GENÉTICA E BIOLOGIA MOLECULAR. Prof. Dra. Luciana Maria de Hollanda

Tamanho: px
Começar a partir da página:

Download "GENÉTICA E BIOLOGIA MOLECULAR. Prof. Dra. Luciana Maria de Hollanda"

Transcrição

1

2 GENÉTICA E BIOLOGIA MOLECULAR Prof. Dra. Luciana Maria de Hollanda

3 Quem é vc Professora? A primeira dúvida que surge Quando a gente inicia um semestre é

4 Eu sou o que sou! Sou o capitão da minha alma e o mestre do meu destino!! Graduação: Licenciatura em Ciências Biológicas (UNICAMP) Mestrado: Genética e Biologia Molecular em Procariotos, no Departamento de Genética, Evolução e Biopatógenos (Conceito 7 CAPES) Doutorado: Genética e Biologia Molecular de Eucariotos, no Hemocentro vinculado ao HC-UNICAMP (Conceito 7 CAPES) Pós-Doutorado UNICAMP Biologia Molecular, Biotecnologia, Nanoncologia.

5

6 Antes de iniciar a aula Vamos aos...

7

8 Aulas Teóricas Com o emprego de metodologias ativas Todas as aulas ministradas as Terças-Feiras Bloco C Sala 53 Das 20:35 as 22:15 Lista de Presença como chamada

9 Na semana anterior a PROVA será realizada um estudo dirigido, ou Host, da matéria da prova. Questões respondidas em grupo (Grupos de 5 alunos) Valor da ME = 2 pontos

10

11 PROFESSORA... E COMO SERÁ A PROVA? QUANTAS SERÃO? QUANTO VALE?

12 Duas Avaliações: Uma Avaliação ao final da Unidade Programática 1 (UP1) Cairá somente o conteúdo da UP1 Provas contextualizadas (PC) com questões a luz do ENADE e, terão 8 questões Cada questão valendo 1 ponto PC = 8.0 pontos

13 Uma Avaliação ao final da Unidade Programática 2 (UP2) Cairá o conteúdo de toda a disciplina As Provas serão contextualizadas (PC2) e terão 8 questões Cada questão valendo 1 ponto PC2 = 8.0 pontos

14 Como será calculada a Média Final (MF) MF = (UP1 x 4) + (UP2 x 6) 10 MF 6,00 (aluno aprovado) MF 4,0 e 5,99 (aluno Prova Final)

15 HbF Como será a Prova Final (PF)?? CAIRÁ TODA MATÉRIA DO SEMESTRE PROVA COM 10 QUESTÕES CADA QUESTÃO VALENDO 1 PONTO Prova Final

16 Albert Einstein Marie Curie

17

18 Todo material destas aulas

19 Profa. Como a gente te acha para perguntar sobre a matéria antes da prova com

20

21

22 E porque?

23

24 Porque toda a origem de......todos os animais do planeta

25

26 Além disso......o aparecimento de algumas doenças...

27

28 Mas Professora... Genética o que Estuda?

29 Em outras palavras BM e Genética... BM = Estuda as principais moléculas (DNA, RNA e Proteína que fazem parte da vida, e cujo a qual sem elas a vida não existiria! Genética = E como essa informação genética é transmitida para os seus descendentes. "Uma vida não questionada não merece ser vivida." (Platão)

30

31 Ciclo da Vida

32 #tátudobematéaqui? #algumadúvida?

33

34

35 A genética é o ramo da biologia responsável pelo estudo da hereditariedade e de tudo o que esteja relacionado com a mesma. O objeto de estudo da genética são os padrões de hereditariedade, isto é, o modo com os traços e as características se transmitem dos pais para os filhos.

36 CLÁSSICA OU MENDELIANA Populações ou Evolutiva Que se centra no estudo dos cromossomas e dos genes Comportamento de Genes no meio de uma população e como estes interferem na evolução e na forma como são herdados de geração em geração Desenvolvimento Quantitativa a forma como os genes controlam o desenvolvimento dos organismos analisa o impacto de múltiplos genes sobre o fenótipo Molecular Estuda a composição e sequencia do DNA, RNA e Proteínas e como estas interferem no fenótipo

37 Estuda a Sequencia do DNA Como essa sequencia interfere na tradução deste DNA RNA mensageiro e como este RNA mensageiro É traduzido em Proteína

38

39

40

41

42

43

44

45

46

47

48 Publica os primeiros desenhos de células de cortiça observadas ao microscópio.

49 Descoberta do núcleo celular Estudando partes das plantas ao microscópio descobre o núcleo das células.

50 Herança Mendeliana Cruzou Ervilhas (Pisum sativum) Por muitas gerações Descobriu que os descendentes obedeciam um padrão que se assemelhava ao parental.

51 Isolado o DNA Bioquímico alemão Miescher. Ele queria determinar os componentes químicos do núcleo celular e utilizava glóbulos brancos provenientes do pus em sua pesquisa.

52 Fósforo Ácido NitrogÊnio

53 Das Bases Nitrogenadas ao Ácido Nucléico O pesquisador alemão Albrecht Kossel, demonstrou que a nucleína continha bases nitrogenadas em sua estrutura, explicando o fato da nucleína ser rica em nitrogênio.

54 Nove anos depois, Richard Altmann, que era aluno de Miescher, obteve a nucleína com alto grau de pureza, comprovando sua natureza ácida e dando-lhe, então, o nome de ácido nucléico.

55 Descoberta dos Cromossomos O alemão Walter Flemming descobriu corpos com formato de bastão dentro do núcleo das células, que denominou "cromossomos".

56

57 Partículas da hereditariedade O norte-americano Walter Sutton e o alemão Theodor Boveri deram início à teoria cromossômica da hereditariedade (as "partículas" da hereditariedade estariam localizadas nos cromossomos)

58 Genótipo e Fenótipo O dinamarquês Wilhelm Johannes introduziu o termo "gene" para descrever a unidade mendeliana da hereditariedade. Ele também utilizou os termos "genótipo" e "fenótipo" para diferenciar as características genéticas de um indivíduo de sua aparência externa (fenótipo).

59 Dos Ácidos Nucléicos aos Nucleotídeos Concluíram os componentes básico dos ácidos nucléicos, denominando como nucleotídeo. Onde o ácido nucléico, é composto por vários nucleotídeos unidos entre si.

60 Comprovação do DNA como responsável pela transmissão das características.

61 Descobre, entre outras características, que os grupos fosfatos do DNA estão situados na parte externa da molécula e que esta é formada por cadeias antiparalelas, por difração dos raios x. Estas informações oferecem fortes indícios de qual seria a conformação espacial da estrutura da molécula de DNA.

62 Desvendam a estrutura tridimensional da molécula de DNA, constituída por uma dupla hélice.

63 Grupos de pesquisa liderados por Marshall Nirenberg e pelo indiano Har Gobind Khorana decifram o código genético.

64 DNA Recombinante: O norte-americano Paul Berg obteve as primeiras moléculas de DNA recombinante, unindo DNA de diferentes espécies e inserindo esse DNA híbrido em uma célula hospedeira. Recebeu o Nobel de Química em 1980.

65 Criada a primeira companhia de engenharia genética, a Genentech. Produz a primeira proteína humana em uma bactéria geneticamente modificada e, em 1982, comercializa a primeira droga recombinante, insulina humana.

66 Começa a era do sequenciamento Elabora uma técnica capaz de determinar a ordem das bases nitrogenadas do DNA de qualquer organismo vivo.

67 É obtido o primeiro animal transgênico (um camundongo).

68 É criada a técnica conhecida como impressão digital por DNA, a qual permitiu a identificação precisa das pessoas, contribuindo para a elucidação de vários crimes e para o desenvolvimento dos testes de paternidade pelo DNA.

69 Publicado artigo do norteamericano Kary Mullis que descreve o método PCR (reação em cadeia de polimerase, em inglês), que possibilita a obtenção rápida de bilhões de cópias de um segmento específico de DNA. Mullis ganhou o Nobel em Química em 1993.

70 Criação nos EUA do Instituto Nacional para Pesquisa do Genoma Humano (NHGRI), chefiado por James Watson, para determinar toda a sequência do DNA que compõe os cromossomos humanos. Em 1990 dá-se inicio o Projeto do Genoma Humano.

71 Craig Venter, Smith e companheiros publicam, pela primeira vez o genoma completo de um organismo não viral, a bactéria Haemophilus influenzae.

72 Nascimento da ovelha Dolly, primeiro mamífero clonado a partir de uma célula de um animal adulto pelo Instituto Roslin (Escócia) e pela empresa PPL Therapeutics. Só em fevereiro do ano seguinte o feito foi divulgado. Dolly morreria de envelhecimento precoce em fevereiro de 2003.

73 Pesquisadores do consórcio público Projeto Genoma Humano e da empresa privada norte-americana Celera anunciam o rascunho do genoma humano, que seria publicado em fevereiro de 2001.

74 No Brasil, pesquisadores paulistas anunciam o sequenciamento do genoma da bactéria Xylella fastidiosa, a causadora da doença do amarelinho em cítricos. O artigo foi destacado na capa da revista "Nature".

75

76

77

Disciplina Genética Mendeliana

Disciplina Genética Mendeliana Disciplina Genética Mendeliana Semestre 2008.1 Coordenação: Prof a Neide Santos e-mail: santos_neide@yahoo.com.br Prof a Dr a Ana Maria Benko- Iseppon Laboratório de Genética e Biotecnologia Vegetal Universidade

Leia mais

James Watson, Francis Crick e o DNA

James Watson, Francis Crick e o DNA Pércio Augusto Mardini Farias Este documento tem nível de compartilhamento de acordo com a licença 2.5 do Creative Commons. http://creativecommons.org.br http://creativecommons.org/licenses/by/2.5/br/

Leia mais

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE

GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE GENÉTICA HISTÓRICO CARACTERÍSTICAS LEIS DE MENDEL PROBABILIDADE DEFINIÇÃO Palavra de origem grega gennos (fazer nascer- geração). Estudo dos mecanismos de transmissão de características de uma espécie,

Leia mais

PERÍODO PRÉ-GENÉTICA 1666 Robert Hook Descoberta das células. Schleiden e Schwann

PERÍODO PRÉ-GENÉTICA 1666 Robert Hook Descoberta das células. Schleiden e Schwann Historia da Genética Linha do Tempo PERÍODO PRÉ-GENÉTICA 1666 Robert Hook Descoberta das células 1831 Robert Brown 1838-9 1858 Charles Darwin Alfred Russel Wallace 1859 Charles Darwin Schleiden e Schwann

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

GENÉTICA HUMANA HISTÓRICO 26/08/2013 GREGOR MENDEL AULA 3 RELAÇÃO GENÓTIPO-FENÓTIPO

GENÉTICA HUMANA HISTÓRICO 26/08/2013 GREGOR MENDEL AULA 3 RELAÇÃO GENÓTIPO-FENÓTIPO GENÉTICA HUMANA AULA 3 RELAÇÃO GENÓTIPO-FENÓTIPO CURSO: Psicologia SÉRIE: 2º Semestre CARGA HORÁRIA SEMANAL: 02 Horas/aula CARGA HORÁRIA SEMESTRAL: 40 Horas HISTÓRICO GREGOR MENDEL 1822 Nasceu em Heinzendorf,

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais

1865 JOHANN GREGOR MENDEL

1865 JOHANN GREGOR MENDEL IDENTIFICAÇÃO DO MATERIAL GENÉTICO - UMA VISÃO HISTÓRICA - Profª Ana Luisa Miranda Vilela 1865 JOHANN GREGOR MENDEL Publicou resultados dos cruzamentos de ervilhas Pisum sativum. Postulou as regras que

Leia mais

Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade

Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade A A Unidade IV Tecnologia Aula 21.2 Conteúdo: Genética e sociedade 2 A A Habilidade: Conhecer sobre células- troncos, projeto genoma e engenharia genética. 3 A A Células-tronco Autorrenovação e diferenciação

Leia mais

Exercícios de Ácidos Nucléicos

Exercícios de Ácidos Nucléicos Exercícios de Ácidos Nucléicos 1. (UFOP - JUNHO/2001) A charge acima faz alusão à primeira versão detalhada do mapa genético da nossa espécie, apresentada pelo Projeto Genoma Humano e divulgada no dia

Leia mais

Estudando partes das plantas ao microscópio descobre o núcleo das células.

Estudando partes das plantas ao microscópio descobre o núcleo das células. Linha do Tempo e Gabarito. 1665 Robert Hooke Publica os primeiros desenhos de células observadas ao microscópio: células mortas de cortiça. 1831 Robert Brown Estudando partes das plantas ao microscópio

Leia mais

c) Locus Gênico Local do cromossomo onde se localiza um gene.

c) Locus Gênico Local do cromossomo onde se localiza um gene. Aula Biologia Tio Ton Biologia 1) Conceitos Prévios a) Genética É a ciência que estuda a transmissão de características hereditárias de pais para filhos ao longo das gerações. b) Gene Segmento da molécula

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: ricardo@cefetpi.br Visão Holística

Leia mais

1838: lê Ensaio sobre o princípio da população, de Thomas Malthus (1798)

1838: lê Ensaio sobre o princípio da população, de Thomas Malthus (1798) Ácidos Nucleicos MO640A - Biologia Computacional Felipe Rodrigues da Silva Embrapa Recursos Genéticos e Biotecnologia Grandes Eventos da Genética 1865 Genes são elementos particulados 1871 Descoberta dos

Leia mais

PLANOS DE AULA. TEMA: Proteínas: macromoléculas com estruturas complexas e funções quase infinitas.

PLANOS DE AULA. TEMA: Proteínas: macromoléculas com estruturas complexas e funções quase infinitas. PLANOS DE AULA UNIVERSIDADE FEDERAL DO CEARÁ UFC Professor: Isabel Cristina da Costa Souza Data: 23 /11/2015 TEMA: Proteínas: macromoléculas com estruturas complexas e funções quase infinitas. OBJETIVO

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71)

Universidade Estadual de Londrina (Reconhecida pelo Decreto Federal n. 69.324 de 07/10/71) DELIBERAÇÃO Câmara de Pós-Graduação Nº 32/2012 Reestrutura o Programa de Pós-Graduação em Genética e Biologia Molecular, em nível de Mestrado e Doutorado. CONSIDERANDO a solicitação da Comissão Coordenadora

Leia mais

DNA: Passado, Presente e Futuro

DNA: Passado, Presente e Futuro DNA: Passado, Presente e Futuro O passado O modelo do DNA que hoje nos é tão familiar foi divulgado em abril de 1953 na revista científica Nature pelos cientistas James Watson e Francis Crick. Eles afirmaram

Leia mais

FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETO FAMERP PLANO DE ENSINO. Carga horária Total:

FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETO FAMERP PLANO DE ENSINO. Carga horária Total: FACULDADE DE MEDICINA DE SÃO JOSÉ DO RIO PRETO FAMERP CURSO DE : MEDICINA SÉRIE: 1ª. série ANO LETIVO: 2010 BLOCO I IDENTIFICAÇÃO Código da Disciplina PLANO DE ENSINO Nome da Disciplina Biologia Molecular

Leia mais

Mutação e Engenharia Genética

Mutação e Engenharia Genética Mutação e Engenharia Genética Aula Genética - 3º. Ano Ensino Médio - Biologia Prof a. Juliana Fabris Lima Garcia Mutações erros não programados que ocorrem durante o processo de autoduplicação do DNA e

Leia mais

Resposta: Interbits SuperPro Web

Resposta: Interbits SuperPro Web 1. (Fuvest 2012) Uma mutação, responsável por uma doença sanguínea, foi identificada numa família. Abaixo estão representadas sequências de bases nitrogenadas, normal e mutante; nelas estão destacados

Leia mais

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre

Disciplina: Biologia Educacional. Curso: Pedagogia 2 Semestre Disciplina: Biologia Educacional Curso: Pedagogia 2 Semestre Texto 2: GENÉTICA HEREDITARIEDADE A genética é um a ciência que estuda o material hereditário e os mecanismos de sua transmissão de geração

Leia mais

DNA r ecomb m i b n i a n nt n e

DNA r ecomb m i b n i a n nt n e Tecnologia do DNA recombinante DNA recombinante molécula de DNA contendo sequências derivadas de mais de uma fonte. As primeiras moléculas de DNA recombinante 1972 Paul Berg : vírus SV40 + plasmídeo 1973:

Leia mais

PRÓ-REITORIA DE ENSINO

PRÓ-REITORIA DE ENSINO Plano de Ensino IDENTIFICAÇÃO EIXO TECNOLÓGICO: Informação e Comunicação CURSO: Técnico em Informática FORMA/GRAU:( x )integrado ( )subsequente ( ) concomitante ( ) bacharelado ( ) licenciatura ( ) tecnólogo

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

Programa de Estágios do Núcleo de Engenharia Biológica (PEN)

Programa de Estágios do Núcleo de Engenharia Biológica (PEN) Instituto Superior Técnico Programa de Estágios do Núcleo de Engenharia Biológica (PEN) Núcleo de Engenharia Biológica Em primeiro lugar, a direcção do NEB gostaria de deixar claro que a resposta de forma

Leia mais

ENEM. Biologia Aula 03. Profº Marcelo TESTES

ENEM. Biologia Aula 03. Profº Marcelo TESTES TESTES (ENEM 98) João ficou intrigado com a grande quantidade de notícias envolvendo DNA: clonagem da ovelha Dolly, terapia gênica, testes de paternidade, engenharia genética, etc. Para conseguir entender

Leia mais

BASES NITROGENADAS DO RNA

BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Património Genético. Genética - estuda a transmissão de características de uma geração para a outra

Património Genético. Genética - estuda a transmissão de características de uma geração para a outra Património Genético Genética - estuda a transmissão de características de uma geração para a outra E o que acontece quando os pais se cruzam com outros de caracteres opostos? Por que pais altos geram

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links

Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Seminário de Genética BG - 380 Principal Resumo Professores Componentes Bibliografia Links Darwin Voltar Filogenia anatômica e fisiológica Filogênia Molecular A teoria da evolução de Darwin gerou o conceito

Leia mais

6/10/2014. PRÊMIOS NOBEL selecionados: Histórico. Bioquímica / Biologia molecular. Bioética e Biossegurança BIOQUÍMICA: DNA = Material Genético

6/10/2014. PRÊMIOS NOBEL selecionados: Histórico. Bioquímica / Biologia molecular. Bioética e Biossegurança BIOQUÍMICA: DNA = Material Genético Bioética e Biossegurança Carlos H. I. Ramos cramos@iqm.unicamp.br DNA = Material Genético BIOQUÍMICA: Estuda a estrutura e propriedades químicas de sistemas biológicos e sua função fisiológica. Estudo

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

A Estrutura da molécula de DNA. Identificação dos ácidos nucléicos e da molécula certa inaugura a genética molecular

A Estrutura da molécula de DNA. Identificação dos ácidos nucléicos e da molécula certa inaugura a genética molecular Page 1 of 5 A Estrutura da molécula de DNA Identificação dos ácidos nucléicos e da molécula certa inaugura a genética molecular Em 1869, o bioquímico suíço Friedtich Mieschner aventou pela primeira vez

Leia mais

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS ! Universidade Federal de Pernambuco Centro de Ciências da Saúde Departamento de Patologia Laboratório de Imunopatologia Keizo Asami Prof. Dr. Lucas Brandão BIOLOGIA MOLECULAR APLICADA AO ESTUDO DE DOENÇAS

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula

FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA. Carga Horária: 100 horas/aula FUNDAÇÃO UNIVERSIDADE FEDERAL DE RONDÔNIA - UNIR NÚCLEO DE CIÊNCIAS E TECNOLOGIA - NCT DEPARTAMENTO DE BIOLOGIA Código: CBIGEBA Créditos: 05 Período: 3 o (terceiro período) Disciplina: Genética Básica

Leia mais

03. (Pucrj 2010) A ovelha Dolly, primeiro clone animal oficialmente declarado, após adulta foi acasalada com um macho não aparentado.

03. (Pucrj 2010) A ovelha Dolly, primeiro clone animal oficialmente declarado, após adulta foi acasalada com um macho não aparentado. 01.(Enem PPL 2012) Após a redescoberta do trabalho de Gregor Mendel, vários experimentos buscaram testar a universalidade de suas leis. Suponha um desses experimentos, realizado em um mesmo ambiente, em

Leia mais

JOGO BANCO GENÔMICO: TRABALHANDO COM GENES E ORGANISMOS TRANSGÊNICOS, UMA PRÁTICA PARA O ENSINO DE GENÉTICA

JOGO BANCO GENÔMICO: TRABALHANDO COM GENES E ORGANISMOS TRANSGÊNICOS, UMA PRÁTICA PARA O ENSINO DE GENÉTICA ISSN 1980-3540 03.02, 29-36 (2008) www.sbg.org.br JOGO BANCO GENÔMICO: TRABALHANDO COM GENES E ORGANISMOS TRANSGÊNICOS, UMA PRÁTICA PARA O ENSINO DE GENÉTICA Luiz Ricardo de Souza Paiva 1, Emanuel Ricardo

Leia mais

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA

07/05/2015. Replicação do DNA REPLICAÇÃO DO DNA DIVISÃO CELULAR E REPLICAÇÃO. Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DNA DNA REPLICAÇÃO DO Plano de Aula -Composição e estrutura do - e Hereditariedade -Processo de replicação REPLICAÇÃO DO Profª Juliana Schmidt Medicina 2015 REPLICAÇÃO DO DIVISÃO CELULAR E REPLICAÇÃO Bibliografia

Leia mais

PLANO DE AULAS - MÓDULO CÉLULA E GENOMA Unidade Núcleo e Controle Celular

PLANO DE AULAS - MÓDULO CÉLULA E GENOMA Unidade Núcleo e Controle Celular PLANO DE AULAS - MÓDULO CÉLULA E GENOMA Unidade Núcleo e Controle Celular Professores responsáveis: Antonio Dégas, Laura Araújo Tomé e Daniela Alves Silvestre AULA 5 e 6 - PBL Câncer OBJETIVOS - Compreender

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Exercícios Propostos - Transgênicos Professor Fernando

Exercícios Propostos - Transgênicos Professor Fernando Exercícios Propostos - Transgênicos Professor Fernando 1. (Unicamp) Existem mecanismos que normalmente impedem a troca de genes entre espécies distintas. Nos últimos anos, porém, as fronteiras entre as

Leia mais

Biologia - Grupos A e B - Gabarito revisto

Biologia - Grupos A e B - Gabarito revisto revisto 1 a QUESTÃO: (2, pontos) Avaliador Revisor Em estudos com um vegetal terrestre foram utilizadas plantas jovens com genótipo mutante (M), que não apresentam a formação de uma estrutura presente

Leia mais

MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS

MÓDULO III AULA 2: CONTROLE DA EXPRESSÃO GÊNICA EM EUCARIOTOS BIOLOGIA MOLECULAR BÁSICA MÓDULO III Olá! Chegamos ao último módulo do curso! Antes do início das aulas, gostaria de ressaltar que este módulo está repleto de dicas de animações. Dê uma olhada nas animações

Leia mais

Plano de Ensino IDENTIFICAÇÃO. TURMA: 3 ano EMENTA

Plano de Ensino IDENTIFICAÇÃO. TURMA: 3 ano EMENTA Plano de Ensino IDENTIFICAÇÃO EIXO TECNOLÓGICO: Controle processos industriais CURSO: Técnico em química integrada ao ensino médio FORMA/GRAU:(x)integrado ( )subsequente ( ) concomitante ( ) bacharelado

Leia mais

III AS OLIMPÍADAS DE BIOTECNOLOGIA

III AS OLIMPÍADAS DE BIOTECNOLOGIA III AS OLIMPÍADAS DE BIOTECNOLOGIA Duração da prova: 30 minutos 2008 Final O teste tem a duração total de 30 minutos. Poderá sair da sala ao fim de 15 minutos se já tiver terminado. Nas folhas de respostas

Leia mais

BIOLOGIA - 2 o ANO MÓDULO 37 BIOTECNOLOGIA

BIOLOGIA - 2 o ANO MÓDULO 37 BIOTECNOLOGIA BIOLOGIA - 2 o ANO MÓDULO 37 BIOTECNOLOGIA Bactéria Plasmídeo Enzima de restrição corta o plasmídeo DNA Célula humana Gene para insulina Gene para insulina combinado ao DNA da bactéria com a DNA-ligase

Leia mais

1. O QUE É A ENGENHARIA GENÉTICA?

1. O QUE É A ENGENHARIA GENÉTICA? 1. O QUE É A ENGENHARIA GENÉTICA? Termos sinónimos: Manipulação genética, clonagem de genes, tecnologia do DNA recombinante, modificação genética, nova genética. Áreas de acção: Investigação básica - função

Leia mais

AGRUPAMENTO DE ESCOLAS DE CASTRO DAIRE. Ano Letivo 2012/2013 DEPARTAMENTO DE MATEMÁTICA E CIÊNCIAS EXPERIMENTAIS PLANIFICAÇÃO ANUAL CIÊNCIAS NATURAIS

AGRUPAMENTO DE ESCOLAS DE CASTRO DAIRE. Ano Letivo 2012/2013 DEPARTAMENTO DE MATEMÁTICA E CIÊNCIAS EXPERIMENTAIS PLANIFICAÇÃO ANUAL CIÊNCIAS NATURAIS AGRUPAMENTO DE ESCOLAS DE CASTRO DAIRE Ano Letivo 2012/2013 DEPARTAMENTO DE MATEMÁTICA E CIÊNCIAS EXPERIMENTAIS PLANIFICAÇÃO ANUAL CIÊNCIAS NATURAIS 9º ANO As Docentes Responsáveis: 1º Periodo Unidade

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

UNIVERSIDADE DO ESTADO DO RIO DE JANEIRO. Genética no Ensino Médio: dos Parâmetros Curriculares. Nacionais à sala de aula

UNIVERSIDADE DO ESTADO DO RIO DE JANEIRO. Genética no Ensino Médio: dos Parâmetros Curriculares. Nacionais à sala de aula UNIVERSIDADE DO ESTADO DO RIO DE JANEIRO INSTITUTO DE BIOLOGIA ROBERTO ALCANTARA GOMES DEPARTAMENTO DE ENSINO DE CIÊNCIAS E BIOLOGIA Genética no Ensino Médio: dos Parâmetros Curriculares Nacionais à sala

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

Projeto Genoma Humano. Autores: Kelly Cristina Guedes, Andreia da Silva e Antonia M de Oliveira.

Projeto Genoma Humano. Autores: Kelly Cristina Guedes, Andreia da Silva e Antonia M de Oliveira. Projeto Genoma Humano Autores: Kelly Cristina Guedes, Andreia da Silva e Antonia M de Oliveira. Instituição: Faculdade Alfredo Nasser Email: kellyguedes@hotmail.com.br Palavra chave ( projeto genoma humano,

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular.

Módulo Núcleo. 2) O esquema a seguir apresenta um experimento realizado com uma alga unicelular. Módulo Núcleo Exercícios de Aula 1) O envelope nuclear encerra o DNA e define o compartimento nuclear. Assinale a afirmativa INCORRETA sobre o envelope nuclear. a) É formado por duas membranas concêntricas

Leia mais

Questão 1. Questão 3. Questão 2 1ª PARTE: QUESTÕES OBJETIVAS. alternativa E. alternativa B. A, B e C pertenceriam, respectivamente, a organismos

Questão 1. Questão 3. Questão 2 1ª PARTE: QUESTÕES OBJETIVAS. alternativa E. alternativa B. A, B e C pertenceriam, respectivamente, a organismos 1ª PARTE: QUESTÕES OBJETIVAS Questão 1 O exame de um epitélio e do tecido nervoso de um mesmo animal revelou que suas células apresentam diferentes características. Isso ocorre porque a) as moléculas de

Leia mais

Genética. Leis de Mendel

Genética. Leis de Mendel Genética Leis de Mendel DEFINIÇÕES GENES: Pedaços de DNA síntese de determinada proteína. LOCUS GÊNICO: É o local ocupado pelo gene no cromossomo. GENES ALELOS: Situam-se no mesmo Locus Gênico. HOMOZIGOTOS:

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

CURSOS Agronomia, Ciências Habilitação em Biologia, Educação Física, Farmácia, Fisioterapia e Zootecnia

CURSOS Agronomia, Ciências Habilitação em Biologia, Educação Física, Farmácia, Fisioterapia e Zootecnia PROCESSO SELETIVO 2003/2 BIOLOGIA CURSOS Agronomia, Ciências Habilitação em Biologia, Educação Física, Farmácia, Fisioterapia e Zootecnia Só abra este caderno quando o fiscal autorizar. Leia atentamente

Leia mais

INTRODUÇÃO À MICROBIOLOGIA

INTRODUÇÃO À MICROBIOLOGIA INTRODUÇÃO À MICROBIOLOGIA HISTÓRICO DA MICROBIOLOGIA Prof. Givanildo Benicio - Definição: mikros + bios + logos - Primeiros microrganismos 3,5-3,8 bilhões de anos O QUE SÃO MICRORGANISMOS? Organismos

Leia mais

Senescência e envelhecimento celular

Senescência e envelhecimento celular Senescência e envelhecimento celular Priscila Britto Campos priscila.britto@lance-ufrj.org Senescência De origem latina, significa homen velho Está associada a um declínio de capacidade de resposta ao

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

ESTUDO EXPLORATÓRIO DA PERCEPÇÃO DE ALUNOS DO ENSINO MEDIO SOBRE BIOTECNOLOGIA

ESTUDO EXPLORATÓRIO DA PERCEPÇÃO DE ALUNOS DO ENSINO MEDIO SOBRE BIOTECNOLOGIA ESTUDO EXPLORATÓRIO DA PERCEPÇÃO DE ALUNOS DO ENSINO MEDIO SOBRE BIOTECNOLOGIA Pedro Matheus da Rocha 1* ; Pamela Marissa Deodato Andreotti 1 ; Taylla Michelle de Oliveira Flores 1 ; Ruth Aline da Silva

Leia mais

A BIOINFORMÁTICA COMO INSTRUMENTO DE INSERÇÃO DIGITAL E DE DIFUSÃO DA BIOTECNOLOGIA.

A BIOINFORMÁTICA COMO INSTRUMENTO DE INSERÇÃO DIGITAL E DE DIFUSÃO DA BIOTECNOLOGIA. A BIOINFORMÁTICA COMO INSTRUMENTO DE INSERÇÃO DIGITAL E DE DIFUSÃO DA BIOTECNOLOGIA. Itácio Queiroz de Mello Padilha 1, João Paulo Di Monaco Durbano 2, Amely Branquinho Martins 3, Renata dos Santos Almeida

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Genética de Populações

Genética de Populações MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA MELHORAMENTO ANIMAL Genética de Populações COMO SE CONSEGUE ATINGIR OS OBJETIVOS DO

Leia mais

UMA EXPERIÊNCIA INTERDISCIPLINAR: A MATEMÁTICA E A BIOLOGIA NO ESTUDO DA GENÉTICA

UMA EXPERIÊNCIA INTERDISCIPLINAR: A MATEMÁTICA E A BIOLOGIA NO ESTUDO DA GENÉTICA V ENCONTRO NACIONAL DAS LICENCIATURAS (ENALIC) E O IV SEMINÁRIO NACIONAL DO PIBID Universidade Federal do Rio Grande do Norte (UFRN), 08 à 12 de dezembro de 2014 UMA EXPERIÊNCIA INTERDISCIPLINAR: A MATEMÁTICA

Leia mais

Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula. Calendário 4º Bimestre 2ºC

Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula. Calendário 4º Bimestre 2ºC Calendário 4º Bimestre 2ºA,B,D 16/10 Apresentação Trabalhos (Presença obrigatória TODOS) (sexta) Durante período de Aula 30/10 isto Caderno - Exercícios Genética Parte 1 (3 Pontos) 13/11 isto Caderno -

Leia mais

CURSO DE TECNOLOGIA EM BIOTECNOLOGIA

CURSO DE TECNOLOGIA EM BIOTECNOLOGIA CURSO DE TECNOLOGIA EM BIOTECNOLOGIA Departamento de Biotecnologia, Genética e Biologia Celular Centro de Ciências Biológicas Universidade Estadual de Maringá Coordenador: Prof. Dr. João Alencar Pamphile

Leia mais

Projeto Genoma e Proteoma

Projeto Genoma e Proteoma Projeto Genoma e Proteoma Grupo 3: *Artur S. Nascimento *Bárbara S. Costa *Beatrice Barbosa *Tamyres S. E. Guimarães *Yara Cavalcante O que é genoma? O genoma é o conjunto de todo o material genético que

Leia mais

MANUAL DE ESTÁGIO SUPERVISIONADO

MANUAL DE ESTÁGIO SUPERVISIONADO CENTRO UNIVERSITÁRIO UNA MANUAL DE ESTÁGIO SUPERVISIONADO Belo Horizonte 01/2013 Página 1 de 13 PLANO DE ENSINO DA DISCIPLINA ESTÁGIO SUPERVISIONADO Ementa Atividades supervisionadas na área de atuação

Leia mais

SEÇÃO ENTREVISTA A INICIAÇÃO CIENTÍFICA E A PUBLICAÇÃO NA GRADUAÇÃO COMO MEIOS DE QUALIDADE NA FORMAÇÃO DE ENSINO SUPERIOR JOSÉ ROBERTO RUS PEREZ

SEÇÃO ENTREVISTA A INICIAÇÃO CIENTÍFICA E A PUBLICAÇÃO NA GRADUAÇÃO COMO MEIOS DE QUALIDADE NA FORMAÇÃO DE ENSINO SUPERIOR JOSÉ ROBERTO RUS PEREZ Revista Eventos Pedagógicos v.5, n.4 (13. ed.), número regular, p. 115-121, nov./dez. 2014 SEÇÃO ENTREVISTA A INICIAÇÃO CIENTÍFICA E A PUBLICAÇÃO NA GRADUAÇÃO COMO MEIOS DE QUALIDADE NA FORMAÇÃO DE ENSINO

Leia mais

PROPOSTA PEDAGÓGICA CURRICULAR BIOLOGIA APRESENTAÇÃO

PROPOSTA PEDAGÓGICA CURRICULAR BIOLOGIA APRESENTAÇÃO PROPOSTA PEDAGÓGICA CURRICULAR BIOLOGIA APRESENTAÇÃO A Biologia tem como objeto de estudo o fenômeno Vida, contribuindo para formar sujeitos críticos e atuantes, por meios dos conteúdos que ampliem seu

Leia mais

das espécies Chegamos à aula 50! Durante as aulas do Os trabalhos de Charles Darwin

das espécies Chegamos à aula 50! Durante as aulas do Os trabalhos de Charles Darwin A evolução das espécies A UU L AL A Chegamos à aula! Durante as aulas do telecurso, você viu vários temas relacionados com a Biologia: genética, botânica, zoologia, fisiologia, ecologia entre outros. Finalizaremos

Leia mais

GEO A75 - Trabalho Final de Graduação I

GEO A75 - Trabalho Final de Graduação I - GEO A75 - Trabalho Final de Graduação I http://www.moodle.ufba.br/course/view.php?id=10353 Departamento de Geologia e geofísica Aplicada http://www.moodle.ufba.br/course/category.php?id=131 - Ciência

Leia mais

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA

ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA ACESSO VESTIBULAR QUESTÕES DE PROCESSAMENTO DE RNA OU SPLICING 01. (MAMA 2007.1) PÁGINAS OCULTAS NO LIVRO DA VIDA Os biólogos supunham que apenas as proteínas regulassem os genes dos seres humanos e dos

Leia mais

UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA

UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA UNIVERSIDADE ESTADUAL DE CAMPINAS UNICAMP FACULDADE DE TECNOLOGIA FT PROGRAMA INSTITUCIONAL DE BOLSAS DE INICIAÇÃO CIENTÍFICA Projeto Gene: Ambiente de Apoio à Aprendizagem de Genética Baseado em Tamagotchi

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais

09/03/2015. PRÊMIOS NOBEL selecionados: Histórico. Bioquímica / Biologia molecular. Bioética e Biossegurança BIOQUÍMICA: DNA = Material Genético

09/03/2015. PRÊMIOS NOBEL selecionados: Histórico. Bioquímica / Biologia molecular. Bioética e Biossegurança BIOQUÍMICA: DNA = Material Genético Bioética e Biossegurança Carlos H. I. Ramos cramos@iqm.unicamp.br DNA = Material Genético BIOQUÍMICA: Estuda a estrutura e propriedades químicas de sistemas biológicos e sua função fisiológica. Estudo

Leia mais

CIÊNCIAS BIOLÓGICAS. Fonte: O Estado de S.Paulo, 10/12/ 97.

CIÊNCIAS BIOLÓGICAS. Fonte: O Estado de S.Paulo, 10/12/ 97. CIÊNCIAS BIOLÓGICAS 13. Ao chegar ao Pará (Belém), encontrei a cidade, antes alegre e saudável, desolada por duas epidemias: a febre amarela e a varíola. O governo tomou todas as precauções sanitárias

Leia mais

BIOFÍSICA DAS RADIAÇÕES IONIZANTES

BIOFÍSICA DAS RADIAÇÕES IONIZANTES BIOFÍSICA DAS RADIAÇÕES IONIZANTES DANOS RADIOINDUZIDOS NA MOLÉCULA DE DNA Por ser responsável pela codificação da estrutura molecular de todas as enzimas da células, o DNA passa a ser a molécula chave

Leia mais

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota

Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Matéria: biologia Assunto: hereditariedade e diversidade da vida Prof. enrico blota Biologia Princípios Básicos de Genética A genética é a parte da biologia que trata do estudo dos genes e de suas manifestações,

Leia mais

PLANO DE ENSINO. Período/ Fase: 1ª. Semestre: 1º Ano: 2011

PLANO DE ENSINO. Período/ Fase: 1ª. Semestre: 1º Ano: 2011 PLANO DE ENSINO 1. DADOS DE IDENTIFICAÇÃO Instituição: Universidade Alto Vale do Rio do Peixe Curso: Engenharia Ambiental Professora: Andréa Tozzo Marafon andreamarafon@uniarp.edu.br Período/ Fase: 1ª.

Leia mais

A CONTRIBUIÇÃO DA INTERDISCIPLARIDADE PARA SUPERAÇÃO DA FRAGMENTAÇÃO NA FORMAÇÃO ACADÊMICA

A CONTRIBUIÇÃO DA INTERDISCIPLARIDADE PARA SUPERAÇÃO DA FRAGMENTAÇÃO NA FORMAÇÃO ACADÊMICA A CONTRIBUIÇÃO DA INTERDISCIPLARIDADE PARA SUPERAÇÃO DA FRAGMENTAÇÃO NA FORMAÇÃO ACADÊMICA Cleusa Inês Weber Universidade Tecnológica Federal do Paraná - UTFPR - cleusaines@utfpr.edu.br Luciano Lucchetta

Leia mais

O AR. Do sopro da vida ao DNA

O AR. Do sopro da vida ao DNA O AR Do sopro da vida ao DNA O ar e a mitologia Antes de tudo existir havia o Caos. Uma força misteriosa criou o disco terrestre (Gaia) e a abóbada celeste (Urano), enchendo o universo de ar e luz. Da

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

Aplicações da biotecnologia na área animal

Aplicações da biotecnologia na área animal Aplicações da biotecnologia na área animal As aplicações da biotecnologia moderna na área animal são múltiplas e têm um mercado potencial de bilhões de dólares por ano. A competição por tal mercado exige

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

6 - A importância da sequência didática

6 - A importância da sequência didática As sequências didáticas na Educação Infantil possibilitam um trabalho organizado paulatinamente, possibilitam o crescimento e o aprofundamento em conceitos e em saberes, pouco a pouco, de acordo com a

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais