Polymerase Chain Reaction

Tamanho: px
Começar a partir da página:

Download "Polymerase Chain Reaction"

Transcrição

1 Universidade Federal do Rio Grande do Sul Instituto de Ciências Básicas da Saúde Laboratório de Virologia Polymerase Chain Reaction Equipe de Virologia UFRGS & IPVDF

2 PCR Desenvolvida em meados dos anos 80 Revolucionou a Biologia Molecular Síntese enzimática de cópias de DNA a partir de uma seqüência alvo Reação baseada na replicação do DNA

3 PCR Importância no diagnóstico virológico Requer um mínimo de material gênico para sua realização Pode aliar alta sensibilidade com alta especificidade Resultado em poucas horas

4 PCR Replicação do DNA in vivo Proteínas SSP ou DNA girase

5 PCR Síntese de DNA in vitro Reagentes DNA molde Primers Taq polimerase DNTPs Tampão da enzima H 2 O MgCl 2 Outros: DMSO, glicerol

6 Temperatura PCR - Amplificação Fonte: wps.prenhall.com

7 PCR - Amplificação

8 PCR - Amplificação

9 PCR - Amplificação

10 PCR Ciclos consistindo de 3 etapas: Desnaturação (15seg-1min a 94-95ºC) Anelamento (15seg-1min a 50-55ºC*) Extensão (15seg-3min** a 72ºC) *Temperatura determinada pela Tm dos primers **Tempo determinado pelo tamanho do produto

11 PCR *O que é Tm? Melting temperature

12 PCR A característica da sequência alvo também vai determinar a Tm P. ex.: Herpesvírus bovino 1 ou 5 apresentam um conteúdo de GC em torno de 72% Herpesvírus ovino tipo 2: 52% de GC SV 40 (poliomavírus): 40% GC

13 PCR Taq polimerase: enzima que sintetiza DNA Oriunda do Thermus aquaticus Temperatura ótima: 72 o C Processividade em torno de 1000 pb/min Produto de 500 pb: 30 seg de extensão Produto de 1500 pb: 1 min e 30 seg

14 Fonte: Dieffenbach & Dveksler, 1995 PCR

15 PCR Primers = oligonucleotídeos Pequenas sequencias de nucleotídeos desenhados para serem complementares a sequência alvo O tamanho pode variar entre 15-30pb Normalmente apresentam 50% de GC

16 PCR Outros reagentes: MgCl 2 : cofator da enzima

17 Outros reagentes: PCR DNTPs: deoxinucleotideos trifosfato datp (adenina), dttp (timina), dctp (citosina) e dgtp (guanina) Água (diluente)

18 PCR Outros reagentes: Tampão: oferece as condições básicas (50mM KCl; 10 mm Tris-HCl) para que a reação ocorra Glicerol; DMSO: diminuem a temperatura de fusão e separação das fitas, aumentando a especificidade de anelamento dos primers DNA molde: extração de DNA

19 Extração de ácidos nucléicos Extração de DNA total A partir de tecido remetido ao laboratório Etapas básicas no processo: Lise celular Extração dos ácidos nucléicos Precipitação dos ácidos nucléicos

20 Extração de ácidos nucléicos Composição química de uma célula procariótica DNA 3% RNA 20% Monômeros (aa) 3% Íons inorgânicos 1% Lipopolissacarídeo 3% Proteína 56% Lipídeo 9% Polissacarídeo 5% Fonte: Madigan, 2004

21 Extração de ácidos nucléicos Análise da extração de DNA total A B : Marcador λ x Hind III 2: 400nm de DNA bacteriófago Lambda 3-8: DNA total extraído de gânglios trigêmeos de bovinos 1 e 14: Marcador λ x Hind III 2-13: DNA total extraído de gânglios trigêmeos de bovinos Temos o DNA, falta a sequência alvo? Fotos: Fabrício Campos

22 Sequência alvo PCR

23 Sequência alvo PCR

24 PCR Sequência alvo vai dar origem ao produto de PCR TATGGAGAAGGAAGAGCCCGATACGCTCGCACCACGAGCTTCACGTGACGCTCCGGG GACGCCAAAAGTGCCCGCGATGCCCGGTGTGACCCCGGAGCCATCAGGAAACGCCTC GGAGCCCGCCGACCCGGCGGAGCTCCGGGCGGACTTGCGGGGTCTAAAAGGCTCCA GCGACGATCCTAATTTCTACGTGTGCCCCCCTCCCACCGGTGCGACCGTGGTGCGGCT CGAGGAGCCGCGCCCGTGCCCGGAGTTGCCCAAGGGGCTCAACTTCACCGAGGGCAT CGCCGTAACTTTCAAGGAGAACCTCGCGCCGTACAAGTTTAAGGCCACTATGTACTACAA GGCCGTGACTGTCGCTAGCGTGTGGTCCGGGTACTCGTATAACCAGTTTATGAATATCTT TGAGGACCGTGCCCCTATACCGTTCGAGGAAATCGTCGACCGGATACACGGCCGGGGT ATGTGTTTGTCCACGGCAAAGTACGTCAGGAACAACCTTGAGACCACCGCATTCCATAAT GATGCCGACGAACATGAGATGAAGCTGGTGCCCGCCGAGTCCGCCCCTGGGTTGCATC GCGGATGGCACACCACGCGGCTAAAAA Bovine herpesvirus type 2 glycoprotein B gene BoHV-2F: TATGGAGAAGGAAGAGCCCG BoHV-2R: TTTTTAGCCGCGTGGTGTGC Produto da PCR: 608 pb

25 PCR Fatores que podem interferir na amplificação Reagentes DNA molde Taq polimerase Tampão da enzima MgCl 2 Primers DNTPs H 2 O Outros: DMSO, glicerol

26 Excesso MgCl 2 PCR

27 Excesso DNA PCR

28 Excesso primers PCR

29 PCR Curva DMSO 10% 12% 14%

30 Fase exponencial da PCR Acúmulo de seqüências-alvo durante a PCR em função do nº de ciclos: Fonte: Dieffenbach & Dveksler, 1995

31 PCR Inibidores Excesso de DNA Fenol, clorofórmio Etanol, isopropanol Proteínas H 2 0 (íons, metais pesados) Manipulador Taq, primers, DNTPs Falta de MgCl 2

32 PCR Pode sofrer alterações em relação ao tipo de tecido, condições da reação, experiência do manipulador Exige a padronização do teste ( in house ) Ocorrência de contaminações que levam a resultados falsos positivos e falsos negativos

33 Questão 1 Como podemos evitar a ocorrência de resultados falso-positivos?

34 Fontes de contaminação Combatendo as fontes de contaminação Identificação (fontes pré e pós-pcr) Redução Programa de controle

35 Fontes de contaminação Pré-PCR Manipulação de clones de plasmídeos Extrações repetidas do ácido nucléico molde Preparação do mix da reação

36 Fontes de contaminação Pós-PCR Execução da PCR Geração de aerossóis associada com a análise dos produtos Disseminação da seqüência-alvo

37 Esquema do processamento e análise de amostras Pré-PCR Pós-PCR Fonte: Theodore E. Mifflin

38 Laboratório de diagnóstico Contaminações Análises repetidas da seqüência alvo ( template ) Baixo limite de detecção da PCR (sensibilidade) Principal fonte de contaminação Contaminação pós-pcr pré-pcr

39 Controle da contaminação Dividir em áreas separadas a manipulação do DNA/RNA Extração Preparação do mix (DNTPs, MgCl 2, buffer) Execução da PCR Manipulação e análise dos produtos da PCR

40 Salas pré e pós-pcr Fonte: Theodore E. Mifflin

41 Programa de controle Esterilização dos reagentes Aliquotar os reagentes da PCR Água deonizada, equipamentos, pipetadores, ponteiras em cada sala Adição de controles positivo, negativo e branco (água)

42 Programa de controle Pipetar a amostra com DNA molde como último passo Uso de ponteiras com filtro, de luvas Descontaminação do ambiente (luz UV) Controle e remoção dos amplicons como base do controle da contaminação

43 Questão 2 Como podemos evitar a ocorrência de resultados falso-negativos?

44 Controle interno Seqüência de DNA, diferente da seqüência-alvo, adicionada a cada amostra para ser co-amplificada Detecta falhas na amplificação devido a presença de inibidores Seqüência baseada na seqüência do produto amplificado

45 Controle interno Utiliza os mesmos oligonucleotídeos Presente em todas as reações

46 Variações da técnica de PCR Variações da PCR DNA PCR DNA fs ou cdna RNA RT-PCR RT AAAAA PCR PCR

47 Variações da técnica de PCR Variações da PCR PCR Nested-PCR Multiplex-PCR DNA DNA fd DNA fd PCR PCR 1º par de primers PCR PCR DNA fd PCR 2 o par de primers Possíveis múltiplos pares de primers

48 Nested PCR 570 pb Produto da 1ª PCR BoHV-1 BoHV pb 236 pb

49 Semi-Nested PCR 608 pb Produto da 1ª PCR BoHV pb

50 Real time PCR Detecção da amplificação associada a cada ciclo durante a PCR Quantificação do DNA ou RNA viral (cdna) Ciclos ultra-rápidos (30 min a 2 horas) Nenhuma análise no final da reação de PCR

51 Real time PCR Fonte:

52 Referências THEODORE E. MIFFLIN. Setting up a PCR laboratory. Department of Pathology, University of Virginia, Charlottesville, Virginia VERLENGIA, R.; CRESPO HIRATA, R.D., HIRATA, M.H. Biologia Molecular - Prevenção e controle da contaminação nas reações de amplificação de ácidos nucléicos. NewsLab 43; p.69-80; ESTEVES, P.A.; SILVA, A.D.; SPILKI, F.R.; PINTO, L.S.; DELAGOSTIN, O.A.; FRANCO, A.C.; RIJSEWIJK, F.A.M.; ROEHE, P.M. Differentiation between bovine herpesvirus types 1.1; 1.2 and 5 (BoHV) by polymerase chain reaction followed by restriction enzyme analysis (PCR REA) of a carboxy-terminal region of glycoprotein C (gc) gene.in press. VAN ENGELENBURG, F.A.C.; MAES, R.K.; VAN OIRSCHOT, J.T.; RIJSEWIJK, F.A.M. Development of a Rapid and Sensitive Polymerase Chain Reaction Assay for Detection of Bovine Herpesvirus Type 1 in Bovine Semen. Journal of Clinical Microbiology. Vol. 31, No p

53 Grato pela atenção! Contato:

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR)

Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

WHO GLOBAL SALM-SURV NÍVEL III

WHO GLOBAL SALM-SURV NÍVEL III WHO GLOBAL SALM-SURV NÍVEL III CAMPYLOBACTER spp. Multiplex PCR para detecção de C. jejuni e C. coli Grace Theophilo LRNCEB IOC/FIOCRUZ gtheo@ioc.fiocruz.br Diagnóstico molecular para Campylobacter spp.

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

Departamento de Zoologia da Universidade de Coimbra

Departamento de Zoologia da Universidade de Coimbra Departamento de Zoologia da Universidade de Coimbra Ana Luísa Carvalho Amplificação de um fragmento de DNA por PCR Numa reacção em cadeia catalizada pela DNA polimerase (Polymerase Chain Reaction - PCR),

Leia mais

Kit para calibração de PCR pht

Kit para calibração de PCR pht Kit para calibração de PCR pht Itens fornecidos: Tampões ( concentrado) Composição ( concentrado) I0 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton X-100 IB 500 mm KCl; 100 mm Tris-HCl ph 8,4; 1% Triton

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Exercício 3 PCR Reação em Cadeia da Polimerase

Exercício 3 PCR Reação em Cadeia da Polimerase Exercício 3 PCR Reação em Cadeia da Polimerase (Polymerase Chain Reaction - PCR) Uma das dificuldades dos pesquisadores frente à análise baseada no DNA é a escassez deste. Na medicina forense pode-se ter

Leia mais

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO

BIOTECNOLOGIA FARMACÊUTICA. Aplicação no Laboratório Clínico - PCR APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO BIOTECNOLOGIA FARMACÊUTICA APLICAÇÃO DA BIOTECNOLOGIA NO LABORATÓRIO CLÍNICO Conteúdos abordados -Relembrar alguns conceitos da Replicação do DNA in vivo Aplicação no Laboratório Clínico - PCR -Algumas

Leia mais

RELATÓRIO DE AULA PRÁTICA

RELATÓRIO DE AULA PRÁTICA RELATÓRIO DE AULA PRÁTICA Universidade Federal de Minas Gerais Instituto de Ciências Biológicas Departamento de Bioquímica e Imunologia Professor: Miguel Alunos: Gustavo Bastos, Hugo Rezende, Monica Maertens,

Leia mais

PCR Reação de Polimerase em Cadeia. Termociclador

PCR Reação de Polimerase em Cadeia. Termociclador PCR Reação de Polimerase em Cadeia Termociclador REAÇÃO EM CADEIA DA POLIMERASE (PCR) Técnica que permite a amplificação da quantidade de DNA específico utilizando a enzima Taq DNA polimerase, sequências

Leia mais

Mestrado em Genética Molecular

Mestrado em Genética Molecular Mestrado em Genética Molecular Ano lectivo de 2000/2001, edição 2000-2002 Biologia Molecular Expressão génica (RT-PCR) Protocolo das sessões práticas Braga, 2000 Rui Pedro Soares de Oliveira Mestrado em

Leia mais

Biologia Molecular. Técnicas Moleculares. Lucas Brandão

Biologia Molecular. Técnicas Moleculares. Lucas Brandão Biologia Molecular Técnicas Moleculares Lucas Brandão CONCEITOS BÁSICOS Núcleo - Célula Humana DENTRO DO DNA SE ENCONTRAM OS GENE Definição de Genes Estrutura Gênica n=23, X ou Y 5 UTR 1 Pai Introns 2

Leia mais

IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA

IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA Reação em Cadeia de Polimerase IV CURSO DE VERÃO EM BIOLOGIA MOLECULAR E GENÔMICA MsC. Ingrid Thaís Beltrame Botelho doutoranda ingridthaisbb@hotmail.com O que é PCR? Amplificação de um segmento específico

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

O que é a Reacção em Cadeia da Polimerase (PCR)?

O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? O que é a Reacção em Cadeia da Polimerase (PCR)? 3 5 F R 3 5 Um processo para multiplicar selectivamente um determinado segmento de DNA Esse segmento pode

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio.

Análise Genética de Ceiba pentandra (samaúma) ocorrentes na área de Influência da UHE Santo Antônio. PROJETO: Análise Genética das Populações de Myrciaria dubia (camu-camu) e Ceiba pentandra (samaúma) ocorrentes na área de Influencia da UHE Santo Antônio. Análise Genética de Ceiba pentandra (samaúma)

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 3 - Análise dos produtos: Qualitativa e Semi- Quantitativa

Leia mais

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA

PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA PLANO DE MINICURSO TÍTULO DO MINICURSO: 60 ANOS DO DNA E OS AVANÇOS DA PRODUÇÃO AGROPECUÁRIA OBJETIVO: Proporcionar aos participantes uma maior compreensão dos avanços que a descoberta da estrutura da

Leia mais

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme)

CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) CARACTERIZAÇÃO MOLECULAR DA DREPANOCITOSE (Anemia Falciforme) Genética Humana, LCS 3º Ano,1º Semestre, 2012-2013 2ª Aula Sumário Quantificação de DNA cromossomal e avaliação do grau de pureza por espectrofotometria

Leia mais

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR

Manual Técnico. quantificação de DNA humano em análises forenses. Para WWW.GENOMIC.COM.BR Kit Genomic de Quantificação de DNA Manual Técnico Para quantificação de DNA humano em análises forenses WWW.GENOMIC.COM.BR 1. Introdução Na maioria dos casos forenses, as amostras recebidas apresentam-se

Leia mais

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos

LABORATÓRIO DE BIOENGENHARIA. Métodos rápidos de tipagem de microrganismos LABORATÓRIO DE BIOENGENHARIA Métodos rápidos de tipagem de microrganismos Tradicionalmente, o estudo de microrganismos, a nível genético, bioquímico/fisiológico ou apenas a nível de identificação, requer

Leia mais

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores

Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores Exercício 4 Sequenciamento por finalizadores de cadeia Sequenciamento do DNA: os finalizadores A determinação da seqüência de bases de um segmento de DNA é um passo crítico em muitas aplicações da Biotecnologia.

Leia mais

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR:

Rev. 04 Out/2013. a) Preparo da etapa de amplificação real time área de pós PCR: RTSD01-II Fator II G20210A Q PCR Alert Kit Rev. 04 Out/2013 Instruções de Uso USO PRETENDIDO O produto FATOR II Q-PCR Alert é um kit para teste de amplificação quantitativa de ácidos nucleicos para a determinação

Leia mais

LICENCIATURA EM MEDICINA

LICENCIATURA EM MEDICINA LICENCIATURA EM MEDICINA Disciplina de Biologia Molecular (2º Ano) Ano Lectivo de 2006/2007 3º AULA PRÁTICA 1 - Introdução à tecnologia de PCR 1.1. A reacção de PCR Príncipios e variantes da técnica 2.

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 2 - Características das Reações e Padronização O advento

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 1 - PCR: Princípios e tipos de Reação Breve Histórico Desenvolvida

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

ISOLAMENTO E MANIPULAÇÃO DE UM GENE

ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva

PCR MARCADORES MOLECULARES. Prof. Dr. José Luis da C. Silva PCR MARCADORES MOLECULARES Prof. Dr. José Luis da C. Silva Histórico da PCR Kornberg (1960) Isolou e caracterizou a DNA polimerase. O isolamento desta enzima possibilitou o desenvolvimento da síntese in

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR

Engenharia Molecular. Kit Autossômico GEM. EM-22plex sem extração. Manual Técnico WWW.GENOMIC.COM.BR Engenharia Molecular Kit Autossômico GEM EM-22plex sem extração Manual Técnico WWW.GENOMIC.COM.BR 1. Introdução STRs (short tandem repeats) são sequências repetitivas de 3 a 7 pares de bases encontradas

Leia mais

Biologia molecular aplicada ao diagnóstico de vírus

Biologia molecular aplicada ao diagnóstico de vírus Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG Biologia Molecular DNA RNA Proteínas Célula

Leia mais

Conceitos Básicos de Técnicas em Biologia Molecular

Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 1 2 Conceitos Básicos de Técnicas em Biologia Molecular Conceitos Básicos de Técnicas em Biologia Molecular 3 ISSN 0103-0205 Setembro, 2008 Empresa Brasileira

Leia mais

Mistura de primers de oligonucleotídeos. Mistura de sondas fluorescentes marcadas com FAM / MGB-NFQ e com VIC / MGB-NFQ

Mistura de primers de oligonucleotídeos. Mistura de sondas fluorescentes marcadas com FAM / MGB-NFQ e com VIC / MGB-NFQ RTS110 Aspergillus ssp. Q PCR Alert Kit Instruções de Uso USO PRETENDIDO O kit ASPERGILLUS Q-PCR Alert Kit faz parte de um teste de amplificação quantitativa de ácidos nucleicos para a detecção e dosagem

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

Rev. 04 Out/2013. Amostras

Rev. 04 Out/2013. Amostras BANG07-02 BANG07-05 Philadelphia Oligomix Alert Kit Instruções de Uso USO PRETENDIDO O produto «PHILADELPHIA oligomix Alert kit» é um teste qualitativo de amplificação dos ácidos nucleicos para a pesquisa

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO

ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

Virologia em Laboratório Fase Pré- Analítica

Virologia em Laboratório Fase Pré- Analítica Virologia em Laboratório Fase Pré- Analítica Leonor Rebelo Lab Virologia i do IPOFGL EPE Novembro 2012 1º Curso de Virologia Molecular em Oncologia 1 ,, TÑÜxÇwxÜ t ØÇ vt vé át wx Öâx t ÅxÇàx ÇâÇvt áx vtçát?

Leia mais

Documentos ISSN 0101-6245 Dezembro, 2006

Documentos ISSN 0101-6245 Dezembro, 2006 Documentos ISSN 0101-6245 Dezembro, 2006 116 TÉCNIICAS EM BIIOLOGIIA MOLECULAR ISSN 0101-6245 Dezembro, 2006 Empresa Brasileira de Pesquisa Agropecuária Centro Nacional de Pesquisa de Suínos e Aves Ministério

Leia mais

DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED

DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED DETECÇÃO E DIFERENCIAÇÃO DOS POLIOMAVÍRUS JC E BK PELA REAÇÃO EM CADEIA DA POLIMERASE (PCR) SEMI-NESTED Alâna Costa de Oliveira 1, Marisa Chesky 2 Farmacêutica do Laboratório de Diagnóstico de Doenças

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais

HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem

HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem O Vírus da Hepatite C (HCV) é considerado o principal agente etiológico responsável por 90 a 95% dos casos de hepatite pós-transfusional não A e não

Leia mais

7.012 Conjunto de Problemas 3

7.012 Conjunto de Problemas 3 Nome Seção 7.012 Conjunto de Problemas 3 Data estelar 7.012.10.4.00 Diário Pessoal do Oficial Médico Responsável do USS Hackerprise Depois de voltar de uma missão em Europa, Noslen, um dos membros da tripulação,

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

UM NOVO TESTE PARA TUBERCULOSE

UM NOVO TESTE PARA TUBERCULOSE UM NOVO TESTE PARA TUBERCULOSE Rio de Janeiro e Manaus testam para o Ministério da Saúde uma nova tecnologia para o diagnóstico da tuberculose pulmonar Que novo teste é este? O Xpert MTB/RIF é um método

Leia mais

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR

Noções Básicas de Seqüenciamento Genético. Maria do Carmo Debur LACEN/PR Noções Básicas de Seqüenciamento Genético Maria do Carmo Debur LACEN/PR Determinar a seqüência de nucleo3deos do DNA Métodos Clássicos 1976 Allan Maxam e Walter Gilbert (EUA) Método da Degradação Química

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Genética Molecular Técnicas aplicadas a produção animal

Genética Molecular Técnicas aplicadas a produção animal MINISTÉRIO DA EDUCAÇÃO UNIVERSIDADE FEDERAL DE PELOTAS FACULDADE DE AGRONOMIA ELISEU MACIEL DEPARTAMENTO DE ZOOTECNIA PROGRAMA DE PÓS-GRADUAÇÃO EM ZOOTECNIA Genética Molecular Técnicas aplicadas a produção

Leia mais

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO

GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Extração de DNA. Prof. Silmar Primieri

Extração de DNA. Prof. Silmar Primieri Extração de DNA Prof. Silmar Primieri Conceitos Prévios O que é DNA? Onde se localiza o DNA na célula? Do que são formadas as membranas celulares? Qual a estrutura do DNA? O que é DNA? Unidade básica informacional

Leia mais

Bases Moleculares da Hereditariedade

Bases Moleculares da Hereditariedade UNIVERSIDADE FEDERAL DO PIAUÍ CENTRO DE CIÊNCIAS AGRÁRIAS PROG. DE PÓS GRAD. EM GENET. E MELHORAMENTO NÚCLEO DE ESTUDOS EM GENET. E MELHORAMENTO Bases Moleculares da Hereditariedade Ministrante: João Paulo

Leia mais

PCR technology for screening and quantification of genetically modified organisms (GMOs)

PCR technology for screening and quantification of genetically modified organisms (GMOs) Universidade do Algarve Faculdade de Ciências do Mar e do Ambiente Curso de Licenciatura em Biologia Marinha e Pescas PCR technology for screening and quantification of genetically modified organisms (GMOs)

Leia mais

Ficha Informativa nº11 Fundamentos de Engª.Genética

Ficha Informativa nº11 Fundamentos de Engª.Genética FICHA INFORMATIVA Nº11 FUNDAMENTOS DE ENGª.GENÉTICA Ficha Informativa nº11 Fundamentos de Engª.Genética Durante 25 anos, desde 1950 a 1957, a molécula de DNA foi considerada intocável. A partir da década

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

Produção de Proteínas Recombinantes em Escherichia coli

Produção de Proteínas Recombinantes em Escherichia coli Produção de Proteínas Recombinantes em Escherichia coli Prof. Dr. Catarina Akiko Miyamoto 1 Resumo A produção de proteínas recombinantes para fins terapêuticos, veterinários, e agro-pecuários tem se mostrado

Leia mais

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias.

09 Mutações não interferem no polimorfismo genético e não constituem modificações hereditárias. LISTA DE EXERCÍCIOS 01 Para a realização do exame de paternidade, a perícia, geralmente, é realizada no campo médico-legal por meio da pesquisa do DNA. Porém, pode ocorrer que, sendo esta impossível por

Leia mais

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos

1. Amplificação por PCR de um fragmento do ADN contendo o local de interesse para esses indivíduos Atividades Laboratoriais Caso prático A substituição de uma guanina por uma adenina (G>A) afeta a posição 18 do gene GNPTAB (18G>A). No sentido de caracterizar um grupo de indivíduos para esta substituição

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Técnicas de PCR: Aplicações e Padronização de Reações

Técnicas de PCR: Aplicações e Padronização de Reações Técnicas de PCR: Aplicações e Padronização de Reações BSc. Daniel Perez Vieira (Protozoologia-IMTSP/ Laboratório de Biologia Molecular-IPEN) Aula 4 - Recursos Computacionais: Programas e Sites Relacionados

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

Alexandre Havt. Estrutura dos Ácidos Nucléicos. DNA e RNA Replicação Transcrição Tradução Introdução à Biologia Molecular

Alexandre Havt. Estrutura dos Ácidos Nucléicos. DNA e RNA Replicação Transcrição Tradução Introdução à Biologia Molecular Estrutura dos Ácidos Nucléicos DN e RN Replicação Transcrição Tradução Introdução à Biologia Molecular lexandre Havt Moléculas com informações para a síntese de proteínas DN armazém ou biblioteca celular

Leia mais

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia

Replicação do DNA REPLICAÇÃO DIVISÃO CELULAR E REPLICAÇÃO DNA REPLICAÇÃO. REPLICAÇÃO - Bibliografia REPLICAÇÃO Plano de Aula -DNA e Hereditariedade -Processo de replicação REPLICAÇÃO Prof. Juliana Schmidt Curso Farmácia 2012 REPLICAÇÃO - Bibliografia DIVISÃO CELULAR E REPLICAÇÃO ALBERTS, B.; BRAY, D.;

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo

Manual da Oficina Prática de Genética, Genoma e Biotecnologia. Quarto Módulo www.odnavaiaescola.org Todos os direitos reservados à DNA Goes to School, Inc. 2003 Manual da Oficina Prática de Genética, Genoma e Biotecnologia Quarto Módulo Multiplicando o nosso DNA Kary Mullis A técnica

Leia mais

Introdução a Biologia Molecular

Introdução a Biologia Molecular Mestrado em Microbiologia e Parasitologia Disciplina: Fundamentos de Biologia Molecular Introdução a Biologia Molecular Profa. Rita de Cássia Nasser Cubel Garcia Biologia Molecular consiste principalmente

Leia mais

Atividade de Biologia 1 série

Atividade de Biologia 1 série Atividade de Biologia 1 série Nome: 1. (Fuvest 2013) Louis Pasteur realizou experimentos pioneiros em Microbiologia. Para tornar estéril um meio de cultura, o qual poderia estar contaminado com agentes

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: Todos os direitos são reservados 2015. www.tioronni.com O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS

SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS SEQÜENCIAMENTO ENCIAMENTO DE DNA: MÉTODOS E PRINCÍPIOS PIOS Cristiane Kioko Shimabukuro Dias Pós-doutorado - FAPESP E-mail: crisdias@ibb.unesp.br Laboratório de Biologia e Genética de Peixes - Departamento

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

Análises de DNA. O DNA e sua história. DNA nos remete a Hereditariedade. -Hipócrates ( a.c.): pangênese

Análises de DNA. O DNA e sua história. DNA nos remete a Hereditariedade. -Hipócrates ( a.c.): pangênese Análises de DNA O DNA e sua história DNA nos remete a Hereditariedade -Hipócrates (460-377 a.c.): pangênese -Aristóteles (384-322 a.c.): transmissão das características pelo sêmen 1 O genoma e sua história

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br

Rachel Siqueira de Queiroz Simões, Ph.D rachelsqsimoes@gmail.com rachel.simoes@ioc.fiocruz.br Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Lâmina adesiva vedante 3 Plástico e cola

Lâmina adesiva vedante 3 Plástico e cola RTS120 MTB Q PCR Alert Kit Instruções de Uso USO PRETENDIDO O Kit MTB Q-PCR Alert Kit é um ensaio qualitativo de amplificação de ácidos nucleicos para a detecção de DNA de Mycobacterium tuberculosis (MTB)

Leia mais

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction)

Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) Reacção em cadeia da polimerase (PCR -Polymerase chain reaction) - Realiza a replicação selectiva e rápida de uma sequência específica de nucleotídeos a partir de uma mistura complexa de DNAs amplificação

Leia mais

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes)

CYCLER CHECK. Kit de teste para a validação da uniformidade da temperatura em termocicladores. pronto a usar, pré-aliquotado. REF 71044 (4 testes) PT Instruções de utilização CYCLER CHECK Kit de teste para a validação da uniformidade da temperatura em termocicladores pronto a usar, pré-aliquotado REF 7104 (10 testes) REF 71044 (4 testes) Índice 1.

Leia mais

PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2

PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2 PADRONIZAÇÃO DE ENSAIO DE PCR EM TEMPO REAL EM FORMATO MULTIPLEX APLICADO AO DIAGNÓSTICO DE INFECÇÕES POR HTLV-1 E HTLV-2 Gonçalves MG 1, Fukasawa LO 1, Alencar WK 2, Caterino-de-Araujo A 1 1 Instituto

Leia mais

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA

UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA UNIVERSIDADE FEDERAL DE JUIZ DE FORA DEPARTAMENTO DE PARASITOLOGIA, MICROBIOLOGIA E IMUNOLOGIA Genética Bacteriana Disciplina: Microbiologia Geral e Aplicada à Enfermagem Professora:Luciana Debortoli de

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. www.tioronni.com ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

Reagentes para Biologia Molecular

Reagentes para Biologia Molecular Reagentes para Biologia Molecular Para obtenção de resultados confiáveis, atividades realizadas na área da Biologia Molecular requerem reagentes de qualidade e pureza elevada. Ideais para diversas rotinas

Leia mais

Sequenciamento de genomas

Sequenciamento de genomas Sequenciamento de genomas 1 o genoma completo vírus OX174 5.000 nt (Sanger et al. 1977) em 1977 1000 pb sequenciados por ano neste ritmo genoma E. coli K-12 4.6-Mbp levaria mais de 1000 anos para ser completo

Leia mais

Técnicas Moleculares

Técnicas Moleculares Biologia Molecular no Diagnóstico de Infecção :HPV Maria Elizabeth Menezes,MSc;Ph.D e-mail:melmenezes@dnanalise.com.br DNAnálise Laboratório Técnicas Moleculares HIBRIDIZAÇÃO IN SITU SEQÜENCIAMENTO PCR

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais

CONCEITOS DE BIOLOGIA MOLECULAR. Jorge Mondego

CONCEITOS DE BIOLOGIA MOLECULAR. Jorge Mondego CONCEITOS DE BIOLOGIA MOLECULAR Jorge Mondego Biologia Molecular Genome Transcriptome The OME -Era Proteome Metabolome - Entendimento da fisiologia e reprodução de microorganismos - Entendimento dos mecanismos

Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais