TÍTULO: ANÁLISE MOLECULAR E IMUNOLÓGICA DA OCORRÊNCIA DE EHRLICHIA CANIS NO MUNICÍPIO DE NUPORANGA

Tamanho: px
Começar a partir da página:

Download "TÍTULO: ANÁLISE MOLECULAR E IMUNOLÓGICA DA OCORRÊNCIA DE EHRLICHIA CANIS NO MUNICÍPIO DE NUPORANGA"

Transcrição

1 TÍTULO: ANÁLISE MOLECULAR E IMUNOLÓGICA DA OCORRÊNCIA DE EHRLICHIA CANIS NO MUNICÍPIO DE NUPORANGA CATEGORIA: CONCLUÍDO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: CIÊNCIAS BIOLÓGICAS INSTITUIÇÃO: UNIVERSIDADE DE RIBEIRÃO PRETO AUTOR(ES): PAULO HENRIQUE PETTA JÚNIOR ORIENTADOR(ES): MOZART MARINS COLABORADOR(ES): ANA PAULA AMBROZETO DOS REIS

2 1. Resumo O gênero Ehrlichia compreende cinco espécies de endobactérias Gram-negativas que infectam principalmente macrófagos e neutrófilos, e em alguns casos podem infectar as plaquetas, de diversas espécies de mamíferos incluindo cães, gatos, equinos, ruminantes e humanos, sendo, portanto, considerada uma zoonose. A erliquiose monocítica canina (EMC) que possui como agente etiológico a Ehrlichia canis (ordem Rickettsiales, família Anaplasmataceae) é descrita como uma das mais importantes doenças veterinárias do mundo. O seu vetor de transmissão é o carrapato Rhipicephalus sanguineus, razão pela qual é conhecida popularmente no Brasil como doença do carrapato. A EMC é endêmica em várias regiões tropicais e temperadas, incluindo diversas regiões do Brasil, tanto em áreas rurais como urbanas, e com um considerável número de casos nas regiões sudeste e nordeste. Os sinais clínicos de cães infectados são variados como febre, anorexia, depressão, falta de apetite, vômitos, perda de peso, e em alguns casos anemia e hiperbilirrubinemia. O objetivo deste trabalho foi verificar a ocorrência de E. canis em cães da cidade de Nuporanga, estado de São Paulo, por meio da técnica de PCR aninhado e teste imunológico. Para o PCR foi utilizado DNA genômico de 32 amostras de sangue canino coletadas em tubos à vácuo contendo anticoagulante. Para o teste imunológico foi utilizado o kit SNAP4DX com uma gota de sangue. Foram detectadas 6 amostras positivas pelo PCR aninhado (18,8%) e para o teste imunológico 16 amostras positivas (50%). A discordância entre os testes reflete a sensibilidade dos testes, sendo possivelmente devido à janela de resposta imunológica e fase de infecção pela bactéria, o que reflete na quantidade de DNA bacteriano que pode ser obtida a partir das amostras de sangue. 2. Introdução As erliquioses caninas estão entre as mais importantes hemoparasitoses transmitidas ao cão por carrapatos (Dantas-Torres, 2008). O seu agente etiológico são as bactérias do gênero Ehrlichia (ordem Rickettsiales, família

3 Anaplasmtaceae) as quais se reproduzem como parasitas obrigatórios de diferentes tipos de células sanguíneas (Dumler et al., 2001; Rikihisa, 1991). A E. canis é o principal agente etiológico da doença em cães, nos quais infecta monócitos e macrófagos e causa a erliquiose monocítica canina (EMC), popularmente também conhecida como a doença do carrapato. O cão também é hospedeiro para duas outras espécies importantes e que são a E. chaffeensis e a E. ewingii (Rikihisa, 1991). Devido ao aumento de casos de infecção humana em vários países, especialmente por estas duas útltimas espécies, as erliquioses são consideradas atualmente zoonoses emergentes (Ismail et al., 2010; Pavelites and Prahlow, 2011). Quando não diagnosticada e tratada corretamente, a erliquiose pode ser fatal tanto para os humanos como para os cães (Harrus and Waner, 2011; Ismail et al., 2010; Nakaghi et al., 2008; Pavelites and Prahlow, 2011). No Brasil ainda não existem relatos conclusivos de erliquiose humana, mas a EMC, descrita primeiramente na Argélia em 1935 e atualmente de ocorrência mundial, está distribuída em todos as regiões do país e com prevalências bastante variáveis devido aos tipos de testes para detecção, presença do vetor, área geográfica e estágios da doença (Vieira et al., 2011). O primeiro caso descrito ocorreu em 1973 na cidade de Belo Horizonte, Minas Gerais (Costa, 1973), e atualmente sua prevalência na região sudeste, considerando-se populações de cães atendendidos em hospitais veterinários está entre 15% (Macieira Dde et al., 2005) e 44.7% (Costa et al., 2007). Especificamente na região de Ribeirão Preto, São Paulo, também com animais atendidos em hospital veterinário e utilizando-se um ensaio de PCR aninhado com o gene RNA ribossômico 16S, trabalho realizado por nosso grupo constatou uma prevalência de 38,9% (Santos et al., 2009). A EMC é caracterizada por três estágios bastante distintos: agudo, sub-clínico e crônico (Harrus et al., 1997; Ristic and Holland, 1993; Skotarczak, 2003). O estágio inicial e agudo inicia-se entre oito e vinte dias após a transmissão da bactéria ao animal pela picada de carrapatos infectados da espécie Rhipicephalus sanguineus, o principal vetor de transmissão da doença em regiões tropicais e

4 subtropicais (Aguiar et al., 2007; Parola et al., 2005; Rikihisa, 1991). Nesta fase, a bactéria se multiplica no interior de células mononucleadas e espalha-se pelo fígado, baço e linfonodos sendo caracterizada clinicamente por febre, depressão, dispnéia, anorexia, perda de peso, envolvimento ocular e quadros de alterações neurológicas e renais. O exame laboratorial poderá indicar leucopenia, trombocitopenia e hipergamaglobulinemia. A segunda fase apresenta sintomas considerados sub-clínicos podendo persistir por um período de quarenta a cento e vinte dias ou ainda perdurar por anos como uma infecção críptica. Em muitos casos, mesmo após o tratamento com antibióticos como a doxiciclina (Breitschwerdt et al., 1998; Davoust B, 2005), a infecção persiste com a bactéria alojada principalmente no baço e sendo observada uma trombocitopenia leve e sem um quadro clínico severo (Breitschwerdt et al., 1998; Davoust B, 2005; Harrus et al., 1998). Entretanto, a doença pode evoluir para uma fase crônica, potencialmente fatal, caracterizada por condições de leucopenia, trombocitopenia e hipergamaglobulinemia, semelhantes às da primeira fase, além de um quadro clínico de hemorragias, epitasias e edemas. Na prática clínica, os sinais clínicos e achados laboratoriais são os métodos mais freqüentemente empregados pelo médico veterinário para o diagnóstico de infecção de E. canis. A trombocitopenia é uma alteração hematológica comum apresentada por cães infectados, porém, outros parasitas também podem induzir esta condição hematológica (Nakaghi et al., 2008) (M'Ghirbi et al., 2009). Considerando que o carrapato R. sanguineus é hospedeiro para mais de um parasita, o que potencializa casos de co-infecção, isto dificulta um diagnóstico conclusivo que associe sinais clínicos, achados laboratoriais e o agente etiológico da EMC. Na região de Ribeirão Preto, por exemplo, identificamos animais coinfectados por E. canis e Anaplasma platys, além do protozoário Babesia canis (Santos et al., 2009). A técnica de esfregaço de sangue para se identificar as mórulas intracelulares formadas pelas bactérias é um método de diagnóstico frequentemente utilizado. Entretanto, a sua precisão é baixa, pois a incidência de células apresentando

5 estes corpos de inclusão é reduzida, e outros corpos de inclusão podem ser confundidos com as mórulas da bacterianas (Harrus and Waner, 2011). Exames sorológicos são também bastante utilizados, mas existem problemas no nível de detecção e de reação cruzada entre anticorpos de espécies relacionadas. Além disto, os níveis de anticorpos antiehrlichia podem permanecer altos por períodos superiores a onze meses, dificultando a diferenciação de uma infecção atual de uma anterior ou uma exposição sem o estabelecimento de uma infecção (Nakaghi et al., 2008) Desta forma, estes exames, quando empregados individualmente, podem não ser suficientes para se estabelecer um diagnóstico final da presença de E. canis em animais suspeitos de erliquiose. No sentido de estudar a epidemiologia de diferentes hemoparasitas caninos e ampliar as ferramentas de diagnóstico disponíveis para os médicos veterinários, nosso grupo de pesquisa tem empregado diferentes ensaios baseados na análise de DNA para a detecção de hemoparasitas no cão. Combinados aos sinais clínicos, hematológicos e exames sorológicos, ensaios baseados na análise de DNA podem estabelecer um diagnóstico definitivo para a EMC. Estas técnicas têm sido bastante aplicadas no desenvolvimento de exames para a detecção e identificação de parasitas em amostras de material biológico. O seu uso em exames de rotina depende da facilidade de execução dos ensaios, custos, qualidade e facilidade de visualização dos resultados. O ensaio de PCR aninhado ( nested PCR ) é um dos mais difundidos para a detecção de E. canis em condições experimentais e naturais (Aguirre et al., 2008; Nakaghi et al., 2010). Na primeira reação de PCR costuma-se utilizar primers gênero específicos e na segunda reação, utilizando-se uma alíquota da primeria reação, são empregados primers espécie específicos. Neste trabalho, foi realizado um levantamento da ocorrência de E. canis em uma população de cães do município de Nuporanga, empregando a técnica de PCR aninhado e um teste comercial imunológico. Os dados obtidos foram também utilizados para se comparar o desempenho das duas técnicas na detecção de E.

6 canis, além de se mostrar em qual área (rural ou urbana) se tinha a maior prevalência de infecções. Observou-se uma grande variedade entre as amostras, como, raça, cães já infectados ou não, tipos de infecções, presença de coinfecção, e cães que já apresentavam alguma patologia. 3. Objetivos Levantamento da ocorrência de E. canis em cães do município de Nuporanga através da técnica PCR-aninhado e a comparação dos resultados obtidos com teste imunológico comercial. 4. Metodologia Foi coletado um total de 32 amostras de sangue de cães de ambos os sexos e de raças variadas, com o auxílio de uma médica veterinária, distribuídas entre áreas residenciais (urbano), em chácaras, em áreas rurais e cães abandonados. Os sangues coletados foram guardados em tubos a anticoagulante EDTA K3. vácuo contendo As amostras foram coletadas no dia 23 de março de 2015 na cidade de Nuporanga. Com as amostras coletadas foi realizado o PCR aninhado e o teste imunológico, e em seguida se comparou os resultados de ambos os testes, e foi feito uma descrição estatística. Para o teste imunológico foi usado o kit SNAP 4Dx Plus Test da IDEXX Laboratories seguindo o protocolo do fabricante. Para a extração do DNA das amostras de sangue canino foi utilizado o kit Ilustra Genomic Blood DNA Purification (GE Healthcare), seguindo o protocolo técnico do fabricante.

7 Como controle dos testes se utilizou o próprio controle positivo do kit SNAP 4Dx Plus Test da IDEXX Laboratories para o teste imunológico. E para controle do PCR se utilizou o gene especifico para cães (CYT DOG) com os seguintes primers a uma concentração de 10 µm. CYTDOGfwd1 CYTDOGrev1 CATCAGTCACCCACATCTGC CCATGAATGCTGTGGCTATG 5. Desenvolvimento Foi feita a extração do DNA genômico das amostras coletadas seguindo o protocolo do fabricante. A reação do PCR aninhado (Nested PCR) foi realizada utilizando-se na primeira reação 0,5 µl dos primers CTRA fwd1 e CTRA rev1 (tabela 1) a uma concentração de 10 µm. Utilizou-se ainda 10 µl do reagente GoTaq Green Master Mix (Promega) a uma concentração de 2X, 8 µl de água livre de nucleases (Promega) e 1 µl de produto de PCR para uma volume final de 20 µl. Na segunda reação, foram utilizados os primers CTRA fwd 2 e CTRA rev 2 (tabela 1) e coms reagnetes nas mesmas concentrações. Tabela da sequência dos primers utilizados no PCR aninhado CTRA fwd 1 CTRA rev 1 CTRA fwd 2 CTRA rev 2 ATGTTAGACCCACCATCATGGTCCC GAAGCTTCTTTATCTTCAGAAGGGC CCACGTCCCCAAACAGTTTCTATGT GTCGCACTAGAGGACACCCTGAATC

8 Amabas as reações foram incubadas no termociclador com os seguintes parâmetros: 1 ciclo inicial de 95ºC por 5 minutos, 35 ciclos de 95ºC por 30 segundos, 60ºC por 30 segundos,72ºc por 1 minuto, um ciclo final de 72ºC por 5 minutos e um ciclo adicional de 4ºC para se conservar a reação finalizada. As amostras foram submetidas à eletroforese em gel de agarose 1,5% em TAE (Tris acetato EDTA), com voltagem de 5-9V/cm, corados com brometo de etídio e visualizados em transiluminador sob luz ultra violeta. 6. Resultados Os resultados obtidos indicam que o teste imunológico detectou um maior número de resultados positivos (16) em comparação com o PCR (6). Os seis resultados positivos pelo PCR foram também positivos pelo teste imunológico. Tabela comparativa dos resultados para PCR e teste imunológico PCR Positivo Negativo Total Positivo Imunológico Negativo Total Índice Kappa :0,375 (68,8% de concordância, CI 95% [0,124;0,626).

9 Além de Ehrlichia se obteve ainda dois resultados positivos para Anaplasma no teste imunológico, sendo um deles uma co-infecção (Ehrlichia e Anaplasma). A maioria dos cães infectados era de área rural e sem raça definida. 7. Considerações finais O expressivo número de resultados positivos com o teste imunológico, para presença de E. canis nos cães, pode resultar da resposta imunológica do cão à presença da bactéria, a qual pode permanecer por períodos de até um ano. Por outro lado, na fase crônica da EMC, não há um grande número de bactérias circulantes no sangue, o que dificulta a detecção da presença de DNA bacteriano. Neste trabalho não avaliamso as fases da EMC nos animais testados, porém, ao se considerar o resultado de ambos os testes frente ao número total de amostras coletadas, pode-se concluir que existe uma grande prevalência de erliquiose monocítica canina na cidade de Nopuranga. 8. Fontes consultadas Aguiar, D., Cavalcante, G., Pinter, A., Gennari, S., Camargo, L., Labruna, M., Prevalence of Ehrlichia canis (Rickettsiales: Anaplasmataceae) in dogs and Rhipicephalus sanguineus (Acari: Ixodidae) ticks from Brazil. J Med Entomol. 44, Aguirre, E., Tesouro, M.A., Amusategui, I., Rodriguez-Franco, F., Sainz, A., Comparison between different polymerase chain reaction methods for the diagnosis of Ehrlichia canis infection. Annals of the New York Academy of Sciences 1149, Breitschwerdt, E.B., Hegarty, B.C., Hancock, S.I., Sequential Evaluation of Dogs Naturally Infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J. Clin. Microbiol. 36, Costa, J.O., Ehrlichia canis infection in dog in Belo Horizonte-Brazil. Arquivos Escola Veterinária UFMG 25,

10 Costa, L.M., Jr., Rembeck, K., Ribeiro, M.F., Beelitz, P., Pfister, K., Passos, L.M., Sero-prevalence and risk indicators for canine ehrlichiosis in three rural areas of Brazil. Vet J 174, Dantas-Torres, F., Canine vector-borne diseases in Brazil. Parasit Vectors 1, 25. Davoust B, K.A., Rous V, Maurizi L, Parzy D., Validation of chemoprevention of canine monocytic ehrlichiosis with doxycycline. Vet Microbiol. 107, Dumler, J.S., Barbet, A.F., Bekker, C.P., Dasch, G.A., Palmer, G.H., Ray, S.C., Rikihisa, Y., Rurangirwa, F.R., Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and 'HGE agent' as subjective synonyms of Ehrlichia phagocytophila. Int J Syst Evol Microbiol 51, Harrus, S., Waner, T., Diagnosis of canine monocytotropic ehrlichiosis (Ehrlichia canis): an overview. Vet J 187, Harrus, S., Waner, T., Aizenberg, I., Bark, H., Therapeutic Effect of Doxycycline in Experimental Subclinical Canine Monocytic Ehrlichiosis: Evaluation of a 6-Week Course. J. Clin. Microbiol. 36, Harrus, S., Waner, T., Bark, H., Canine monocytic ehrlichiosis - an update. Comp. Cont. Ed. Prac. Vet 19, Ismail, N., Bloch, K.C., McBride, J.W., Human ehrlichiosis and anaplasmosis. Clin Lab Med 30, M'Ghirbi, Y., Ghorbel, A., Amouri, M., Nebaoui, A., Haddad, S., Bouattour, A., Clinical, serological, and molecular evidence of ehrlichiosis and anaplasmosis in dogs in Tunisia. Parasitol Res 104, Macieira Dde, B., Messick, J.B., Cerqueira Ade, M., Freire, I.M., Linhares, G.F., Almeida, N.K., Almosny, N.R., Prevalence of Ehrlichia canis infection in thrombocytopenic dogs from Rio de Janeiro, Brazil. Vet Clin Pathol 34, Nakaghi, A.C., Machado, R.Z., Ferro, J.A., Labruna, M.B., Chryssafidis, A.L., Andre, M.R., Baldani, C.D., Sensitivity evaluation of a single-step PCR assay using Ehrlichia canis p28 gene as a target and its application in diagnosis of canine ehrlichiosis. Rev Bras Parasitol Vet 19, Nakaghi, A.C.H., Machado, R.Z., Costa, M.T., André, M.R., Baldani, C.D., Canine ehrlichiosis: clinical, hematological, serological and molecular aspects. Ciência Rural 38, Parola, P., Davoustb, B., Raoulta, D., Tick- and flea-borne rickettsial emerging zoonoses. Vet. Res. 36, Pavelites, J.J., Prahlow, J.A., Fatal human monocytic ehrlichiosis: a case study. Forensic Sci Med Pathol 7,

11 Rikihisa, Y., The tribe Ehrlichieae and ehrlichial diseases. Clin Microbiol Rev 4, Ristic, M., Holland, C.J., Canine ehrlichiosis, in: Ristic, Z.W.a.M. (Ed.), Rickettsial and chlamydial diseases of domestic animals. Pergamon Press, Oxford, United Kingdom, pp Santos, F., Coppede, J.S., Pereira, A.L., Oliveira, L.P., Roberto, P.G., Benedetti, R.B., Zucoloto, L.B., Lucas, F., Sobreira, L., Marins, M., Molecular evaluation of the incidence of Ehrlichia canis, Anaplasma platys and Babesia spp. in dogs from Ribeirao Preto, Brazil. Vet J 179, Skotarczak, B., Canine ehrlichiosis. Ann Agric Environ Med 10, Vieira, R.F., Biondo, A.W., Guimaraes, A.M., Dos Santos, A.P., Dos Santos, R.P., Dutra, L.H., Diniz, P.P., de Morais, H.A., Messick, J.B., Labruna, M.B., Vidotto, O., Ehrlichiosis in Brazil. Rev Bras Parasitol Vet 20, 1-12.

TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015

TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015 TÍTULO: ESTUDO RETROSPECTIVO DA OCORRÊNCIA DE EHRLICHIA CANIS DA CIDADE DE RIBEIRÃO PRETO DOS ANOS DE 2014 À 2015 CATEGORIA: CONCLUÍDO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: MEDICINA VETERINÁRIA INSTITUIÇÃO:

Leia mais

COORDENAÇÃO ACADÊMICA NÚCLEO DE GESTÃO DE ATIVIDADES DE PESQUISA COORDENAÇÃO ACADÊMICA. Projeto de Pesquisa Registrado Informações Gerais

COORDENAÇÃO ACADÊMICA NÚCLEO DE GESTÃO DE ATIVIDADES DE PESQUISA COORDENAÇÃO ACADÊMICA. Projeto de Pesquisa Registrado Informações Gerais COORDENAÇÃO ACADÊMICA Projeto de Pesquisa Registrado Informações Gerais 1. Coordenador (a): ANA KARINA DA SILVA CAVALCANTE (KARINA@UFRB.EDU.BR) Vice- Coordenador (a): 2. Título do projeto: Ocorrência de

Leia mais

IMPORTÂNCIA DA AVALIAÇÃO HEMATOLÓGICA E SOROLÓGICA (DOT- BLOT ELISA) NO DIAGNÓSTICO DE ERLIQUIOSE EM CÃES

IMPORTÂNCIA DA AVALIAÇÃO HEMATOLÓGICA E SOROLÓGICA (DOT- BLOT ELISA) NO DIAGNÓSTICO DE ERLIQUIOSE EM CÃES IMPORTÂNCIA DA AVALIAÇÃO HEMATOLÓGICA E SOROLÓGICA (DOT- BLOT ELISA) NO DIAGNÓSTICO DE ERLIQUIOSE EM CÃES IMPORTANCE OF EVALUATION HAEMATOLOGICAL AND SEROLOGICAL (ELISA dot-blot) IN THE DIAGNOSIS OF EHRLICHIOSIS

Leia mais

CATEGORIA: EM ANDAMENTO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: MEDICINA VETERINÁRIA INSTITUIÇÃO: CENTRO UNIVERSITÁRIO ANHANGUERA DE NITERÓI

CATEGORIA: EM ANDAMENTO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: MEDICINA VETERINÁRIA INSTITUIÇÃO: CENTRO UNIVERSITÁRIO ANHANGUERA DE NITERÓI TÍTULO: PERFIL HEMATOLÓGICO E PARASITOLÓGICO DE ANIMAIS DOMÉSTICOS COM SUSPEITA DE INFECÇÃO POR PARASITOS ( HEMOPARASITOS E ENDOPARASITOS) COM POTENCIAL ZOONÓTICO ATENDIDOS NO HOSPITAL DE CLÍNICAS DA FACULDADE

Leia mais

42º Congresso Bras. de Medicina Veterinária e 1º Congresso Sul-Brasileiro da ANCLIVEPA - 31/10 a 02/11 de 2015 - Curitiba - PR 1

42º Congresso Bras. de Medicina Veterinária e 1º Congresso Sul-Brasileiro da ANCLIVEPA - 31/10 a 02/11 de 2015 - Curitiba - PR 1 1 FREQUÊNCIA DE HEMOPARASITOSES EM CÃES NA REGIÃO SUL FLUMINENSE RJ PEDRO HENRIQUE EVANGELISTA GUEDES 1, ANA PAULA MARTINEZ DE ABREU 2, THIAGO LUIZ PEREIRA MARQUES 2, PATRÍCIA DA COSTA 1 1 Alunos de curso

Leia mais

Positive reagent occurrence for Granulocytic Anaplasmosis agents by enzyme immunoassays of sentinel animals in Campos dos Goytacazes, RJ.

Positive reagent occurrence for Granulocytic Anaplasmosis agents by enzyme immunoassays of sentinel animals in Campos dos Goytacazes, RJ. Revista Científica da FMC - Vol. 9, nº 2, 2014 ARTIGO ORIGINAL Ocorrência de reagentes positivos para agentes da Anaplasmose Granulocítica por testes imunoenzimáticos de animais sentinelas em Campos dos

Leia mais

ERLIQUIOSE CANINA: RELATO DE CASO

ERLIQUIOSE CANINA: RELATO DE CASO ERLIQUIOSE CANINA: RELATO DE CASO Sérgio Pinter GARCIA FILHO Mestrando do programa de Cirurgia Veterinária, Departamento de Morfologia e Fisiologia Animal, Universidade Estadual Paulista UNESP, Jaboticabal,

Leia mais

Ehrlichia canis em cães atendidos em hospital veterinário de Botucatu, Estado de São Paulo, Brasil

Ehrlichia canis em cães atendidos em hospital veterinário de Botucatu, Estado de São Paulo, Brasil doi:10.4322/rbpv.01803010 Rev. Bras. Parasitol. Vet., Jaboticabal, v. 18, n. 3, p. 57-61, jul.-set. 2009 ISSN 1984-2961 (eletrônico) Artigo Completo Ehrlichia canis em cães atendidos em hospital veterinário

Leia mais

UNIVERSIDADE DE BRASÍLIA

UNIVERSIDADE DE BRASÍLIA UNIVERSIDADE DE BRASÍLIA OCORRÊNCIA DE Ehrlichia canis EM CÃES SINTOMÁTICOS ATENDIDOS NO HOSPITAL VETERINÁRIO DA UNIVERSIDADE DE BRASÍLIA E ANÁLISE DE VARIABILIDADE EM REGIÕES GENÔMICAS DE REPETIÇÃO MARIANA

Leia mais

ERLIQUIOSE CANINA - RELATO DE CASO

ERLIQUIOSE CANINA - RELATO DE CASO UNIVERSIDADE CASTELO BRANCO INSTITUTO QUALITTAS DE PÓS-GRADUAÇÃO CURSO LATU-SENSU DE CLÍNICA MÉDICA E CIRURGICA DE PEQUENOS ANIMAIS ERLIQUIOSE CANINA - RELATO DE CASO Gleizer Lopes de Campos dos Santos

Leia mais

Ensaios e Ciência: Ciências Biológicas, Agrárias e da Saúde ISSN: 1415-6938 editora@uniderp.br Universidade Anhanguera Brasil

Ensaios e Ciência: Ciências Biológicas, Agrárias e da Saúde ISSN: 1415-6938 editora@uniderp.br Universidade Anhanguera Brasil Ensaios e Ciência: Ciências Biológicas, Agrárias e da Saúde ISSN: 1415-6938 editora@uniderp.br Universidade Anhanguera Brasil Souza Mundim, Érika Cristina de; Silva Francisco, Manoel Marcelo da; Souza,

Leia mais

Erliquiose Monocítica Canina: Revisão sobre a doença e o diagnóstico

Erliquiose Monocítica Canina: Revisão sobre a doença e o diagnóstico UNIVERSIDADE FEDERAL DE GOIÁS ESCOLA DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIA ANIMAL Disciplina: SEMINÁRIOS APLICADOS Erliquiose Monocítica Canina: Revisão sobre a doença e o diagnóstico Herika

Leia mais

CAMILA SANTOS MANOEL. Alterações clínicas, hematológicas e sorológicas de cães infectados por Ehrlichia canis

CAMILA SANTOS MANOEL. Alterações clínicas, hematológicas e sorológicas de cães infectados por Ehrlichia canis CAMILA SANTOS MANOEL Alterações clínicas, hematológicas e sorológicas de cães infectados por Ehrlichia canis São Paulo 2010 CAMILA SANTOS MANOEL Alterações clínicas, hematológicas e sorológicas de cães

Leia mais

EPIDEMIOLOGIA DA EHRLICHIA SP. E AVALIAÇÃO DO SEU POTENCIAL ZOONÓTICO NO MUNICÍPIO DE SALVADOR, BAHIA. BÁRBARA MARIA PARANÁ DA SILVA SOUZA

EPIDEMIOLOGIA DA EHRLICHIA SP. E AVALIAÇÃO DO SEU POTENCIAL ZOONÓTICO NO MUNICÍPIO DE SALVADOR, BAHIA. BÁRBARA MARIA PARANÁ DA SILVA SOUZA Universidade Federal da Bahia Escola de Medicina Veterinária Mestrado em Ciência Animal nos Trópicos EPIDEMIOLOGIA DA EHRLICHIA SP. E AVALIAÇÃO DO SEU POTENCIAL ZOONÓTICO NO MUNICÍPIO DE SALVADOR, BAHIA.

Leia mais

Diagnóstico sorológico de erliquiose canina com antígeno brasileiro de Ehrlichia canis

Diagnóstico sorológico de erliquiose canina com antígeno brasileiro de Ehrlichia canis Ciência 796 Rural, Santa Maria, v.37, n.3, p.796-802, mai-jun, 2007 Aguiar et al. ISSN 0103-8478 Diagnóstico sorológico de erliquiose canina com antígeno brasileiro de Ehrlichia canis Serological diagnosis

Leia mais

ERLIQUIOSE TRANSMITIDA AOS CÃES PELO CARRAPATO MARROM (Rhipicephalus sanguineus)

ERLIQUIOSE TRANSMITIDA AOS CÃES PELO CARRAPATO MARROM (Rhipicephalus sanguineus) Revisão de Literatura ERLIQUIOSE TRANSMITIDA AOS CÃES PELO CARRAPATO MARROM (Rhipicephalus sanguineus) Daniela Maria Bastos de SOUZA¹, Zoraide Fernandes COLETO²*, Andreia Fernandes de SOUZA¹, Sildivane

Leia mais

Instruções de Uso. ImmunoComb CANINE EHRLICHIA. N Cat. do Produto: 50CEH201/50CEH210 USO VETERINÁRIO - PRODUTO IMPORTADO

Instruções de Uso. ImmunoComb CANINE EHRLICHIA. N Cat. do Produto: 50CEH201/50CEH210 USO VETERINÁRIO - PRODUTO IMPORTADO Instruções de Uso ImmunoComb CANINE EHRLICHIA Kit para a detecção de anticorpos IgG de Ehrlichia canis N Cat. do Produto: 50CEH201/50CEH210 USO VETERINÁRIO - PRODUTO IMPORTADO Instruction Cat. No: 63CEH511

Leia mais

UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA VETERINARIA (CLÍNICA E REPRODUÇAO ANIMAL)

UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA VETERINARIA (CLÍNICA E REPRODUÇAO ANIMAL) UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA VETERINARIA (CLÍNICA E REPRODUÇAO ANIMAL) PEDRO BITTENCOURT VELHO OCORRÊNCIA E CARACTERIZAÇÃO MOLECULAR DE

Leia mais

UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS GRADUAÇÃO EM MEDICINA VETERINÁRIA (CLÍNICA E REPRODUÇÃO ANIMAL)

UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS GRADUAÇÃO EM MEDICINA VETERINÁRIA (CLÍNICA E REPRODUÇÃO ANIMAL) UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS GRADUAÇÃO EM MEDICINA VETERINÁRIA (CLÍNICA E REPRODUÇÃO ANIMAL) RENATA DE SOUZA ROSA LIMA OCORRÊNCIA DE ANTÍGENOS DE Dirofilaria

Leia mais

Raimundo Nonato Moraes Benigno 1, Bárbara Renata Fontes Rodrigues 2 e Nicolau Maués da Serra-Freire 3

Raimundo Nonato Moraes Benigno 1, Bárbara Renata Fontes Rodrigues 2 e Nicolau Maués da Serra-Freire 3 AVALIAÇÃO DAS INFECÇÕES POR Babesia e Ehrlichia EM CÃES E DAS INFECÇÕES HUMANAS POR CARRAPATOS ORIUNDOS DESSES CÃES NO MUNICÍPIO DE CAMPINAS, ESTADO DE SÃO PAULO* EVALUATION OF THE INFECTIONS FOR Babesia

Leia mais

PUBVET, Publicações em Medicina Veterinária e Zootecnia. Erliquiose x Babesiose canina: relato de caso

PUBVET, Publicações em Medicina Veterinária e Zootecnia. Erliquiose x Babesiose canina: relato de caso PUBVET, Publicações em Medicina Veterinária e Zootecnia. Erliquiose x Babesiose canina: relato de caso Zuliete Aliona Araujo de Souza Fonseca 1 ; Êlika Suzianny Sousa 2 ; Edinaidy Suianny Rocha de Moura

Leia mais

OCORRÊNCIA DE EHRLICHIOSE CANINA EM MOSSORÓ RESUMO ABSTRACT

OCORRÊNCIA DE EHRLICHIOSE CANINA EM MOSSORÓ RESUMO ABSTRACT OCORRÊNCIA DE EHRLICHIOSE CANINA EM MOSSORÓ (Occurrence of canine Ehrlichiosis in Mossoró) Allany Maria Melo de MEDEIROS & Ana Kelen Felipe LIMA 1 * 1 FAVET/Programa de Pós-graduação em Ciências Veterinárias/UECE

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

XIII Congresso Brasileiro de Parasitologia Veterinária & I Simpósio Latino-Americano de Ricketisioses, Ouro Preto, MG, 2004.

XIII Congresso Brasileiro de Parasitologia Veterinária & I Simpósio Latino-Americano de Ricketisioses, Ouro Preto, MG, 2004. ERLIQUIOSE CANINA Rosangela Zacarias Machado 1 Professora Titular do Departamento de Patologia Veterinária, Faculdade de Ciências Agrárias e Veterinárias, Campus de Jaboticabal UNESP e-mail: zacarias@fcav.unesp.br

Leia mais

PREVALÊNCIA DE Ehrlichia canis PELA TÉCNICA DE NESTED- PCR E CORRELAÇÃO COM A PRESENÇA DE MÓRULA E TROMBOCITOPENIA EM CÃES DE ALEGRE-ES

PREVALÊNCIA DE Ehrlichia canis PELA TÉCNICA DE NESTED- PCR E CORRELAÇÃO COM A PRESENÇA DE MÓRULA E TROMBOCITOPENIA EM CÃES DE ALEGRE-ES UNIVERSIDADE FEDERAL DO ESPÍRITO SANTO CENTRO DE CIÊNCIAS AGRÁRIAS PROGRAMA DE PÓS-GRADUAÇAO EM CIÊNCIAS VETERINÁRIAS MARA RÚBIA ROCHA PEREIRA SALES PREVALÊNCIA DE Ehrlichia canis PELA TÉCNICA DE NESTED-

Leia mais

IDENTIFICAÇÃO POR PCR DA BACTÉRIA BARTONELLA VINSONII SUBSP. BERKHOFFII EM 50 CÃES COM INFECÇÃO POR EHRLICHIA CANIS (E. CANIS)

IDENTIFICAÇÃO POR PCR DA BACTÉRIA BARTONELLA VINSONII SUBSP. BERKHOFFII EM 50 CÃES COM INFECÇÃO POR EHRLICHIA CANIS (E. CANIS) IDENTIFICAÇÃO POR PCR DA BACTÉRIA BARTONELLA VINSONII SUBSP. BERKHOFFII EM 50 CÃES COM INFECÇÃO POR EHRLICHIA CANIS (E. CANIS) IDENTIFICATION FOR PCR OF BACTERIUM BARTONELLA VINSONII SUBSP. BERKHOFFII

Leia mais

DETECÇÃO MOLECULAR E SOROLÓGICA DE Ehrlichia canis E Babesia canis EM FELÍDEOS SELVAGENS BRASILEIROS MANTIDOS EM CATIVEIRO

DETECÇÃO MOLECULAR E SOROLÓGICA DE Ehrlichia canis E Babesia canis EM FELÍDEOS SELVAGENS BRASILEIROS MANTIDOS EM CATIVEIRO 1 1 UNIVERSIDADE ESTADUAL PAULISTA FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS CÂMPUS DE JABOTICABAL DETECÇÃO MOLECULAR E SOROLÓGICA DE Ehrlichia canis E Babesia canis EM FELÍDEOS SELVAGENS BRASILEIROS

Leia mais

EVIDÊNCIA SOROLÓGICA E MOLECULAR DE ERLIQUIOSE CANINA NO MUNICÍPIO DE PATOS

EVIDÊNCIA SOROLÓGICA E MOLECULAR DE ERLIQUIOSE CANINA NO MUNICÍPIO DE PATOS IX CONGRESSO DE INICIAÇÃO CIENTÍFICA DA UNIVERSIDADE FEDERAL DE CAMPINA GRANDE PIBIC/CNPq/UFCG-2011 EVIDÊNCIA SOROLÓGICA E MOLECULAR DE ERLIQUIOSE CANINA NO MUNICÍPIO DE PATOS Herta Karyanne Araújo Almeida

Leia mais

MICOPLASMOSE EM CÃES RELATO DE 4 CASOS

MICOPLASMOSE EM CÃES RELATO DE 4 CASOS MICOPLASMOSE EM CÃES RELATO DE 4 CASOS Melissa Silva-Santos 1 ; Paulo Tojal Dantas Matos 1 ; Victor Fernando Santana Lima¹; Patrícia Oliveira Meira-Santos²; Leandro Branco Rocha². 1. Estudante de Medicina

Leia mais

PARASITOSES EM PEQUENOS ANIMAIS DA COMUNIDADE DO MATADOURO: DIAGNÓSTICO, TRATAMENTO E CONSCIENTIZAÇÃO

PARASITOSES EM PEQUENOS ANIMAIS DA COMUNIDADE DO MATADOURO: DIAGNÓSTICO, TRATAMENTO E CONSCIENTIZAÇÃO PARASITOSES EM PEQUENOS ANIMAIS DA COMUNIDADE DO MATADOURO: DIAGNÓSTICO, TRATAMENTO E CONSCIENTIZAÇÃO Priscilla Helena Aniboleti Machado 1; Daniela Fernandes Stelzer 1 ; Raphaela Cricco Guidi 2 ; Glaydston

Leia mais

UNIVERSIDADE FEDERAL DE CAMPINA GRANDE CENTRO DE SAÚDE E TECNOLOGIA RURAL CAMPUS DE PATOS-PB CURSO DE MEDICINA VETERINÁRIA MONOGRAFIA

UNIVERSIDADE FEDERAL DE CAMPINA GRANDE CENTRO DE SAÚDE E TECNOLOGIA RURAL CAMPUS DE PATOS-PB CURSO DE MEDICINA VETERINÁRIA MONOGRAFIA UNIVERSIDADE FEDERAL DE CAMPINA GRANDE CENTRO DE SAÚDE E TECNOLOGIA RURAL CAMPUS DE PATOS-PB CURSO DE MEDICINA VETERINÁRIA MONOGRAFIA Avaliação do sangue total e suas frações no diagnóstico de erliquiose

Leia mais

UNIVERSIDADE CASTELO BRANCO INSTITUTO DE PÓS-GRADUAÇÃO QUALITTAS CURSO DE ESPECIALIZAÇÃO EM CLÍNICA MÉDICA DE FELINOS ERLIQUIOSE FELINA:

UNIVERSIDADE CASTELO BRANCO INSTITUTO DE PÓS-GRADUAÇÃO QUALITTAS CURSO DE ESPECIALIZAÇÃO EM CLÍNICA MÉDICA DE FELINOS ERLIQUIOSE FELINA: UNIVERSIDADE CASTELO BRANCO INSTITUTO DE PÓS-GRADUAÇÃO QUALITTAS CURSO DE ESPECIALIZAÇÃO EM CLÍNICA MÉDICA DE FELINOS ERLIQUIOSE FELINA: UMA REVISÃO DE LITERATURA Luciane Mary Prado Vasconcelos de Amorim

Leia mais

UNIVERSIDADE CASTELO BRANCO CENTRO DE CIÊNCIAS DA SAÚDE E BIOLÓGICAS CURSO DE ESPECIALIZAÇÃO EM PATOLOGIA CLÍNICA VETERINÁRIA

UNIVERSIDADE CASTELO BRANCO CENTRO DE CIÊNCIAS DA SAÚDE E BIOLÓGICAS CURSO DE ESPECIALIZAÇÃO EM PATOLOGIA CLÍNICA VETERINÁRIA UNIVERSIDADE CASTELO BRANCO CENTRO DE CIÊNCIAS DA SAÚDE E BIOLÓGICAS CURSO DE ESPECIALIZAÇÃO EM PATOLOGIA CLÍNICA VETERINÁRIA TROMBOCITOPENIA CICLICA E ANAPLASMA PLATYS: ASPECTOS EPIDEMIOLÓGICOS E CLÍNICOS.

Leia mais

em equinos na Universidade Federal Rural do Rio de Janeiro, Campus Seropédica*

em equinos na Universidade Federal Rural do Rio de Janeiro, Campus Seropédica* Frequência de anticorpos da classe IgG anti-rickettsia rickettsii em equinos na Universidade Federal Rural do Rio de Janeiro, Campus Seropédica* Matheus Dias Cordeiro 1, Vanessa de Almeida Raia 2, Jaqueline

Leia mais

EFEITO OVICIDA DE METARHIZIUM ANISOPLIAE IP 46, EM SOLO, SOBRE RHIPICEPHALUS SANGUINEUS

EFEITO OVICIDA DE METARHIZIUM ANISOPLIAE IP 46, EM SOLO, SOBRE RHIPICEPHALUS SANGUINEUS EFEITO OVICIDA DE METARHIZIUM ANISOPLIAE IP 46, EM SOLO, SOBRE RHIPICEPHALUS SANGUINEUS Macsuel Corado Barreto, Christian Luz Instituto de Patologia Tropical e Saúde Pública Universidade Federal de Goiás,

Leia mais

REVISTA CIENTÍFICA DE MEDICINA VETERINÁRIA - ISSN:1679-7353 Ano XIII-Número 24 Janeiro de 2015 Periódico Semestral

REVISTA CIENTÍFICA DE MEDICINA VETERINÁRIA - ISSN:1679-7353 Ano XIII-Número 24 Janeiro de 2015 Periódico Semestral ERLIQUIOSE CANINA REVISÃO DE LITERATURA EHRLICHIOSIS CANINE - LITERATURE REVIEW SILVA, I. P. M. Medica Veterinária - Universidade Severino Sombra, Vassouras - RJ RESUMO A Erliquiose é uma das principais

Leia mais

ERLIQUIOSE MONOCÍTICA CANINA

ERLIQUIOSE MONOCÍTICA CANINA UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL FACULDADE DE VETERINÁRIA COMISSÃO DE ESTÁGIOS ERLIQUIOSE MONOCÍTICA CANINA Pedro Reinisch Galant Porto Alegre RS 2010/1 2 UNIVERSIDADE FEDERAL DO RIO GRANDE DO

Leia mais

LUCIANA SOUZA DE OLIVEIRA. Investigação molecular de Ehrlichia em uma população de cães e gatos em Viçosa/MG

LUCIANA SOUZA DE OLIVEIRA. Investigação molecular de Ehrlichia em uma população de cães e gatos em Viçosa/MG LUCIANA SOUZA DE OLIVEIRA Investigação molecular de Ehrlichia em uma população de cães e gatos em Viçosa/MG Dissertação apresentada à Universidade Federal de Viçosa, como parte das exigências do Programa

Leia mais

INSTITUTO ADOLFO LUTZ CENTRO DE VIROLOGIA NÚCLEO DE DOENÇAS DE TRANSMISSÃO VETORIAL

INSTITUTO ADOLFO LUTZ CENTRO DE VIROLOGIA NÚCLEO DE DOENÇAS DE TRANSMISSÃO VETORIAL INSTITUTO ADOLFO LUTZ CENTRO DE VIROLOGIA NÚCLEO DE DOENÇAS DE TRANSMISSÃO VETORIAL LABORATÓRIO DE RIQUÉTSIAS Fabiana Cristina Pereira dos Santos Pesquisador Científico D) Qual é a previsão para otimizar

Leia mais

UNIVERSIDADE FEDERAL DE MATO GROSSO DO SUL MESTRADO EM CIÊNCIA ANIMAL

UNIVERSIDADE FEDERAL DE MATO GROSSO DO SUL MESTRADO EM CIÊNCIA ANIMAL UNIVERSIDADE FEDERAL DE MATO GROSSO DO SUL MESTRADO EM CIÊNCIA ANIMAL AZITROMICINA NO TRATAMENTO DA ERLICHIOSE MONOCÍTICA EM CÃES NATURALMENTE INFECTADOS Daniela Torres Cantadori CAMPO GRANDE MATO GROSSO

Leia mais

PREVALÊNCIA, FATORES DE RISCO E ASSOCIAÇÕES LABORATORIAIS PARA ERLIQUIOSE MONOCÍTICA CANINA

PREVALÊNCIA, FATORES DE RISCO E ASSOCIAÇÕES LABORATORIAIS PARA ERLIQUIOSE MONOCÍTICA CANINA PREVALÊNCIA, FATORES DE RISCO E ASSOCIAÇÕES LABORATORIAIS PARA ERLIQUIOSE MONOCÍTICA CANINA Marcos Roberto Alves Ferreira 1 ; Edismauro Garcia Freitas-Filho 1 ; Marcia Dias 2 ; Cecília Nunes Moreira 3.

Leia mais

Avaliação de diferentes fontes de DNA para realização de. nested PCR no diagnóstico da erliquiose canina TEREZA EMMANUELLE DE FARIAS ROTONDANO

Avaliação de diferentes fontes de DNA para realização de. nested PCR no diagnóstico da erliquiose canina TEREZA EMMANUELLE DE FARIAS ROTONDANO UNIVERSIDADE FEDERAL DE PERNAMBUCO CENTRO DE CIÊNCIAS BIOLÓGICAS PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS Avaliação de diferentes fontes de DNA para realização de nested PCR no diagnóstico da erliquiose

Leia mais

EFICÁCIA DA DOXICICLINA E DA COMBINAÇÃO COM O DIPROPIONATO DE IMIDOCARB NO TRATAMENTO DE Ehrlichia canis EM CÃES

EFICÁCIA DA DOXICICLINA E DA COMBINAÇÃO COM O DIPROPIONATO DE IMIDOCARB NO TRATAMENTO DE Ehrlichia canis EM CÃES UNIVERSIDADE FEDERAL DE MATO GROSSO DO SUL MESTRADO EM CIÊNCIA ANIMAL EFICÁCIA DA DOXICICLINA E DA COMBINAÇÃO COM O DIPROPIONATO DE IMIDOCARB NO TRATAMENTO DE Ehrlichia canis EM CÃES Efficacy of doxycycline

Leia mais

ALTERAÇÕES CLÍNICO-HEMATOLÓGICAS DA INFECÇÃO POR Babesia canis vogeli EM CÃES DO MUNICÍPIO DE SEROPÉDICA, RIO DE JANEIRO, BRASIL*

ALTERAÇÕES CLÍNICO-HEMATOLÓGICAS DA INFECÇÃO POR Babesia canis vogeli EM CÃES DO MUNICÍPIO DE SEROPÉDICA, RIO DE JANEIRO, BRASIL* ALTERAÇÕES CLÍNICO-HEMATOLÓGICAS DA INFECÇÃO POR Babesia canis vogeli EM CÃES DO MUNICÍPIO DE SEROPÉDICA, RIO DE JANEIRO, BRASIL* Joice Aparecida Rezende Vilela 1+, Marcus Sandes Pires 1, Claudia Bezerra

Leia mais

Diagnóstico diferencial da trombocitopenia em cães e gatos. Leonardo P. Brandão, MV, Msc, PhD

Diagnóstico diferencial da trombocitopenia em cães e gatos. Leonardo P. Brandão, MV, Msc, PhD Diagnóstico diferencial da trombocitopenia em cães e gatos Leonardo P. Brandão, MV, Msc, PhD Gerente de Produto 0peração Animais de Companhia- MERIAL Saúde Animal 2011 Trombopoiese Plaquetas são fragmentos

Leia mais

Review Article ERLIQUIOSE CANINA: ALTERAÇÕES HEMATOLÓGICAS EM CÃES DOMÉSTICOS NATURALMENTE INFECTADOS CANINE EHRLICHIOSIS: HEMATOLOGIC ALTERATIONS IN DOMESTIC DOGS NATURALLY INFECTED Christina de Siqueira

Leia mais

INCIDÊNCIA DE FEBRE MACULOSA NA CIDADE DE AMPARO. Palavras- Chave: Saúde, Pesquisa, Febre Maculosa, Patologia, Enfermagem.

INCIDÊNCIA DE FEBRE MACULOSA NA CIDADE DE AMPARO. Palavras- Chave: Saúde, Pesquisa, Febre Maculosa, Patologia, Enfermagem. INCIDÊNCIA DE FEBRE MACULOSA NA CIDADE DE AMPARO Daniela Aparecida Correa Aline Gritti Rodrigues Resumo: O presente artigo terá como objetivo abordar a incidência de Febre Maculosa na cidade de Amparo

Leia mais

INSUFICIÊNCIA RENAL SECUNDÁRIA A ERLIQUIOSE CANINA: REVISÃO DE LITERATURA

INSUFICIÊNCIA RENAL SECUNDÁRIA A ERLIQUIOSE CANINA: REVISÃO DE LITERATURA UNIVERSIDADE FEDERAL RURAL DO SEMI-ÁRIDO PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO CURSO DE ESPECIALIZAÇÃO EM CLÍNICA MÉDICA DE PEQUENOS ANIMAIS MARIA VILMA ROCHA ANDRADE CRUZ INSUFICIÊNCIA RENAL SECUNDÁRIA

Leia mais

PUBVET, Publicações em Medicina Veterinária e Zootecnia. Estresse em cães no trabalho policial com suspeita de infecção pela Ehrlichia sp

PUBVET, Publicações em Medicina Veterinária e Zootecnia. Estresse em cães no trabalho policial com suspeita de infecção pela Ehrlichia sp PUBVET, Publicações em Medicina Veterinária e Zootecnia. Estresse em cães no trabalho policial com suspeita de infecção pela Ehrlichia sp Walterez Geralda de Araujo Barboza 1, Lucas Fernandes dos Santos

Leia mais

Oftalmopatias na erliquiose monocítica canina. Eye diseases in canine monocytic ehrlichiosis. Oftalmopatías en erliquiosis monocítica canina

Oftalmopatias na erliquiose monocítica canina. Eye diseases in canine monocytic ehrlichiosis. Oftalmopatías en erliquiosis monocítica canina Oftalmopatias na erliquiose monocítica canina Eye diseases in canine monocytic ehrlichiosis Oftalmopatías en erliquiosis monocítica canina Anderson Barros Teixeira Pinto 1* e Cláudio Baptista de Carvalho

Leia mais

Aspectos Clínicos da Hemobartolenose Felina

Aspectos Clínicos da Hemobartolenose Felina GEAC UFV Grupo de Estudos de Animais de Companhia Aspectos Clínicos da Hemobartolenose Felina Cecilia Sartori Zarif, Graduanda do 9 período de Medicina Veterinária da UFV Etiologia Anemia Infecciosa Felina

Leia mais

INFORME TÉCNICO FEBRE MACULOSA BRASILEIRA

INFORME TÉCNICO FEBRE MACULOSA BRASILEIRA SUBSECRETARIA DE VIGILÂNCIA EM SAÚDE SUPERINTENDÊNCIA DE VIGILÂNCIA EPIDEMIOLÓGICA E AMBIENTAL COORDENAÇÃO DE VIGILÂNCIA EPIDEMIOLÓGICA DIVISÃO DE TRANSMISSÍVEIS E IMUNOPREVINÍVEIS GERENCIA DE DOENÇAS

Leia mais

Dengue NS1 Antígeno: Uma Nova Abordagem Diagnóstica

Dengue NS1 Antígeno: Uma Nova Abordagem Diagnóstica Dengue NS1 Antígeno: Uma Nova Abordagem Diagnóstica Dengue é uma doença endêmica que afeta mais de 100 países, incluindo as regiões de clima tropical e subtropical da África, Américas, Leste do Mediterrâneo,

Leia mais

UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA VETERINÁRIA (CLÍNICA E REPRODUÇÃO ANIMAL)

UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA VETERINÁRIA (CLÍNICA E REPRODUÇÃO ANIMAL) UNIVERSIDADE FEDERAL FLUMINENSE FACULDADE DE VETERINÁRIA PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA VETERINÁRIA (CLÍNICA E REPRODUÇÃO ANIMAL) DANIELA PRADO RODRIGUES OCORRÊNCIA DE HEMOPARASITOS EM FELÍDEOS

Leia mais

UNIVERSIDADE FEDERAL RURAL DO RIO DE JANEIRO INSTITUTO DE VETERINÁRIA CURSO DE PÓS-GRADUAÇÃO EM MEDICINA VETERINÁRIA DISSERTAÇÃO

UNIVERSIDADE FEDERAL RURAL DO RIO DE JANEIRO INSTITUTO DE VETERINÁRIA CURSO DE PÓS-GRADUAÇÃO EM MEDICINA VETERINÁRIA DISSERTAÇÃO UNIVERSIDADE FEDERAL RURAL DO RIO DE JANEIRO INSTITUTO DE VETERINÁRIA CURSO DE PÓS-GRADUAÇÃO EM MEDICINA VETERINÁRIA DISSERTAÇÃO Ehrlichia canis E Anaplasma platys EM CÃES (Canis familiaris, Linnaeus,

Leia mais

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além

deficiências gênicas em amostras de DNA, de seres humanos e/ou animais, o qual além "PROCESSO DE IDENTIFICAÇÃO E INVESTIGAÇÃO DE DEFICIENCIAS GÊNICAS COM UTILIZAÇÃO DE FLUORESCÊNCIA, OU PROCESSO PCR MULTIPLEX FLUORESCENTE". Trata o presente relatório da descrição detalhada acompanhada

Leia mais

Virologia em Laboratório Fase Pré- Analítica

Virologia em Laboratório Fase Pré- Analítica Virologia em Laboratório Fase Pré- Analítica Leonor Rebelo Lab Virologia i do IPOFGL EPE Novembro 2012 1º Curso de Virologia Molecular em Oncologia 1 ,, TÑÜxÇwxÜ t ØÇ vt vé át wx Öâx t ÅxÇàx ÇâÇvt áx vtçát?

Leia mais

XXIII CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA

XXIII CONGRESSO DE PÓS-GRADUAÇÃO DA UFLA ALTERAÇÕES HEMATOLÓGICAS ENCONTRADAS EM CÃES COM HEPATOZOON CANIS ATRAVÉS DE HEMOGRAMAS REALIZADOS NO LABORATÓRIO DE PATOLOGIA CLÍNICA DA UNIVERSIDADE FEDERAL DE LAVRAS CLEIBIANE EVANGELISTA FRANCO BORGES

Leia mais

Competência vetorial de carrapatos do grupo Rhipicephalus sanguineus

Competência vetorial de carrapatos do grupo Rhipicephalus sanguineus Jonas Moraes-Filho Competência vetorial de carrapatos do grupo Rhipicephalus sanguineus do Brasil, Argentina e Uruguai para transmissão da bactéria Ehrlichia canis, agente etiológico da erliquiose monocítica

Leia mais

Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros

Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros Pré-imunização e Tratamento de Tristeza Parasitária em Bovinos Leiteiros Laboratório de Imunovirologia Molecular DBG UFV Prof. Sérgio Oliveira de Paula Tristeza Parasitária Bovina (TPB) Enfermidade hemoparasita

Leia mais

ISABELA TEBALDI POUBEL DO CARMO

ISABELA TEBALDI POUBEL DO CARMO FACULDADE DE VETERINÁRIA Programa de Pós-Graduação em Medicina Veterinária (Clínica e Reprodução Animal) ISABELA TEBALDI POUBEL DO CARMO CIRCULAÇÃO DE Ehrlichia canis (DONATIEN e LESTOQUARD, 1935) EM CÃES

Leia mais

ASPECTOS CLÍNICOS E LABORATORIAIS DE CÃES SUSPEITOS DE INFECÇÕES CAUSADASPOR Ehrlichia spp. E Anaplasma spp. EM CAMPOS DOS GOYTACAZES, RJ.

ASPECTOS CLÍNICOS E LABORATORIAIS DE CÃES SUSPEITOS DE INFECÇÕES CAUSADASPOR Ehrlichia spp. E Anaplasma spp. EM CAMPOS DOS GOYTACAZES, RJ. ASPECTOS CLÍNICOS E LABORATORIAIS DE CÃES SUSPEITOS DE INFECÇÕES CAUSADASPOR Ehrlichia spp. E Anaplasma spp. EM CAMPOS DOS GOYTACAZES, RJ. MARIA VERÔNICA GALARCE ZAVALA UNIVERSIDADE ESTADUAL DO NORTE FLUMINENSE

Leia mais

Pesquisa de anticorpos anti-rickettsia rickettsii em eqüinos do Centro de Controle de Zoonoses do município de São Paulo (CCZ/SP)

Pesquisa de anticorpos anti-rickettsia rickettsii em eqüinos do Centro de Controle de Zoonoses do município de São Paulo (CCZ/SP) 85 Pesquisa de anticorpos anti-rickettsia rickettsii em eqüinos do Centro de Controle de Zoonoses do município de São Paulo (CCZ/SP) Jonas MORAES-FILHO 1 Maurício Claudio HORTA 1 Richard de Campos PACHECO

Leia mais

Diagnóstico Microbiológico

Diagnóstico Microbiológico Diagnóstico Microbiológico Identificação e Tipagem Bacteriana Prof. Vânia Lúcia Diagnóstico clínico Sinais (mensuráveis) e sintomas (subjetivos) Origem Etiologia Natureza Diagnóstico laboratorial Identificação

Leia mais

UNIVERSDADE CASTELO BRANCO QUALITTAS CLINICA MÉDICA DE PEQUENOS ANIMAIS ERLIQUIOSE CANINA. Gustavo Roberto Storti

UNIVERSDADE CASTELO BRANCO QUALITTAS CLINICA MÉDICA DE PEQUENOS ANIMAIS ERLIQUIOSE CANINA. Gustavo Roberto Storti UNIVERSDADE CASTELO BRANCO QUALITTAS CLINICA MÉDICA DE PEQUENOS ANIMAIS ERLIQUIOSE CANINA Gustavo Roberto Storti Ribeirão Preto, set. 2006 GUSTAVO ROBERTO STORTI Aluno do Curso de Clínica Médica de Pequenos

Leia mais

SOROPREVALÊNCIA DE Borrelia spp. EM EQUINOS DE USO MILITAR DO MUNICÍPIO DE SÃO BORJA, ESTADO DO RIO GRANDE DO SUL

SOROPREVALÊNCIA DE Borrelia spp. EM EQUINOS DE USO MILITAR DO MUNICÍPIO DE SÃO BORJA, ESTADO DO RIO GRANDE DO SUL SOROPREVALÊNCIA DE Borrelia spp. EM EQUINOS DE USO MILITAR DO MUNICÍPIO DE SÃO BORJA, ESTADO DO RIO GRANDE DO SUL SEROPREVALENCE OF Borrelia spp. IN HORSES THE MILITARY USE OF SÃO BORJA COUNTY, STATE OF

Leia mais

Boletim eletrônico. Anemia Infecciosa Equina. Ano1-Nº2 30 de Dezembro de 2010. IDAF/DDSIA/SEAR (Dados de janeiro a outubro de 2010) INTRODUÇÃO

Boletim eletrônico. Anemia Infecciosa Equina. Ano1-Nº2 30 de Dezembro de 2010. IDAF/DDSIA/SEAR (Dados de janeiro a outubro de 2010) INTRODUÇÃO Boletim eletrônico Epidemiológico Anemia Infecciosa Equina Ano-Nº 3 de Dezembro de. IDAF/DDSIA/SEAR (Dados de janeiro a outubro de ) EDITORIAL O boletim epidemiológico eletrônico é uma iniciativa do Departamento

Leia mais

ERLICHIOSE CANINA. Gabriela Cristina Gibrim Dias. Juliana Franzé Tiepo

ERLICHIOSE CANINA. Gabriela Cristina Gibrim Dias. Juliana Franzé Tiepo UNIVERSIDADE CASTELO BRANCO PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO COORDENAÇÃO DE PÓS-GRADUAÇAO CURSO DE PÓS-GRADUAÇÃO "LATO SENSU" EM CLÍNICA MÉDICA E CIRÚRGICA EM PEQUENOS ANIMAIS ERLICHIOSE CANINA

Leia mais

Comentários sobre os Indicadores de Morbidade e Fatores de Risco até 2006

Comentários sobre os Indicadores de Morbidade e Fatores de Risco até 2006 D.2.3 Taxa de incidência de dengue 1. Conceituação Número de casos novos notificados de dengue (clássico e febre hemorrágica da dengue códigos A90-A91 da CID-10), por 100 mil habitantes, na população residente

Leia mais

Hemoplasmose felina relato de caso

Hemoplasmose felina relato de caso Hemoplasmose felina relato de caso Carla Camargo Regus Jairo Ramos de Jesus Leonardo Rocha da Silva Paula P. Santos Fernando F. Argenta Cristine D. B. Fischer RESUMO A hemoplasmose felina está relacionada

Leia mais

Lílian Maria Lapa Montenegro Departamento de Imunologia Laboratório rio de Imunoepidemiologia

Lílian Maria Lapa Montenegro Departamento de Imunologia Laboratório rio de Imunoepidemiologia XVIII Congresso Mundial de Epidemiologia e VII Congresso Brasileiro de Epidemiologia Avaliação do desempenho da técnica de nested- PCR em amostras de sangue coletadas de pacientes pediátricos com suspeita

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

RIBEIRO UENF ALINE D ANGELO AGUIAR TERAPÊUTICA DA EHRLICHIOSE CANINA: EFICÁCIA DA ALOPATIA E DA HOMEOPATIA

RIBEIRO UENF ALINE D ANGELO AGUIAR TERAPÊUTICA DA EHRLICHIOSE CANINA: EFICÁCIA DA ALOPATIA E DA HOMEOPATIA UNIVERSIDADE ESTADUAL DO NORTE FLUMINENSE DARCY RIBEIRO UENF ALINE D ANGELO AGUIAR TERAPÊUTICA DA EHRLICHIOSE CANINA: EFICÁCIA DA ALOPATIA E DA HOMEOPATIA CAMPOS DOS GOYTACAZES RJ 2013 ALINE D ANGELO AGUIAR

Leia mais

INSTITUIÇÃO:UNIVERSIDADE FEDERAL RURAL DE PERNAMBUCO

INSTITUIÇÃO:UNIVERSIDADE FEDERAL RURAL DE PERNAMBUCO TÍTULO:AVALIAÇÃO DA INCIDÊNCIA DA DENGUE NO CAMPUS DA UNIVERSIDADE FEDERAL RURAL DE PERNAMBUCO ATRAVÉS DA CONFIRMAÇÃO SOROLÓGICA AUTORES: Cavalcanti, A. C.; Oliveira A. C. S. de; Pires, E. C. ; Lima, L.

Leia mais

LEPTOSPIROSE?? Bruna Coelho

LEPTOSPIROSE?? Bruna Coelho LEPTOSPIROSE?? Bruna Coelho M. V. do Serviço de Clínica Médica de Pequenos Animais HOVET FMVZ USP Residência em Clínica e Cirurgia de Pequenos animais HOVET FMVZ USP Especialização em Clínica Médica FMVZ

Leia mais

CORRELAÇÃO ENTRE VELOCIDADE DE HEMOSSEDIMENTAÇÃO E PROTEÍNA C REATIVA EM UM GRUPO DE IDOSOS.

CORRELAÇÃO ENTRE VELOCIDADE DE HEMOSSEDIMENTAÇÃO E PROTEÍNA C REATIVA EM UM GRUPO DE IDOSOS. CORRELAÇÃO ENTRE VELOCIDADE DE HEMOSSEDIMENTAÇÃO E PROTEÍNA C REATIVA EM UM GRUPO DE IDOSOS. Autor: ANA LUIZADA SILVA Orientador: Sâmia Macedo Queiroz Mota Castellão Tavares Coautor(es): Ana Luiza da Silva,

Leia mais

UNIVERSIDADE CASTELO BRANCO CURSO DE PÓS-GRADUAÇÃO CLÍNICA MÉDICA E CIRÚRGICA DE PEQUENOS ANIMAIS ERLIQUIOSE CANINA. Renata Guimarães Canello

UNIVERSIDADE CASTELO BRANCO CURSO DE PÓS-GRADUAÇÃO CLÍNICA MÉDICA E CIRÚRGICA DE PEQUENOS ANIMAIS ERLIQUIOSE CANINA. Renata Guimarães Canello UNIVERSIDADE CASTELO BRANCO CURSO DE PÓS-GRADUAÇÃO CLÍNICA MÉDICA E CIRÚRGICA DE PEQUENOS ANIMAIS ERLIQUIOSE CANINA Renata Guimarães Canello São Paulo, Set. 2009. RENATA GUIMARÃES CANELLO Aluna do Curso

Leia mais

TÍTULO: SCREENING PARA AMILASE SALIVAR EM CÃES DE DIFERENTES RAÇAS CATEGORIA: EM ANDAMENTO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE

TÍTULO: SCREENING PARA AMILASE SALIVAR EM CÃES DE DIFERENTES RAÇAS CATEGORIA: EM ANDAMENTO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE TÍTULO: SCREENING PARA AMILASE SALIVAR EM CÃES DE DIFERENTES RAÇAS CATEGORIA: EM ANDAMENTO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: MEDICINA VETERINÁRIA INSTITUIÇÃO: UNIVERSIDADE ANHEMBI MORUMBI AUTOR(ES):

Leia mais

VIRUS O QUE SÃO VIRUS São as menores entidades biológicas: têm DNA e proteínas. Medem entre 15 e 300 nm. São seres acelulares: São parasitas intracelulares obrigatórios: Só se reproduzem dentro de células.

Leia mais

AVALIAÇÃO DO PERFIL GLICÊMICO EM INDIVÍDUOS COM DEFICIÊNCIA INTELECTUAL APRESENTANDO OU NÃO SÍNDROME DE DOWN

AVALIAÇÃO DO PERFIL GLICÊMICO EM INDIVÍDUOS COM DEFICIÊNCIA INTELECTUAL APRESENTANDO OU NÃO SÍNDROME DE DOWN 12. CONEX Apresentação Oral Resumo Expandido 1 ÁREA TEMÁTICA: ( ) COMUNICAÇÃO ( ) CULTURA ( ) DIREITOS HUMANOS E JUSTIÇA ( ) EDUCAÇÃO ( ) MEIO AMBIENTE ( X) SAÚDE ( ) TRABALHO ( ) TECNOLOGIA AVALIAÇÃO

Leia mais

HEPATOZOONOSE CANINA

HEPATOZOONOSE CANINA HEPATOZOONOSE CANINA Sílvia Letícia Monteiro JUNQUEIRA 1, Tales Dias do PRADO 2, Helton Freires OLIVEIRA³, Thays Nascimento COSTA 4, Luiz Antonio Franco da SILVA 5. 1. Médica Veterinária Residente de Patologia

Leia mais

ANEMIA MICROCÍTICA EM PEQUENOS ANIMAIS

ANEMIA MICROCÍTICA EM PEQUENOS ANIMAIS ANEMIA MICROCÍTICA EM PEQUENOS ANIMAIS GARCIA, Claudia Zeferino HERRERA, Mariana de Souza JÚNIOR, José Maria Fernandes ALMEIDA, Marcio Fernando RAMOS, Matheus Henrique Fabri Discentes do 3º ano de Medicina

Leia mais

Infermun em parvovirose canina

Infermun em parvovirose canina em parvovirose canina Redução do tempo de recuperação em cães infectados por Parvovirus e tratados com Departamento I+D. Laboratórios Calier, S.A. INTRODUÇÃO: A Parvovirose é uma das enfermidades entéricas

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais

Gráfico 1: Frequência das formas clínico-histopatológicas da hanseníase, representada em porcentagem de casos.

Gráfico 1: Frequência das formas clínico-histopatológicas da hanseníase, representada em porcentagem de casos. 37 5-RESULTADOS Do total de 128 amostras estudadas, obtidos de 128 pacientes, 66 casos (51,56%) foram do sexo masculino e 62 casos (48,48%) do sexo feminino. A idade dos pacientes variou de 03 anos a 88

Leia mais

RAIVA. A raiva é um doença viral prevenível de mamíferos, que geralmente é transmitida através da mordida de uma animal infectado.

RAIVA. A raiva é um doença viral prevenível de mamíferos, que geralmente é transmitida através da mordida de uma animal infectado. RAIVA A raiva é um doença viral prevenível de mamíferos, que geralmente é transmitida através da mordida de uma animal infectado. RAIVA PRINCIPAIS VETORES - Furão (ferrets) - Raposas - Coiotes - Guaxinins

Leia mais

DETECÇÃO PARASITOLÓGICA, MOLECULAR E SOROLÓGICA DE Ehrlichia canis E Babesia canis EM CÃES DA REGIÃO CENTRO - ORIENTAL DA COLÔMBIA.

DETECÇÃO PARASITOLÓGICA, MOLECULAR E SOROLÓGICA DE Ehrlichia canis E Babesia canis EM CÃES DA REGIÃO CENTRO - ORIENTAL DA COLÔMBIA. UNIVERSIDADE ESTADUAL PAULISTA JÚLIO DE MESQUITA FILHO FACULDADE DE CIÊNCIAS AGRÁRIAS E VETERINÁRIAS CÂMPUS DE JABOTICABAL DETECÇÃO PARASITOLÓGICA, MOLECULAR E SOROLÓGICA DE Ehrlichia canis E Babesia canis

Leia mais

UNIVERSIDADE CASTELO BRANCO PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO COORDENAÇÃO DE PÓS-GRADUAÇÃO CURSO DE PÓS-GRADUAÇÃO LATO SENSU

UNIVERSIDADE CASTELO BRANCO PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO COORDENAÇÃO DE PÓS-GRADUAÇÃO CURSO DE PÓS-GRADUAÇÃO LATO SENSU UNIVERSIDADE CASTELO BRANCO PRÓ-REITORIA DE PESQUISA E PÓS-GRADUAÇÃO COORDENAÇÃO DE PÓS-GRADUAÇÃO CURSO DE PÓS-GRADUAÇÃO LATO SENSU EM CLÍNICA MÉDICA E CIRURGICA EM PEQUENOS ANIMAIS ERLIQUIOSE CANINA Vinnicyus

Leia mais

SUSCETIBILIDADE AO BENZONIDAZOL DE ISOLADOS DE Trypanosoma cruzi DA AMAZÔNIA BRASILEIRA

SUSCETIBILIDADE AO BENZONIDAZOL DE ISOLADOS DE Trypanosoma cruzi DA AMAZÔNIA BRASILEIRA SUSCETIBILIDADE AO BENZONIDAZOL DE ISOLADOS DE Trypanosoma cruzi DA AMAZÔNIA BRASILEIRA Gleison Daion Piovezana Bossolani (PIBIC/CNPq-UEM), Ana Paula Margioto Teston, Daniele dos Reis, Greicy Brisa Malaquias

Leia mais

FACULDADE CATÓLICA SALESIANA GRADUAÇÃO EM ENFERMAGEM DISCIPLINA DE DOENÇAS INFECTO-PARASITÁRIAS HIV/AIDS

FACULDADE CATÓLICA SALESIANA GRADUAÇÃO EM ENFERMAGEM DISCIPLINA DE DOENÇAS INFECTO-PARASITÁRIAS HIV/AIDS FACULDADE CATÓLICA SALESIANA GRADUAÇÃO EM ENFERMAGEM DISCIPLINA DE DOENÇAS INFECTO-PARASITÁRIAS HIV/AIDS Descrição Doença que representa um dos maiores problemas de saúde da atualidade, em função de seu

Leia mais

Questionário - Proficiência Clínica

Questionário - Proficiência Clínica Tema Elaboradora TESTE DE ANTIGLOBULINA E SUA APLICAÇÃO EM LABORATÓRIOS Margarida de Oliveira Pinho, Bióloga, Responsável pelo Setor de Imunohematologia e Coordenação da equipe técnica do Serviço de Hemoterapia

Leia mais

Homeopatia e isoterapia no tratamento da Ehrlichiose canina

Homeopatia e isoterapia no tratamento da Ehrlichiose canina Trabalho de Pesquisa e isoterapia no tratamento da Ehrlichiose canina Homeopathy and isotherapy on canine Ehrlichiosis treatment Aline D Angelo Aguiar - Médica Veterinária Homeopata (IHB), Pós-graduada

Leia mais

Diagnóstico Laboratorial de Chikungunya

Diagnóstico Laboratorial de Chikungunya Diagnóstico Laboratorial de Chikungunya Fernanda Montenegro de Carvalho Araújo Dezembro/2014 Introdução A febre do CHIKUNGUNYA é uma doença endêmica nos países do Sudeste da Ásia, África e Oceania e emergente

Leia mais

Informe Epidemiológico EBOLA N O 13 Atualizado em 28-10-2014, às 14h

Informe Epidemiológico EBOLA N O 13 Atualizado em 28-10-2014, às 14h Informe Epidemiológico EBOLA N O 13 Atualizado em 28-10-2014, às 14h Situação Atual Os países com casos de Doença pelo Vírus Ebola (DVE) são classificados em duas categorias: 1- Países com transmissão

Leia mais