POLIMORFISMO R72P EM PACIENTES COM CÂNCER DE MAMA ATENDIDOS NO HOSPITAL ARAÚJO JORGE - ASSOCIAÇÃO DE COMBATE AO CÂNCER EM GOIÁS.

Tamanho: px
Começar a partir da página:

Download "POLIMORFISMO R72P EM PACIENTES COM CÂNCER DE MAMA ATENDIDOS NO HOSPITAL ARAÚJO JORGE - ASSOCIAÇÃO DE COMBATE AO CÂNCER EM GOIÁS."

Transcrição

1 POLIMORFISMO R72P EM PACIENTES COM CÂNCER DE MAMA ATENDIDOS NO HOSPITAL ARAÚJO JORGE - ASSOCIAÇÃO DE COMBATE AO CÂNCER EM GOIÁS. 1. Introdução: Autores: Vanessa Bernardes (UEG) 1, 2 Simone Souza Fagundes (PUC-GO) 2,3 Flávio Monteiro Ayres (UEG) 1,2,3 O câncer de mama é o segundo tipo de câncer mais frequente no Brasil e no mundo, e o primeiro entre as mulheres (FU et al., 2010; DONG et al., 2010; SOARES et al. 2010), respondendo por 22 a 30% dos casos novos ao ano (CAFFAREL, et al., 2010) e pela segunda principal causa de morte relacionada com câncer em mulheres (JANG et al., 2010). O conceito de câncer como uma doença genética é relativamente recente. O ganho de função dos oncogenes e a perda de função de genes supressores de tumor são eventos subjacentes à progressão tumoral. O câncer consiste em um desenvolvimento neoplásico, que é o resultado do acúmulo de alterações genéticas que comprometem o controle do crescimento normal da célula e a diferenciação terminal (ALMAZOV et al., 2007). No câncer de mama, a célula tumoral é caracterizada pela desregulação da proliferação celular e apoptose, desaparecimento de células mioepiteliais, transformação epitélio-mesênquima e instabilidade genômica (VIEIRA & ESTEVES, 2005). No processo de progressão do carcinoma da mama, proto-oncogenes e os genes supressores de tumor, como o gene TP53, estão envolvidos (MELO, 2008). O gene supressor de tumor TP53 encontra-se no sítio 17p13.1 e codifica uma fosfoproteína nuclear de 53 kilodaltons (kda) denominada proteína 53 (p53) (RIBEIRO JR. & SAFATLE-RIBEIRO, 2006). A p53 controla pontos de checagem (checkpoints) durante o ciclo celular para viabilizar o sistema de reparo a danos genômicos ou indução de parada do ciclo celular, senescência e apoptose (BURGDORF et al., 2011). A ação da p53 visa impedir a proliferação de células com DNA mutado (XU et al., 2008). O gene TP53 apresenta um Single Nucleotide Polymorphism (SNP) no códon 72 do éxon 4 (R72P) por substituição de um par de bases, codificando códon para prolina (CCC, TP53Pro) ou para arginina (CGC, TP53Arg) (CONTU et al.,2009). Em humanos, esses alelos polimórficos geram dois genótipos homozigotos, TP53Arg/TP53Arg ou TP53Pro/TP53Pro e um genótipo heterozigoto TP53Arg/Pro(LO et al., 1992). As variantes protéicas resultantes desses dois alelos diferem no ponto de junção entre o domínio de transativação N-terminal e o domínio de ligação ao DNA, com alteração funcional da proteína (ACHATZ, 2008). A frequência dos alelos polimórficos R72P varia entre grupos étnicos (DOKIANAKIS et al., 2000). O alelo TP53Pro é mais prevalente na população africana (OLIVIER et al., 2002) e em populações que estão mais próximas da linha do Equador, supostamente por este alelo conferir proteção contra raios UV (DAMIM et al., 2006). O alelo TP53Arg é a mais comum em populações das Américas do Norte e Sul, Europa Ocidental e Japão (OLIVIER et al., 2002). Entre chineses, a expressão do alelo TP53Arg foi associada ao desenvolvimento de câncer de mama. Ainda no câncer de mama, o alelo TP53Arg não foi associado com mutação do gene TP53, corroborando que esse alelo por si confere maior 1 Bolsista PIBIC/CNPq. Unidade Universitária de Ciências Exatas e Tecnológicas, UEG. 2 Laboratório de Pesquisa em Genética, ESEFFEGO, UEG. 3 Programa de Mestrado em Genética, PUC-GO. 1

2 susceptibilidade ao câncer e que a inativação do gene TP53 por mutação está sujeita a menor pressão seletiva que o alelo TP53Pro (SIDDIQUEet al., 2005). Portanto, as frequências alélicas e genotípicas do R72P permanecem desconhecidas para pacientes com câncer de mama regiões Sudeste, Centro-Oeste, Norte e Nordeste do Brasil. Assim, o objetivo deste trabalho foi analisar o polimorfismo do códon 72 do gene p53 em Câncer da Mama pela técnica de reação de polimerase em cadeia (PCR), em pacientes atendidas na Associação de Combate ao Câncer em Goiás (ACCG). 2. Metodologia: O grupo de estudo foi composto por 43 pacientes do sexo feminino com carcinoma ductal infiltrante (CDI) atendidas pelo Serviço de Ginecologia e Mama do Hospital Araújo Jorge (HAJ). Todos os procedimentos de coleta de amostras e experimentais seguirão o regulamento institucional em vigor e aprovação pelo Comitê de Ética e Pesquisa. Para a determinação do papel do polimorfismo do gene p53 em câncer de mama foram utilizadas amostras de tecido parafinado obtidas de 43 pacientes atendidas no Serviço de Patologia do Hospital Araújo Jorge (HAJ) até Fatias de 20 µm de tecido incluso em parafina foram utilizadas para confirmação histológica ao microscópio óptico, para posterior extração de DNA e amplificação por PCR. Blocos de parafina foram obtidos dos arquivos do Laboratório de Histopatologia do HAJ para isolamento de DNA. O material biológico consistia em fragmentos de tumores de mama fixados em formol e incluídos em blocos de parafina. Para cada amostra parafinada, uma lâmina adicional foi confeccionada e corada por hematoxilinaeosina para confirmação do diagnóstico. Para realizar a desparafinização e extração do DNA foi utilizado o Kit MagneSil Genomic (Promega, USA) conforme as instruções do fabricante. As amostras de DNA foram amplificadas por PCR utilizando um conjunto individual de primers para os alelos polimórficos codantes de arginina (TP53Arg) e prolina (TP53Pro) no códon 72 do gene p53, com produtos de amplificação esperados de 141 e 177 pares de base, respectivamente. As amostras de DNA genômico serão submetidas à eletroforese em gel de agarose a 2,0% para avaliar a presença e grau de preservação ou degradação da amostra, para separação das bandas e determinação dos genótipos. 3. Resultados: Foram analisados 43 casos de mulheres diagnosticadas com carcinoma de mama atendidas na Associação de Combate ao Câncer do Estado de Goiás (HAJ) entre 1979 e Para analisar o polimorfismo no códon 72 do exón 4, usamos uma PCR-AS, que detecta especificamente o alelo TP53Arg e o alelo TP53Pro. O par de primers de TP53Arg dá um produto de PCR com 141pb, enquanto que o par de primers de TP53Pro, dá um produto de 177pb. Como grupo controle negativo foram utilizadas amostras contendo água Mili-Q, água deionizada. Os controles positivos de TP53Arg foram feitos utilizando amostras de DNA extraídas de mucosa oral. Já para o alelo TP53Pro, os controles positivos utilizados foram obtidos de amostras de câncer colorretal. Houve uma diferença na distribuição dos genótipos presentes nas amostras de carcinoma mamário. A freqüência do alelo TP53Arg/TP53Arg (49%) foi bem mais alta que a freqüência em ao alelo TP53Pro/TP53Pro (13%). Enquanto que em heretorizogose TP53Arg/TP53Pro (38%) também apresentou uma frequência alta. 2

3 4. Discussão: Nossas amostras de tumores de mama mostraram uma prevalência de TP53Arg em homozigose (49%) comparado com TP53Pro em homozigose (13%). Nosso resultado indica que o alelo TP53Arg em homozigose pode representar um possível fator de risco no desenvolvimento do câncer de mama. Assim como um estudo realizado no sul do Brasil, que demonstrou, a partir de 108 casos de mulheres com câncer de mama, que o alelo TP53Arg em homozigose representa maior susceptibilidade a desenvolver carcinoma mamário (DAMIM et al., 2006). Porém, ambos resultados são controversos com outro estudo realizado em Porto Alegre (RS), onde a associação entre o polimorfismo R72P e o maior risco de desenvolvimento de câncer de mama não foi verificado. (MELO, 2008). Esta contradição pode ser justificada pela grande variação inter-racial e étnica da população estudada, devido à miscigenação e a exposição a diferentes fatores ambientais, já que a freqüência de genótipos da TP53 códon 72 varia de acordo com as etnias (DOKIANAKIS, 2000). Na América do Norte foram realizados experimentos in vitro. No Canadá, utilizando células, plasmídeos e anticorpos, constataram diferenças biológicas e bioquímicas entre TP53Arg e TP53Pro. Ambas podem ser consideradas do tipo selvagem, identificou-se que TP53Pro é um ativador de transcrição mais forte que o TP53Arg (THOMAS et al., 1999), e TP53Arg é mais eficiente do que a variante TP53Pro na indução de apoptose (THOMAS et al. 1999; DUMONT et al., 2003; CHANG-CLAUDE et al. 2009). Por outro lado, a TP53Pro induz mais eficientemente a parada do ciclo celular e reparo do DNA que a TP53Arg (PETITJEAN et al., 2007), o que pode proteger o tumor de quimioterapia apoptose induzida (SCHIMIDT et al. 2009). Em nosso estudo, a frequência de TP53Arg em homozigose (49%) mostrou ser mais alta ao ser comparada com a TP53Arg em heterozigose TP53Arg/TP53Pro (38%). Indivíduos com o genótipo homozigoto TP53Arg/TP53Arg são até sete vezes mais susceptíveis ao desenvolvimento do câncer que aqueles com o genótipo heterozigoto (STOREY et al., 1998). No continente europeu, um estudo realizado com 108 judeus provenientes do leste europeu, e com 24 judeus de outras etnias, corroborou uma correlação do genótipo TP53Arg/TP53Arg com casos de câncer de mama para ambos os grupos, além disso também ocorreu uma associação significativa do alelo TP53Arg para os casos de alto risco de câncer de mama (OHAYON et al. 2005). Igualmente, 115 pacientes turcas com câncer de mama, demonstrou que o alelo TP53Arg foi super representado (BUYRU et al. 2003). Na Grécia, 56 pacientes com câncer de mama, comparadas com um grupo de 61 indivíduos saudáveis, apresentou maior freqüência do genótipo TP53Arg/TP53Arg (63%) nos tumores de mama, enquanto os outros genótipos TP53Pro/TP53Pro corresponderam a 21% e 17% (TP53Arg/TP53Pro). Em todos os casos, o alelo TP53Arg em homozigose correlacionou-se com o carcinoma mamário, sendo um potencial fator de risco para o desenvolvimento do câncer de mama (PAPADAKIS et al. 2000). Em contrapartida, diferentes resultados foram obtidos nos países asiáticos. No Japão, um trabalho com 200 pacientes de câncer de mama e 282 cidadãos locais como grupo controle, identificou um aumento significativo nos casos de câncer de mama quando o alelo TP53Pro estava presente em homozigose (SIDDIQUE et al., 2005) Em um estudo populacional, obteve-se DNA de amostras de sangue periférico de 160 chineses e 105 poloneses saudáveis determinando a expressão de TP53Pro/TP53Arg com base nos dados do eletroferograma. O resultado demonstrou que a população chinesa expressa predominantemente TP53Pro, enquanto que os poloneses são expressadores do TP53Arg, tal fato se correlaciona com os brancos apresentarem cerca de 2 vezes maior susceptibilidade a desencadearem câncer que os asiáticos (MABROUK et al., 2003). 3

4 Assim como verificado nos europeus (SCHIMIDT et al., 2009), em populações asiáticas o genótipo TP53Pro/TP53Pro no códon 72 foi significativamente associado com pobre sobrevida livre de doença, DFS (P=0,004). Os pacientes com câncer de mama TP53Pro/TP53Pro apresentam menor sensibilidade à quimioterapia adjuvante, mas DFS menor. Tal fato pode relacionar-se com a mais eficiente indução de apoptose do alelo TP53Arg (MELO, 2008). Tumores de mama com os genótipos TP53Arg/TP53Arg ou TP53Arg/Pro são mais sensíveis ao tratamento quimioterápico, enquanto os tumores homozigotos TP53Pro/TP53Pro apresentam pior evolução clínica (XU et al., 2005). 5. Considerações finais: Apesar de haver achados contraditórios, em resumo, nossos resultados indicam que a homozigose de TP53Arg no códon 72 do gene TP53 está associada a uma maior suceptibilidade para o desenvolvimento do câncer de mama, apesar de não ser significativo. Deve-se salientar, que esta informação precisa ser fundamentada com adicional estudos sobre um número maior de indivíduos. Os valores de risco e prognóstico do R72P variam conforme o perfil étnico/geográfico avaliado, além da investigação de retenção alélica por perda de heterozigose (ZHUO et al., 2009). Portanto, investigações das frequências alélicas e genotípicas do R72P podem subsidiar o melhor conhecimento de marcadores moleculares com potencial valor diagnóstico e/ou prognóstico para populações locais ou regionais do Brasil, além de elucidar o papel deste polimorfismo na carcinogênese mamária. 6. Referências: [1] ACHATZ, M.I.A.S.W. Modificadores de penetrância de mutações germinativas no gene TP53 em famílias brasileiras com diagnóstico clínico da síndrome de Li- Fraumeni e Li-Fraumeni like: impacto dos polimorfismos intragênicos do TP53 e de genes que regulam a atividade da p53. Tese de Doutorado em Ciências, Oncologia. Faculdade de Medicina da Universidade de São Paulo, p. 228, [2] ALMAZOV, V.P.; KOCHETKOV, D. V.; CHUMAKOV, P. M. Use of p53 for Therapy of Human Cancer. Mol Biol (Mosk), v. 41, n. 6, p , [3] ASSUMPÇÃO, J, G., SEIDINGER, A. L., MASTELLARO, M. J., RIBEIRO, R. C., ZAMBETTI, G. P., GANTI, R., SRIVASTAVA, K., SHURTLEFF, S., PEI, D., ZEFERINO, L. C., DUFLOTH, R. M., BRANDALISE, S. R., YUNES, J. A. Association of the germline TP53 R337H mutation with breast cancer in southern Brazil. BMC Cancer. 1;8:357, [4] BURGDORF, K. S.; GRARUP, N.; JUSTESEN, J. M.; HARDER, M. N.; WITTE, D. R.; JORGENSEN, T.; SANDBAEK, A.; LAURITZEN, T.; MADSBAD, S.; HANSEN, T.; DIAGRAM, C.; PEDERSEN, O. Studies of the Association of ArgTP53Proro of Tumor Suppressor Protein p53 with Type 2 Diabetes in a Combined Analysis of 55,521 Europeans. PLoS One., v.6, n. 1, [5] BUYRU, N.; TIGLI, H.; DALAY, H. P53 codon polymorphism in breast cancer, v. 10, p , [6] CAFFAREL, M. M.; ANDRADAS, C.; MIRA, E.; PÉREZ-GÓMES, E.; CERUTTI, C.; MORENO- BUENO,G.; FLORES, J. M.; GARCÍA-REAL, I.; PALACIOS,J.; MAÑES,S.; GUZMÁN, M.; SÁNCHEZ,C. Cannabinoids reduce ErbB2-driven breast cancer progression through Akt inhibition. Molecular Cancer, v.9, p. 196, [7] CAVALCANTI JR, G. B.; KLUMB, C. E.; MAIA, R. C. P53 e as hemopatias malignas. Revista Brasileira de Cancerologia, v. 48, n. 3, p , [8] CHANG-CLAUDE, J.; AMBROSONE, C. B.; LILLA, C.; KROPP, S.; HELMBOLD, I.; VON FOURNIER, D.; HAASE, W.; SAUTTER-BIHL, M. L.; WENZ, F.; SCHMEZER, P.; POPANDA, O. Genetic polymorphisms in DNA repair and damage response genes and late normal tissue complications of radiotherapy for breast cancer. Br J Cancer, v.100, n.10, p , [9] CONTU, S.S; AGNES, G.; DAMIN, A. P.; CONTU, P. C.; ROSITO, M. A.; ALEXANDRE, C. O.; DAMIN, D. C. Lack of correlation between p53 codon 72 polymorphism and anal cancer risk. World J Gastroenterol, v. 15, n. 36, p , [10] DAMIN, A.; FRAZZON, A.P.; DAMIN, D.C; ROEHE, A.; HERMES, V.; ZETTLER, C.; ALEXANDRE, C.O. Evidence for an association of TP53 codon 72 polymorphism with breast cancer risk. Cancer Detect Prev, v. 30, p , [11] DOKIANAKIS, D. N.; KOUMANTAKI, E.; BILLIRI, K. SPANDIDOS, D. A. P53 codon 72 polymorphism as a risk factor in the development of HPV-associated nonmelanoma skin cancers in immunocompetent hosts. International Journal of Molecular Medicine, v. 5, p , [12] DONG, X.; SUN, X.; GUO, P.; LI, Q.; SASAHARA, M.; ISHII, Y.; DONG, J. atbf1 inhibits er function by selectively competing with aib1 for binding to er in er- 4

5 positive breast cancer cells. The Journal of Biological Chemistry, v. 285, p Agosto, 2010 [13] DUMONT, P., LEU JI, DELLA PIETRA AC III, GEORGE DL, MURPHY M. et al., The codon 72 polymorphic variants of p53 have markedly different apoptotic potential. Nat Genet, v. 33, n. 3, p , [14] FU, Y.; LIAN, Y.; KIM, K. S.; ZHANG, L.; HINDLE, A. K.; BRODY, F.; SIEGEL, R. S.; MCCAFFREY, T. A.; FU, S. W. BP1 Homeoprotein Enhances Metastatic Potential in ER-negative Breast Cancer. Journal of Cancer, v.1, p.54-62, [15] JANG, J. Y.; JEON, Y. K., KIM, C. W. Degradation of HER2/neu by ANT2 shrna suppresses migration and invasiveness of breast cancer cells. BioMed Central Cancer, v.10, p.391, [16] LO, K.W.; MOK, C.H.; CHUNG, G.; HUANG, D.P.; WONG, F.; CHAN, M.; LEE, J.C. TSAO, S.W. Presence of p53 mutation in human cervical carcinomas associated with HPV-33 infection. Anticancer Res., v. 12, p , [17] MABROUK, I.; BACCOUCHE, S.; EL-ABED, R.; MOKDAD-GARGOURI, R.; MOSBAH, A.; SAID, S.; DAOUD, J.; FRIKHA, M.; JLIDI, R.; GARGOURI, A. No evidence of correlation between p53 codon 72 polymorphism and risk of bladder or breast carcinoma in tunisian patients. Ann N Y Acad Sci, v. 1010, n. p , [18] MELO, P. M. Análise do polimorfismo TP53ARGP do gene TP53 em pacientes com carcinoma de mama ductal invasor. Dissertação (Mestrado em Ciências Médicas). Universidade Federal do Rio Grande do Sul, Faculdade de Medicina. Porto Alegre [19] OHAYON, T. GERSHONI-BARUCH, R.; PAPA, M. Z.; MENACHEM, T. D.; BARZILAI, S. E.; FRIEDMAN, E. The TP53Argp p53 mutation is associated with familial breast cancer in jewish women. Br J Cancer, v. 92, n. 6, p , [20] OLIVIER, M., et al., The iarc tp53 database: New online mutation analysis and recommendations to users. Hum Mutat, v. 19, n. 6, p , [21] PAPADAKIS, E. N.; DOKIANAKIS, D. N.; SPANDIDOS, D. A. P53 codon 72 polymorphism as a risk factor in the development of breast câncer. Mollecular Cell Biology Research Communications, v. 3, n. 6, p , [22] PETITJEAN A, ACHATZ MI, BORRESEN-DALE AL, HAINAUT P, OLIVIER M. TP53 mutations in human cancers: functional selection and impact on cancer prognosis and outcomes. Oncogene, v. 26, n.15, p , cancer patients. Breast Cancer Research, v. 11, n. 6, [25] SCHNEIDER-STOCK, R.; BOLTZEY,C.; PETERSZ, B.; SZIBOR, R.; LANDTB, O.; MEYER, F.; ROESSNER, A. Selective Loss of Codon 72 Proline p53 and Frequent Mutational Inactivation of the Retained Arginine Allele in Colorectal Cancer. Neoplasia, v. X, n. Y, [26] SIDDIQUE, M. M.; BALRAM, C., FISZER- MALISZEWSKA, L.; AGGARWAL, A.;TAN, A.; TAN, P.; SOO, K. C.; SABAPATHY, K. Evidence for selective expression of the p53 codon 72 polymorphs: Implications in cancer development. Cancer Epidemiol Biomarkers Prev., v.14, p , [27] SOARES, J. J., FONSECA, R. P., CERCI, J. J., BUCHPIGUEL, C. A., CUNHA, M. L.; MAMED, M.; ALMEIDA, S. A. Lista de recomendações do Exame PET/CT com 18F-FDG em Oncologia: consenso entre a Sociedade Brasileira de Cancerologia e a Sociedade Brasileira de Biologia, Medicina Nuclear e Imagem Molecular. Radiol Bras, São Paulo, v. 43, n. 4, [28] STOREY, A.; THOMAS, M.; KALITA, A.; HARWOOD, C.; GARDIOL, D.; MANTOVANI, F.; BREUER, J.; LEIGH, M.; MATLASHEWSKI, G.; BANKS, L. Role of a p53 polymorphism in the development of human papilloma-virus-associated cancer. Nature, v. 393, p , [29] THOMAS, M.; KALIRA, A.; LABRECQUE, S.; PIM, D.; BANKS, L. MATLASHEWSKI, G. Two polymorphic variants of wild-type p53 differ biochemically and biologically. Molecular and Cellular Biology, v. 19, n. 2, p , [30] VIEIRA RJS, ESTEVES VF. Prevenção do câncer de mama: mito ou realidade? Prática hospitalar, v.40, p , [31] WESTON A, GODBOLD JH. Polymorphisms of H-ras-1 and p53 in breast cancer and lung cancer: a metaanalysis. Environ Health Perspect, v.105, p , [32] XU Y, YAO L, ZHAO A, OUYANG T, LI J, WANG T, FAN Z, FAN T, LIN B, LU Y, XIE Y. Effect of p53 codon 72 genotype on breast cancer survival depends on p53 gene status. Int J Cancer, v. 122 p , [33] XU, Y.; YAO, L.; OUYANG, T.; LI, J.; WANG, T.; FAN, Z.; LIN, B.; LU, Y.; XIE, Y. P53 Codon 72 Polymorphism Predicts the Pathologic Response to Neoadjuvant Chemotherapy in Patientswith Breast Cancer. Clin Cancer Res., v.11, n.20, p , [34] ZHUO, W.; ZHANG, Y.; XIANG, Z.; CAI, L.; CHEN, Z. Polymorphisms of TP53 codon 72 with breast carcinoma risk: evidence from cases and controls. Journal of Experimental & Clinical Cancer Research, v. 28, p.115, [23] RIBEIRO JR.U.; SAFATLE-RIBEIRO A.V.. P53 in clinical contexts: yes or not? Arq Gastroenterol., v.43, n.1, p.6-7, jan/mar, [24] SCHMIDT, M. K.; TOMMISKA, J.; BROEKS, A.; LEEUWEN, F. E. V.; VEER, L. J. V.; PHAROAH, P. D. P.; EASTON, D. F.; SHAH, M.; HUMPHREYS, M.; DÖRK, T.; REINCKE, S. A.; FAGERHOLM, R.; BLOMQVIST, C.; NEVANLINNA, H. Combined effects of single nucleotide polymorphisms TP53 TP53ARGP and MDM2 SNP309, and p53 expression on survival of breast 5

Polimorfismo R72P do Gene TP53 no Câncer de Mama

Polimorfismo R72P do Gene TP53 no Câncer de Mama Polimorfismo R72P do Gene TP53 no Câncer de Mama Vanessa Bernardes; Simone S. Fagundes; Flávio M. Ayres. Universidade Estadual de Goiás, 75.132-903, Brasil vanessabernardes08@gmail.com flavio.ayres@ueg.br

Leia mais

POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE

POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE POLIMORFISMO DO CÓDON 72 DO GENE TP53 EM PACIENTES COM LEUCEMIA MIELÓIDE Jeany Camelo Santos 1, Rafael Lucas Leonídeo 2, Flávio Monteiro Ayres 3,4 1 Bolsista PBIC/UEG. 2 Aluno de iniciação científica PVIC.

Leia mais

PAPERPET. Caio Mayrink Maio/2011

PAPERPET. Caio Mayrink Maio/2011 PAPERPET Caio Mayrink Maio/2011 RAD51 G135C POLYMORPHISM IS ASSOCIATED WITH BREAST CANCER SUSCEPTIBILITY: A META-ANALYSIS INVOLVING 22,399 SUBJECTS Haiming Sun, Jing Bai, Feng Chen, Yan Jin, Yang Yu, Lianhong

Leia mais

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco

macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Patologia Cirúrgica macroscopia clivagem processamento inclusão - parafina coloração desparafinização microtomia bloco Exame Histopatológico Exame anatomopatológico é ATO MÉDICO! lâminas microscopia laudo

Leia mais

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS.

CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Laura S. W ard CAMPANHA PELA INCLUSÃO DA ANÁLISE MOLECULAR DO GENE RET EM PACIENTES COM CARCINOMA MEDULAR E SEUS FAMILIARES PELO SUS. Nódulos da Tiróide e o Carcinoma Medular Nódulos da tiróide são um

Leia mais

Neoplasias 2. Adriano de Carvalho Nascimento

Neoplasias 2. Adriano de Carvalho Nascimento Neoplasias 2 Adriano de Carvalho Nascimento Biologia tumoral Carcinogênese História natural do câncer Aspectos clínicos dos tumores Biologia tumoral Carcinogênese (bases moleculares do câncer): Dano genético

Leia mais

Null polymorphism of GSTM1 gene in susceptibility of Breast Cancer: Evidence based on Meta-analysis

Null polymorphism of GSTM1 gene in susceptibility of Breast Cancer: Evidence based on Meta-analysis Null polymorphism of GSTM1 gene in susceptibility of Breast Cancer: Evidence based on Meta-analysis Authors: Daiane de Oliveira Cunha, Paula Lailla Freitas Ribeiro, Xisto Sena Passos, Cesar Augusto Sam

Leia mais

Desenvolvimento de marcadores moleculares relacionados a resistência celular após terapia fotodinâmica em carcinomas mamários

Desenvolvimento de marcadores moleculares relacionados a resistência celular após terapia fotodinâmica em carcinomas mamários Desenvolvimento de marcadores moleculares relacionados a resistência celular após terapia fotodinâmica em carcinomas mamários Joze Barbosa Galioti Orientadora: Profª Drª Renata A. Canevari Introdução O

Leia mais

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG

USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER. Orientadora, docente do Curso de Farmácia, UnuCET Anápolis - UEG USO DE MARCADORES TUMORAIS PARA DIAGNÓSTICO E ACOMPANHAMENTO DO TRATAMENTO DO CÂNCER Gyzelly Gondim de Oliveira 1 ; Cristiane Alves da Fonseca 2 1 Graduanda do Curso de Farmácia, UnuCET Anápolis - UEG

Leia mais

polimorfismos da MTHFR e risco de câncer de mama em mulheres jovens: estudo caso controle no Rio de Janeiro Dados preliminares

polimorfismos da MTHFR e risco de câncer de mama em mulheres jovens: estudo caso controle no Rio de Janeiro Dados preliminares Ácido fólico, f polimorfismos da MTHFR e risco de câncer de mama em mulheres jovens: estudo caso controle no Rio de Janeiro Dados preliminares Dirce Maria Lobo Marchioni FSP/USP ENSP/FIOCRUZ 2008 Introdução

Leia mais

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes

Variabilidade genética. Variabilidade Genética. Variação genética e Evolução. Conceitos importantes Variabilidade genética Conceitos importantes Variação genética: variantes alélicos originados por mutação e/ou recombinação Diversidade ou variabilidade genética: medida da quantidade de variabilidade

Leia mais

ESTUDO DO PADRÃO DE PROLIFERAÇÃO CELULAR ENTRE OS CARCINOMAS ESPINOCELULAR E VERRUCOSO DE BOCA: UTILIZANDO COMO PARÂMETROS A

ESTUDO DO PADRÃO DE PROLIFERAÇÃO CELULAR ENTRE OS CARCINOMAS ESPINOCELULAR E VERRUCOSO DE BOCA: UTILIZANDO COMO PARÂMETROS A ESTUDO DO PADRÃO DE PROLIFERAÇÃO CELULAR ENTRE OS CARCINOMAS ESPINOCELULAR E VERRUCOSO DE BOCA: UTILIZANDO COMO PARÂMETROS A IMUNOEXPRESSÃO DO PCNA, KI-67 E CICLINA B1 SPÍNDULA FILHO, José Vieira de ;

Leia mais

V Congresso de Iniciação Científica do IAMSPE

V Congresso de Iniciação Científica do IAMSPE V Congresso de Iniciação Científica do IAMSPE São Paulo 17/11/2011 Estudo genético da síndrome de Birt- Hogg-Dubé (variante Hornstein- Knickenberg) Bolsista: Sergio Aparecido do Amaral Junior (Faculdade

Leia mais

Glicosaminoglicanos (GAGS) Introdução. heteropolissacarídeos lineares constituídos por unidades dissacarídicas repetitivas.

Glicosaminoglicanos (GAGS) Introdução. heteropolissacarídeos lineares constituídos por unidades dissacarídicas repetitivas. Identificação e quantificação pela espectroscopia de massa de glicosaminoglicanos sulftados da matriz extracelular no tecido colorretal neoplásico e não neoplásico* * Departmento de Biologia Molecular,

Leia mais

Key Words: câncer de mama, quimioterapia neoadjuvante, quimioterapia, resposta patológica, carbopaltina.

Key Words: câncer de mama, quimioterapia neoadjuvante, quimioterapia, resposta patológica, carbopaltina. Alta taxa de resposta completa patológica (prc) em câncer de mama triplo negativo após quimioterapia neoadjuvante sequencial Augusto Ribeiro GABRIEL, MD* Ruffo de FREITAS JÚNIOR, MD, PhD* * Programa de

Leia mais

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas:

GENÉTICA E CÂNCER. Para que a carcinogênese ocorra são necessárias algumas condições, entre elas: GENÉTICA E CÂNCER O câncer é uma doença genética, independentemente de ocorrer de forma esporádica ou hereditária, pois a carcinogênese sempre inicia com danos no DNA. Geralmente, esses danos são potencializados

Leia mais

Médico, este é um canal de comunicação dedicado exclusivamente a você!

Médico, este é um canal de comunicação dedicado exclusivamente a você! CANAL MÉDICO Médico, este é um canal de comunicação dedicado exclusivamente a você! A equipe do canal médico do laboratório Alvaro, é formada por bioquímicos, biomédicos e médicos com grande experiência

Leia mais

Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3.

Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. CONHECIMENTO ESPECÍFICO SOBRE O CÂNCER NÃO AUMENTA CONSCIENTIZAÇÃO. Pollyanna Pereira Nascimento 1, 3 ; Andréia Juliana Leite Rodrigues 2,3. 1 Voluntária Iniciação Científica PVIC/UEG 2 Pesquisadora Orientadora

Leia mais

ANÁLISE COMPARATIVA DOS GRAUS HISTOLÓGICOS ENTRE TUMOR PRIMÁRIO E METÁSTASE AXILAR EM CASOS DE CÂNCER DE MAMA

ANÁLISE COMPARATIVA DOS GRAUS HISTOLÓGICOS ENTRE TUMOR PRIMÁRIO E METÁSTASE AXILAR EM CASOS DE CÂNCER DE MAMA ANÁLISE COMPARATIVA DOS GRAUS HISTOLÓGICOS ENTRE TUMOR PRIMÁRIO E METÁSTASE AXILAR EM CASOS DE CÂNCER DE MAMA Pinheiro, A.C ¹, Aquino, R. G. F. ¹, Pinheiro, L.G.P. ¹, Oliveira, A. L. de S. ¹, Feitosa,

Leia mais

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA

PUCRS CURSO DE CIÊNCIAS BIOLÓGICAS Genética I AULA PRÁTICA APLICAÇÕES DAS TÉCNICAS DE PCR E ELETROFORESE DE DNA Analise a seguinte situação hipotética (1): Uma equipe de pesquisadores está realizando um inventário da biodiversidade de uma área tropical ainda inexplorada, porém já sofrendo grande impacto de fragmentação

Leia mais

TÉCNICAS DE ESTUDO EM PATOLOGIA

TÉCNICAS DE ESTUDO EM PATOLOGIA TÉCNICAS DE ESTUDO EM PATOLOGIA Augusto Schneider Carlos Castilho de Barros Faculdade de Nutrição Universidade Federal de Pelotas TÉCNICAS Citologia Histologia Imunohistoquímica Citometria Biologia molecular

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs

ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs ANÁLISE GENÔMICA, MAPEAMENTO E ANÁLISE DE QTLs João Meidanis Scylla Bioinformática e UNICAMP III Congresso Brasileiro de Melhoramento de Plantas Gramado, RS Maio 2005 MINI-CURSO - AGENDA 1. Primeiro Dia

Leia mais

Patogênese e Testes Genéticos no ide

Patogênese e Testes Genéticos no ide Patogênese e Testes Genéticos no Carcinoma Medular de Tireóide ide Ana Luiza Maia Serviço de Endocrinologia, Hospital de Clínicas de Porto Alegre, Universidade Federal do Rio Grande do Sul, Porto Alegre,

Leia mais

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa

Pesquisa. 40 INCA Relatório Anual 2005 Pesquisa Pesquisa A pesquisa no INCA compreende atividades de produção do conhecimento científico, melhoria dos procedimentos diagnósticos e terapêuticos do câncer e formação de recursos humanos em pesquisa oncológica.

Leia mais

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes

4 fases. o Fase S o Fase M o Fase G1 o Fase G2. Status de nutrientes Pós-graduação em Nutrição Clínica e Gastronomia Funcional do NECPAR NUTRIÇÃO NO CÂNCER Nut. Ariana Ferrari Período que ocorre os eventos necessários para a divisão celular 4 fases o Fase S o Fase M o Fase

Leia mais

I Curso de Verão em Oncologia Experimental Cursos Práticos

I Curso de Verão em Oncologia Experimental Cursos Práticos I Curso de Verão em Oncologia Experimental Cursos Práticos 1. Técnicas Experimentais para o Estudo da Expressão Gênica O curso terá como base o estudo da expressão gênica utilizando um fator de transcrição.

Leia mais

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO

UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Biologia 12º ano Cap.2.1. Alterações do Material Genético Mutações UN.2 -PATRIMÓNIO GENÉTICO E ALTERAÇÕES AO MATERIAL GENÉTICO Situação Problemática

Leia mais

42º Congresso Bras. de Medicina Veterinária e 1º Congresso Sul-Brasileiro da ANCLIVEPA - 31/10 a 02/11 de 2015 - Curitiba - PR

42º Congresso Bras. de Medicina Veterinária e 1º Congresso Sul-Brasileiro da ANCLIVEPA - 31/10 a 02/11 de 2015 - Curitiba - PR 1 MARCELA BENEVENTE [1], LUCIANA MOURA CAMPOS PARDINI [2], ADRIANA CAMARGO FERRASI [1,3], MARIA INES DE MOURA CAMPOS PARDINI [3], ALINE FARIA GALVANI [3], JOSE JOAQUIM TITTON RANZANI [2] 1. Instituto de

Leia mais

Hereditariedade e cancer de mama Mutacoes e Polimorfismos

Hereditariedade e cancer de mama Mutacoes e Polimorfismos Hereditariedade e cancer de mama Mutacoes e Polimorfismos Dr. Jose Claudio Casali da Rocha Laboratorio Mantis Diagnosticos Avancados IOP Instituto de Oncologia do Parana Hospital Erasto Gaertner PUC-PR

Leia mais

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE

Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE Doutoranda Marina Curado Valsechi Profa. Dra. Ana Elizabete Silva Laboratório de Citogenética e Biologia Molecular Departamento de Biologia IBILCE UNESP, São José do Rio Preto Câncer : Doença Genética?

Leia mais

Avanços na Patologia cirúrgica. Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein.

Avanços na Patologia cirúrgica. Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein. Avanços na Patologia cirúrgica Renée Zon Filippi Laboratório de Anatomia Patológica do Hospital Israelita Albert Einstein reneezon@einstein.br Avanços Neoplasias de pulmão Câncer colorretal Carcinoma

Leia mais

Numeração Única: 0112.14.001131-6 TEMA: TAMOXIFENO NO TRATAMENTO ADJUVANTE DO CANCER DE MAMA

Numeração Única: 0112.14.001131-6 TEMA: TAMOXIFENO NO TRATAMENTO ADJUVANTE DO CANCER DE MAMA NT 38/2013 Solicitante: Dra. Renata Abranches Perdigão do JESP da Fazenda Pública de Campo Belo Data: 22/02/2014 Medicamento X Material Procedimento Cobertura Numeração Única: 0112.14.001131-6 TEMA: TAMOXIFENO

Leia mais

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética

Origem da variação. Conceitos importantes. Diversidade Genética. Variação genética Variação genética Origem da variação Professor Fabrício R Santos fsantos@icb.ufmg.br Departamento de Biologia Geral, UFMG 2012 Variação fenotípica hereditária Variação fenotípica causada pelo ambiente

Leia mais

Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço

Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço Carcinogênese, Biologia Tumoral e Marcadores Tumorais em Câncer de Cabeça e Pescoço A P R E S E N T A D O R : S E L I N A L D O A M O R I M R E S I D E N T E D E C I R U R G I A D E C A B E Ç A E P E S

Leia mais

Técnicas moleculares

Técnicas moleculares Técnicas moleculares PCR Reação em Cadeia da Polimerase Inventada em 1983 por Kary Mullis é uma das técnicas mais comuns utilizadas em laboratórios de pesquisas médicas e biológicas Kary Mullis ganhou

Leia mais

13. CONEX Pôster Resumo Expandido 1 O PROJETO DE EXTENSÃO CEDTEC COMO GERADOR DE FERRAMENTAS PARA A PESQUISA EM CÂNCER DE MAMA

13. CONEX Pôster Resumo Expandido 1 O PROJETO DE EXTENSÃO CEDTEC COMO GERADOR DE FERRAMENTAS PARA A PESQUISA EM CÂNCER DE MAMA 13. CONEX Pôster Resumo Expandido 1 ISSN 2238-9113 ÁREA TEMÁTICA: (marque uma das opções) ( ) COMUNICAÇÃO ( ) CULTURA ( ) DIREITOS HUMANOS E JUSTIÇA ( ) EDUCAÇÃO ( ) MEIO AMBIENTE (X ) SAÚDE ( ) TRABALHO

Leia mais

A EVOLUÇÃO DA LUTA CONTRA O CÂNCER

A EVOLUÇÃO DA LUTA CONTRA O CÂNCER A EVOLUÇÃO DA LUTA CONTRA O CÂNCER Vanessa Gabriela Martins Pereira, Thaís Nogueira Silva, Laísa de Fátima Rangel, Karen Dias Ferreira, Hadassa Cristina Souza dos Santos, Gisele Aparecida de Castro Moreira,

Leia mais

Estamos prontos para guiar o tratamento com base no status do HPV?

Estamos prontos para guiar o tratamento com base no status do HPV? Controvérsias no Tratamento de Câncer de Cabeça e Pescoço Localmente Avançado Estamos prontos para guiar o tratamento com base no status do HPV? Igor A. Protzner Morbeck, MD, MSc Oncologista Clínico Onco-Vida,

Leia mais

www.simposiocancerdemama.com.br

www.simposiocancerdemama.com.br Alfredo Carlos S.D. Barros Goiânia, 15/5/2014 SIMPÓSIO INTERNACIONAL 8 e 9 de agosto de 2014 Hotel Unique São Paulo, SP Michael D. Alvarado Cirurgião UCSF Breast Care Center San Francisco, EUA Eric P.

Leia mais

Avanços da nutrigenômica nos casos de câncer

Avanços da nutrigenômica nos casos de câncer Avanços da nutrigenômica nos casos de câncer Prof. Dr. Thomas Prates Ong tong@usp.br Lab. Dieta-Nutrição-Câncer Depto. De Alimentos e Nutrição Experimental Faculdade de Ciências Farmacêuticas USP Nutrigenômica???

Leia mais

Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira

Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira Disciplina: Patologia Oral 4 e 5º períodos CÂNCER BUCAL http://lucinei.wikispaces.com Prof.Dr. Lucinei Roberto de Oliveira 2012 Sigmund Freud ( 1856-1939, 83 anos ) durante 59 anos, mais de 20 charutos/dia

Leia mais

Câncer de Mama IZABELLA SERAPHIM PITANGA. Princípios Básicos História Natural Epidemiologia. Mastologista do Núcleo da Mama

Câncer de Mama IZABELLA SERAPHIM PITANGA. Princípios Básicos História Natural Epidemiologia. Mastologista do Núcleo da Mama Câncer de Mama Princípios Básicos História Natural Epidemiologia IZABELLA SERAPHIM PITANGA Mastologista do Núcleo da Mama O QUE É CÂNCER? Câncer é o nome dado a um conjunto de mais de 100 doenças que têm

Leia mais

Papilomavírus Humano HPV

Papilomavírus Humano HPV Papilomavírus Humano HPV -BIOLOGIA- Alunos: André Aroeira, Antonio Lopes, Carlos Eduardo Rozário, João Marcos Fagundes, João Paulo Sobral e Hélio Gastão Prof.: Fragoso 1º Ano E.M. T. 13 Agente Causador

Leia mais

Técnicas Moleculares Aplicadas ao Estudo de Patologias

Técnicas Moleculares Aplicadas ao Estudo de Patologias Patologia x Genética Técnicas Moleculares Aplicadas ao Estudo de Patologias Lucas Brandão Patologia Clínica Definição: Fornece informações ao médico, de modo a proporcionar-lhe os meios necessários para

Leia mais

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense

Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Papilomavírus Humanos (HPV) Virologia MIP Instituto Biomédico Universidade Federal Fluminense Características principais Agente etiológico das verrugas (tumores epiteliais benignos) Infectam epitélio de

Leia mais

André Salazar e Marcelo Mamede CANCER PATIENTS: CORRELATION WITH PATHOLOGY. Instituto Mário Penna e HC-UFMG. Belo Horizonte-MG, Brasil.

André Salazar e Marcelo Mamede CANCER PATIENTS: CORRELATION WITH PATHOLOGY. Instituto Mário Penna e HC-UFMG. Belo Horizonte-MG, Brasil. F-FDG PET/CT AS A PREDICTOR OF INVASIVENESS IN PENILE CANCER PATIENTS: CORRELATION WITH PATHOLOGY André Salazar e Marcelo Mamede Instituto Mário Penna e HC-UFMG. Belo Horizonte-MG, Brasil. 2014 CÂNCER

Leia mais

Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina

Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina Departamento de Biologia Celular e Molecular Projeto: Desenvolvimento de Casos Clínicos para Aplicação no Ensino de Biologia Celular e Molecular para Medicina Tema: Bases Moleculares do Câncer e Ação A

Leia mais

Genética e Câncer. Viviane Ferreira Esteves

Genética e Câncer. Viviane Ferreira Esteves Genética e Câncer Viviane Ferreira Esteves Fatores de risco Fatores internos Predisposição hereditária Fatores externos Ambientais Predisposição Genética para o Câncer Tipo de câncer Mama Cólon Leucemias

Leia mais

SEQÜENCIAMENTO DO PROTO-ONCOGENE RET

SEQÜENCIAMENTO DO PROTO-ONCOGENE RET SEQÜENCIAMENTO DO PROTO-ONCOGENE RET Importância da identificação das mutações do proto-oncogene RET e sua atuação no desenvolvimento dos diversos fenótipos das neoplasias endócrinas múltiplas tipo 2 As

Leia mais

Numeração Única: 112.13.008257-4 TEMA: TAMOXIFENO NO TRATAMENTO ADJUVANTE DO CANCER DE MAMA

Numeração Única: 112.13.008257-4 TEMA: TAMOXIFENO NO TRATAMENTO ADJUVANTE DO CANCER DE MAMA NT 209/2013 Solicitante: Dra. Renata Abranches Perdigão do JESP da Fazenda Pública de Campo Belo Data: 01/11/2013 Medicamento X Material Procedimento Cobertura Numeração Única: 112.13.008257-4 TEMA: TAMOXIFENO

Leia mais

REAÇÃO EM CADEIA DA POLIMERASE (PCR)

REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128

RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128 123 RESUMOS DE PROJETOS... 124 ARTIGOS COMPLETOS(RESUMOS)... 128 RESUMOS DE PROJETOS 124 A GENÉTICA E NEUROFISIOLOGIA DO AUTISMO... 125 PAPEL DO POLIMORFISMO IL17A (RS7747909) NA TUBERCULOSE.... 126 PAPEL

Leia mais

PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO

PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO PROCESSO DE ANÁLISE DO DNA: PROJETO DE DIVULGAÇÃO CIENTÍFICA PARA PROFESSORES DE ENSINO MÉDIO Cynthia Germoglio Farias de Melo cynthia_fariasm@hotmail.com Rayner Anderson Ferreira do Nascimento raynerbiomedicina@gmail.com

Leia mais

Resumo. Tatiana de Almeida Simão Departamento de Bioquímica Instituto de Biologia Roberto Alcantara Gomes Universidade do Estado do Rio de Janeiro

Resumo. Tatiana de Almeida Simão Departamento de Bioquímica Instituto de Biologia Roberto Alcantara Gomes Universidade do Estado do Rio de Janeiro Mutações no gene TP53 em tumores malignos de mama: associação com fatores de risco e características clínico-patológicas, inclusive risco de óbito, em pacientes residentes no Rio de Janeiro TP53 mutation

Leia mais

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética

GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA. Genética GAGCTGACAGGTTCCTCTTAAAGCCCTG AGTCCCAGGGAAGGGACCTGCAGGCCCG GCCACGCCCAGGCCGCTTTAGCGCGCAA Genética GATGGCGGCATGCACGCCCCGCGGCCGG AGCCGAGTGGGCCCGAGCGCTTCCGAGC do Cancro Proença-a-Nova 10.06.2011 ATTCCCGAAGTCCAGAGAAACTCCGGGA

Leia mais

SEPARAÇÃO ELETROFORÉTICA DE DNA

SEPARAÇÃO ELETROFORÉTICA DE DNA A eletroforese em gel de agarose consiste no método mais usado para separar, identificar, analisar, caracterizar e purificar fragmentos de DNA. Uma molécula de DNA, quando exposta a um campo elétrico,

Leia mais

Faculdade de Medicina da Universidade do Porto

Faculdade de Medicina da Universidade do Porto Faculdade de Medicina da Universidade do Porto Instabilidade Genética e Cancerização Prof. José Carlos Machado 5 Março 2007 Hoje vamos falar sobre instabilidade genética e cancerização. Há uma lógica de

Leia mais

Pesquisa. Ações Nacionais de Pesquisa

Pesquisa. Ações Nacionais de Pesquisa Pesquisa O câncer vem apresentando prevalência crescente na população brasileira. Exige, portanto, ações estratégicas no âmbito da atenção oncológica, que envolvem a busca de incentivo à pesquisa nas áreas

Leia mais

Declaração de Conflitos de Interesse

Declaração de Conflitos de Interesse Declaração de Conflitos de Interesse Nada a declarar. Elias Fernando Miziara - DF MR A biologia viral na indução do câncer por HPV Epidemiologia no Brasil Dr. Elias Fernando Miziara Lesâo provocada por

Leia mais

Genômica. O que chamou mais atenção no filme?

Genômica. O que chamou mais atenção no filme? Genômica O que chamou mais atenção no filme? Tempo para sequenciamento do genoma Predição do fenótipo com base no genótipo Como este conhecimento pode ser usado para gerar novas tecnologias? Sequenciamento

Leia mais

DENSIDADE MAMOGRÁFICA E POLIMORFISMOS DO GENE DO RECEPTOR DE ESTROGÊNIO MSPI E DO RECEPTOR DE PROGESTERONA PROGINS NAS ÍNDIAS DO ESTADO DO AMAPÁ

DENSIDADE MAMOGRÁFICA E POLIMORFISMOS DO GENE DO RECEPTOR DE ESTROGÊNIO MSPI E DO RECEPTOR DE PROGESTERONA PROGINS NAS ÍNDIAS DO ESTADO DO AMAPÁ Declaro não haver nenhum conflito de interesse. TEMA LIVRE DENSIDADE MAMOGRÁFICA E POLIMORFISMOS DO GENE DO RECEPTOR DE ESTROGÊNIO MSPI E DO RECEPTOR DE PROGESTERONA PROGINS NAS ÍNDIAS DO ESTADO DO AMAPÁ

Leia mais

Dufloth, RM Página 1 31/3/200928/1/200923/1/2009

Dufloth, RM Página 1 31/3/200928/1/200923/1/2009 Dufloth, RM Página 1 31/3/200928/1/200923/1/2009 RELATÓRIO TÉCNICO-CIENTÍFICO FINAL (Observação: as informações prestadas neste relatório poderão, no todo ou em parte, ser publicadas pela FAPESC.) 1. IDENTIFICAÇÃO

Leia mais

Universidade do Vale do Paraíba Faculdade de Educação e Artes Ciências Biológicas

Universidade do Vale do Paraíba Faculdade de Educação e Artes Ciências Biológicas Universidade do Vale do Paraíba Faculdade de Educação e Artes Ciências Biológicas Aluna: Carolina Genúncio da Cunha Menezes Costa Orientadora: Prof.ª Dr.ª Renata de Azevedo Canevari Co-orientador: Prof.

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

Processo número: 0013603-80.2014 TEMA: IRESSA (GEFITININIBE) NO TRATAMENTO DO CÂNCER DE PULMÃO NÃO PEQUENAS CÉLULAS METASTÁTICO

Processo número: 0013603-80.2014 TEMA: IRESSA (GEFITININIBE) NO TRATAMENTO DO CÂNCER DE PULMÃO NÃO PEQUENAS CÉLULAS METASTÁTICO NOTA TÉCNICA 81/2014 Solicitante Ilma Dra. Marcela Maria Amaral Novais Juíza de Direito Comarca de Caeté Minas Gerais Data: 03/05/2014 Medicamento X Material Procedimento Cobertura Processo número: 0013603-80.2014

Leia mais

Biotecnologia: principais me todos moleculares

Biotecnologia: principais me todos moleculares Biotecnologia: principais me todos moleculares Raphael Bessa Parmigiani, PhD Centro de Oncologia Molecular Instituto Sírio-Libanês de Ensino e Pesquisa Curso de Introdução à Biologia Molecular Goiânia,

Leia mais

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1

Oncologia. Aula 2: Conceitos gerais. Profa. Camila Barbosa de Carvalho 2012/1 Oncologia Aula 2: Conceitos gerais Profa. Camila Barbosa de Carvalho 2012/1 Classificação da Quimioterapia Em relação ao número de medicamentos usados; Em relação ao objetivo; Em relação à via de administração;

Leia mais

TÍTULO: UTILIZAÇÃO DA MAMOGRAFIA PARA O DIAGNÓSTICO DO CÂNCER DE MAMA MASCULINO

TÍTULO: UTILIZAÇÃO DA MAMOGRAFIA PARA O DIAGNÓSTICO DO CÂNCER DE MAMA MASCULINO TÍTULO: UTILIZAÇÃO DA MAMOGRAFIA PARA O DIAGNÓSTICO DO CÂNCER DE MAMA MASCULINO CATEGORIA: CONCLUÍDO ÁREA: CIÊNCIAS BIOLÓGICAS E SAÚDE SUBÁREA: MEDICINA INSTITUIÇÃO: CENTRO UNIVERSITÁRIO ANHANGUERA DE

Leia mais

Alterações citogenéticas na leucemia linfocítica crônica

Alterações citogenéticas na leucemia linfocítica crônica 132_Newslab_Informe Científico Alterações citogenéticas na leucemia linfocítica crônica *Monika Conchon médica onco-hematologista Nos últimos anos, vários marcadores de prognóstico foram identificados

Leia mais

POLIMORFISMOS DOS ÉXONS 4 E 7 DO GENE TP53 EM POPULAÇÕES DA REGIÃO AMAZÔNICA, ESTADO DO PARÁ

POLIMORFISMOS DOS ÉXONS 4 E 7 DO GENE TP53 EM POPULAÇÕES DA REGIÃO AMAZÔNICA, ESTADO DO PARÁ UNIVERSIDADE FEDERAL DO PARÁ INSTITUTO DE CIENCIAS BIOLOGICAS FACULDADE DE BIOMEDICINA IGOR ANDRADE PESSÔA POLIMORFISMOS DOS ÉXONS 4 E 7 DO GENE TP53 EM POPULAÇÕES DA REGIÃO AMAZÔNICA, ESTADO DO PARÁ BELÉM

Leia mais

CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET

CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET CÂNCER : ABORDAGEM AVALIATIVA DE CAUSA E PRENVEÇÃO SOBRE O ÁLCOOL, EXPOSIÇÃO AO SOL E TABAGISMO ENTRE SERVIDORES UEG - UnUCET Rejane de Sousa Ferreira 1, Cristiane Alves da Fonseca 2, Andréia Juliana Leite

Leia mais

Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer

Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer Doe sua Nota Fiscal Paulista para a Pesquisa do Câncer Hospital A.C.Camargo, um dos principais centros de diagnóstico, tratamento, ensino e pesquisa sobre o câncer da América Latina. Pesquisadores que

Leia mais

MUTAÇÃO. O que é mutação? - Alteração no material genético.

MUTAÇÃO. O que é mutação? - Alteração no material genético. Universidade Federal do Piauí Núcleo de Estudos em Genética e Melhoramento (GEM) CNPJ: 12.597.925/0001-40 Rua Dirce de Oliveira,3597- Socopo/Teresina-PI Mutação MARIANE DE MORAES COSTA Teresina, 01 de

Leia mais

CURRICULUM VITAE. Dados Pessoais. Nome Cintia Mendonça de Abreu

CURRICULUM VITAE. Dados Pessoais. Nome Cintia Mendonça de Abreu CURRICULUM VITAE Dados Pessoais Nome Cintia Mendonça de Abreu Formação Universitária Graduação Instituição Faculdade de Medicina - Universidade Federal de Goiás Conclusão 17/11/1995 Pós-Graduação Residência

Leia mais

Genética e Melhoramento de Plantas

Genética e Melhoramento de Plantas Genética e Melhoramento de Plantas Marcadores moleculares e sua utilização no melhoramento Por: Augusto Peixe Introdução ao uso de Marcadores moleculares Definição Marcador molecular é todo e qualquer

Leia mais

Disciplina: Patologia Bucal 5º período CÂNCER ORAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira

Disciplina: Patologia Bucal 5º período CÂNCER ORAL. http://lucinei.wikispaces.com. Prof.Dr. Lucinei Roberto de Oliveira Disciplina: Patologia Bucal 5º período CÂNCER ORAL http://lucinei.wikispaces.com Prof.Dr. Lucinei Roberto de Oliveira 2012 Sigmund Freud ( 1856-1939, 83 anos ) durante 59 anos, mais de 20 charutos/dia

Leia mais

PROTEÍNA P53 E O CÂNCER: CONTROVÉRSIAS E ESPERANÇAS

PROTEÍNA P53 E O CÂNCER: CONTROVÉRSIAS E ESPERANÇAS PROTEÍNA P53 E O CÂNCER: CONTROVÉRSIAS E ESPERANÇAS JALSI TACON ARRUDA, BÁRBARA MARIOTTO BORDIN, LANA CRISTINA BUENO MIRANDA, DÉBORA LEMOS MALDI MAIA, KATIA KARINA VEROLLI DE OLIVEIRA MOURA Resumo: um

Leia mais

Trocando Idéias XVII 29 de agosto de 2012

Trocando Idéias XVII 29 de agosto de 2012 Trocando Idéias XVII 29 de agosto de 2012 Infecção extragenital por HPV Câncer Oral Clique para editar o estilo do subtítulo mestre Flávia de Miranda Corrêa Divisão de Epidemiologia Coordenação Geral de

Leia mais

Pesquisa em Biologia Molecular: Como Fazer?

Pesquisa em Biologia Molecular: Como Fazer? GENÉTICA E BIOLOGIA MOLECULAR Pesquisa em Biologia Molecular: Como Fazer? Molecular Biology Research - How to do it? MAURO DE SOUZA LEITE PINHO - TSBCP PINHO MSL. Rev bras Coloproct, 2006;26(3): 331-336.

Leia mais

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4.

Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. BASES CELULARES DO CANCER. Maysa Paula da Costa 1, 3 ; Cristiane Alves da Fonseca 2,3 ; Andréia Juliana Leite Rodrigues 2,3,4. 1 Graduanda Curso de Ciências Biológicas UEG/UNuCET 2 Pesquisadora Orientadora

Leia mais

Redações vencedoras I Concurso de Redação

Redações vencedoras I Concurso de Redação Redações vencedoras I Concurso de Redação 1 Lugar Aluno: Julia Stefani Moraes Professora: Regina M. Macedo de Melo Castro Informação: A melhor maneira de combater o câncer Penso que falar sobre este assunto

Leia mais

Doenças genéticas da hipertensão:

Doenças genéticas da hipertensão: Dia Mundial da Saúde 2013 sessão Hipertensão Arterial, 11 de Abril Doenças genéticas da hipertensão: o papel dos rins na retenção de sais Peter Jordan Departamento de Genética Humana, Instituto Nacional

Leia mais

Senescência celular: Um mecanismo endógeno antitumoral

Senescência celular: Um mecanismo endógeno antitumoral celular: Um mecanismo endógeno antitumoral José Eduardo Vargas Dep. Biofisica Centro de Biotecnologia UFRGS - 2011 - Viver é envelhecer, nada mais. (Simone de Beauvoir)? Como se define o envelhecimento

Leia mais

O que é o câncer de mama?

O que é o câncer de mama? O que é o câncer de mama? As células do corpo normalmente se dividem de forma controlada. Novas células são formadas para substituir células velhas ou que sofreram danos. No entanto, às vezes, quando células

Leia mais

APESP 246 Caso Botucatu. Dra. Viviane Hellmeister Camolese Martins - R2

APESP 246 Caso Botucatu. Dra. Viviane Hellmeister Camolese Martins - R2 APESP 246 Caso Botucatu Dra. Viviane Hellmeister Camolese Martins - R2 História Clínica LP, 55 anos, homem, branco, pedreiro, hipertenso Massa palpável em flanco E TC = massa de 8 cm no pólo superior renal

Leia mais

Técnicas Moleculares

Técnicas Moleculares Biologia Molecular no Diagnóstico de Infecção :HPV Maria Elizabeth Menezes,MSc;Ph.D e-mail:melmenezes@dnanalise.com.br DNAnálise Laboratório Técnicas Moleculares HIBRIDIZAÇÃO IN SITU SEQÜENCIAMENTO PCR

Leia mais

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO

ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO ESCOLA SECUNDÁRIA DE CASQUILHOS BARREIRO 3º Teste Sumativo DISCIPLINA DE BIOLOGIA 12ºano Turmas A e B TEMA: Regulação e alteração do material genético Versão A 31 de janeiro de 2013 90 minutos Nome: Nº

Leia mais

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA

APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA APRESENTAÇÃO DE PROPOSTA DE CURSO: DNA NA ESCOLA Público alvo: Estudantes de 3º ano do ensino médio Local: Escolas de ensino médio e/ou cursos pré-vestibulares Carga horária: 12 horas Organização: HELIX

Leia mais

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja

O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja O papel das nodulinas na fixação biológica do nitrogênio na cultura de soja SOUZA, R.C. 1 ; SANTOS, M.A. 2 ; HUNGRIA, M. 3 1 Centro Universitário Filadélfia - Unifil, renata@ cnpso.embrapa.br; 2 Escola

Leia mais

Introdução 50.000 novos casos por ano DNA microarray imuno-histoquímica (IHQ) tissue microarray (TMA) técnicas alternativas de construção de TMA

Introdução 50.000 novos casos por ano DNA microarray imuno-histoquímica (IHQ) tissue microarray (TMA) técnicas alternativas de construção de TMA Introdução No Brasil o câncer de mama é a neoplasia maligna mais freqüente, com cerca de 50.000 novos casos por ano. Na última década, avanços na área da patologia molecular permitiram o reconhecimento

Leia mais

HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem

HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem HEPATITE C PCR Qualitativo, Quantitativo e Genotipagem O Vírus da Hepatite C (HCV) é considerado o principal agente etiológico responsável por 90 a 95% dos casos de hepatite pós-transfusional não A e não

Leia mais

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária.

O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Mutação O alelo para a hemoglobina S (cadeia β ) é recessivo. Os indivíduos heterozigóticos (Hb A Hb S ), portadores, são resistentes à malária. Introdução Agentes internos ou externos causam alterações

Leia mais

Lapatinibe para câncer de mama

Lapatinibe para câncer de mama Data: 05/11/2013 NTRR 212/2013 Solicitante: Desembargador Geraldo Augusto de Almeida Mandado de Segurança: nº1.0000.13.083981-4/000 Impetrado: Secretário de Estado da Saúde de Minas Gerais. Medicamento

Leia mais

PERFIL DAS IDOSAS RASTREADAS PARA O CÂNCER DO COLO DO ÚTERO EM CRUZ ALTA, RS

PERFIL DAS IDOSAS RASTREADAS PARA O CÂNCER DO COLO DO ÚTERO EM CRUZ ALTA, RS PERFIL DAS IDOSAS RASTREADAS PARA O CÂNCER DO COLO DO ÚTERO EM CRUZ ALTA, RS CERBARO, Kamila 1 ; GARCES, Solange Beatriz Billig 2 ; HANSEN, Dinara 2 ; ROSA, Carolina Böettge 2 ; BRUNELLI, Ângela Vieira

Leia mais

DETECÇÃO, DIAGNÓSTICO E ESTADIAMENTO DO CÂNCER DE MAMA

DETECÇÃO, DIAGNÓSTICO E ESTADIAMENTO DO CÂNCER DE MAMA RESSONÂNCIA NUCLEAR MAGNÉTICA DAS MAMAS DETECÇÃO, DIAGNÓSTICO E ESTADIAMENTO DO CÂNCER DE MAMA A crescente experiência com a Ressonância Nuclear Magnética (RNM) vem trazendo dúvidas pertinentes quanto

Leia mais

Resposta Imune contra o Câncer

Resposta Imune contra o Câncer Câncer é um termo genérico, que compreende em torno de 200 doenças, cujas células causadoras partilham algumas características em comum: Mutações genéticas; Crescimento descontrolado; Capacidade de migração

Leia mais

Lyria Mori Departamento de Biologia, Instituto de Biociências, Universidade de São Paulo B I O L O G I A M O L E C U L A R

Lyria Mori Departamento de Biologia, Instituto de Biociências, Universidade de São Paulo B I O L O G I A M O L E C U L A R Conhecido há milênios, o câncer termo que abrange muitas doenças cuja característica básica é a proliferação descontrolada de células é hoje um dos principais males que afligem a humanidade. As descobertas

Leia mais

Influência do peso corporal no tratamento adjuvante do câncer de mama

Influência do peso corporal no tratamento adjuvante do câncer de mama Influência do peso corporal no tratamento adjuvante do câncer de mama Declaro não haver conflito de interesse Dra Maria Cecília Monteiro Dela Vega Médica Oncologista Clínica- CEBROM e Hospital Araujo Jorge

Leia mais

Prof a Dr a Camila Souza Lemos IMUNOLOGIA. Prof a. Dr a. Camila Souza Lemos. camila.souzabiomedica@gmail.com AULA 4

Prof a Dr a Camila Souza Lemos IMUNOLOGIA. Prof a. Dr a. Camila Souza Lemos. camila.souzabiomedica@gmail.com AULA 4 IMUNOLOGIA Prof a. Dr a. Camila Souza Lemos camila.souzabiomedica@gmail.com AULA 4 Imunidade contra tumores Linfócitos T-CD8 (azul) atacando uma célula tumoral (amarela) A imunologia tumoral é o estudo

Leia mais