Biologia molecular aplicada ao diagnóstico de vírus

Save this PDF as:

Tamanho: px
Começar a partir da página:

Download "Biologia molecular aplicada ao diagnóstico de vírus"


1 Biologia molecular aplicada ao diagnóstico de vírus Tânia Rosária Pereira Freitas Pesquisadora em Ciências Exatas e da Natureza Virologia Animal - Lanagro/MG

2 Biologia Molecular DNA RNA Proteínas

3 Célula Animal

4 Núcleo Celular: cromossomas

5 Desenovelando o cromossoma

6 Gene

7 DNA Ácido Desoxirribonucléico

8 DNA: estrutura e composição Molécula de DNA: duas cadeias ou fitas de nucleotídeos. Nucleotídeos: açúcar + fosfato + base nitrogenada Disposição: As bases nitrogenadas estão no centro da molécula e os esqueletos açúcar-fosfato estão externos.

9 Nucleotídeos Cada nucleotídeo contém 1 a 3 grupos fosfato (PO4-) ligado ao carbono 5 do açúcar 2 -desoxi D ribose 1 base nitrogenada ligada ao carbono 1 do açúcar

10 Bases Nitrogenadas Purinas Pirimidinas

11 Bases complementares Complementaridade entre as bases: Adenina estabelece duas ligações de hidrogênio com Timina Citosina estabelece três ligações de hidrogênio com Guanina Relação molar A/T = 1,0 e C/G = 1,0

12 Nucleotídeos Direção de crescimento: Ligações fosfodiester entre o grupo fosfato 5 de um nucleotídeo e o grupo hidroxila 3 de outro. Uma das extremidades tem fosfato livre 5 e o nucleotídeo da outra apresenta um hidroxila 3 livre.

13 RNA Ácido ribonucléico

14 RNA: Composição Similar ao DNA: Bases nitrogenadas Base nitrogenada: uracila (substitui a timina) Açúcar: ribose Grupamento fosfato Fita única Altamente reativo

15 Tipos e funções RNA mensageiro ou mrna : carrega a informação (código genético) para síntese protéica (Tradução) RNA transportador, de transferência ou trna: transporta o aminoácido até o maquinaria de tradução. RNA ribossômico ou rrna: compõe a estrutura física do ribossoma, local onde se processará a tradução.

16 Mecanismos Moleculares Replicação do DNA Transcrição Tradução

17 Mecanismos moleculares Replicação do DNA Nova molécula de DNA Transcrição do DNA Produz moléculas de RNA Tradução do RNA Produção de Proteínas

18 Replicação do DNA

19 Replicação do DNA Replicação: Uma molécula de DNA dupla fita (parental) pode se replicar originado duas moléculas de DNA (filhas). Dinâmica: a replicação envolve a ação simultânea e integrada de: Enzimas DNA polimerase, Primases, Helicases, etc Vários fatores protéicos Nucleotídeos e RNA

20 Replicação do DNA

21 Replicação: Semi conservativa

22 Transcrição Síntese de RNA

23 Transcrição do DNA: Síntese de RNA Procariotos RNA polimerase separa os pares de base do DNA, desenrolando o DNA, dando início a síntese de RNA, formando uma bolha de transcrição no DNA. Eucariotos a transcrição envolve 3 classes de RNAs polimerases nos seus núcleos: Polimerase I: sintetiza o precursor de rrna (subunidade maior). Polimerase II: sintetiza precursores dos mrnas. Polimerase III: sintetiza os RNAs pequenos, os trnas e o rrna ribossômico (subunidade menor)

24 Transcrição: Uma cópia do gene (DNA) é transcrita em RNA

25 Transcrição do mrna

26 Processamento do mrna: transcrito primário: splicing hnrna

27 mrna RNAm contém uma seqüência linear de bases que são complementares ao DNA que serviu de molde.

28 Transcrição do trna

29 RNA transportador ou de transferência

30 Transcrição rrna

31 Rna ribossômico ou rrna

32 Ribossomas

33 Código Genético Códons: Trios ou tripletos de bases do ácido nucléico (DNA e RNA). No RNAm os códons podem ser: iniciadores (códon de iniciação), podem especificar um dos 20 diferentes aminoácidos que são encontrados normalmente nas proteínas finalizadores (códon de terminação) O códon é dito degenerado pois mais de um tripleto pode especificar o mesmo aminoácido

34 Código genético: códons

35 Tradução Síntese de proteínas

36 Tradução RNA mensageiro RNA transportador Ribossomas Vários fatores protéicos Enzimas

37 Tradução

38 Transcrição/Tradução

39 Dogma Central

40 Genomas

41 Virologia Molecular Diagnóstico Molecular

42 Vírus Parasitas intracelulares obrigatórios Genoma: DNA ou RNA Simples ou complexos Mecanismos de replicação Utilizam a maquinaria celular Interferem no metabolismo celular

43 Vírus: classificação

44 Vírus RNA

45 Vírus DNA

46 Vírus DNA: Herpes

47 Aplicação de métodos moleculares Custo x Benefício Conhecimento em biologia molecular Equipamentos, insumos biológicos e reagentes Tipo de infecção Aguda ou crônica Tipo de Amostra Corte de tecidos Excreções e secreções Sistemas de Replicação viral Animais Cultivos celulares

48 Virologia Molecular Métodos: Análise genômica Diagnóstico

49 Conhecimentos precursores Eletroforese em gel Gel de Poliacrilamida PAGE Proteínas Gel de Agarose ácidos nucléicos Enzimas de restrição Mapas de restrição Padrão de cortes

50 Eletroforese em gel Técnica de separação de moléculas Migração de partículas em um determinado gel durante a aplicação de uma diferença de potencial. As moléculas são separadas de acordo com o seu tamanho: Poros do gel Menor massa migração mais que as de maior massa.

51 Eletroforese

52 Eletroforese de fragmentos de DNA em gel de agarose

53 Enzimas de Restrição (1953): Bacteriófago fenômeno de restrição/modificação Nucleases bacterianas altamente específicas que clivavam o DNA estranho. Degradação do DNA estranho (restrição). Proteção do próprio DNA pela metilação (modificação).

54 Enzimas de restrição

55 Enzimas de restrição Enzimas e organismos de origem Ava I- Anabaena variabilis: C* C/T C G A/G G Bam HI - Bacillus amyloliquefaciens: G* G A T C C Bgl II- Bacillus globigii: A* G A T C T Eco RI - Escherichia coli RY 13: G* A A T T C Eco RII- Escherichia coli R245: * C C A/T G G Hae III - Haemophilus aegyptius: G G * C C * Local do corte

56 Enzimas de restrição: Clivagens

57 Aplicação Enzimas de restrição Padrões de corte Mapas de restrição Tecnologia do DNA Recombinante Clonagem Vetores Inserção e deleção de genes

58 Mapeamento de restrição

59 Mapa de restrição de Herpesvirus suíno1 (doença de Aujeszky)

60 Mapa de restrição: Plasmídeo

61 DNA recombinante: clonagem

62 Diagnóstico molecular Técnicas de Hibridização de ácidos nucléicos

63 Hibridizações Definição: pareamento dos nucleotídeos em fitas complementares de DNA ou RNA Hibridização in situ Sondas ou Probes Blotting North blotting South blotting

64 Hibridização: conceito

65 Hibridização in situ - ISH Pareamento: DNA-DNA; DNA-RNA; RNA-RNA Detecção de DNA ou mrna: Localizar com precisão um gene específico ou seus transcritos em um tipo de população celular ou áreas. Detectar a presença do DNA ou RNA infecciosos em processos patológicos. Oncogênese

66 Hibridização in situ - ISH Amostras: Fixação - Paraformaldeído estéril 4% Desidratação - Sacarose 30% Polímero inerte (criomolde) e Congelamento e cortes em criostato (-10 m) Sondas: DNA, cdna e crna e oligonucleotídeos Marcação Radioisótopos ( 3 H, 35 S, 135 I, 32 P) Biotina, fosfatase alcalina Fluorescente

67 Hibridização in situ

68 FISH sonda fluorescente

69 Sonda marcada com radioisótopos

70 North blotting e South blotting

71 Northern Blot: RNA Técnica para estudar a expressão gênica Verificar se um determinado gene de um genoma é ou não transcrito em RNA Quantificar esse transcrito Utilizando sonda de DNA Envolve a técnica de eletroforese do ácido nucléico A fixação num suporte sólido

72 Northern Blotting

73 Southern blot: DNA

74 Western Blotting Especificação de uma proteína viral através de anticorpos específicos Bandeamento da proteína pela eletroforese em gel de poliacrilamida - PAGE Transferência para membrana de nitrocelulose Incubação com anticorpos policlonais ou monoclonais conjugados com enzimas (Peroxidase) ou substâncias luminescentes Revelação: Cromógeno (OPD)

75 WB

76 Reação em Cadeia de Polimerase PCR RT/PCR Extração do genoma Purificação Produção de cdna Amplificação Seqüênciamento Análise (edição) Dendogramas Tipos e topotipos virais

77 PCR: Polymerase Chain Reaction Definições: PCR: amplificação de uma seqüência ou fragmento da molécula de DNA. O fragmento a ser amplificado é delimitado por seqüências iniciadoras (primers) RT-PCR: Vírus com genoma RNA é necessário produzir o DNA complementar cdna

78 PCR: dinâmica

79 Produto do PCR

80 Vírus da Febre Aftosa VP1

81 Ciclo viral

82 Vírus da Febre Aftosa: Foot-and-mouth disease virus (FMDV) Serotype: Foot-and-mouth disease virus O (FMDV-O) 5' UTR L VP4 VP2 VP3 VP1 2A 2B 2C 3A 3B 1 3B 2 3B 3 3C 3D 3' UTR Serotype: Foot-and-mouth disease virus A (FMDV-A) 5' UTR L VP4 VP2 VP3 VP1 2A 2B 2C 3A 3B 1 3B 2 3B 3 3C 3D 3' UTR Serotype: Foot-and-mouth disease virus C (FMDV-C) 5' UTR L VP4 VP2 VP3 VP1 2A 2B 2C 3A 3B 1 3B 2 3B 3 3C 3D 3' UTR

83 Metodologia Amostras com vírus inativado (tecido, raspado esofágico faríngeo, cultivo celular, etc.) Extração do RNA Viral (Chomczynski & Sacchi, 1987) Método homogeneização da amostra em tiocianato de guanidina + ß-mercaptoetanol (100mM), fenol, precipitação em álcool. RNA em Trizol (fenol + tiocinato de guanidina)

84 Extração do RNA

85 Transcrição do RNA viral - RT RNA viral 5 AAAA 3 Enzima: Transcriptase reversa cdna

86 Amplificação do cdna obtido pela Reação da Cadeia de Polimerase IIII cdna IIII Taq DNA Polimerase Iniciadores da seqüência 1D (VP1) N= No.2 n

87 Iniciadores aplicados na PCR Primer Seqüência Tamanho Local. O dir ACCAACCTCCTTGATGTGGCT A dir TACCAAATTACACACACGGAA C dir TACAGGGATGGGTATGTGTGTACC Iniciador Reverso (para os três sorotipos) LMR GACATGTCCTCCTGCATCTG

88 Produtos do PCR PM CN PM 1301 pb 863 pb 813 pb 1:C 3 Rezende/Bra/55 2: A 24 Cruzeiro/Bra/55 3: O 1 Campos/Bra/58

89 Purificação dos produtos da PCR Kit Comercial (Concert Rapid Gel Extraction System, GIBCO-BRL) Pureza e Rendimento Purificação dos fragmentos de DNA por afinidade Eletroforese ( Peso e massa) Eluição do produto amplificado

90 Quantificação dos produtos purificados 2000pb = 200ng 1200pb = 120ng 800pb = 80ng 860 pb 80ng 400pb= 40ng 200pb= 20ng 100pb=10ng

91 Seqüênciamento Cíclico Preparar amostras para o seqüênciamento automático Similar ao PCR: Polimerizar o produto do PCR com nucleotídeos fluorescentes Kit Comercial (ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kit, Applied Biosystems) Pelo menos 60ng/amostra Designação Seqüência (5-3 ) Localização Iniciador Universal: (sentido reverso) GAAGGGCCCAGGGTTGGACTC

92 Seqüênciamento de nucleotídeos: eletroforese capilar e cromatogramas

93 Dendogramas e Topotipos

94 Muito Obrigada!

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia

Genética Molecular. Fundamentos Aplicações científicas Biotecnologia Genética Molecular Fundamentos Aplicações científicas Biotecnologia Genética Molecular DNA RNA Proteínas Universo Celular Ciclo celular Ciclo Celular: Mitose Célula animal Núcleo Celular: Cromossomas Cromossoma:

Leia mais

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe!

Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Aula: 2 Temática: Ácidos Nucléicos Hoje estudaremos a bioquímica dos ácidos nucléicos. Acompanhe! Introdução: Os ácidos nucléicos são as moléculas com a função de armazenamento e expressão da informação

Leia mais

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause

Núcleo Celular. Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Biomedicina primeiro semestre de 2012 Profa. Luciana Fontanari Krause Núcleo Celular Eucarioto: núcleo delimitado por membrana nuclear (carioteca) Portador dos fatores hereditários e controlador

Leia mais


ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLEÍCOS RIBOSSOMO E SÍNTESE PROTEÍCA ÁCIDOS NUCLÉICOS: Moléculas orgânicas complexas, formadas polimerização de nucleotídeos (DNA e RNA) pela Contêm a informação que determina a seqüência de aminoácidos

Leia mais

Princípios moleculares dos processos fisiológicos

Princípios moleculares dos processos fisiológicos 2012-04-30 UNIVERSIDADE AGOSTINHO NETO FACULDADE DE CIÊNCIAS DEI-BIOLOGIA ---------------------------------------------- Aula 5: Princípios moleculares dos processos fisiológicos (Fisiologia Vegetal, Ano

Leia mais

Estrutura e Função de Ácidos Nucléicos

Estrutura e Função de Ácidos Nucléicos UNIVERSIDADE DE SÃO PAULO INSTITUTO DE QUÍMICA DEPARTAMENTO DE BIOQUÍMICA QBQ0313 Estrutura e Função de Ácidos Nucléicos Flavia Carla Meotti Os Ácidos Nucléicos Função: armazenamento e transmissão da informação

Leia mais


DNA E SÍNTESE PROTEICA Genética Animal DNA e síntese proteica 1 DNA E SÍNTESE PROTEICA Estrutura do DNA: -Molécula polimérica, cujos monômeros denominam-se nucleotídeos. -Constituição dos nucleotídeos: açúcar pentose (5 -desoxirribose)

Leia mais

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015.

Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. Criado e Desenvolvido por: RONNIELLE CABRAL ROLIM Todos os direitos são reservados 2015. ÁCIDOS NUCLEICOS ÁCIDOS NUCLÉICOS: são substâncias formadoras de genes, constituídas por um grande

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: D rd. Mariana de F. Gardingo Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: D rd. Mariana de F. Gardingo Diniz TRANSCRIÇÃO DNA A transcrição é o processo de formação de uma molécula de RNA a partir de uma molécula molde

Leia mais

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ==============================================================================================

BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== PROFESSOR: Leonardo Mariscal BANCO DE QUESTÕES - BIOLOGIA - 1ª SÉRIE - ENSINO MÉDIO ============================================================================================== Ácidos Nucleicos 01- Os

Leia mais

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala

Técnicas de biologia molecular. da análise de genes e produtos gênicos únicos a abordagens em larga escala Técnicas de biologia molecular da análise de genes e produtos gênicos únicos a abordagens em larga escala os mesmos genes, qual a diferença? Dogma central Localizando alvos Técnicas iniciais para evidenciar

Leia mais

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas

BIOLOGIA MOLECULAR. Ácidos Nucléicos e Síntese de Proteínas BIOLOGIA MOLECULAR Ácidos Nucléicos e Síntese de Proteínas Nucleotídeos São moléculas formadas pela união de um açúcar ou pentose, uma base nitrogenada e um grupo fosfato. Os Ácidos Nucléicos (DNA e RNA)

Leia mais

Dra. Kátia R. P. de Araújo Sgrillo.

Dra. Kátia R. P. de Araújo Sgrillo. Dra. Kátia R. P. de Araújo Sgrillo São macromoléculas gigantescas, com massa molecular maior que 100 milhões. Os ácidos nucléicos foram isolados pela primeira vez a partir do núcleo

Leia mais


REAÇÃO EM CADEIA DA POLIMERASE (PCR) Área de Ciências da Saúde Curso de Medicina Módulo: Saúde do Adulto e Idoso II GENÉTICA HUMANA Professora: Dra. Juliana Schmidt REAÇÃO EM CADEIA DA POLIMERASE (PCR) A molécula de DNA é um longo polímero

Leia mais

Bases Moleculares da Hereditariedade


Leia mais

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva

Estrutura e função dos ácidos nucléicos. Profa. Melissa de Freitas Cordeiro-Silva Estrutura e função dos ácidos nucléicos Profa. Melissa de Freitas Cordeiro-Silva > Polímeros de nucleotídeos Funções: DNA (ácido desoxirribonucléico) : > Armazenar as informações necessárias para a construção

Leia mais

O fluxo da informação é unidirecional

O fluxo da informação é unidirecional Curso - Psicologia Disciplina: Genética Humana e Evolução Resumo Aula 3- Transcrição e Tradução Dogma central TRANSCRIÇÃO DO DNA O fluxo da informação é unidirecional Processo pelo qual uma molécula de

Leia mais


ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE ISOLAMENTO E MANIPULAÇÃO DE UM GENE Importância da Engenharia Genética Diversidade biológica X Diversidade gênica Etapas básicas da Clonagem Escolha e amplificação do

Leia mais

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas.

- Ácido ribonucléico (ARN ou RNA): participa do processo de síntese de proteínas. 1- TIPOS DE ÁCIDO NUCLÉICO: DNA E RNA Existem dois tipos de ácidos nucléicos: - Ácido desoxirribonucléico (ADN ou DNA): é o principal constituinte dos cromossomos, estrutura na qual encontramos os genes,

Leia mais

Criado e Desenvolvido por: Todos os direitos são reservados 2015.

Criado e Desenvolvido por: Todos os direitos são reservados 2015. Criado e Desenvolvido por: Todos os direitos são reservados 2015. O NÚCLEO E A SÍNTESE PROTEÍCA O núcleo celular, descoberto em 1833 pelo pesquisador escocês Robert Brown, é uma estrutura

Leia mais

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas

Os primeiros indícios de que o DNA era o material hereditário surgiram de experiências realizadas com bactérias, sendo estas indicações estendidas GENERALIDADES Todo ser vivo consiste de células, nas quais está situado o material hereditário. O número de células de um organismo pode variar de uma a muitos milhões. Estas células podem apresentar-se

Leia mais

BIOTECNOLOGIA. 2. Conceito de clonagem molecular

BIOTECNOLOGIA. 2. Conceito de clonagem molecular BIOTECNOLOGIA 1. Introdução Até a década de 70, o DNA era o componente celular mais difícil de ser analisado. Sua seqüência de nucleotídeos de enorme tamanho e monotonia química era geralmente analisada

Leia mais


CONTROLE DO METABOLISMO GENES CONTROLE DO METABOLISMO GENES 10/06/15 1º ANO - BIOLOGIA 1 ESTRUTURA DO GENE Segmentos (pedaços) da molécula de DNA, o constituinte dos nossos cromossomos, onde estão inscritas receitas (códigos genéticos)

Leia mais

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva

BIOLOGIA MOLECULAR. Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR Prof. Dr. José Luis da C. Silva BIOLOGIA MOLECULAR A Biologia Molecular é o estudo da Biologia em nível molecular, com especial foco no estudo da estrutura e função do material genético

Leia mais

DNA A molécula da vida. Prof. Biel Série: 9º ano

DNA A molécula da vida. Prof. Biel Série: 9º ano DNA A molécula da vida Prof. Biel Série: 9º ano DNA FINGER-PRINTING A expressão DNA "Finger-Print" (ou Impressões Genéticas) designa uma técnica de separação de segmentos de DNA que permite a identificação

Leia mais

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes.

> ESTUDO DO RNA. (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. Biologia > Citologia > Sintese Protéica > Alunos Prof. Zell (biologia) (C) O ácido nucléico I é DNA e o II, RNA. (D) O ácido nucléico I é RNA e o II, DNA. (E) I é exclusivo dos seres procariontes. > ESTUDO

Leia mais

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA".

1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou impressão digital de DNA. Ácidos Nuclêicos 1. (Unesp) A ilustração apresenta o resultado de um teste de paternidade obtido pelo método do DNA-Fingerprint, ou "impressão digital de DNA". a) Segundo o resultado acima, qual dos homens,

Leia mais


TRANSCRIÇÃO DO DNA: Tipos de RNA TRANSCRIÇÃO DO DNA: Síntese do mrna Gene (Unidades transcricionais) Tipos de RNA Tipos de RNA polimerase Tipos de RNA polimerase DNA dependente Transcrição em Procariotos Transcrição em Eucariotos Mecanismos

Leia mais


16/04/2015 ÁCIDOS NUCLEICOS DNA E RNA DNA E RNA DNA E RNA BREVE HISTÓRICO DA DESCOBERTA DO DNA BREVE HISTÓRICO DA DESCOBERTA DO DNA ÁCIDOS NUCLEICOS E RNA E RNA Plano de Aula -Componentes básicos de e RNA -Características estruturais e funcionais -Tipos de RNA Profª Dra. Juliana Schmidt Medicina 2014 E RNA BREVE HISTÓRICO DA DESCOBERTA

Leia mais

Equipe de Biologia. Biologia

Equipe de Biologia. Biologia Aluno (a): Série: 3ª Turma: TUTORIAL 5B Ensino Médio Equipe de Biologia Data: Biologia Ácidos nucléicos Os ácidos nucléicos são moléculas gigantes (macromoléculas), formadas por unidades monoméricas menores

Leia mais

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação

SÍNTESES NUCLEARES. O DNA éo suporte da informação genética. Parte 1 Replicação SÍNTESES NUCLEARES O DNA éo suporte da informação genética Parte 1 Replicação Estrutura do DNA Replicação do DNA Nucleótidos A informação genética das células é armazenada sob a forma de 2 moléculas similares:

Leia mais

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz

MEDICINA VETERINÁRIA. Disciplina: Genética Animal. Prof a.: Drd. Mariana de F. G. Diniz MEDICINA VETERINÁRIA Disciplina: Genética Animal Prof a.: Drd. Mariana de F. G. Diniz Gene, é a unidade fundamental da hereditariedade. Cada gene é formado por uma sequência específica de ácidos nucléicos

Leia mais


TRANSCRICAO E PROCESSAMENTO DE RNA TRANSCRICAO E PROCESSAMENTO DE RNA Número de genes para RNA RNA ribossômico - rrna Os rrnas correspondem a 85 % do RNA total da célula, e são encontrados nos ribossomos (local onde ocorre a síntese proteíca).

Leia mais

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada

Ácidos nucléicos. São polímeros compostos por nucleotídeos. Açúcar - pentose. Grupo fosfato. Nucleotídeo. Base nitrogenada ÁCIDOS NUCLÉICOS Ácidos nucléicos São polímeros compostos por nucleotídeos Açúcar - pentose Nucleotídeo Grupo fosfato Base nitrogenada Composição dos Ácidos nucléicos pentoses: numeração da pentose: pentose

Leia mais

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO.

Transcrição e Tradução. Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Transcrição e Tradução Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Biologia, enfermagem, nutrição e TO. Tópicos abordados na aula Dogma Central da Biologia Molecular;

Leia mais

Replicação Quais as funções do DNA?

Replicação Quais as funções do DNA? Replicação Quais as funções do DNA? Aula nº 4 22/Set/08 Prof. Ana Reis Replicação O DNA é a molécula que contém a informação para todas as actividades da célula. Uma vez que as células se dividem, é necessário

Leia mais


COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA COMUNICAÇÃO DA INFORMAÇÃO NAS MOLÉCULAS DE DNA E RNA Andréia Cristina Hypólito José 11075810 Fernando Caldas Oliveira 11085410 Giovana Zaninelli 11017210 Renato Fernandes Sartori 11061110 Rodrigo de Mello

Leia mais

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA.

Genes. Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Genes Menor porção do DNA capaz de produzir um efeito que pode ser detectado no organismo. Região do DNA que pode ser transcrita em moléculas de RNA. Ácidos nucleicos Os ácidos nucléicos são macromoléculas

Leia mais

Rachel Siqueira de Queiroz Simões, Ph.D

Rachel Siqueira de Queiroz Simões, Ph.D Pontifícia Universidade Católica do Rio de Janeiro Centro de Ciências Biológicas e da Saúde Casa da Medicina Unidade Gávea Coordenação Central de Extensão EPIDEMIOLOGIA MOLECULAR Rachel Siqueira de Queiroz

Leia mais

Extração de DNA e Amplificação por PCR

Extração de DNA e Amplificação por PCR Universidade Federal de São Carlos Departamento de Genética e Evolução Disciplina Práticas de Genética Extração de DNA e Amplificação por PCR Érique de Castro 405523, Victor Martyn 405612, Wilson Lau Júnior

Leia mais


GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO GABARITO BIOLOGIA REVISÃO 01 3 ANO A/B ENSINO MÉDIO Resolução: 01. B 02. E 03. No alantóide da ave há uma rede de capilares sangüíneos onde ocorre a respiração. O principal excreta nitrogenado da ave é

Leia mais

Bioinformática Aula 01

Bioinformática Aula 01 Bioinformática Aula 01 Prof. Ricardo Martins Ramos * * Doutorando em Genética e Toxicologia Aplicada CEFET-PI/ULBRA-RS Linha de Pesquisa Bioinformática Estrutural E-mail: Visão Holística

Leia mais

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular?

8/18/2015. IFSC Campus Lages. Biologia Molecular. Prof. Silmar Primieri. O que é Biologia Molecular? IFSC Campus Lages Biologia Molecular Prof. Silmar Primieri O que é Biologia Molecular? 1 Aplicabilidades da Biologia Molecular Genética do Câncer Doenças com herança complexa Preservação de espécies ameaçadas

Leia mais

Reação em Cadeia Da Polimerase

Reação em Cadeia Da Polimerase Reação em Cadeia Da Polimerase X Jornada Farmacêutica IV Amostra 2010 Sueli Massumi Nakatani LACEN-PR Um Pouco de História... Um Pouco de História... 1983 Kary Mullis for his invention of the polymerase

Leia mais

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular

PROGRAMA TEÓRICO. 2. O Dogma Central da Biologia Molecular PROGRAMA TEÓRICO 1. As moléculas da Biologia Molecular: DNA, RNA e proteínas Aspectos particulares da composição e estrutura do DNA, RNA e proteínas. EG- Características bioquímicas dos ácidos nucleicos,

Leia mais

Tecnologia do DNA recombinante

Tecnologia do DNA recombinante Tecnologia do DNA recombinante Tecnologia do DNA Recombinante déc. 70 conhecimento de mecanismos biomoleculares enzimas biológicas cortar DNA ligar DNA replicar DNA transcrever reversamente o RNA complementaridade

Leia mais


ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO ÁCIDOS NUCLEICOS DNA - ÁCIDO DESOXIRRIBONUCLEICO RNA - ÁCIDO RIBONUCLEICO 1 Funções dos ácidos nucleicos Armazenar e expressar a informação genética Replicação Cópia da mensagem contida no DNA, que será

Leia mais

As bactérias operárias

As bactérias operárias A U A UL LA As bactérias operárias Na Aula 47 você viu a importância da insulina no nosso corpo e, na Aula 48, aprendeu como as células de nosso organismo produzem insulina e outras proteínas. As pessoas

Leia mais


DO GENE À PROTEÍNA ALGUNS CONCEITOS BASICOS COMO SE ORGANIZAM OS NUCLEÓTIDOS PARA FORMAR O DNA? DO GENE À PROTEÍNA O processo de formação das proteínas no ser humano pode ser difícil de compreender e inclui palavras e conceitos que possivelmente nos são desconhecidos. Assim, vamos tentar explicar

Leia mais

Aula 4 Estrutura do RNA

Aula 4 Estrutura do RNA Biologia Molecular Básica Módulo I Básico Aula 4 Estrutura do RNA O RNA é uma molécula intermediária na síntese de proteínas. Ela faz a intermediação entre o DNA e as proteínas. As principais diferenças

Leia mais

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B.

Do Corpo Humano ao DNA. Noções de Biologia Molecular. Nucleotídeos - DNA RNA. Dogma central. Prof a. Dr a. Mônica B. Do Corpo Humano ao DNA Noções de Biologia Molecular Prof a. Dr a. Mônica B. Melo FCM - SCSP - Estrutura dos ácidos nucléicos (DNA, RNA) - Replicação - Transcrição - Processamento - Tradução -Mutações -

Leia mais

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética

UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética UNIVERSIDADE ESTADUAL DE MARINGÁ Departamento de Biologia Celular e Genética Biologia Molecular Tópicos de estudo Prof a Dr a Maria Aparecida Fernandez 2003 1 Unidade I Estrutura dos Ácidos Nucléicos Estrutura

Leia mais

Curso: Integração Metabólica

Curso: Integração Metabólica Curso: Integração Metabólica Aula 2: Breve revisão estrutura do DNA Prof. Carlos Castilho de Barros Prof. Augusto Schneider Quando se estuda metabolismo você certamente vai se deparar com termos de genéyca!

Leia mais

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes

Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Antes da descoberta dos sirnas oligonucleotídeos antisenso (ASO) eram usados para silenciar genes Zamecnik PC and Stephenson ML, 1978: oligonucleotídeos como agentes antisenso para inibir replicação viral.

Leia mais

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são

O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são Atividade extra Fascículo 2 Biologia Unidade 4 Questão 1 O DNA é formado por pedaços capazes de serem convertidos em algumas características. Esses pedaços são chamados de genes. Assinale abaixo quais

Leia mais

Problemas de Engenharia Genética

Problemas de Engenharia Genética Engenharia Genética Secção de Genética e Dinâmica de Populações Departamento de Biologia Vegetal Faculdade de Ciências da Universidade de Lisboa Problemas de Engenharia Genética 2. Técnicas de análise

Leia mais


CÓDIGO GENÉTICO E SÍNTESE PROTEICA CÓDIGO GENÉTICO E SÍNTESE PROTEICA Juliana Mara Stormovski de Andrade As proteínas são as moléculas mais abundantes e funcionalmente diversas nos sistema biológicos. Praticamente todos os processos vitais

Leia mais


GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO GENÉTICA VII APLICAÇÕES DO CONHECIMENTO GENÉTICO Prof. Jose Amaral/2012/2013 Metabolismo de controle O metabolismo é controlado pelos ácidos nucléicos, compostos que coordenam uma série de reações em que

Leia mais



Leia mais


BASES NITROGENADAS DO RNA BIO 1E aula 01 01.01. A determinação de como deve ser uma proteína é dada pelos genes contidos no DNA. Cada gene é formado por uma sequência de códons, que são sequências de três bases nitrogenadas que

Leia mais

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética.

Ácidos Nucleicos 22/12/2011. Funções do Material Genético. informação genética. Ácidos Nucleicos Profa. Dra. Juliana Garcia de Oliveira Disciplina: Biologia Celular e Molecular Turmas: Ciências Biológicas, enfermagem, nutrição e TO. Funções do Material Genético Mendel, 1865: genes

Leia mais

DNA polimerases dependentes de "template"

DNA polimerases dependentes de template DNA polimerases dependentes de "template" - Adicionam deoxiribonucleótidos à extremidade 3' de cadeias duplas de DNA com um local de "priming" - A síntese ocorre exclusivamente na direcção 5'-3' da nova

Leia mais

Química do material genético

Química do material genético 1 O NÚCLEO No núcleo estão os cromossomos, onde estão "armazenadas" as informações genéticas de cada espécie. Os seguintes componentes constituem o núcleo celular: Membrana Nuclear: também chamada de carioteca

Leia mais

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos

VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos VI Congresso Brasileiro de Biossegurança Simpósio Latino-Americano de Produtos Biotecnológicos Rio de Janeiro, 21-25 setembro de 2009 Universidade do Estado do Rio de Janeiro - UERJ Construções Mais Comuns

Leia mais

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu

PCR tempo real. PCR quantitativo. 52º Congresso Nacional de Genética Foz do Iguaçu PCR tempo real PCR quantitativo 52º Congresso Nacional de Genética Foz do Iguaçu Aspectos Básicos um dos métodos atuais de aferir o nível de expressão de genes mas não é o único: Northern blotting (quantificação

Leia mais

Genética e Evolução: Profa. Gilcele

Genética e Evolução: Profa. Gilcele Genética e Evolução: Profa. Gilcele Genética É o estudo dos genes e de sua transmissão para as gerações futuras. É o estudo da hereditariedade, a transmissão de traços de genitores para filhos. É dividida

Leia mais

Como o DNA nuclear comanda todo o funcionamento da célula????

Como o DNA nuclear comanda todo o funcionamento da célula???? início Moléculas de RNA Como o DNA nuclear comanda todo o funcionamento da célula???? gene DNA espaçador fim Profa Estela Rossetto início O que faz o DNA? http://rizomas. net/ensino-debiologia/recur sospedagogicos/2

Leia mais

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel

Bioinformática. Conceitos Fundamentais de Biologia Molecular. Paulo Henrique Ribeiro Gabriel Bioinformática Conceitos Fundamentais de Biologia Molecular Paulo Henrique Ribeiro Gabriel Faculdade de Computação Universidade Federal de Uberlândia 24 de agosto de 2015 Paulo H. R. Gabriel

Leia mais

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas

Southern blotting análise de DNA. Northern blotting análise de RNA. Western blotting análise de proteínas Southern blotting análise de DNA Northern blotting análise de RNA Western blotting análise de proteínas Southern blotting Hibridação DNA-DNA em membrana Southern blot Digestão enzimática Eletroforese em

Leia mais


Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) 1 Universidade Federal Fluminense Instituto Biomédico Departamento de Microbiologia e Parasitologia Disciplina: Virologia Apostila de aula prática REAÇÃO EM CADEIA PELA POLIMERASE (PCR) A técnica de reação

Leia mais


BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA BIOLOGIA - 1 o ANO MÓDULO 08 RIBOSSOMOS E SÍNTESE PROTEICA Fixação 1) (UNICAMP) Considere um fragmento de DNA com a seguinte sequência de bases: GTA GCC TAG E responda: a) Qual será a sequência

Leia mais

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho

Genética Bacteriana. Prof (a) Dra. Luciana Debortoli de Carvalho Universidade Federal de Juiz de Fora Departamento de Microbiologia, Parasitologia e Imunologia Genética Bacteriana Prof (a) Dra. Luciana Debortoli de Carvalho Introdução O DNA existe como uma hélice de

Leia mais

V e t e r i n a r i a n D o c s Genética

V e t e r i n a r i a n D o c s Genética V e t e r i n a r i a n D o c s Genética Introdução Conceitos Gene: segmento de DNA que é expresso para produzir um produto funcional, o que pode ser RNA ou polipeptídeo. 3 partes: seqüência reguladora,

Leia mais

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi

Como a vida funciona? O processo de Transcrição. Prof. Dr. Francisco Prosdocimi Como a vida funciona? O processo de Transcrição Prof. Dr. Francisco Prosdocimi Dogma central O fluxo da informação é unidirecional Refutação definitiva da herança dos caracteres adquiridos Transcrição

Leia mais



Leia mais

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges

Fundamentos de GENÉTICA BACTERIANA. Profa Francis Moreira Borges Fundamentos de GENÉTICA BACTERIANA Profa Francis Moreira Borges As bactérias possuem material genético, o qual é transmitido aos descendentes no momento da divisão celular. Este material genético não está

Leia mais

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto

Genética Humana. Prof. João Ronaldo Tavares de Vasconcellos Neto Genética Humana Prof. João Ronaldo Tavares de Vasconcellos Neto JAN/2012 Princípios Básicos As proteínas são vinculo entre genótipo e fenótipo; A expressão gênica é o processo pelo qual o DNA coordena

Leia mais

Mitocôndrias e Cloroplastos

Mitocôndrias e Cloroplastos Universidade Federal de Sergipe Centro de Ciências Biológicas e da Saúde Departamento de Morfologia Biologia Celular Mitocôndrias e Cloroplastos Características gerais de mitocôndrias e cloroplastos Mitocôndrias

Leia mais


NÚCLEO e DIVISÃO CELULAR NÚCLEO e DIVISÃO CELULAR CÉLULA EUCARIONTE Cláudia Minazaki NÚCLEO Único; Normalmente: central Formato: acompanha a forma da célula Tamanho: varia com o funcionamento da célula Ciclo de vida da célula

Leia mais

Análise de expressão gênica

Análise de expressão gênica Universidade Federal do Espírito Santo Laboratório de Biotecnologia Aplicado ao Agronegócio Análise de expressão gênica Fernanda Bravim EXPRESSÃO GÊNICA Processo pelo qual a informação contida em um gene

Leia mais

RNA: transcrição e processamento

RNA: transcrição e processamento Universidade Federal do Piauí Centro de Ciências Agrárias Programa de Pós-graduação em Genética e Melhoramento Núcleo de Estudos em Genética e Melhoramento Bases Moleculares da Hereditariedade RNA: transcrição

Leia mais

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota

Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Matéria: Biologia Assunto: Moléculas, células e tecidos - Código genético Prof. Enrico Blota Biologia Moléculas, células e tecidos - Código Genético O núcleo é de fundamental importância para grande parte

Leia mais


BIOTECNOLOGIA E ENGENHARIA GENÉTICA. Profa. Maria Paula BIOTECNOLOGIA E ENGENHARIA GENÉTICA Profa. Maria Paula FERRAMENTAS Enzimas: de restrição, DNA-ligase, DNA-polimerase, transcriptase Vetores: plasmídeos, vírus 1) PGH O número de genes é muito menor do

Leia mais

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty

A natureza química do material genético Miescher nucleínas. ácidos nucleicos. ácido desoxirribonucleico ácido ribonucleico Avery MacLeod McCarty UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL COLÉGIO DE APLICAÇÃO Departamento de Ciências Exatas e da Natureza Disciplina: Biologia Professora: Lauren Valentim A natureza química do material genético A natureza

Leia mais

PCR in situ PCR Hotstart

PCR in situ PCR Hotstart Bruno Matos e Júlia Cougo PCR in situ PCR Hotstart Disciplina de Biologia Molecular Profª. Fabiana Seixas Graduação em Biotecnologia - UFPel PCR in situ - É a técnica de PCR usada diretamente numa lâmina

Leia mais

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc.

Replicação do DNA. geradas cópias c. idênticas. das moléculas de DNA presentes lula-mãe, a seguir herdadas pelas duas célulasc. Replicação de DNA DNA Dupla-hélice composta de nucleotídeos ligados entre si e cujas bases nitrogenadas de uma hélice fazem pontes de hidrogênio com bases nitrogenadas de outra hélice, numa direção anti-paralela

Leia mais

Sequenciamento de DNA

Sequenciamento de DNA Sequenciamento de DNA Figure 8-50a Molecular Biology of the Cell ( Garland Science 2008) Método de Sanger Reação de síntese de DNA por uma DNA polimerase A incorporação de um dideoxinucleotídeo interrompe

Leia mais

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o

A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o 1 A partícula viral infectante, chamada vírion, consiste de um ácido nucléico e de uma capa protéica externa (capsídeo). O conjunto do genoma mais o capsídeo de um vírion é denominado de nucleocapsídeo.

Leia mais

A Molécula da Vida. Estrutura

A Molécula da Vida. Estrutura A Molécula da Vida Os cromossomos de células eucarióticas são formado por DNA associado a moléculas de histona, que são proteínas básicas. É na molécula de DNA que estão contidos os genes, responsáveis

Leia mais

Aula 7 Ácidos nucléicos

Aula 7 Ácidos nucléicos Aula 7 Ácidos nucléicos Os ácidos nucléicos DNA (ácido desoxirribonucléico) e o RNA (ácido ribonucléico) são substâncias essenciais para os seres vivos, pois mantêm a informação genética que controla a

Leia mais

Aula 2 Unidades fundamentais dos ácidos nucléicos

Aula 2 Unidades fundamentais dos ácidos nucléicos Biologia Molecular Básica Módulo I Básico Aula 2 Unidades fundamentais dos ácidos nucléicos Prezado professor, nesta aula você vai estudar os nucleotídeos que formam os blocos constituintes dos ácidos

Leia mais

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa

MOLECULAR. Daniel Macedo de Melo Jorge. Acontecimentos na genética e genômica. e genômica. Escala Comparativa SUMÁRIO ENÉI MOLEULR Daniel Macedo de Melo Jorge História da enética Molecular; Organização e estrutura dos genomas; DN e RN Dogma entral Replicação ranscrição radução enes

Leia mais

Construção de Bibliotecas de cdna

Construção de Bibliotecas de cdna Construção de Bibliotecas de cdna Claudia Teixeira Guimarães Antônio A.C. Purcino Eliane A. Gomes Jurandir V. Magalhães Newton P. Carneiro Elto E.G. Gama Robert E. Schaffert Sidney N. Parentoni Vera M.C.

Leia mais

Biologia Professor Vianna 1ª série / 1º trimestre

Biologia Professor Vianna 1ª série / 1º trimestre Biologia Professor Vianna 1ª série / 1º trimestre Módulo 3 ÁCIDOS NUCLEICOS E CITOLOGIA 1 Os itens abaixo referem-se à estrutura, composição e função dos ácidos nucleicos. Estrutura: I) Dupla hélice; II)

Leia mais


Ácidos Nucléicos OS ÁCIDOS NUCLÉICOS Ácidos Nucléicos DNA e RNA Profª Ana Luisa Miranda Vilela OS ÁCIDOS NUCLÉICOS Constituintes: Nucleotídeos formados por três diferentes tipos de moléculas: um açúcar (pentose) desoxirribose no DNA e ribose

Leia mais

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome

Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 Avaliação Curso de Formação Pós-Graduada da Biologia Molecular à Biologia Sintética 15 de Julho de 2011 Nome 1 - As enzimas de restrição ou endonucleases recebem uma designação que provem (1 valor) a)

Leia mais

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito

objetivo RNA aspectos funcionais e estruturais AULA Pré-requisito RNA aspectos funcionais e estruturais 5 objetivo Ao final desta aula, você terá a oportunidade de: Descrever os aspectos funcionais e estruturais do RNA. Pré-requisito Para acompanhar mais facilmente esta

Leia mais

Replicação do DNA a Nível Molecular

Replicação do DNA a Nível Molecular Replicação do DNA a Nível Molecular Função do DNA Transferência de informação Copiada em DNA (Replicação) Traduzida em proteína Modelo de replicação do DNA proposto por Watson e Crick Replicação ou Duplicação?

Leia mais

Painéis Do Organismo ao Genoma

Painéis Do Organismo ao Genoma Painéis Do Organismo ao Genoma A série de 5 painéis do organismo ao genoma tem por objetivo mostrar que os organismos vivos são formados por células que funcionam de acordo com instruções contidas no DNA,

Leia mais

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869

Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 Biologia Molecular de Corinebactérias Produtoras de Aminoácidos: Análise do Genoma de Brevibacterium lactofermentum ATCC 13869 António Carlos Matias Correia Dissertação apresentada à Universidade de Aveiro

Leia mais