0,3) Calcule a probabilidade de pais A e B terem uma menina afetada pela doença. (0,4) QUESTÃO 9 Julgue as frases a seguir quanto a sua correção. Reescreva-as completamente, de forma correta, se necessário. Se não houver necessidade de correção, escreva INFORMAÇÃO CORRETA. Cruzamentos entre homozigotos para um par de gene produzirá descendentes com fenótipos e genótipos iguais a um dos pais. Casais com genótipos duplo homozigotos, formados por homem com sangue A, Rh positivo e mulher com sangue B, Rh negativo, podem gerar filhos que doam sangue para ambos os pais. Casais formados por homem com sangue O, Rh negativo e mulher com sangue A, Rh positivo geram filhos doadores apenas para um dos pais. Um casal com sangue AB, Rh positivo, gera filhos com sangue O, Rh negativo, se ambos forem duplamente heterozigotos. (E) Um homem e uma mulher que possuam sangues diferentes quanto ao sistema ABO e quanto ao sistema Rh podem gerar filhos que possam doar sangue para um dos componentes do casal. QUESTÃO 10 Durante muito tempo, a possibilidade de uma criança nascer com a doença hemolítica do recém-nascido ou eritoblastose fetal era sempre motivo de preocupação para a parturiente. A respeito dessa doença, responda ou faça o que a seguir é solicitado. Quais são as condições necessárias para que a doença hemolítica apareça? (0,4) Apresente um sintoma próprio dessa doença. (0,2) Como essa doença pode ser prevenida? (0,4) :: PÁG. 3

4 3ªsérie 2.3 BIOLOGIA 2º período :: 21/5/2009 QUESTÃO 1 Célula A: Célula C: A - B - C - QUESTÃO 2 QUESTÃO 4 QUESTÃO 5 QUESTÃO 3 PÁG. 1

5 QUESTÃO 9 QUESTÃO 6 QUESTÃO 7 (E) QUESTÃO 10 QUESTÃO 8 Calcule I Calcule II PÁG. 2

Biologia LIVRO 3 Unidade 1 Avaliação capítulos 1, 2, 3 e 4 Genética PRIMEIRA LEI DE MENDEL.

Biologia LIVRO 3 Unidade 1 Avaliação capítulos 1, 2, 3 e 4 Genética PRIMEIRA LEI DE MENDEL. PRIMEIRA LEI DE MENDEL. 1. Estabeleça, no quadro, a relação correta entre as colunas dos termos e respectivas definições presentes no estudo de genética. ( a ) penetrância ( b ) expressividade ( c ) dominância

Leia mais

2ª LISTA - GENÉTICA - 3º ANO - CMCG - PROF. BELAN

2ª LISTA - GENÉTICA - 3º ANO - CMCG - PROF. BELAN 2ª LISTA - GENÉTICA - 3º ANO - CMCG - PROF. BELAN 1. (FUVEST) A cor dos pelos nas cobaias é condicionada por uma série de alelos múltiplos com a seguinte escala de dominância: C (preta) > C 1 (marrom)

Leia mais

Programa de Retomada de Conteúdo 3º Bimestre

Programa de Retomada de Conteúdo 3º Bimestre Educação Infantil, Ensino Fundamental e Ensino Médio, Rua Cantagalo 305, 313, 325, 337 e 339 Tatuapé Fones: 2293-9166 Diretoria de Ensino Região LESTE 5 Programa de Retomada de Conteúdo 3º Bimestre Nome:

Leia mais

BIOLOGIA. Professor (a): Robyson 3º Ano Matutino 1 Bimestre. Aluno (a): Nº. a) 15% b) 25% c) 50% d) 100% e) 0%

BIOLOGIA. Professor (a): Robyson 3º Ano Matutino 1 Bimestre. Aluno (a): Nº. a) 15% b) 25% c) 50% d) 100% e) 0% Lista: BIOLOGIA 01 Professor (a): Robyson 3º Ano Matutino 1 Bimestre ata: 18 / 03 / 2015 Aluno (a): Nº 01. (UFPE) Renato (III.1), cuja avó materna e avô paterno eram albinos, preocupado com a possibilidade

Leia mais

No início do século XX, o austríaco Karl Landsteiner, misturando o sangue de indivíduos diferentes, verificou que apenas algumas combinações eram

No início do século XX, o austríaco Karl Landsteiner, misturando o sangue de indivíduos diferentes, verificou que apenas algumas combinações eram No início do século XX, o austríaco Karl Landsteiner, misturando o sangue de indivíduos diferentes, verificou que apenas algumas combinações eram compatíveis. Descobriu, assim, a existência do chamado

Leia mais

01) Observe a genealogia a seguir:

01) Observe a genealogia a seguir: COLÉGIO CEC CENTRO EDUCACIONAL CIANORTE ED. INFANTIL, ENS. FUNDAMENTAL E MÉDIO - SISTEMA ANGLO DE ENSINO. LISTA DE REVISÃO DE GENÉTICA TERCEIRÃO PROF. NANNI 01) Observe a genealogia a seguir: Sabendo-se

Leia mais

TD de revisão 8º Ano- 4ª etapa- 2015

TD de revisão 8º Ano- 4ª etapa- 2015 TD de revisão 8º Ano- 4ª etapa- 2015 1. Classifique os métodos anticoncepcionais abaixo, relacionando as colunas: (1) Natural ou comportamental (2) De Barreira (3) Hormonal (4)Cirúrgico ( ) Camisinha (M)

Leia mais

Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº. Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh

Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº. Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh . Ensino Médio 2º ano classe: Prof. Gustavo Nome: nº Lista de Exercícios 1ª Lei de Mendel, exceções e Sistema ABO e Rh. 1- Em um experimento, preparou-se um conjunto de plantas por técnica de clonagem

Leia mais

GENÉTICA. a) 180 b) 240 c) 90 d) 120 e) 360

GENÉTICA. a) 180 b) 240 c) 90 d) 120 e) 360 GENÉTICA 1. O gene autossômico que condiciona pêlos curtos no coelho é dominante em relação ao gene que determina pêlos longos. Do cruzamento entre coelhos heterozigotos nasceram 480 filhotes, dos quais

Leia mais

01/10/2012 GENÉTICA ANÁLISE DO HEREDOGRAMA PADRÃO DE HERANÇA AUTOSSÔMICO III. Autossômico recessivo - Fenótipo preto

01/10/2012 GENÉTICA ANÁLISE DO HEREDOGRAMA PADRÃO DE HERANÇA AUTOSSÔMICO III. Autossômico recessivo - Fenótipo preto GENÉTICA Heredogramas e Probabilidades ANÁLISE DO HEREDOGRAMA PADRÃO DE HERANÇA AUTOSSÔMICO Indivíduo sexo masculino normal Indivíduo sexo feminino normal Indivíduo sexo masculino afetado Indivíduo sexo

Leia mais

ENSINO MÉDIO. Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC

ENSINO MÉDIO. Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC ENSINO MÉDIO Disciplina: BIOLOGIA Professor: GUSTAVO Série: 2ª ABC 1- A Doença de Huntington (DH) é uma anomalia autossômica com caráter dominante, cuja manifestação ocorre na fase adulta, com uma progressiva

Leia mais

Primeira e Segunda Lei de Mendel, Polialelia, Sangue e Sexo

Primeira e Segunda Lei de Mendel, Polialelia, Sangue e Sexo Primeira e Segunda Lei de Mendel, Polialelia, Sangue e Sexo 1. Em uma espécie de planta, a forma dos frutos pode ser alongada, oval ou redonda. Foram realizados quatro tipos de cruzamento entre plantas

Leia mais

(www.joseferreira.com.br. Adaptado)

(www.joseferreira.com.br. Adaptado) Questão 01 - (FGV) A imagem da lâmina a seguir mostra um resultado obtido em teste de tipagem sanguínea humana para os sistemas ABO e Rh. O método consiste, basicamente, em pingar três gotas de sangue

Leia mais

Centro Educacional Juscelino Kubitschek

Centro Educacional Juscelino Kubitschek Centro Educacional Juscelino Kubitschek ALUNO: N.º: DATA: / / ENSINO: ( ) Fundamental (x) Médio SÉRIE: _3ª TURMA: TURNO: DISCIPLINA: _BIOLOGIA PROFESSOR: Silas Miranda 01- A genealogia abaixo apresenta

Leia mais

6Ï$%5$48$1'2$8725,=$'2

6Ï$%5$48$1'2$8725,=$'2 COLE AQUI A ETIQUETA. 6Ï$%5$48$1'2$8725,=$'2 /HLDDWHQWDPHQWHDVLQVWUXo}HVTXHVHVHJXHP 1 - Este caderno contém VHLV questões, constituídas de itens e subitens, abrangendo um total de TXDWRU]H páginas, numeradas

Leia mais

Projeto-síntese de Ciências 8º ano 3º trimestre

Projeto-síntese de Ciências 8º ano 3º trimestre Ciências/15 8º ano Turma: 3º trimestre Nome: Data: / / 8ºcie303r Caros alunos, Projeto-síntese de Ciências 8º ano 3º trimestre O 3º trimestre de Ciências encerra nossos estudos sobre o corpo humano e trata

Leia mais

o hemofílico. Meu filho também será?

o hemofílico. Meu filho também será? A U A UL LA Sou hemofílico. Meu filho também será? Nas aulas anteriores, você estudou alguns casos de herança genética, tanto no homem quanto em outros animais. Nesta aula, analisaremos a herança da hemofilia.

Leia mais

Genética. Leis de Mendel

Genética. Leis de Mendel Genética Leis de Mendel DEFINIÇÕES GENES: Pedaços de DNA síntese de determinada proteína. LOCUS GÊNICO: É o local ocupado pelo gene no cromossomo. GENES ALELOS: Situam-se no mesmo Locus Gênico. HOMOZIGOTOS:

Leia mais

I. Os anticorpos são transferidos através da placenta.

I. Os anticorpos são transferidos através da placenta. Revisão para recuperação Questão 01) A descoberta dos sistemas sanguíneos ABO e Rh teve grande impacto na área médica, pois permitiu realizar transfusões de sangue apenas entre pessoas de grupos sanguíneos

Leia mais

3-Esquematize o exame de tipagem sanguínea e possíveis resultados.

3-Esquematize o exame de tipagem sanguínea e possíveis resultados. Lista de exercícios para prova mensal do 3º bimestre 1-Diferencie autossomos de heterossomos. 2-Defina e exemplifique: a) Herança ligada ao sexo b) Herança restrita ao sexo c) Herança influenciada pelo

Leia mais

QUESTÃO 01 QUESTÃO 02(UNISA)

QUESTÃO 01 QUESTÃO 02(UNISA) Disciplina: Biologia Data: /09/2012 Professor: Luiz Carlos Panisset Travassos Turma: 3º Tipo de Atividade: Atividades de recuperação Segmento:EM/Agro Etapa:2ª Nome do(a) aluno(a): QUESTÃO 01 Uma criança

Leia mais

Resoluções das atividades

Resoluções das atividades LIVRO BIOLOGIA Resoluções das atividades Sumário Capítulo 5 Genética do sangue e eritroblastose fetal Capítulo 6 Herança dos cromossomos sexuais Capítulo 7 Lei da Segregação Independente e interação gênica

Leia mais

Vizinho Seu José, isto vai ser muito difícil de conseguir; melhor o senhor comprar outros porcos com esse jeitão.

Vizinho Seu José, isto vai ser muito difícil de conseguir; melhor o senhor comprar outros porcos com esse jeitão. Exercício 1: (UFSC 2010) Seu José da Silva, um pequeno criador de porcos do Oeste do Estado de Santa Catarina, desejando melhorar a qualidade de sua criação, comprou um porco de raça diferente daquela

Leia mais

UFMG - 2003 2º DIA BIOLOGIA BERNOULLI COLÉGIO E PRÉ-VESTIBULAR

UFMG - 2003 2º DIA BIOLOGIA BERNOULLI COLÉGIO E PRÉ-VESTIBULAR UFMG - 2003 2º DIA BIOLOGIA BERNOULLI COLÉGIO E PRÉ-VESTIBULAR Biologia Questão 01 Observe estas figuras, em que estão representadas a produtividade anual de 1 m 2 de pasto e a quantidade de alimento que

Leia mais

Genética humana e saúde. Grupos sanguíneos (ABO e Rh): transfusão e incompatibilidade T E M A 2

Genética humana e saúde. Grupos sanguíneos (ABO e Rh): transfusão e incompatibilidade T E M A 2 Genética humana e saúde T E M A 2 Neste tema, você conhecerá algumas características do ser humano que possuem base genética, como os grupos sanguíneos. Também estudará doenças decorrentes de mau funcionamento

Leia mais

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre Disciplina: Biologia Educacional Curso: Pedagogia 2 Semestre Texto 2: GENÉTICA HEREDITARIEDADE A genética é um a ciência que estuda o material hereditário e os mecanismos de sua transmissão de geração

Leia mais

O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário

O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário O albinismo é uma doença metabólica hereditária, resultado de disfunção gênica na produção de melanina. Para que a doença se manifeste é necessário que a mutação esteja em homozigose (doença autossômica

Leia mais

Conteúdos Programáticos

Conteúdos Programáticos Página 1 de 11 SECRETARIA DE ESTADO DE CIÊNCIA E TECNOLOGIA SECTEC FUNDAÇÃO DE APOIO À ESCOLA TÉCNICA FAETEC ESCOLA TÉCNICA ESTADUAL JOÃO LUIZ DO NASCIMENTO RUA DR. LOURIVAL RIBEIRO DA SILVA Nº 272, NOVA

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 46 SISTEMA AB0

BIOLOGIA - 2 o ANO MÓDULO 46 SISTEMA AB0 BIOLOGIA - 2 o ANO MÓDULO 46 SISTEMA AB0 Fenótipo Aglutinogênio (hemácias) Aglutinina (plasma) A A Anti-B B B Anti-A Genótipos I A I A ou I A i/ AA ou AO I B I B ou I B i/ BB ou BO AB A e B - I A I B /

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 2004) As três cores de pelagem de cães labradores (preta, marrom e dourada) são condicionadas pela interação de dois genes autossômicos, cada um deles com dois alelos: "Ee" e "Bb". Os cães homozigóticos

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 92) Nos anos 40, o famoso cineasta Charlie ChapIin foi acusado de ser o pai de uma criança, fato que ele não admitia. Os exames de sangue revelaram que a mãe era do grupo A, a criança do grupo

Leia mais

1ª LEI DE MENDEL 17/05/2012. 1) Conceitos Prévios. a) Genética

1ª LEI DE MENDEL 17/05/2012. 1) Conceitos Prévios. a) Genética 1) Conceitos Prévios a) Genética É a ciência que estuda a transmissão de características hereditárias de pais para filhos ao longo das gerações. b) Gene Segmento da molécula de DNA capaz de determinar

Leia mais

Genética Grupos sanguíneos

Genética Grupos sanguíneos Genética Grupos sanguíneos 1- Em um banco de sangue, existe o seguintes estoque: 12 litros de sangue do tipo A, 7 litros de sangue do tipo B, 3 litros de sangue do tipo AB e 10 litros de sangue do tipo

Leia mais

As flores de uma determinada planta podem ser brancas, vermelhas ou creme. A cor branca (ausência de deposição de pigmento) é condicionada por alelo

As flores de uma determinada planta podem ser brancas, vermelhas ou creme. A cor branca (ausência de deposição de pigmento) é condicionada por alelo As flores de uma determinada planta podem ser brancas, vermelhas ou creme. A cor branca (ausência de deposição de pigmento) é condicionada por alelo recessivo (aa). O alelo A determina a deposição de pigmento.

Leia mais

GENÉTICA 1ª Lei de Mendel

GENÉTICA 1ª Lei de Mendel GENÉTICA 1ª Lei de Mendel 1) Um rato marrom foi cruzado com duas fêmeas pretas. Uma delas teve 7 filhotes pretos e 6 filhotes de cor marrom. A outra teve 14 filhotes de cor preta. Os genótipos do macho

Leia mais

Órion MEDICINA BIOLOGIA. (Tovar) NOME: Lista 03 Jundiaí e Maracanã

Órion MEDICINA BIOLOGIA. (Tovar) NOME: Lista 03 Jundiaí e Maracanã Órion MEDICIN BIOLOGI (Tovar) NOME: Lista 03 Jundiaí e Maracanã 01) Sabe-se em determinada população manifestam-se 3(três) tipos de alelos, e e a relação de dominância é > >. Suponha numa população hipotética

Leia mais

BIOLOGIA Prof.: Camacho Lista: 08 Aluno(a): Turma: Data: 01/04/2015

BIOLOGIA Prof.: Camacho Lista: 08 Aluno(a): Turma: Data: 01/04/2015 BIOLOGIA Prof.: Camacho Lista: 08 Aluno(a): Turma: Data: 01/04/2015 Questão 01) Uma mulher pertencente ao tipo sanguíneo A, Rh casa-se com um homem pertencente ao tipo B, Rh+, que nasceu com eritroblastose

Leia mais

Aula 14 Sistema ABO. Grupo sangüíneo (fenótipo) Aglutinogênio (hemácias) Aglutinina (soro) Anti - B. Anti - A. A e B.

Aula 14 Sistema ABO. Grupo sangüíneo (fenótipo) Aglutinogênio (hemácias) Aglutinina (soro) Anti - B. Anti - A. A e B. Aula 14 Sistema ABO A transfusão de sangue incompatível pode provocar queda de pressão, escurecimento da visão, desmaio e até a morte. Esses efeitos são devidos a uma reação de aglutinação, ou seja reunião

Leia mais

01 - (UNIMEP RJ) 02 - (GAMA FILHO RJ) 03 - (UFPA) 04 - (UFRJ) 05 - (FUVEST SP)

01 - (UNIMEP RJ) 02 - (GAMA FILHO RJ) 03 - (UFPA) 04 - (UFRJ) 05 - (FUVEST SP) 01 - (UNIMEP RJ) Assinale a alternativa que apresenta um casal que pode ter descendentes com todos os tipos sangüíneos do sistema ABO. a) IA i x IA IB b) i i x i I c) IA IB x IA IB d) IA IA x IB i e) nenhuma

Leia mais

Histologia e Genética

Histologia e Genética Histologia e Genética Sangue Tecido Conjuntivo Sanguíneo Sistema ABO Sistema RH Sistema MN Sangue Tecido Conjuntivo Sanguíneo O sangue é o sistema de transporte interno de todos os vertebrados e de vários

Leia mais

A PRIMEIRA LEI DE MENDEL E A ESPÉCIE HUMANA TESTES

A PRIMEIRA LEI DE MENDEL E A ESPÉCIE HUMANA TESTES 1 A PRIMEIRA LEI DE MENDEL E A ESPÉCIE HUMANA TESTES 1) Se um homem for heterozigoto para o albinismo: I.Qual a proporção dos espermatozoides que conterão um gene A e dos que conterão o gene a? II. E se

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 55 HERANÇA LIGADA AO SEXO

BIOLOGIA - 2 o ANO MÓDULO 55 HERANÇA LIGADA AO SEXO BIOLOGIA - 2 o ANO MÓDULO 55 HERANÇA LIGADA AO SEXO Mulher portadora Homem não afectado Gene normal Gene alterado Mulher portadora Mulher não afectada Homem não afectado Homem afectado Homem afectado

Leia mais

2. Nesse sistema, ocorre uma relação de protocooperação entre algas e bactérias.

2. Nesse sistema, ocorre uma relação de protocooperação entre algas e bactérias. PROVA DE BIOLOGIA QUESTÃO 01 Entre os vários sistemas de tratamento de esgoto, o mais econômico são as lagoas de oxidação. Essas lagoas são reservatórios especiais de esgoto, que propiciam às bactérias

Leia mais

COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a):

COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a): COLÉGIO SHALOM Ensino Fundamental 8 Ano Prof.ª: Nize C.Pavinato - Disciplina: Ciências Aluno(a): Trabalho de Recuperação Data: / /15 1. O sistema endócrino é formado por glândulas endócrinas e de secreção

Leia mais

CADERNO DE EXERCÍCIOS 3D

CADERNO DE EXERCÍCIOS 3D CADERNO DE EXERCÍCIOS 3D Ensino Médio Ciências da Natureza II Questão Conteúdo Habilidade da Matriz da EJA/FB 1 Fórmula estrutural de compostos H25 e H26 orgânicos 2 Conceitos em Genética, Doenças H66/

Leia mais

Profs. Nolinha e Thomaz

Profs. Nolinha e Thomaz 1 TREINAMENTO DE QUESTÕES DISCURSIVAS () Profs. Nolinha e Thomaz QUESTÃO 01 Um pesquisador realizou um experimento para verificar a influência da bainha de mielina na velocidade de condução do impulso

Leia mais

4. Os anestésicos, largamente usados pela medicina, tornam regiões ou todo o organismo insensível à dor porque atuam:

4. Os anestésicos, largamente usados pela medicina, tornam regiões ou todo o organismo insensível à dor porque atuam: MATÉRIA: Biologia PROFESSOR: Warley SÉRIE: 3º ano TIPO: Atividade de Recuperação - 2ª etapa 1. Quais os tipos de músculos encontrados no corpo humano? 2. As células do tecido muscular cardíaco apresentam

Leia mais

Dominância Incompleta Codominância Alelos Múltiplos (polialelismo) Alelos Letais Epistasia (interação génica)

Dominância Incompleta Codominância Alelos Múltiplos (polialelismo) Alelos Letais Epistasia (interação génica) Dominância Incompleta Codominância Alelos Múltiplos (polialelismo) Alelos Letais Epistasia (interação génica) Dominância Incompleta Codominância Alelos Múltiplos (polialelismo) Alelos Letais Epistasia

Leia mais

PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert

PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert PLANO DE AULA Autores: Ana Paula Farias Waltrick, Stephanie Caroline Schubert 1. DADOS DE IDENTIFICAÇÃO Nível de Ensino: Ensino Médio Ano/Série: 3º ano Disciplina: Biologia Quantidade de aulas: 2 2. TEMA

Leia mais

A) As moléculas orgânicas simples obtidas são glicerídios que são utilizados pelo organismo com função reguladora.

A) As moléculas orgânicas simples obtidas são glicerídios que são utilizados pelo organismo com função reguladora. QUESTÃO 1 "Ceará joga fora opção alimentar" Segundo pesquisas da UFC, a cada ano 800 toneladas de carne de cabeça de lagosta não são aproveitadas sendo lançadas ao mar. "0 estudo sobre hidrólise enzimática

Leia mais

Genética Conceitos Básicos

Genética Conceitos Básicos Genética Conceitos Básicos O que é genética? É o estudo dos genes e de sua transmissão para as gerações futuras. É dividida em: Genética Clássica Mendel (1856 1865) Genética Moderna Watson e Crick (1953).

Leia mais

Disciplina: Biologia Série: 2ª série EM - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Genética de Populações

Disciplina: Biologia Série: 2ª série EM - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Genética de Populações Disciplina: Biologia Série: 2ª série EM - 1º TRIM Professora: Ivone Azevedo da Fonseca Assunto: Genética de Populações GENÉTICA DE POPULAÇÕES Quando estudamos, em determinada família ou linhagem, o modo

Leia mais

Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula. Calendário 4º Bimestre 2ºC

Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula. Calendário 4º Bimestre 2ºC Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula 30/10 isto Caderno - Exercícios Genética Parte 1 (3 Pontos) 13/11 isto Caderno -

Leia mais

Ciências E Programa de Saúde

Ciências E Programa de Saúde Governo do Estado de São Paulo Secretaria de Estado da Educação Ciências E Programa de Saúde 13 CEEJA MAX DADÁ GALLIZZI PRAIA GRANDE SP Vai e avisa a todo mundo que encontrar que ainda existe um sonho

Leia mais

PlanetaBio Resolução de Vestibulares UNICAMP 2011 2ª fase www.planetabio.com

PlanetaBio Resolução de Vestibulares UNICAMP 2011 2ª fase www.planetabio.com 1- Doenças graves como o botulismo, a lepra, a meningite, o tétano e a febre maculosa são causadas por bactérias. As bactérias, no entanto, podem ser úteis em tecnologias que em pregam a manipulação de

Leia mais

GENÉTICA HUMANA HISTÓRICO 26/08/2013 GREGOR MENDEL AULA 3 RELAÇÃO GENÓTIPO-FENÓTIPO

GENÉTICA HUMANA HISTÓRICO 26/08/2013 GREGOR MENDEL AULA 3 RELAÇÃO GENÓTIPO-FENÓTIPO GENÉTICA HUMANA AULA 3 RELAÇÃO GENÓTIPO-FENÓTIPO CURSO: Psicologia SÉRIE: 2º Semestre CARGA HORÁRIA SEMANAL: 02 Horas/aula CARGA HORÁRIA SEMESTRAL: 40 Horas HISTÓRICO GREGOR MENDEL 1822 Nasceu em Heinzendorf,

Leia mais

10.04. Este casal poderá ter uma criança com Eritroblastose Fetal. A probabilidade é de 50%. CRUZAMENTO Mulher Homem rr X Rr

10.04. Este casal poderá ter uma criança com Eritroblastose Fetal. A probabilidade é de 50%. CRUZAMENTO Mulher Homem rr X Rr BIO 4E aula 10 10.01. Para que ocorra a Eritroblastose Fetal (Doença Hemolítica do Recém Nascido) a mãe deve ter sangue Rh - e ter sido sensibilizada, e a criança deve ser Rh +. 10.02. Quando uma mulher

Leia mais

Questão 1 Questão 2. Questão 3. Resposta. Resposta

Questão 1 Questão 2. Questão 3. Resposta. Resposta Questão 1 Questão 2 O esquema abaixo representa as principais relações alimentares entre espécies que vivem num lago de uma região equatorial. a) O câncer é uma doença genética, mas na grande maioria dos

Leia mais

USO EXCLUSIVO DA ORGANIZAÇÃO

USO EXCLUSIVO DA ORGANIZAÇÃO OBC 2015 Fase Final 22 de agosto de 2015 CÓDIGO OBC CADERNO 2 USO EXCLUSIVO DA ORGANIZAÇÃO TESTES FÍSICA QUÍMICA BIOLOGIA QUESTÕES TOTAL Máximo 30,0 10,0 10,0 10,0 30,0 60,0 Nota 1 Nota 2 Nota 3 01 02

Leia mais

Ervilhas, Hereditariedade e o Nascimento da Genética

Ervilhas, Hereditariedade e o Nascimento da Genética Volume 1 Módulo 2 Biologia Unidade 3 Ervilhas, Hereditariedade e o Nascimento da Genética Para início de conversa... Desde a unidade 1, estamos construindo um conhecimento importante sobre o campo da Biologia,

Leia mais

Biologia UNIVERSIDADE ESTADUAL DE FEIRA DE SANTANA PROGRAD CSA

Biologia UNIVERSIDADE ESTADUAL DE FEIRA DE SANTANA PROGRAD CSA UNIVERSIDADE ESTADUAL DE FEIRA DE SANTANA PROGRAD CSA ProSel 2015.2 - Recursos Interpostos Nota: As justificativas aqui descritas estão exatamente como constam no banco de dados, no tocante à ortografia

Leia mais

Lista de Genética 2º EM Colégio São José - 2013

Lista de Genética 2º EM Colégio São José - 2013 1. (Fuvest 91) No porquinho-da-índia existe um par de genes autossômicos que determina a cor da pelagem: o alelo dominante B determina a cor preta e o recessivo b, a cor branca. Descreva um experimento

Leia mais

UFMG - 2004 2º DIA BIOLOGIA BERNOULLI COLÉGIO E PRÉ-VESTIBULAR

UFMG - 2004 2º DIA BIOLOGIA BERNOULLI COLÉGIO E PRÉ-VESTIBULAR UFMG - 2004 2º DIA BIOLOGIA BERNOULLI COLÉGIO E PRÉ-VESTIBULAR Biologia Questão 01 Uma indústria localizada na região assinalada com o algarismo I, no mapa a seguir, foi responsável pelo derramamento de

Leia mais

Lista de Exercícios GENÉTICA Grupos Sanguíneos Profº Fernando Teixeira fernando@biovestiba.net

Lista de Exercícios GENÉTICA Grupos Sanguíneos Profº Fernando Teixeira fernando@biovestiba.net Lista de Exercícios GENÉTICA Grupos Sanguíneos Profº Fernando Teixeira fernando@biovestiba.net 01 - (MACK SP/2013) b) os candidatos III e IV podem ser excluídos da paternidade. c) o candidato I é o pai

Leia mais

BIOLOGIA SETOR 1402 REVISÃO R 4

BIOLOGIA SETOR 1402 REVISÃO R 4 REVISÃO R 4 SETOR 1402 BIOLOIA 1. (Fuvest) No heredorama abaixo estão representadas pessoas que têm uma doença enética muito rara, cuja herança é dominante. A doença é causada por mutação em um ene localizado

Leia mais

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO

A FAMÍLIA SILVA E SEUS GENES. Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO A FAMÍLIA SILVA E SEUS GENES Os filhos são diferentes, mas todos são Silva. Saiba como! ALBINO PIGMENTADO PROCEDIMENTO PROCEDIMENTO PARTE 1 Determinação dos genótipos dos pais 1.1. Observar a aparência

Leia mais

Sangue. A herança a dos grupos sanguíneos neos humanos. Professora Catarina

Sangue. A herança a dos grupos sanguíneos neos humanos. Professora Catarina A herança a dos grupos sanguíneos neos humanos Genética Professora Catarina Sangue Principais funções: Transportar O 2 e nutrientes a todas as células c do corpo; Recolher CO 2 e excreções; Transportar

Leia mais

Questão 1. Questão 3. Questão 2 1ª PARTE: QUESTÕES OBJETIVAS. alternativa E. alternativa B. A, B e C pertenceriam, respectivamente, a organismos

Questão 1. Questão 3. Questão 2 1ª PARTE: QUESTÕES OBJETIVAS. alternativa E. alternativa B. A, B e C pertenceriam, respectivamente, a organismos 1ª PARTE: QUESTÕES OBJETIVAS Questão 1 O exame de um epitélio e do tecido nervoso de um mesmo animal revelou que suas células apresentam diferentes características. Isso ocorre porque a) as moléculas de

Leia mais

Grupo I 1. (14 pontos) A figura em baixo mostra uma representação esquemática de uma célula eucariótica.

Grupo I 1. (14 pontos) A figura em baixo mostra uma representação esquemática de uma célula eucariótica. Provas Especialmente Adequadas Destinadas a Avaliar a Capacidade para a Frequência dos Cursos Superiores do Instituto Politécnico de Leiria dos Maiores de 23 Anos - 2011 Prova de conhecimentos específicos

Leia mais

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Biologia Princípios Básicos de Genética A genética é a parte da biologia que trata do estudo dos genes e de suas manifestações,

Leia mais

Questão 1. Questão 3. Questão 2. Resposta. Resposta

Questão 1. Questão 3. Questão 2. Resposta. Resposta Questão 1 Uma enzima, extraída da secreção de um órgão abdominal de um cão, foi purificada, dissolvida em uma solução fisiológica com ph 8 e distribuída em seis tubos de ensaio. Nos tubos 2, 4 e 6, foi

Leia mais

COLÉGIO XIX DE MARÇO excelência em educação PROVA DE RECUPERAÇÃO ANUAL DE CIÊNCIAS

COLÉGIO XIX DE MARÇO excelência em educação PROVA DE RECUPERAÇÃO ANUAL DE CIÊNCIAS COLÉGIO XIX DE MARÇO excelência em educação 2012 PROVA DE RECUPERAÇÃO ANUAL DE CIÊNCIAS Aluno(a): Nº Ano: 8º Turma: Data: / /2013 Nota: Professor(a): Karina Valor da Prova: 90 pontos MATUTINO: Orientações

Leia mais

03. (Pucrj 2010) A ovelha Dolly, primeiro clone animal oficialmente declarado, após adulta foi acasalada com um macho não aparentado.

03. (Pucrj 2010) A ovelha Dolly, primeiro clone animal oficialmente declarado, após adulta foi acasalada com um macho não aparentado. 01.(Enem PPL 2012) Após a redescoberta do trabalho de Gregor Mendel, vários experimentos buscaram testar a universalidade de suas leis. Suponha um desses experimentos, realizado em um mesmo ambiente, em

Leia mais

Nome: Nº Ano: 3º Turma: Disciplina: Biologia Professor: Wanessa Data: / /

Nome: Nº Ano: 3º Turma: Disciplina: Biologia Professor: Wanessa Data: / / Nome: Nº Ano: 3º Turma: Disciplina: Biologia Professor: Wanessa Data: / / 1ª Lei de Mendel 01. Ordene as duas colunas e assinale a ordem certa. Atividade 1 Lista de exercícios Genética 05. Qual a probabilidade

Leia mais

De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um

De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um De acordo com a segunda lei de Mendel, assinale o que for correto, no que ser refere ao cálculo referente aos tipos de gametas formados por um indivíduo. 01) Considerando-se um indivíduo AaBbcc pode-se

Leia mais

GOIÂNIA, / / 2015. PROFESSOR: FreD. ALUNO(a): Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

GOIÂNIA, / / 2015. PROFESSOR: FreD. ALUNO(a): Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações: GOIÂNIA, / / 2015 PROFESSOR: FreD DISCIPLINA: Biologia SÉRIE: 1º ALUNO(a): Lista de Exercícios No Anhanguera você é + Enem Antes de iniciar a lista de exercícios leia atentamente as seguintes orientações:

Leia mais

1 GENÉTICA MENDELIANA

1 GENÉTICA MENDELIANA 1 GENÉTICA MENDELIANA Gregor J. Mendel nasceu em 1822, no ano de 1843 ingressou no mosteiro Altbriinn, que pertencia à Ordem dos Agostinianos, na antiga cidade de Bruiinn, Áustria, hoje Brno, República

Leia mais

MENDELISMO. Primeira Lei de Mendel ou Princípio da Segregação ou Lei da pureza dos gametas:

MENDELISMO. Primeira Lei de Mendel ou Princípio da Segregação ou Lei da pureza dos gametas: Genética Animal - Mendelismo 1 MENDELISMO Primeira Lei de Mendel ou Princípio da Segregação ou Lei da pureza dos gametas: Mendel concluiu que os padrões hereditários são determinados por fatores (genes)

Leia mais

Áudio. GUIA DO PROFESSOR Síndrome de Down - Parte I

Áudio. GUIA DO PROFESSOR Síndrome de Down - Parte I Síndrome de Down - Parte I Conteúdos: Tempo: Síndrome de Down 5 minutos Objetivos: Auxiliar o aluno na compreensão do que é síndrome de Down Descrição: Produções Relacionadas: Neste programa de Biologia

Leia mais

P R O V A DE BIOLO G I A I I

P R O V A DE BIOLO G I A I I 10 P R O V A DE BIOLO G I A I I QUESTÃO 31 Uma criança do sexo masculino pertencente ao grupo sangüíneo AB e com síndrome de Down foi curada de uma leucemia, após receber transplante de medula óssea proveniente

Leia mais

A probabilidade de nascer uma menina afetada do cruzamento de 3 com 11 é: a) 0,00 b) 0,25 c) 0,50 d) 0,75 e) 1,00

A probabilidade de nascer uma menina afetada do cruzamento de 3 com 11 é: a) 0,00 b) 0,25 c) 0,50 d) 0,75 e) 1,00 Genética e Evolução 1. A mosca drosófila, de olho branco, apresenta a constituição genética X W Y e não possui gene para olho vermelho, que impede a manifestação do outro gene, para olho branco. Na frase,

Leia mais

Primeira Lei de Mendel e Heredograma

Primeira Lei de Mendel e Heredograma Primeira Lei de Mendel e Heredograma 1. (UFC-2006) Leia o texto a seguir. A Doença de Alzheimer (D.A.) (...) é uma afecção neurodegenerativa progressiva e irreversível, que acarreta perda de memória e

Leia mais

INTERAÇÃO GÊNICA EPISTASIA POLIGENIA OU HERANÇA QUANTITATIVA. PM/Bombeiro - PR. Oromar Ciências Humanas Parte 03. Foto das cristas de galinhas

INTERAÇÃO GÊNICA EPISTASIA POLIGENIA OU HERANÇA QUANTITATIVA. PM/Bombeiro - PR. Oromar Ciências Humanas Parte 03. Foto das cristas de galinhas INTERAÇÃO GÊNICA Ocorre quando dois ou mais pares de genes, situados em cromossomos homólogos diferentes, interagem entre si para determinar uma mesma característica. FENÓTIPOS Crista ervilha Crista rosa

Leia mais

Padrão de respostas às questões discursivas

Padrão de respostas às questões discursivas Padrão de respostas às questões discursivas A seguir encontram-se as questões das provas discursivas da 2ª ETAPA do Vestibular UFF 2011, acompanhadas das respostas esperadas pelas bancas. GABARITO BIOLOGIA

Leia mais

Vestibulando Web Page www.vestibulandoweb.com.br - SIMULADO X -

Vestibulando Web Page www.vestibulandoweb.com.br - SIMULADO X - - SIMULADO X - 01) (UFES/2008) (BIRNER, E. UZUNIAN, E. Biologia 2. 3. ed. São Paulo: Harbra, 2005, p. 297.) As figuras acima apresentam um inseto, um crustáceo e um anelídeo, respectivamente, que, apesar

Leia mais

TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres. INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade

TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres. INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade TD DE CIÊNCIAS 8ª. série PROFa. Marjory Tôrres INTRODUÇÃO À GENÉTICA Os princípios básicos da Hereditariedade Todas as pessoas são diferentes, cada um é único, apresentam características que são próprias

Leia mais

PROVA DE AVALIAÇÃO DOS CONHECIMENTOS E COMPETÊNCIAS BIOLOGIA. Nome:

PROVA DE AVALIAÇÃO DOS CONHECIMENTOS E COMPETÊNCIAS BIOLOGIA. Nome: PROVA DE AVALIAÇÃO DOS CONHECIMENTOS E COMPETÊNCIAS BIOLOGIA 13/06/2011 Nome: 1. Classifique as afirmações seguintes como verdadeira (V) ou falsa (F): a) A espermatogénese é um processo contínuo, com inicio

Leia mais

Primeira Lei de Mendel -> recebe mais dois nomes: dominância completa (heterozigoto manifesta uma das duas características) ou monohibridismo

Primeira Lei de Mendel -> recebe mais dois nomes: dominância completa (heterozigoto manifesta uma das duas características) ou monohibridismo Genética 1ª Lei de Mendel Começa a fazer a divisão com os indivíduos parentais, puros, com base na cor dos parentais. Alelos, partes de um cromossomo, são genes situados na mesma posição de cromossomos

Leia mais

GABARITO DEFINITIVO DA IX OBB (1ª FASE)

GABARITO DEFINITIVO DA IX OBB (1ª FASE) (1/5) Resolução Comentada OBB IX Fase 1 GABARITO DEFINITIVO DA IX OBB (1ª FASE) 1 A B C D E 11 A B C D E 21 A B C D E 2 A B C D E 12 A B C D E 22 A B C D E 3 A B C D E 13 A B C D E 23 A B C D E 4 A B C

Leia mais

ANTÍGENO OU AGLUTINOGÊNIO (nas hemácias)

ANTÍGENO OU AGLUTINOGÊNIO (nas hemácias) HERANÇA DOS GRUPOS SANGÜÍNEOS NA ESPÉCIE HUMANA SISTEMA ABO É um caso de polialelia porque existem três alelos envolvidos (I A, I B, i); O alelo I A determina a produção do antígeno ou aglutinogênio A

Leia mais

Questão 01 Gabarito: 27 Comentário

Questão 01 Gabarito: 27 Comentário Questão 01 Gabarito: 27 Biologia 01. Correta, pois essa é a definição de metabolismo basal, que consiste nas reações que garantem a sobrevivência do indivíduo e dos seus tecidos. 02. Correta, uma vez que

Leia mais

Exercícios de Aprofundamento Bio - Genética

Exercícios de Aprofundamento Bio - Genética . (Unesp 205) Fátima tem uma má formação de útero, o que a impede de ter uma gestação normal. Em razão disso, procurou por uma clínica de reprodução assistida, na qual foi submetida a tratamento hormonal

Leia mais

Sistema Cardiovascular

Sistema Cardiovascular Sistema Cardiovascular O sistema cardiovascular é responsável pela circulação do sangue. O sangue transporta: nutrientes obtidos na digestão; Oxigênio; Gás carbônico; Resíduos; Hormônios. Vasos Sanguíneos

Leia mais

ATIVIDADE DE RECUPERAÇÃO PARALELA PREVENTIVA 3º Trimestre/2014 GABARITO

ATIVIDADE DE RECUPERAÇÃO PARALELA PREVENTIVA 3º Trimestre/2014 GABARITO NOME: ANO: 2º EM Nº: PROF.(A): Claudia Lobo DATA: ATIVIDADE DE RECUPERAÇÃO PARALELA PREVENTIVA 3º Trimestre/2014 GABARITO 1. A fenilcetonúria é uma doença que tem herança autossômica recessiva. Considere

Leia mais